T.C.
GIDA, TARIM VE HAYVANCILIK BAKANLIĞI
HAYVANCILIK VE SU ÜRÜNLERİ ARAŞTIRMALARI DAİRE
BAŞKANLIĞI
PROGRAM DEĞERLENDİRME ÖZET KİTAPÇIĞI
2014
1
BÜYÜKBAŞ, KÜÇÜKBAŞ ve HAYVAN GENETİK KAYNAKLARI ARAŞTIRMALARI PROGRAM
DEĞERLENDİRME TOPLANTISI GÜNDEMİ
03 MART 2014 PAZARTESİ
09.30-12.30
AÇILIŞ PROGRAMI
12:30-14:00
YEMEK ARASI
I. OTURUM BİLGİLENDİRME SUNUMU VE YENİ TEKLİF PROJELER
14:00 – 15:30
Proje Lideri /
Sunan
Dr. Bekir
ANKARALI
Engin ÜNAY
Zeliha
SAVRUNLU
Şükrü DOĞAN
Oturum Başkanı: Prof. Dr. Ali AKMAZ
(Katip Üyeler: Hayvancılık Merkez Araştırma Enstitüsü Müdürlüğü)
Projenin
Proje / Sunum Adı
Kurum
Durumu
TAGEM Büyükbaş, Küçükbaş ve Genetik Kaynakları
TAGEM
Sunu
Araştırmaları
Rasyona İlave Edilen Linoleik Asidin Koyunlarda Döl
Yeni
HMAEM
Verimine Etkisi
Teklif
Şanlıurfa İklim Koşullarında Şarole Irkı Koyunların
Yeni
Entansif Yetiştiricilikte Verim Performansı ve GAPTAEM
Teklif
Adaptasyon Kabiliyeti
Akkaraman ve Orta Anadolu Merinosu Kuzularında
Sütten Kesim Dönemindeki Bazı Vücut Ölçülerinin
Yeni
BUTAEM
Erken Seleksiyon Kriteri Olarak Kullanılma İmkanının
Teklif
Araştırılması
15:30-16:00
Ara
16:00-17:30
II. OTURUM YENİ TEKLİF PROJELER
Gülşen Yıldırım
ŞENYER
Tülay CANATAN
Hakan
ERDURAN
Sığla Yağının Biyo Element, Ham Besin Madde
İçeriklerinin Tespiti İle Koyunlarda Bazı Biyokimyasal
Kan Parametreleri Ve Antioksidan Kapasite Üzerine
Etkisi
Yapay Merada Otlatma ile Yapay Meraya ilaveten
Konsantre Yem Verilmesinin Dağlıç ve Akkaraman Irkı
Erkek Kuzuların Besi Performansı, Karkas ve Et
Kalitesi Özellikleri Üzerine Etkisi
Konya Bölgesinde Yarı-Entansif Koşullarda Kıl,
Saanen x Kıl ve Alpin x Kıl Melezi Keçilerinin (F1, G1
ve F1 x G1) Bazı Verim Özellikleri
HMAEM
Yeni
Teklif
BUTAEM
Yeni
Teklif
BUTAEM
Yeni
Teklif
04 MART 2014 SALI
I. OTURUM YENİ TEKLİF PROJELER
09:00-10:30
Fatma AKTAŞ
Oturum Başkanı: Prof. Dr. Mustafa SAATÇİ
(Katip Üyeler: Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
Müdürlüğü)
Üre Muamelesi Ve Fungal İnokulasyon Yoluyla
Buğday
Samanının
Lignoselülozik
İçeriğinin
Yeni
DATAEM
Parçalanması Ve In Sıtu Naylon Torba Tekniği
Teklif
Kullanarak Yem Ve Enerji Değerinin Belirlenmesi
2
(Doktora Tezi)
Donor Beslemede Korunmuş Metionin Kullanılmasının
Embrıyo Kalıtesi Üzerine Etkisinin Araştırılması
(Doktora Tezi)
Donör İnek Rasyonlarına Doymamış Yağ Asiti
İlavesinin Süperovülasyon Performansı ve Embriyo
Kalitesi Üzerine Etkileri (Doktora Tezi)
DOATAEM
Yeni
Teklif
DOATAEM
Yeni
Teklif
Anadolu Mandasının Islahı
BKAİM
Sonuç
Anadolu Mandasının Islahı
BKAİM
Yeni
Teklif
Vildan Ö. KUZ
Ulusal Evcil Hayvan Genetik Kaynakları Bilgi
Sisteminin Hazırlanması ve Yönetimi Projesi
TBMAEM
Mustafa YAŞLI
Yerli Sığır Genetik Kaynağının Korunması Projesi
KKTC-HDM
12:30-14:00
Yemek Arası
Kurtuluş GÖK
Serdal ÇOBAN
10:30-11:00
Ara
11:00-12:30
II. OTURUM YENİ TEKLİF PROJELER
Dr. Mustafa
KÜÇÜKKEBAPÇI
Mehmet Akif
YÜKSEL
Yeni
Teklif
Yeni
Teklif
III. OTURUM YENİ TEKLİF VE SONUÇLANAN PROJELER
14:00-15:30
Oturum Başkanı: Prof. Dr. İhsan SOYSAL
(Katip Üyeler: Koyunculuk Araştırma İstasyonu Müdürlüğü)
Hüseyin Erdem
ERTEN
Karakoyunların Moleküler Filogenetik Analizi
Tamer
SEZENLER
Diyarbakır ve Yöresinde Yetiştirilen Güvercinlerin
Morfolojik Özeliklerinin Saptanması
Marmara Bölgesi Şartlarına Uygun Bandırma Koyun
Tipi Geliştirme Çalışmaları
15:30-16:00
Ara
16:00-17:30
IV. OTURUM SONUÇLANAN PROJELER
Bekir GÖK
Kıl Keçisi Ve Honamlı Tipi Kıl Keçisi Oğlaklarının Besi
Performansı, Kesim Ve Karkas Özellikleri
Bırusk KESKİN
Murat ÜNAL
Tülay CANATAN
Saanen, Kıl Keçisi Ve Melezlerinin Bazı Kıl
Özelliklerinin Belirlenmesi
Yetiştirici Şartlarında Suni Mera Ve Entansif Beslenen
Kuzuların Besi Ve Karkas Özelliklerinin
Karşılaştırılması
DATEM
GAPUTAEM
BKAİM
BUTAEM
Yeni
Teklif
Yeni
Teklif
Sonuç
Sonuç
HMAEM
Sonuç
BDUTAE
Sonuç
05 MART 2014 ÇARŞAMBA
I. OTURUM SONUÇLANAN PROJELER
09:00-10:30
Oturum Başkanı: Prof. Dr. Orhan KARACA
(Katip Üyeler: Doğu Akdeniz Tarımsal Araştırma Enstitüsü Müdürlüğü)
3
Dr. Mesut
YILDIRIR
Mehmet Emin
VURAL
Kurtuluş GÖK
Karacabey Merinoslarında Laktasyon Dönemi Besleme
Koşulları ile Flushing Etkinliği Arasındaki İlişkiler
Güney Karaman ve Karacadağ Zom Koyunlarının
Filogenetik Yapılarının Moleküler Tekniklerle
Belirlenmesi
Prostaglandinlerle Östrus Senkronizasyonu Yapılmış
Siklusları Düzensiz, Embriyo Transferi
Uygulamalarından Gebe Kalmayan Düvelerde βKaroten, Cu +B12 Vitamini ve Se+e Vitaminin
Reprodüktif Performans Üzerine Etkisi
10:30-11:00
Ara
11:00-12:30
II. OTURUM SONUÇLANAN PROJELER
Alper BİLGE
Damızlık Koyun Keçi Islah Bilgi Sistemi Yazılım
Sunumu
Dr. Ahmet Hamdi
AKTAŞ
Ex-situ ve In-situ olarak Yetiştirilen Kıvırcık Koyun
Irkının Morfolojik ve Gelişme Özelliklerinin İki
Farklı Yöntemle Karşılaştırılması
Kıl Keçisi ve Honamlı Tipi Kıl Keçisi Oğlaklarında
Büyüme Performansı, Kesim ve Karkas Özellikleri
12:30-14:00
Yemek Arası
Tamer
SEZENLER
TAGEM
Sonuç
GAPUTAEM
Sonuç
DOATAEM
Sonuç
BİLTAY
TEKNOLOJİ
Bilgi
BKAİM
Sonuç
BUTAEM
Devam
Eden
III. OTURUM DEVAM EDEN PROJELER
14:00-15:30
Tülay CANATAN
Necdet İlker İÇİL
N. Kürşat
AKBULUT
Tamer
SEZENLER
Tamer
SEZENLER
Tamer
SEZENLER
Dr. Yalçın
YAMAN
Halil EROL
Oturum Başkanı: Dr. Şükrü DURSUN
(Katip Üyeler: Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
Müdürlüğü)
Bazı Koyun Irklarında Çiftleşme, Doğum, Ana ve Kuzu
Devam
BUTAEM
Davranışlarının Belirlenmesi
Eden
Metabolik Profil Testinin Koyunculuk İşletmelerinde
Devam
HMAEM
Uygulanabilirliğinin Araştırılması (Doktora Tezi)
Eden
Koyunlarda Östrus Siklusunda Ve Gebeliğin Erken
Devam
Döneminde
Uterustan
Elde
Edilen
Ultrason BUTAEM
Eden
Görüntülerinin İşlenmesi
Bandırma Koyununda Üreme, Büyüme ve Karkas
Devam
BKAİM
Özelliklerinin Islahı ve Tip Sabitleştirme
Eden
Kıvırcık ve Karacabey Merinosu Koyun Irklarında Kur
Devam
ve Aşım Davranışlarının Elde Sıfat Yöntemiyle BKAİM
Eden
Belirlenmesi
Devam
Ülkesel Merinos Geliştirme Projesi
BKAİM
Eden
Bandırma
Koyunculuk
Araştırma
İstasyonu
Bünyesinde
Yetiştirilen
Damızlık
Koçların
Devam
BKAİM
Spermatolojik Özelliklerinin ve Dondurulabilirliğinin
Eden
Belirlenmesi
Erkek ve Kastre Ankara Keçisi Oğlaklarında Farklı
Devam
Kesim Ağırlıklarında Besi Performansı, Kesim, Karkas HMAEM
Eden
ve Bazı Et Kalite Özellikleri (Tez projesi)
15:30-16:00
Ara
16:00-17:30
IV. OTURUM DEVAM EDEN PROJELER
4
Şaban IŞIK
Erdoğan SEZGİN
Hakan ERDURAN
Dr. Şükrü
DURSUN
İrfan GÜNGÖR
Dr. Hülya
HANOĞLU
İlke ÜNLÜSOY
Farklı Koyun Irk Ve Genotiplerinin Sütten Kesilmiş
Kuzularının
Yapay
Meradaki
Büyüme
Performanslarının Belirlenmesi
Halk Elinde Yetiştirilen Hemşin ve Morkaraman
Koyunlarının Yapağı Özelliklerinin ve Lanolin
Miktarının Belirlenmesi
Farklı Şartlarda Yarı-Entansif Koşullarda Yetiştirilen Kıl
Keçisi
Melezlerin
Verim
Performanslarının
Karşılaştırılması
Kangal Tipi Akkaraman Koyunların Süt Verimi Ve
Meme Özelliklerinin Belirlenmesi
İvesi Koyunlarının Seleksiyona Dayalı Olarak Süt
Verimlerinin Artırılması
Süt Karma Yemlerinde In Vivo ve In Vitro Olarak
Saptanan
Enerji
ve
Protein
Değerlerinin
Karşılaştırılması
Bazı Yerli Koyun Irklarında İnhibin βB Geninin Yavru
Verimine Etkisi
BUTAEM
Devam
Eden
DATAEM
Devam
Eden
BUTAEM
Devam
Eden
BUTAEM
GAPTAEM
Devam
Eden
Devam
Eden
BKAİM
Devam
Eden
HMAEM
Devam
Eden
06 MART 2014 PERŞEMBE
I.OTURUM DEVAM EDEN PROJELER
09:00-10:30
Oturum Başkanı: Dr. Sadrettin YÜKSEL
(Katip Üyeler: : Doğu Anadolu Tarımsal Araştırma Enstitüsü Müdürlüğü
İbrahim
HALICI
Ali ATİK
Uğur
DEMİRCİ
Pınar
ÖZDEMİR
Dr. Bekir
ANKARALI
Prof. Dr. M.
İhsan
SOYSAL
Dr. Hatice
HIZLI
Süt Emme Dönemindeki Akkaraman Kuzularının Süzek
Yemleme (Creep Feeding) Sistemi ile Büyütülmesi
Bazı Yerli Koyun Irklarımızın Yapağı Verim Özelliklerinin
Belirlenmesi ve Lanolin Miktarlarının Araştırılması
Süzek Yemleme Sistemi İle Meraya Ek Olarak Baklagil
Yem Bitkileri Veya Kesif Yem İle Beslemenin Kuzuların
Büyüme Performansına Ve Meraya Olan Etkisi
Koyunlarda Zeytin Yaprağı Ekstraktının İn Vitro Ve İn
Vivo Besin Madde Sindirilebilirliği İle Rumen
Fermentasyonu, Bazı Kan Parametreleri Ve Antioksidan
Kapasite Üzerine Etkisi
BUTAEM
Devam
Eden
Devam
Eden
BUTAEM
Devam
Eden
HMAEM
Devam
Eden
Halk Elinde Küçükbaş Hayvan Islahı Projesi
TAGEM
Devam
Eden
Halk Elinde Anadolu Mandasının Islahı Projesi
TAGEM
Devam
Eden
Anadolu Alacası Geliştirme Projesi
DOATAEM
Devam
Eden
DOATAEM
Devam
Eden
GAPUTAEM
Devam
Eden
10:30-11:00
Ara
11:00-12:30
II. OTURUM DEVAM EDEN PROJELER
Zeynel
GÖÇMEZ
Sığırlarda
Dondurulmuş
Embriyolardan
Embriyo
Transferi İle Gebelik Elde Edilmesi
Diyarbakır İli Halk Elinde Yetiştirilen Anadolu
Mandalarında Verim ve Malakların Büyüme Özellikleri,
β-lactoglobulin, k-casein ve Prolaktin Genleri ile Süt ve
Bileşenleri Arasındaki İlişkinin Araştırılması
Yavuz HAN
BUTAEM
5
Dr. Yalçın
YAMAN
Anadolu Mandasi, Murrah Ve Bunlarin Melezlerinde
Prnp In/Del Polimorfizmizminin Belirlenmesi
BKAİM
Devam
Eden
Engin ÜNAY
Süt Sığırlarında Besin Madde Tüketimi Ve Bazı
Metabolizma Değerleri İle Döl Verimi İlişkilerinin
Saptanması
HMAEM
Devam
Eden
Vedat
KARAKAŞ
Süt ve Üreme ile İlişkilendirilmiş Bazı SNP’lerin İki Farklı
Sığır Irkı İçin Değerlendirilmesi
HMAEM
Devam
Eden
HMAEM
Devam
Eden
HMAEM
Devam
Eden
Vedat
Karakaş
Muharrem
SATILMIŞ
12:30-14:00
Sığırlarda Görülen Bazı Kalıtsal Bozuklukların
Tespitinde Multipleks PCR Optimizasyon İmkanlarının
Araştırılması
In Vitro Embriyo Kültür Ortamina Ve Sperma
Sulandiricilarina
Ilave
Edilen
Eritropoietinin
Spermatolojik Parametreler, Oksidatif Stres Ve Embriyo
Gelişimi Üzerine Etkisi
Yemek Arası
III. OTURUM DEVAM EDEN PROJELER VE BİLGİLENDİRME SUNUMU
14:00-15:30
Oturum Başkanı: Prof. Dr. Gürsel DELLAL
(Katip Üyeler: Doğu Akdeniz Tarımsal Araştırma Enstitüsü Müdürlüğü)
Dr. Sema
YAMAN
Kanola Küspesi Ve Çözeltili Kuru Damıtılmış Mısırın
(Ddgs) İn Situ Ve İn Vitro Rumen Protein
Parçalanabilirlikleri Arasındaki İlişkiler
HMAEM
Devam
Eden
Dr. Sema
YAMAN
Çam Kabuğu Ve Yucca Schidigera Ekstraktının İn Vitro
Besin Maddeleri Sindirilebilirliği İle Rumen Uçucu Yağ
Asitleri, Süt Verimi, Biyolojik Kan Parametreleri Ve
Antioksidan Kapasite Üzerine Etkisi
HMAEM
Devam
Eden
Arzu EROL
TUNÇ
Soya Küspesi ve Ekstrude Soyanın İn Situ ve İn Vitro
Rumen Protein Parçalanabilirlikleri Arasındaki İlişkiler
HMAEM
Devam
Eden
Salih
ABBASOĞLU
Kuzey Kıbrıs Türk Cumhuriyeti’nde Küçükbaş Hayvan
Sürülerinde (Damascus) Verim Özelliklerinin Araştırılması
KKTC/TB
Bilgi
Dr. Hülya
HANOĞLU
Marmara Bölgesinde Organik Sığır Yetiştiriciliğinin
Geliştirilmesi / Organik Sistemde Üretilen Boz Irk
Sığırların Karkas ve Et Kalitesi Özellikleri
BKAİM
Bilgi
M. Akif
YÜKSEL
Anadolu Mandası Ex situ in vivo Koruma
BKAİM
Devam
Eden
Panel Tartışma: Türkiye’de Et Üretimi Sorunları ve Çözüm Önerileri
Oturum Başkanı: Dr. İrfan DAŞKIRAN
Katılımcılar: Prof. Dr. Zafer ULUTAŞ, Prof. Dr. İbrahim TAPKI, Prof. Dr. Alper ÖNENÇ, Prof. Dr. Türker
SAVAŞ, Dr. Sadrettin YÜKSEL
15:30-16:00
Ara
16:00-18:00
IV. OTURUM DEVAM EDEN PROJELER
6
M. Akif
YÜKSEL
Anadolu Mandası In situ Koruma
BKAİM
Devam
Eden
Dr. Mustafa
KÜÇÜKKEBA
PÇI
Marmara Hayvancılık Araştırma Enstitüsündeki Bozırk
Sığırlarda Reprodüktif Parametrelerin Belirlenmesi ve
Değerlendirilmesi
BKAİM
Devam
Eden
Vedat
KARAKAŞ
Zülal T.
YILDIRIR
Zülal T.
YILDIRIR
Zeynel
GÖÇMEZ
Zeynel
GÖÇMEZ
Zeynel
GÖÇMEZ
Dr. Sadrettin
YÜKSEL
Dr. Sadrettin
YÜKSEL
Muharrem
SATILMIŞ
Dr. Sadrettin
YÜKSEL
Halk Elinde Korunan Yerli Kara Sığırlarda Biyoçeşitlilik
Analizi
HMAEM
Yerli Kara Sığırı Ex situ in vivo Koruma
HMAEM
Yerli Kara Sığırı In situ Koruma
HMAEM
Güney Anadolu Kırmızısı (Kilis) Sığırı Ex situ in vivo
Koruma
DATAEM
Güney Anadolu Kırmızısı (Kilis) Sığırı In situ Koruma
DATAEM
Yerli Güney Sarısı Sığırı In situ Koruma
DATAEM
Doğu Anadolu Kırmızısı Sığırı Ex situ in vivo Koruma
DATAEM
Doğu Anadolu Kırmızısı Sığırı In situ Koruma
DATAEM
Doğu Anadolu Kırmızısı ineklerde epidural yolla yapılan
süperovulasyon etkinliğinin araştırılması
HMAEM
Zavot Sığırı In situ Koruma
DATAEM
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
07 MART 2014 CUMA
I.OTURUM DEVAM EDEN PROJELER
09:00-10:30
Dr. Deniz
SOYSAL
Dr. Deniz
SOYSAL
Vedat KARAKAŞ
Necdet Akay
N.Kürşat
AKBULUT
Tülay CANATAN
Emre ALARSLAN
Emre ALARSLAN
Orhan KARADAĞ
10:30-11:00
Oturum Başkanı: Oya AKIN
(Katip Üyeler: GAP Uluslararası Tarımsal Araştırma ve Eğitim Merkezi
Müdürlüğü)
Devam
Boz Irk Sığırı Ex situ in vivo Koruma
BKAİM
Eden
Devam
Boz Irk Sığırı In situ Koruma
BKAİM
Eden
Koyun Koruma Sürülerinin Yönetiminde Genetik ve
Devam
İstatistiksel Yaklaşımlardan Yararlanma: Bir Model
HMAEM
Eden
Çalışma
Devam
Güney Karaman Koyunu Ex situ in vivo Koruma
BUTAEM
Eden
Devam
Dağlıç Koyunu In situ Koruma
BUTAEM
Eden
Evcil Hayvan Genetik Kaynaklarının Korunması
Kapsamında Afyonkarahisar ve Konya’da bulunan
Devam
BUTAEM
Dağlıç Koyunlarının Bazı Morfolojik ve Fizyolojik Irk
Eden
Özelliklerinin Tanımlanması
Devam
Gökçeada Koyunu Ex situ in vivo Koruma
BKAİM
Eden
Devam
Gökçeada Koyunu In situ Koruma
BKAİM
Eden
Devam
Sakız Koyunu Ex situ in vivo Koruma
BKAİM
Eden
Ara
7
11:00-12:30
Dr. Mesut
YILDIRIR
Dr. Yalçın
YAMAN
II. OTURUM DEVAM EDEN PROJELER
Sakız Koyunu In situ Koruma
TAGEM
Çine Çaparı Koyunu In situ Koruma
BKAİM
Halil EROL
Karagül Koyunu In situ Koruma
HMAEM
A.Taner ÖNALDI
Karakaçan Koyunu In situ Koruma
BKAİM
Kıvırcık Koyunu Ex situ in vivo Koruma
BKAİM
Kıvırcık Koyunu In situ Koruma
BKAİM
Burcuhan BALTA
Hemşin Koyunu In situ Koruma
DATAEM
Erdoğan SEZGİN
Kaçkar Keçisi In situ Koruma
DATAEM
Tamer
SEZENLER
Tamer
SEZENLER
Erdoğan SEZGİN
12:30-14:00
Abaza Keçisi In situ Koruma
DATAEM
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Yemek Arası
III. OTURUM DEVAM EDEN PROJELER
14:00-15:30
Oturum Başkanı: Muharrem SATILMIŞ
(Katip Üyeler: Hayvancılık Merkez Araştırma Enstitüsü Müdürlüğü)
Erdoğan SEZGİN
Gürcü Keçisi In situ Koruma
DATAEM
Zeynel GÖÇMEZ
Kilis Keçisi In situ Koruma
DATAEM
Zeynel GÖÇMEZ
Halep Keçisi In situ Koruma
DATAEM
Orhan KARADAĞ
Honamlı Keçisinin Kimi Morfolojik ve Genetik
Karakteristikleri Aracılığıyla Tanımlanması Üzerine Bir
Araştırma
BKAİM
Bekir GÖK
Honamlı Keçisi In situ Koruma
BUTAEM
Halil EROL
Ankara Keçisi Ex situ in vivo ve In situ Koruma
HMAEM
Tiftik (Renkli Ankara) Keçisi In situ Koruma
GAPUTAEM
Denizli ve Gerze Tavuk Irkları Ex situ in vivo ve In situ
Koruma
HMAEM
Kafkas Arısı Ex situ in vivo Koruma
KAÜEGMM
Muhsin KARA
Kafkas Arısı In situ Koruma
DATEM
Sadettin IŞIK
İpekböceği Hatları Ex situ in vivo Koruma
Bursa il
GTHM
15:30-16:00
16:00-18:00
Ara
IV. OTURUM DİLEK VE TEMENNİLER - KAPANIŞ
Mehmet Emin
VURAL
Dr. Neval
ÖZDOĞAN
M. Coşkun
SAVAŞCI
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
8
BÜYÜKBAŞ HAYVANCILIK ARAŞTIRMALARI
YENİ TEKLİF PROJELER
PROJE ÖZETLERİ
Proje No
Proje Başlığı:
ÜRE MUAMELESİ ve FUNGAL
İNOKULASYON YOLUYLA BUĞDAY
SAMANININ LİGNOSELÜLOZİK İÇERİĞİNİN
PARÇALANMASI ve IN SITU NAYLON
TORBA TEKNİĞİ KULLANARAK YEM ve
ENERJİ DEĞERİNİN BELİRLENMESİ
Projeyi Yürüten Kuruluş:
Doğu Anadolu Tarımsal Araştırma Enstitüsü
Müdürlüğü
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
TAGEM
Fatma AKTAŞ
Prof. Dr. Mevlüt KARAOĞLU
Prof Dr. Ömer Faruk ALGUR
Dr. Abdulkadir ÖZLÜTÜRK
Vet. Hek. Özmen BİBEROĞLU
01/01/2015 - 01/01/2017
103.800,00
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
PROJE ÖZETİ
Bölgemizde önemli bir potansiyele sahip olan buğday samanı hayvan beslemede, düşük yem
değerine rağmen vazgeçilmez bir yem maddesi olarak kullanılmaya devam edilmektedir.
Ancak tahıl samanı yapısal özelliğinden dolayı besin değeri ve besleme kalitesi bakımından
tüketildiğine oranla iyi bir noktada değildir. Sahip olduğu selüloz ve lignin miktarı ve
bunların kimyasal yapısından dolayı sindirilebilirliği düşüktür. Son yıllarda bu amaca yönelik
yapılan bazı çalışmalarda kimyasal maddelerle (üre, NH3, NaOH vb) muamele etmek
suretiyle samanın besin değerini ve dolayısıyla yem olma özelliğini artırma yoluna gidilmiştir.
Ancak gelinen noktanın biyolojik yöntemlerle daha ileri götürülmesi önemli bir gereklilik
olarak görülmektedir. Bu maksatla ülkemizde değişik kaynaklarda verilen önemli düzeydeki
kaba yem açığını kapatmaya yönelik olarak buğday samanının bazı funguslarla
(Phanerochaete chrysosporium ve Pleurotus eryngii) inoküle edilerek yem değerinin
arttırılması amaçlanmıştır. Aynı zamanda azot kaynağı olarak üre kullanılan saman örnekleri
funguslarla muamele edilecektir.
Araştırmada 18 aylık 4 baş Siyah Alaca erkek hayvana kanül açılarak hayvan materyali olarak
kullanılacaktır. İnokule edilmiş buğday samanları 4, 8, 16, 24, 36, 72 ve 96 saat inkübasyon
sürelerine tabi tutulacaktır. Daha sonra kontrol ve muamele gruplarında;ham protein, ham kül,
kuru madde, ADF, NDF, ADL analizleri yapılarak, parçalanabilirlik ve yem değerleri
belirlenecektir.
9
Yemlerin enerji değerlerinin tespitinde ise; 48 saatteki kuru madde parçalanabilirliğinden
yararlanılarak, “Rowett Araştırma Enstitüsü” nde geliştirilmiş olan regresyon eşitliğinden
metabolik enerji değeri hesaplanacaktır.
ME, MJ7kg KM= 2.27563+ 0.1073xKMP
KMP: Kuru madde parçalanabilirliği, % (48.saat)
MJ: Mega joule
Proje No
Proje Başlığı:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
DONOR BESLEMEDE KORUNMUŞ
METİONİN KULLANILMASININ
EMBRIYO KALITESİ ÜZERİNE
ETKİSİNİN ARAŞTIRILMASI
(DOKTORA)
DOĞU AKDENİZ TARIMSAL
ARAŞTIRMA ENSTİTÜSÜ MÜDÜRLÜĞÜ
TAGEM
Kurtuluş GÖK
Prof. Dr. Berrin KOCAOĞLU GÜÇLÜ
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
01/01/2015 - 01/01/2016
20.000,00
Projeyi Yürüten Kuruluş:
PROJE ÖZETİ
Proje Özeti: Proje özetinde kısaca projenin amacı, materyali ve metodu, nerede
yürütüleceği, nasıl analiz edileceği kısaca ne gibi çıktıları olabileceği belirtilmelidir.
Aşağıda belirtilen kısımlar projenin dayanağını oluşturduğu literatür bildirişlerinde
verilmelidir.
Son yılarda, dünyada ve ülkemizde süt ineği işletmelerinde yaşanan en önemli
problemlerden biride üreme performansında yaşanan hızlı düşüştür. Her yıl üreme güçlüğü,
meme hastalıkları, yaşlılık ve ölüm gibi nedenlerle sürüden ayıklanmak zorunda olan
ineklerin yerini yeni düveler almaktadır. Özellikle son 20 yıllık süreçte ineklerde genetik
ilerleme ve süt verimindeki artışa rağmen döl veriminde yaşanan kayıplar, sektörde konu ile
ilgili yeni çözüm önerileri ve araştırmaların sayısını artırmıştır. Üreme performansını
iyileştirmeye yönelik son yapılan araştırmalar döl verimi-beslenme arasındaki ilişkiyi işaret
etmektedir. Çünkü beslemede yapılan yanlışlıkların yanında eksik ya da fazlalıklar ineklerin
üreme fonksiyonları üzerinde olumsuz etki yapmaktadır.
Öte yandan kıymetli
damızlıklardan daha fazla yavru elde edebilmek, eldeki sürünün ıslahında ve safkan
damızlıklara dönüştürülmesinde yararlanmak, hayvan ıslahı çalışmalarına hız kazandırmak,
embriyoların transferi ile doğrudan damızlık olarak kullanılabilecek yavru elde edebilmek
için süperovulasyon ve embriyo transfer uygulamaları birlikte yapılmaktadır. Bu işlemlerin
maliyetinin yüksek olması nedeniyle sürekli yeni yöntemler denenmekte veya var olan
teknikler geliştirilmeye çalışılmaktadır. Bu yöntemlerden birisi de MOET (Çoklu
10
yumurtlatma ve embriyo transferi) tekniğidir. MOET’te başarılı olabilmek için
süperovulasyon uygulanan ve donör hayvan olarak da adlandırılan genetik kapasitesi yüksek
hayvanların bakım ve beslenmelerinin optimum olması gerekmektedir. Ancak donör
ineklerden elde edilecek embriyo sayısı ve kalitesinin artırılmasında makro ve mikro besin
madde miktarlarının belirlenmesi veya etkinliklerinin saptanması yönünde özel bir
çalışmaya rastlanmamıştır.
Genetik kapasitesi yüksek hayvanların (donör) yemle alınan protein ve nitrojen
tabiatında olmayan protein (NPN) kaynakları rumende farklı hız ve düzeyde amonyak’a
kadar parçalanır. Bunlardan bir kısmı mikrobiyel proteine dönüşürken bir kısmı da amonyak
biçiminde rumenden emilir. Bu nedenle kaliteli protein kaynaklarının rumende hızla
yıkılmasını önlemek ve yem proteinlerinden daha fazla yararlanmak için rumende yıkım
hızını düşürücü yönde muamele yöntemleri geliştirilmiştir. Kaliteli protein kaynaklarının
muamelesiz olarak rumenden geçmesi ve kullanılmasında yem proteinin rumende
mikrobiyel proteinlere dönüşümleri sırasında %55’lere varan kayıplar oluşabilmektedir.
Ruminant hayvanlar yaşama payı protein ihtiyacını yalnız mikrobiyal proteinden
karşılamalarına rağmen süt verimi yüksek ve gelişmekte olan ruminant hayvanlar
mikrobiyal proteinin yanında bypass proteine ihtiyaç duyarlar. Rasyondaki değerli
proteinlerin rumende mikroorganizmalar tarafından aşırı bir şekilde parçalanması idrarda üre
atılımı şeklinde kayıplara neden olmaktadır. Rasyondaki kaliteli proteinlerin korunmasının
temel sebeplerinden birisi bu kayıpları azaltmak ve rumende aşırı amonyak oluşumunu
önlemektir.
Yüksek süt verimli sığırlarda protein ve enerji ihtiyacının ruminal sentezle
karşılanamadığı metionin, lisin ve valin gibi aminoasitlerin süt üretiminde sınırlandırıcı rol
oynadığı görüldüğünden yüksek süt verimi için proteinlerin bir bölümünün ruminal
parçalanmadan kaçırılarak ya da korunarak (by-pass) protein olarak barğırsaklara
geçirilmesi büyük önem taşır. Korunmuş protein, yemdeki proteinin rumende
parçalanmayan kısmıdır. Sığırlarda protein gereksinimi by-pas protein ve mikrobiyal protein
olmak üzere iki yolla karşılanır. Rumenden bağırsaklara geçen proteinler sindirilirler ve
yüksek süt verimli hayvanların yüksek değerli protein ihtiyaçları karşılanmış olur. Burada
dikkat edilmesi gerekli durum ise parçalanabilen ve parçalanmayan (korunmuş) protein
arasındaki oran ihtiyacı karşılayacak şekilde ayarlanmalıdır. Bu nedenle yüsek süt verimli
ineklerde rasyon proteinlerinin bir bölümü rumende by-pass protein içerikleri fazla olan
balık unu, et unu, tüy unu ve kan unu gibi hayvansal kökenli yemler ile soya fasulyesi ve
mısır glüteni gibi bitkisel kaynaklardan karşılanmalıdır. Korunmuş (by-pass)proteinlerin
ince bağırsaklardan emilimi de önemlidir. Rasyonda by-pass özelliği yüksek proteinin fazla
olması mikroorganizmaların azot bakımından yetersiz beslenmelerine yol açar. Bu durumda
bağırsaklarda toplam protein miktarının azalması dolayısıyla süt veriminin düşmesi söz
konusudur.
Metionin protein sentezinde ön madde olarak yer alan bir kükürtlü aminoasittir.
Ayrıca birçok biyokimyasal reaksiyona katılarak protein yapısındaki çeşitli ara ürünlerin
üretilmesinde rol alır. Organizmada özellikle hepatotoksik maddelerin uzaklaştırılmasında
antioksidan aktiviteye sahiptir. Metionin içerdiği kükürt aracılığı ile ve şelat yapabilme
11
kapasitesi ile serbest radikallerin karaciğerden uzaklaştırılmasını sağlayarak karaciğerin
korunmasını sağlamaktadır. Ayrıca süt ineklerinde süt proteini düzeyini artırdığı, sütteki üre
nitrojeni seviyesini ise düşürdüğü, üreme performansının iyileştiği, ovarian aktivitesini ve
foliküler dinamiğini iyileştirdiği bildirilmektedir. Fakat donör ineklerin beslenmesinde
metioninin veya korunmuş metioninin etkisi irdelenmemiştir.
Bu çalışmanın amacı korunmuş metioninin donörlerde süperovulasyon protokolü ile
elde edilen embriyoların kaliteleri üzerine etkilerini belirlemektir. Araştırma, Doğu Akdeniz
Tarımsal Araştırma Enstitüsü Müdürlüğüne ait Hacıali işletmesinde bulunan Büyükbaş
Hayvancılık Ünitesinde Anadolu Alacası Geliştirme Projesi kapsamında kurulan Süt
Sığırcılığı Tesislerinde yürütülecektir.
Son yıllarda MOET gibi modern ıslah tekniklerinin uygulanmasına bağlı olarak
donör hayvanların beslenme düzeylerinin dikkate alınması önemle vurgulanmakta; ancak bu
konuda son derece sınırlı bilgiler bulunmaktadır.
Anahtar Kelimeler: Donör besleme, embriyo kalitesi, metionin
12
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
DONÖR İNEK RASYONLARINA
DOYMAMIŞ YAĞ ASİTİ İLAVESİNİN
SÜPEROVÜLASYON PERFORMANSI VE
EMBRİYO KALİTESİ ÜZERİNE ETKİLERİ
(DOKTORA)
DOĞU AKDENİZ TARIMSAL
ARAŞTIRMA ENSTİTÜSÜ MÜDÜRLÜĞÜ
TAGEM
Serdal ÇOBAN
Prof. Dr. Zeynep ERDOĞAN
Kurtuluş GÖK
Erkan SAY
Doç. Dr. Yaşar ERGÜN
(Projede Doğum ve Jinekoloji Uzmanı olarak
Danışman)
Dr. Tugay AYAŞAN
01/01/2014 - 01/01/2016
30.000,00
PROJE ÖZETİ
Proje Adı: Donör İnek Rasyonlarına Doymamış Yağ Asiti İlavesinin Süperovülasyon
Performansı ve Embriyo Kalitesi Üzerine Etkileri
Özet
Hayvancılık alanında modern teknolojilerden faydalanarak verimi artırmak ve kısa
zamanda üstün nitelikli yavrular elde edebilmek için, suni tohumlama, seksüel siklus
senkronizasyonu, embriyo transferi ve embriyoların dondurulması, embriyoda cinsiyet
tayini gibi bir takım yöntemler gittikçe yaygın bir şekilde kullanılmaya başlanmıştır. İster
birim hayvan başına verimi artırmak, ister mevcut hayvanların verimlerini koruyup
sürekliliğini sağlamak konusunda olsun uygulanan bu biyolojik yöntemlerin ana amacı
üstün erkek ya da dişi genotipinin yaygınlaştırılmasıdır.
Hayvan ıslahında başarının artırılmasında kullanılan modern tekniklerden biri de
embriyo transferidir. Embriyo transferindeki başarı donör hayvanın süperovulasyona
cevabı ile elde edilen embriyo sayısı ve kalitesine bağlıdır. Süperovulasyon uygulaması
sonucunda ovaryumda birden fazla folikülün gelişmesi, bu foliküllerin ovulasyonu ve
oositin fertilizasyonunun şekillenmesi, kaliteli embriyoların elde edilmesi amaçlanır.
13
Bu aşamaları doğrudan etkileyen beslenmeye bağlı başlıca faktörler rasyonun
enerji, protein, yağ, vitamin ve mineral içeriğidir. Negatif ve pozitif enerji dengesi, yetersiz
veya aşırı protein tüketimi, mineral veya vitamin yetersizliği gibi beslenme bozuklukları
döl verimi ile ilgili sorunlara yol açmaktadır. Donör ineklerin dengeli rasyonlarla
beslenmesi, daha iyi oosit düzeyine ve embriyo kalitesinde iyileşmeye yol açarken;
yetersiz ve dengesiz beslenmesi folikül sayısının azalmasına, oosit sayısının düşmesine yol
açmaktadır. Dolayısıyla embriyo transferinde beklenen başarıyı düşürmektedir.
Rasyon yağ asitleri ile üreme fonksiyonları arasında doğrudan bir ilişki
bulunmaktadır. Bu bağlamda üzerinde durulan besin maddesi omega-3 yağ asitleri
olmuştur. Omega 3 içeriği zengin balık yağıyla desteklenen rasyonla beslenen ineklerde
döl tutma, kolostrum üretimi ve doğan yavru sayısının arttığı saptanmıştır.
Mevcut proje kapsamında; rasyona ilave edilen rumen-korunmuş Omega-3 yağ
asitlerinin donör ineklerde süperovulasyon performansı ve embriyo kalitesi üzerine etkisi
belirlenecektir.
Anahtar Kelimeler: Donor inek, omega-3, süperovulasyon, embriyo kalitesi
14
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/97-09-02-01
ANADOLU MANDASININ ISLAHI
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
KOYUNCULUK ARAŞTIRMA İSTASYONU
TAGEM
Mehmet Akif YÜKSEL
Dr. Deniz SOYSAL
Dr. Mustafa KÜÇÜKKEBAPÇI
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
01/01/2015 - 31/12/2019
2.119.500,00
PROJE ÖZETİ
Bu proje ile Anadolu mandalarının Murrah ırkı mandalarla melezleme ve seleksiyon yoluyla
ıslahı amaçlanmıştır. Özellikle süt verimi ve laktasyon sürelerinin artırılması öncelikli hedef olarak
seçilmiştir. Bunun yanında diğer verim ve performans parameterelerinin ortaya konması
hedeflenmiştir.
Improvement of Anatolian water buffalo using Murrah buffalo via crossbreeding and
selection is aimed in this project. Especially increasing of milk yield and lactation period is selected
as first goal furthermore putting forward yield and size performance parameters.
Anahtar Kelimeler: Anadolu mandası, Murrah mandası, ıslah, melezleme, seleksiyon, süt verimi
15
BÜYÜKBAŞ HAYVANCILIK ARAŞTIRMALARI
GELİŞME RAPORLARI
PROJE ÖZETLERİ
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSÜD /13 /02 /01 /04
Halk Elinde Anadolu Mandasının Islahı
Ülkesel Projesi
TAGEM
TAGEM
Dr. Bekir ANKARALI
Prof. Dr. İhsan SOYSAL
Prof. Dr. Mustafa TEKERLİ
Doç. Dr. Ayhan YILMAZ
Yrd. Doç. Dr. Hüseyin ERDEM
Dr. Mustafa KÜÇÜKKEBABÇI
Yrd. Dr. Aziz ŞAHİN
Yavuz HAN
01/01/2012 - 31/12/2016
15.577.700 TL (Transfer Bütçesi)
PROJE ÖZETİ
Bu proje ile İstanbul, Bitlis, Samsun, Düzce, Balıkesir, Afyonkarahisar, Tokat, Diyarbakır
İllerindeki Anadolu mandalarının seleksiyon yoluyla ıslahı amaçlanmıştır. Özellikle süt
verimi ve laktasyon sürelerinin artırılması öncelikli hedef olarak seçilmiştir. Bunun yanında
diğer verim ve performans parametrelerinin ortaya konması hedeflenmiştir. İstanbul, Bitlis,
Samsun, Düzce, Balıkesir, Afyonkarahisar, Tokat, Diyarbakır illerinde yetiştirici elindeki
sürülerde uygulanması düşünülen projede 11.258 baş dişi 24 ay yaş ve daha büyük Anadolu
Mandası düvesi, ineği ile fenotipe göre seçilmiş yeter sayıda 24 ay yaş ve daha büyük (50
mandaya bir baş boğa) Anadolu manda boğası kullanılacaktır. Gıda Tarım ve Hayvancılık
Bakanlığınca en az üç baş anaç mandası olan katılımcı yetiştiricilere hayvan başına ilk yıl için
650 TL destekleme ödemesi yapılması öngörülmüştür. Parasal desteğin miktarı bakanlıkça
sonraki yıllarda artırılabilir. Projede iyileştirilmesi hedeflenen verim özellikleri öncelikle süt
ve süt yağı verimi, bunun yanında canlı ağırlık, süt proteini, döl verimidir.
16
TAGEM / HAYSÜD / 01-09-02-03
Anadolu Alacası Geliştirme Projesi
Doğu Akdeniz Tarımsal Araştırma Enstitüsü
Müdürlüğü
TAGEM
Dr. Hatice HIZLI
Dr. Tugay AYAŞAN
Hasan MUTLU
Aysun TEKGÜL
Kurtuluş GÖK
Serdal ÇOBAN
Ertan YAZGAN
01/01/2001 - Devamlı
61.581.000,00 TL
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
1. Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları:
Proje, 2013 yılının ilk altı ayında planlandığı şekilde embriyo transferleri yapılmıştır. İkinci altı aylık
periyotta donör olmadığından embriyo transferi yapılamamıştır. Bu dönem içerisinde, donör alımı ile
ilgili çalışmalar (yurt içi ve dışı) yapılmış olup ihalede belirtilen teknik özelliklere uygun gerek yurt
dışından bakılan hayvanlardaki genital muayenelerde Schmallenberg virüsünden (SBV), gerekse
yurt içinde ise Damızlık Birliği süt ve döl verim kayıtları ve diğer koşulları sağlayan uygun
hayvanlar bulunamadığından donör satın alınamamıştır.
A) Hayvan Materyali
Proje kapsamında oluşturulan sürünün hayvan mevcudu, 767 olup, detayları Tablo 1’de verilmiştir.
Tablo 1: 16.12.2013 Tarihi İtibariyle AAGP Sürü Mevcudu.
İnek
Baş
G.
Boğa
Baş
Baş
Düve
Baş
Siyah Alaca
1
5
166
438
34
45
35
43
67
TOPLAM
1
5
166
438
34
45
35
43
767
Boğa
Irk / Çağ
Dana Dana
E
Dişi
Buzağı
Dişi
Buzağı Toplam
E
Baş
İşletmede Donör sayısı 31 baş olup; bunlardan 4 başı yeni doğum yapmış olduğundan ancak 2014
yılında yapılacak embriyo transferinde kullanılabilecektir. Donörlerden diğer 21 başının halen
17
gebeliği devam etmektedir. Bunların dışındaki 6 başı ise daha evvel embriyo alınmış olduğundan
tohumlama yapılarak gebe bırakılacaktır.
İşletmedeki Taşıyıcı hayvanların sayısı 573 baş olup; bunlardan 120 başı gebe, 50 baş kasımaralık aylarında tohumlama yapıldı, geriye kalan 403 baş inek+düve en yaşlılarından başlanarak
yapay tohumlama ya da embriyo transferinde kullanılacaktır.
B) Hayvan Sağlığı Çalışmaları
a)
b)
c)
d)
6 aylık periyodlarda IBR, BVD, BT, BL, Tuberkulosis, Leptospirosis ve Brucellosis taraması,
Altı aylık periyodlarla iç parazit mücadelesi,
Haftalık periyodlarda insektisit ve fare mücadelesi yapılmış ayrıca;
Proje sürüsü için Ege Vet firmasından satın alınan Leptoferm-5 isimli Leptosipirosiz aşısı (11
Temmuz 2012 tarihinde üretimiş ve son kullanma tarihinin 11 Mayıs 2015 olduğu belirtilmiş)
Rapelli olarak Donörler ve erkek hayvanlar dışındaki hayvanlara 22 Mayıs 2013 ve 8 Temmuz
2013 tarihlerinde 2cc lik dozda kas içine uygulanmıştır. Aşı uygulaması ve sonuçları Tablo2 de
verilmiştir.
Tablo2: Leptospirosiz (Leptoferm-5) Aşı Uygulaması ve Sonuçları
Uygulanan
Aşı Uygulama
Uygulanan Düve 1.Ser. Mua.
Düve sayısı
Tarihi
sayısı (baş)
Tarihi
(baş)
1. Ser. Mua.
(+)
22.05.2013
617
19.06.2013
35
14
08.07.2013
696
17.09.2013
696
7
24.10.2013
7
5
28.11.2013
5
5
13 Mayıs 2013 tarihinde yapılan Proje izleme komitesi tarafından alınan karar gereği erkek
hayvanlar ile donörler hariç tüm sürüye yeniden aşı yapılmasına (2012 de de yapılmıştı) karar
verilmişti. Bu nedenle alınan karar gereği Adana Veteriner Kontrol Araştırma Enstitüsü Müdürlüğü
ve Veteriner Kontrol Merkez Araştırma Enstitüsü Müdürlüğü ile işbirliği yapılarak 22 Mayıs 2013
tarihinde erkek hayvanlar ile donörler hariç tüm sürüye aşı yapılmıştır. Yine, ilgili Enstitülerle
görüşülerek tesadüfen seçilen 35 hayvandan kan örneği alınıp serolojik muayeneye gönderilmiş ve
aşı yapılmış bu hayvanlardan 14 baş hayvanda düşük titre seviyesinde (aşıdan kaynaklanan) pozitif
sonuçlar tespit edilmiştir.
1. Aşı uygulamasından elde edilen sonuçlar değerlendirildikten sonra, 8 Temmuz 2013 tarihlerinde
2.kez aynı aşı yine erkek hayvanlar ve donörler hariç tüm sürüye uygulanmıştır. İkinci altı aylık rutin
serolajij muayenede 17.09.2013 tarihinde 696 hayvana yapılmış olup 7 hayvanda titre seviyesi
yüksek bulunmuştur. Ancak bu sonucun aşıdan olup olmadığı tespit edilemediğinden hayvanlar
karantinaya ayrılmıştır. 24.10.2013 tarihinde karantinaya alınan 7 baş hayvandan kan örneği alınmış,
bunlardan iki tanesi negatif diğerlerinin de titre seviyeleri düşük (aşı kaynaklı) olduğu tespit
edilmiştir. 28.11.2013 tarihinde pozitif bulunan beş hayvanın kan örneği alınmış ve düşük titre
seviyesinde pozitiflik mevcut olduğundan karantina devam etmektedir.
C) Embriyo Transfer Çalışmaları
18
2013 yılı içerisinde şubat, mayıs ve haziran aylarında 15 süperovulasyon protokolü yapılmış ve 35
donör (bazıları 2 kez) kullanılarak, 156 adet taze transfer yapılmış ve detayları Tablo 3’de
verilmiştir.
YILI
Süperovulasyon
Kullanılan Donör
Taze Trans er
Tablo 3: 2013 Yılında Yapılan Taze Transfer Çalışmaları
2013
15
35
156
Mart ve Nisan aylarında donörler dinlendirildiğinden (2012 yılında 3 kez kullanılmış
olduğundan) , temmuz ve ağustos aylarında sıcaklık sebebiyle, eylül, ekim, kasım ve aralık aylarında
da donör olmadığı için transfer yapılamamıştır.
Donör
Şubat
Süperovulasyon
Tablo 4: 2013 Yılında Yapılan ET Çalışmalarında Elde Edilen Embriyoların Özellikleri ve Gebelik
Muayeneleri ve Gerçekleşen Doğumlar
5
9
1.
2.
Top.
Kalite Kalite Dej.
Emb.
Emb. Emb.
158
Mart
39
23
96
Abort
Doğum
ET
45.Gün.
Gebelik
62
34
7
27
Donörler dinlendirildiğinden ET yapılamadı
Nisan
Mayıs
7
18
157
33
14
110
47
27
2
Haziran
3
8
74
37
10
27
47
21
3
Temmuz
Sıcaklık sebebiyle ET yapılamadı
Gebelikler
devam
19
etmektedir.
Ağustos
Eylül
Ekim
Donör olmadığından ET yapılamadı
Kasım
Aralık
TOPLAM
15
35
389
109
47
233
156
82
12
2012 ve 2013 yılı yapılan embriyo transferleri sonucu oluşturulan öz ve üvey kardeş familyaları
Tablo 5’de verilmiştir. Tablo 5’de 2012 yılında oluşturulan öz ve üvey kardeş familyalarından 63
baş, 2013 yılında oluşturulan öz ve üvey kardeş familyalarından 27 baş toplam 90 baş buzağı
doğmuş olup 43 baş buzağının doğumu 2014 şubat ve mart aylarında beklenmektedir.
Tablo 5: 2012 Ve 2013 Yılı Yapılan Embriyo Transferleri Sonucu Oluşturulan Öz Ve Üvey Kardeş
Familyaları
Doğan buzağı
Dönor
Gebe
Devam eden
Baba Adı
Kulak No
sayısı
gebelik
sayısı
Dişi
Erkek
Bosside Altaros
8163
2
2
-
-
1479
1
-
-
1
6763
5
-
1
4
6761
8
-
1
7
6767
2
2
-
7214
9
4
5
-
0064
2
-
2
-
1488
4
-
-
4
6755
1
-
1
-
7219
2
1
1
-
1489
6
-
5
1
1481
9
3
6
-
6765
4
-
2
2
Oman-Oman
Logan
Arrıad
Lotta-Hill
20
Charlesdale
Regancresta Alta
ıota
Clear-Echo
E-Longwiev
TOPLAM
7225
2
1
-
1
7208
6
2
1
3
4481
7
4
3
-
1477
9
3
3
3
7224
1
1
-
-
7223
20
3
10
7
6752
6
2
4
-
6793
8
1
-
7
0061
1
1
-
-
1487
2
-
-
2
7202
10
4
6
-
6768
4
1
2
1
6757
2
1
1
-
133
36
54
43
21
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM / 03-01-01-07
Sığırlarda Dondurulmuş Embriyolardan
Embriyo Transferi ile Gebelik Elde Edilmesi
Doğu Akdeniz Tarımsal Araştırma Enstitüsü
Müdürlüğü
TAGEM
Zeynel GÖÇMEZ
Uğur SERBESTER
Ertan YAZGAN
Necla ÇANKAYA
O. Gazi DÜNDAR
01/02/2004– 31/12/2014
97.500,00 TL
PROJE ÖZETİ
1. Başlıca Faaliyetlerin Gerçekleşme Durumu: Projede vitrifikasyonla dondurularak elde
edilen embriyoların transfer edilerek oluşan gebeliklerin incelenerek bu konuda bir çalışma
yapılması amaçlanmıştır. 2011 yılında uygulaması dondurulmuştu.
2013 yılı için proje
gerçekleştirilemezse daha önce enstitüde tarafımızdan yapılmış olan dondurulmuş embriyo
transferi çalışmaları rapor haline getirilerek sunulacağı ve bu şekilde projenin kapatılacağı
teklifi kabul edilmişti. Şu ana kadar yıl içinde çalışma yapılamadığından bahsedildiği gibi
enstitüde yapılmış dondurulmuş embriyo transferi çalışmaları değerlendirilip sonuç raporu
olarak 2015 yılında sunulacaktır.
22
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSÜD 13/A-02/P-01/03
Diyarbakır İli Halk Elinde Yetiştirilen
Anadolu Mandalarında Verim ve Malakların
Büyüme Özellikleri, β-lactoglobulin, k-casein
ve Prolaktin Genleri ile Süt ve Bileşenleri
Arasındaki İlişkinin Araştırılması
GAP Uluslararası Tarımsal Araştırma ve
Eğitim Merkezi Müdürlüğü
TAGEM
Yavuz HAN
Prof. Dr. Galip BAKIR
Yrd. Doç. Dr. Emel ÖZKAN
01/01/2013 – 31/12/2014
85.500,00 TL
PROJE ÖZETİ:
Bu çalışmada Diyarbakır ilinde Anadolu Mandası Halk Elinde Islah çalışmaları
çerçevesinde yetiştirilen sürülerin süt ve döl verimlerinin belirlenmesi ve sürüde doğan bir
kısım malakların büyüme özelliklerinin incelenmesi hedeflenmektedir. Ayrıca, süt
proteinleri β-lactoglobulin, k-casein ve prolaktin geni bakımından poliformizmine bakılarak
süt verimi ile ilişkisi ile uygulanacak seleksiyon ve ıslah çalışmalarına katkı yapma
olanakları araştırılmış olacaktır.
23
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSUD/12/02/01/05
Anadolu Mandası, Murrah ve Bunların
Melezlerınde Prnp İn/Del
Polimorfizmizminin Belirlenmesi
Bandırma Koyunculuk Araştırma İstasyonu
Müdürlüğü
TAGEM
Dr. Yalçın YAMAN
Orhan KARADAĞ
01/03/2012 – 30/12/2015
36.500,00 TL
PROJE ÖZETİ:
1. Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Proje kapsamında Kurumda yetiştirilen 225 mandaya ait kan örnekleri
toplanarak DNA ekstraksiyonu yapıldı. Proje materyal ve metodunda belirtildiği üzere; DNA
örnekleri PRNP geninde Promoter bölgesindeki 23bp İN/Del ve intron bölgesindeki 12bp
İN/DEL polimorfizmlerini tespit etmek amacıyla promoter ve intron bölgeleri için ayrı ayrı
PCR işlemi yapıldı. 205 örnekte PRNP promoter bölgesi, 217 örnekte ise PRNP intron
bölgesi PCR işlemi başarıyla gerçekleştirildi. İncelenen örneklerin tamamında her iki bölgede
de İnsersion tespit edilmiş, herhangi bir varyasyon saptanamamıştır.
24
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSÜD/12/02/01/04
Süt Sığırlarında Besin Madde Tüketimi ve
Bazı Metabolizma Değerleri ile Döl Verimi
İlişkilerinin Saptanması
Hayvancılık Merkez Araştırma Enstitüsü
Müdürlüğü
TAGEM
Engin ÜNAY
Dr. Sema YAMAN
Dr. Umut TAŞDEMİR
Aziz ÖZTÜRK
Halil İbrahim AKÇADAĞ
Yusuf BURUCU
Rahmi DARICI
01/04/2012 – 30/12/2013
42.000,00 TL
PROJE ÖZETİ:
1. Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Proje kapsamında işletmeye ait verim kayıtları yemleme kayıtları
alınmıştır. Alınan kan serumu örneklerinde gerekli analizler yapılmıştır. Analizlere ait
istatistik çalışması devam etmektedir.
25
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSÜD/13/02/01/02
Süt ve Üreme ile İlişkilendirilmiş Bazı
SNP’lerin İki Farklı Sığır Irkı İçin
Değerlendirilmesi
Hayvancılık Merkez Araştırma Enstitüsü
Müdürlüğü
TAGEM
Vedat KARAKAŞ
01/01/2013 – 31/12/2013
60.000,00 TL
PROJE ÖZETİ:
1. Başlıca Faaliyetlerin Gerçekleşme Durumu:
Yerli Kara sığır materyalinden kanlar alınmış olup DNA izolasyonu aşamasına geçilmiştir.
Ayrıca SNP paneline seçilecek SNP’lerle ilgili çalışmalar devam etmektedir.
26
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSUD/12/02/01/03
Sığırlarda Görülen Bazı Kalıtsal
Bozuklukların Tespitinde Multipleks PCR
Optimizasyon İmkanlarının Araştırılması
Hayvancılık Merkez Araştırma Enstitüsü
Müdürlüğü
TAGEM
İlkay DEMİRHAN
Vedat KARAKAŞ
Bengi Çınar KUL
Nüket BİLGEN
01/03/2012 – 01/03/2015
40.000,00 TL
PROJE ÖZETİ:
1.
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Multipleks PCR optimizasyonu için ilk set primerler ve sentetik oligolar kullanılarak ilk
çalışmalar yapılmış fakat başarı sağlanamamıştır.
27
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSÜD/13/A-02/P-01/01
In Vitro Embriyo Kültür Ortamına ve Sperma
Sulandiricilarina Ilave Edilen Eritropoietinin
Spermatolojik Parametreler, Oksidatif Stres
ve Embriyo Gelişimi Üzerine Etkisi
Hayvancılık Merkez Araştırma Enstitüsü
Müdürlüğü
TAGEM
Muharrem SATILMIŞ
01/04/2013 – 01/04/2014
4.000,00 TL
PROJE ÖZETİ:
1. Başlıca Faaliyetlerin Gerçekleşme Durumu:
Çalışmanın bu aşamasında spermaların elde edilmesi ve dondurulması işlemi tamamlanmıştır.
Bu amaç için 2-6 yaşlı 3 baş boğa kullanıldı. Boğalardan suni vajen yöntemiyle haftada 2 kez
2 hafta süreyle 12 ejakülat alındı. Elde edilen toplam 12 ejakülatda başlıca spermatolojik
özellikler yönünden muayeneleri yapıldı. Her bir boğadan alınan ejakülatlar 4 eşit hacme
bölünerek,
1- Tris sulandırıcısı + 12.5 U eritropoietin /ml
2- Tris sulandırıcısı + 25 U eritropoietin /ml
3- Tris sulandırıcısı + 50 U eritropoietin /ml
4- Tris sulandırıcısı + 100 U eritropoietin / ml
5- Tris sulandırıcısı + 200 U eritropoietin /ml
6- Tris sulandırıcısı (Kontrol)
olacak şekilde sulandırıldı. Sulandırma işlemi payetlerin her birinde 175x105 spermatozoa
olacak şekilde yapıldı. Ekilibrasyon işlemini takiben 0.25 ml’lik payetlere çekilerek kontrollü
sperma dondurma cihazı ile 7 dakika içerisinde dondurulduktan sonra sıvı azot içerisine
nakledildi (-1960C ).
Çalışmanın ikinci aşamasında lokal mezhabalardan inek ovaryumları fizyolojik tuzlu su
(%0.9) ve antibiyotik (%0.1) içeren taşıma sıvısı içerisinde ve 25-30oC’lik sabit ısı sağlayan
28
termosta 2-3 saat içerisinde laboratuvara getirildi. Ovaryum yüzeyindeki immatür oositler
aspire edilerek A ve B kalite olan oositler in vitro embriyo üretim sürecine alındı. Oositlerin
in vitro maturasyonu amacıyla %10 FCS + 2µg/ml FSH katkılı TCM-199 medyumunda ve 22
saat süreyle %5 CO2, %95’in üzerinde nem ve 39oC’deki inkubatörde maturasyon işlemi
gerçekleştirildi. Spermalar ile 5-6 saat süreyle fertilizasyonları sağlandıktan sonra kumulus
hücrelerinden pipetlenerek uzaklaştırılan oositler eritropoietinin farklı miktarlarının ilave
edildiği CR1aa kültür medyumlarında kültür periyoduna alındı. Kültür ortamının 2. günü
sonunda bölünme kontrolleri yapılarak bölünme oranları kayıt edildi. 7. ve 8. gün blastosist
oranları ve embriyo kaliteleri değerlendirildi. Aynı günlerde kültür medyumlarından alınan
numuneler total antioksidan kapasite ölçümlerinin yapılması için – 40 oC’ye kaldırıldı.
Dondurulan embriyo ve spermaların antioksidan ölçümleri ve spermatoljik muayeneleri
yapılarak rapor yazılacaktır.
29
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSÜD/14-A02-P03-003
Kanola Küspesi ve Çözeltili Kuru Damıtılmış
Mısırın (DDGS) İn Situ ve İn Vitro Rumen
Protein Parçalanabilirlikleri Arasındaki
İlişkiler
Hayvancılık Merkez Araştırma Enstitüsü
Müdürlüğü
TAGEM
Dr. Sema YAMAN
Arzu Erol TUNÇ
Engin ÜNAY
Gülşen Yıldırım ŞENYER
06/01/2014 – 31/12/2015
28.000,00 TL
PROJE ÖZETİ:
Bu çalışma, ülkemizde özellikle yüksek süt verimli ineklerin beslenmesinde yaygın olarak
kullanılan soya küspesine alternatif olabilecek protein kaynaklarından olan kanola küspesi ve
kuru çözeltili damıtılmış mısırın in situ (naylon-torba) ve saflaştırılmış sentetik enzim
yöntemleri (Streptomyces griseus) kullanarak, rumende parçalanabilen proteinlerini tayin
etmek ve bu yöntemler arasındaki ilişkiden yararlanarak in vitrodan in situ rumen protein
parçalanabilirliğini (IRPP) tahmin eden regresyon denklemleri geliştirmek amacıyla
planlanmıştır.
Proje sonucunda bulunacak ilişki ve regresyon denklemleri yem sanayicileri ve araştırmacılar
için, in vitro protein parçalanabilirliğinden in situ protein parçalanabilirliğini tahmin etmede
kullanılabilecektir.
30
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSÜD/14-A02-P03-002
Çam Kabuğu Ve Yucca Schidigera
Ekstraktının İn Vitro Besin Maddeleri
Sindirilebilirliği İle Rumen Uçucu Yağ
Asitleri, Süt Verimi, Biyolojik Kan
Parametreleri Ve Antioksidan Kapasite
Üzerine Etkisi
Hayvancılık Merkez Araştırma Enstitüsü
Müdürlüğü
TAGEM
Dr. Sema YAMAN
Arzu Erol TUNÇ
Engin ÜNAY
Gülşen Yıldırım ŞENYER
İbrahim ARIK
Prof. Dr. Gültekin YILDIZ
Pınar ÖZDEMİR
Yard. Doç. Dr. Laçine AKSOY
06/01/2014 – 28/02/2016
40.000,00 TL
PROJE ÖZETİ:
Bu çalışma kondanse taninler içeren çam kabuğu ekstrakt ve steroidal saponin içeren Yucca
schidigera bitkisinin tanen ve saponin içeriklerinin rumende mikrobiyal popülasyon ve protein
parçalanabilirliği üzerinde azaltıcı etkisi ve anti mikrobiyal, anti oksidan etkilerini
belirleyerek ruminantlarda yem katkısı olarak kullanma potansiyelini araştırmak için
planlanmıştır. Çalışma iki aşamada gerçekleştirilecektir. Birinci aşamada bahsedilen
ekstraktların in vitro gerçek besin maddeleri sindirimine etkisi incelenecektir. Bu amaçla
ekstrakların rumende protein , kuru madde, organik madde ve NDF parçalanabilirliğine
etkilerini test etmek için rumende çabuk parçalanan protein, enerji ve kaba yem kaynakları
olarak soya küspesi, arpa ve yonca kuru otu substrat olarak seçilmiştir. Birinci aşama
sonuçları doğrultusunda 15 baş Siyah Alaca süt ineği rasyonlarına katılacak dozlarla bu
ekstraktların süt verimine ve süt bileşenlerine etkisi in vivo olarak tespit edilecektir.
Çalışmada ayrıca ekstraktların rumen sıvısında uçucu yağ asitleri (UYA) miktarları ve
protozoa sayıları üzerindeki etkileri de belirlenecektir. Çalışmada kanda bazı biyolojik kan
metabolitleri ile antioksidan kapasitesi üzerine etkiler de belirlenecektir. Ekstraktların in vitro
mikrobiyel ve antioksidan kapasitesi ve fenol içeriği belirlenecektir.
31
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM/HAYSÜD/14-A02-P03-001
Soya Küspesi ve Ekstrude Soyanın İn Situ ve
İn Vitro Rumen Protein Parçalanabilirlikleri
Arasındaki İlişkiler
Hayvancılık Merkez Araştırma Enstitüsü
Müdürlüğü
TAGEM
Arzu Erol TUNÇ
Doç. Dr. Yusuf CUFADAR
Dr. Sema YAMAN
01/06/2014 – 31/12/2015
28.000,00 TL
PROJE ÖZETİ:
Bu çalışma, ülkemizde ruminant beslemede özellikle yüksek verimli süt sığırlanın
beslenmesinde yaygın olarak kullanılan soya küspesi ve ekstrude soyanın in situ (naylontorba) ve saflaştırılmış sentetik enzim yöntemleri (Streptomyces griseus) kullanarak, rumende
parçalanabilen proteinlerini tayin etmek ve bu yöntemler arasındaki ilişkiden yararlanarak in
vitrodan in situ rumen protein parçalanabilirliğini (IRPP) tahmin eden regresyon denklemleri
geliştirmek amacıyla planlanmıştır.
Proje sonucunda bulunacak ilişki ve regresyon denklemleri yem sanayicileri ve araştırmacılar
için, in vitro protein parçalanabilirliğinden in situ protein parçalanabilirliğini tahmin etmede
kullanılabilecektir.
32
BÜYÜKBAŞ HAYVANCILIK ARAŞTIRMALARI
SONUÇ RAPORLARI
PROJE ÖZETLERİ
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/11-01-01-01
Prostaglandinlerle Östrus Senkronizasyonu
Yapılmış Siklusları Düzensiz, Embriyo Transferi
Uygulamalarından Gebe Kalmayan Düvelerde ΒKaroten, Cu +B12 Vitamini Ve Se+E Vitaminin
Reprodüktif Performans Üzerine Etkisi
Projeyi Yürüten Kuruluş:
Doğu Akdeniz Tarımsal Araştırma Enstitüsü
Müdürlüğü
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
TAGEM
Kurtuluş GÖK
Serdal ÇOBAN
Uğur KARA
Emel KARAKOZAK
Aysun ÇAMLIDAĞ
Hasan MUTLU
01/01/2010 - 31/12/2014
20.000,00 TL
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
PROJE ÖZETİ:
Araştırmada, düveler her birinde 15 inek bulunan benzer özellikte 7 muamele gruba
ayrıldı ve canlı ağırlıkları, yaşları, cidago ölçüleri, reprodüktif geçmişleri ve vücut kondisyon
skorları çalışmanın başında belirlendi.
Çalışma kapsamında, 1. Grup, Kontrol grubu, 2. ve 3. grup ise farklı uygulamalarla βkaroten, 4. ve 5. grup ise farklı uygulamalarla Cu + B12 vitamini, 6. ve 7. grup ise farklı
uygulamalarla Se+E vitamini enjekte edilen düvelerden oluşturuldu.
β-karoten, vitamin B12, Vitamin E ve Progesteron düzeyleri eliza testi ile tespit
edilecek ve her hayvanın östrus döneminde folikül sayısı, çapı, PG uygulamaları sırasında CL
varlığı, sayısı ve çapı, gebelik bulguları, embriyonik ölüm oranına bakıldı.
Gruplar arasındaki farkın kontrolü istatistiki olarak tek yönlü varyans analizi
(ANOVA) ile Gebelik’e etkisi ise Mann-Whitney Test ile yapıldı.
Bu çalışma ile döl tutmama problemi bulunan düvelerde β-karoten etkisi, Cu+vitamin
B12 etkisi ve Se+Vitamin E etkisi araştırılması ve bu verilerin reprodüktif problemlerin
ortaya çıkmasındaki rollerinin ortaya konması amaçlandı.
33
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/97-09-02-01
Anadolu Mandasının Islahı
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Koyunculuk Araştırma İstasyonu Müdürlüğü
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi:
TAGEM
Dr. Mustafa KÜÇÜKKEBAPÇI
M. Akif YÜKSEL
Dr. Deniz SOYSAL
Dr. Yalçın YAMAN
01/05/2008 - 01/05/2013
690.605,00 TL
PROJE ÖZETİ:
Bu proje ile Anadolu mandalarının Murrah ırkı mandalarla melezleme ve seleksiyon yoluyla
ıslahı amaçlanmıştır. Özellikle süt verimi ve laktasyon sürelerinin artırılması öncelikli hedef
olarak seçilmiştir. Bunun yanında diğer verim ve performans parametrelerinin ortaya konması
hedeflenmiştir. Birinci laktasyonda elde edilen sonuçlar Anadolu mandalarında, F1
melezlerinde ve G1 melezlerinde sırasıyla, ilk laktasyon ortalama süt verimi 508,4725,46,
883,5955,62 ve 1361,8109,68 kg; ilk laktasyon süresi 175,045,17, 236,9513,20 ve
317,4411,74 gün; ilkine malaklama yaşı 41,730,54, 51,231,16 ve 55,682,48 ay; süt
yağı %8,230,22, %8,360,18 ve %8,460,13 olarak saptanmıştır. Doğumdan 6 ay yaşa
kadar vücut gelişim performanslarında genel olarak F1 melezlerinin üstün olduğu
görülmüştür. Projenin hedeflenen verim özellikleri yönünden bir artış sağladığı görülmüş,
ancak böyle bir çalışma için canlı materyal sayısının yetersiz olduğu kanaatine varılmıştır.
Canlı materyal sayısının arttırılarak projeye kesintisiz devam edildiği takdirde istenilen hedefe
varılabileceği düşünülmektedir.
34
KÜÇÜKBAŞ HAYVANCILIK ARAŞTIRMALARI
YENİ TEKLİF PROJELER
DESTEK BAŞVURUSUNDA BULUNULAN PROJENİN
Rasyona İlave Edilen Linoleik Asidin Koyunlarda Döl
BAŞLIĞI
Verimine Etkisi
ARAŞTIRMA FIRSAT
Küçükbaş Hayvancılık
ALANI
ARAŞTIRMA PROGRAMI Hayvan Besleme
Yüksek
PROGRAM ÖNCELİĞİ
PROJE ÖNERİSİ YAPAN KURULUŞUN
HAYVANCILIK MERKEZ ARAŞTIRMA ENSTİTÜSÜ
ADI
LALAHAN/ANKARA
ADRESİ
PROJE / ALT PROJE LİDERİ
Engin ÜNAY
ADI SOYADI
Hayvancılık Merkez Araştırma Enstitüsü
KURUMU
312.8651196
TELEFONU
[email protected]
E-POSTA
PROJE / ALT PROJE YÜRÜTÜCÜLERİ
ADI SOYADI
KURUMU
Dr. Sema YAMAN
Hayvancılık Merkez Araştırma Enstitüsü
İlke ÜNLÜSOY
Hayvancılık Merkez Araştırma Enstitüsü
Arzu EROL
Hayvancılık Merkez Araştırma Enstitüsü
Zulal TAVLI YILDIRIR
Hayvancılık Merkez Araştırma Enstitüsü
Pınar ÖZDEMİR
Hayvancılık Merkez Araştırma Enstitüsü
PROJE TOPLAM
BÜTÇESİ (TL)
31.000,00
PROJE BAŞLAMA TARİHİ
(GÜN/AY/YIL)
01.04.2015
E-POSTA
PROJE BİTİŞ
TARİHİ
(GÜN/AY/YIL)
01.01.2017
PROJE ÖZETİ
Proje Özeti:
Projeye Nisan 2015 yılında başlanacak olup Hayvancılık Merkez Araştırma Enstitüsünde
toplam 40 baş Akkaraman koyunu oluşturacaktır. Koyunlar Kontrol ve Deneme Grupları (5,
10, 15, 20 g/kg yem KLA (Konjuge Lineleik Asit) içeren rasyonla beslenen gruplar olmak
üzere toplam 5 gruba 8 er baş olacak şekilde ayrılacaktır. Rasyona ilave KLA lar ticari
kullanım amaçlı satılan ürünlerden ve rumen bypas özellikli olacaktır. İlave KLA, koç katım
döneminden 30 gün önce Eylül ayında verilmeye başlayacak üreme üzerindeki etkisini tam
olarak göstermesi sağlanacaktır. KLA, koç katım döneminde en az 2 seksüel siklus içerecek
35
şekilde 36 gün verilmeye devam edecektir. Bu süre toplamda 66 gün olacaktır. Bu süre
içerisinde yemlerde ve kanda KLA analizleri ile yumurtalık fonksiyonlarının izlenmesi
amacıyla ultrasonografi muayene yapılacaktır. KLA nın üreme üzerindeki metabolizmasının
incelenmesi amacıyla proje süresince belirli periyotlarla alınacak kanda üreme hormonları
(prostoglandin ve progesteron), NEFA, BHB, BUN, Glikoz ve kolesterol analizleri
yapılacaktır. Koç katım döneminde ultrason yardımıyla Korpus Luteum (CL) sayımı ve
gebelik muayenesi yapılacaktır.
Kuzulama mevsiminde ise, koç altı koyun sayısına göre kuzu verimleri ve ikizlik oranı
verileri alınarak rasyona katılan KLA nın özellikle kuzu verimine ve ikizliğe etkisi
irdelenecektir.
Anahtar Kelimeler: Koyun besleme, KLA, besleme kuzu verimi ilişkisi
Projenin Amacı ve Gerekçesi:
Yapılan son çalışmalarda geviş getiren hayvanların doğal bir bileşeni olan KLA’ in kanser
riskini azalttığı, kalp hastalıklarını önlemekte yardımcı olduğu, bağışıklık fonksiyonlarını
geliştirdiği ve obeziteyle mücadelede vücudu yağsızlaştırarak etkili olduğu tespit edilmiştir.
Bu özelliğinin yanında özellikle büyükbaş hayvanlarda yapılan çalışmalarda embriyonun
uterusa tutunmasında ve yaşamını devam ettirmesinde etkili olduğu, corpus luteum gelişimini
olumlu etkilediği, progesteron arttırıcı bir özelliği olduğu saptanmıştır. Bu veriler ışığında
özellikle corpus luteum üzerinde ki olumlu etkisinin koyunlarda ikizlik arttırıcı etkisinin
olabileceği hipotezi ile bu çalışma hazırlanmıştır. Çalışmada ülkemiz koyun popülasyonunun
önemli bir kısmını oluşturan Akkaraman ırkı kullanılarak ikizlik oranı ve kuzu verimi
üzerinde etkisinin olup olmadığına bakılacaktır.
Proje ile Elde Edilmek İstenilen Çıktılar ve Kullanım Alanlarını Açıklanmalıdır.
Araştırma sırasında uygulanacak olan 4 farklı dozdaki KLA dan kuzu veriminin
arttırılmasında kontrol grubuna oranla istatiksel olarak önemli fark bulunan kullanım
dozunun yem sanayisinde kullanılması amacıyla yapılacak yayın, sunum ve posterlerle
üreticilere ulaşımı sağlanacaktır.
LİTERATÜR ÖZETİ:
Konjuge linoleik asit (KLA), oktadekadienoik asidin konjuge çift bağlarla pozisyon
ve geometrik izomerlerinin bir karışımıdır. Geviş getiren hayvanlardan elde edilen gıdaların
doğal bir bileşeni olan KLA, kanser riskini azaltmakta, kalp hastalıklarını önlemekte,
bağışıklık fonksiyonlarını geliştirmekte ve şişmanlığı tedavi etmekte veya vücudu
yağsızlaştırmaktadır. KLA izomerlerinin büyük bir kısmını cis-9, trans-11 izomeri
oluşturmaktadır. Bu izomer, “rumenik asit” olarak da adlandırılmaktadır. Rumenik asit, sığır
etindeki (Fritsche ve Fritsche 1998) ve sütteki (Gurr 1998, O’Shea ve ark. 1998) toplam
KLA’ nın yaklaşık %90’nını oluşturmaktadır.
Konjuge linoleik asit, linoleik asitin (oktadekadionik asit) konguje olarak oluşturduğu
pozisyonel ve geometrik izomerlerinin karışımı olan bir yağ asitidir (Bauman ve ark., 1999;
İrkin ve Eren, 2008). Konjuge linoleik asit, kotu kolesterolü düşürüp iyi kolesterolu artırıcı,
kalp krizinde etkin bir rol oynayan trigliserit seviyesini azaltıcı, arterioskelerozis ve
trombozu engelleyerek kan akışkanlığını azaltıcı gibi onemli etkilere sahiptir (Çelik ve
Demirel, 2004). İnsanlarda, KLA’ in bu etkileri gosterebilmesi icin gunde 400 mg’ dan daha
fazla KLA (cis-9, trans-11) ’in diyetle alınması gerekirken, genel beslenme alışkanlıklarıyla
vucuda gunluk alınan miktarın ortalama 200 mg’ ın altında olduğu belirlenmiştir
(Ritzenthaler ve ark., 2001). İnsan sağlığı uzerine olumlu etkilere sahip omega-3 PUFA ve
KLA’in hayvansal urunlerde, ozellikle de ruminantların etinde ve sutunde arttırılması son
36
yıllarda uzerinde onemle durulan bir konudur (Dhiman ve ark., 200; Gillis ve ark., 2004;
Noci ve ark., 2007). Rumende KLA, probiyotik ozellik gosteren bazı bakteriler tarafından
(Lactobacillus, Propiobacterium, Bifidobacterium ve Enterococcus) linoleik asitten
oluşturulurken, başlıca urun olarak vaksenik asit (C18:1, trans-Δ11) ve son urun olarak
stearik asit oluşmaktadır (İrkin ve Eren, 2008).
Rasyona kuru madde oranının %3 ü oranında yağ ilavesinin, ineklerde corpus luteum
oranının artması, progesteron seviyesinin artması ve fertiliteyi olumlu etkilediği bildirilmiştir
(Staples ve ark., 1998).
Spicer ve ark., (1993), Doğum sonrası dönemdeki 14 S.Alaca inek üzerinde yaptıkları
denemede doğumdan sonra 4. hafta ile 12. hafta arasında rasyona KM bazında %1,8
korunmuş yağ (Megalac; CLA+Oleik+Palmitik) ilavesi ile yaptıkları araştırma sonucunda,
deneme grubunun Plazma Kolesterol ve Progesteron seviyelerinin kontrol grubuna oranla
daha yüksek olduğunu belirtmektedir. Bu durumun ise gebelik oranını yükselteceği
yorumunu yapmakla birlikte konunun araştırılması gerektiğini belirtmektedirler.
Sadeghipanah ve ark., (2006), 52 baş 6 yaşlı yağlı kuyruklu Zandi koyununda
flashing döneminde yağ ilavesinin üreme parametrelerine üzerine etkilerini incelemek
amacıyla yaptıkları bir denemede; 4 deneysel grup oluşturmuşlardır. Contol (grup 1) yağ
ilavesiz grup, %4,5 don yağı yağ asitlerinin Ca tuzları ile muamele edilmiş formu ilaveli
rasyonla beslenen grup (grup 2), %4,5 soya yağı yağ asitlerinin Ca tuzları ile muamele
edilmiş formu ile beslenen grup (grup 3), grup 4 ise %2,25 2. grup ilave yağ asitleri ve
%2,25 3. grup yağ ilavesinin birlikte kullanıldığı grubu oluşturmuşlardır. Laparoskopik
muayene ile 3mm den büyük folliküller ve CL sayılmıştır. CL sayısı yumurtlama oranı
(ovulation rate) olarak alınmıştır. Deneme sonuçlarına göre Yumurtlama oranı en yüksek 3.
grupta tespit edilmiştir (p<0,05). Follikül sayısının ise 2. grupta diğerlerinden daha düşük
bulunmuştur (p<0,05). Gebelik oranı, 3. grupta diğer gruplara oranla daha önemli
bulunmuştur (p<0,05). Gebelik oranı 2, ve 4. grupta ise kontrol (grup 1) e göre daha önemli
bulunmuştur (p< 0,05). Kuzulama ve ikizlik oranı grup 3 de en yüksek 2 ve 4. grupta ise
grup 1 e göre daha önemli bulunmuştur (p<0,05). Sonuç olarak koyunlarda flashing
dönemdeki rasyona yağ ilavesinin (özelliklede unsaturated fatty acids) yumurtlama oranı,
gebelik oranı, üreme performansına olumlu etkisi olduğu kanısına varmışlardır.
MATERYAL ve METOT:
Hayvan Materyali: Araştırmanın hayvan materyalini, Enstitü Koyun Keçi yetiştirme
şubesinde mevcut 40 baş 2 – 3 yaşlı Akkaraman ırkı koç altı koyun oluşturacaktır. Hayvanlar
5 gruba 8 er baş olacak şekilde tesadüfi olarak dağıtılacaktır.
Yem ve Yemleme Düzeni: Enstitü değirmeninde hazırlacak olan %13 HP içeren (Arpa,
Ayçiçeği Küspesi,Kepek, Vitamin ve Min Karması içerikli) yem bazal rasyon olarak
kullanılacaktır. Hayvanlar canlı ağırlıklarının % 2 si oranında KM içerecek şekilde %30
kesif %70 kaba yemle beslenecektir. Hesaplanan rasyonda kaba yemin meradan
karşılanacağı, %30 luk kesif yemin ise bazal yemle bireysel kafeslerde beslenmeleri
sağlanacaktır. Hayvanlar deneme süresince doğal seksüel siklusun etkilenmemesi amacıyla
sürü ile birlikte mera otlamasına devam edecek olup kesif yem ile yapılacak KLA doz
denemesi mera öncesi ½ ve mera dönüşü ½ şeklinde yapılacaktır. Kontrol grubunda bazal
rasyona KLA ilave edilmeyecektir. Deneme gruplarında ise KLA dozları 5, 10, 15 ve 20
g/kg yem olacak şekilde mikser ortamında karıştırılacaktır. Kullanılacak olan KLA by pass
özellikli olup konjuge linoleik asidin Ca tuzları ile muamelesi ile elde edilmiş ticari
preparatlardan oluşacaktır. Yemleme koç katım döneminden 1 ay önce (Eylül ayında)
başlayacak, koç katım döneminde 2 seksüel siklusu içerecek şekilde 36 gün daha devam
37
ettirilecektir. Deneme süresi toplam 66 gün olacaktır. Projede kullanılacak yem tek seferde
ve aynı ham madde ile hazırlanacaktır.
Örneklerin toplanması ve Yapılacak Analizler: Deneme başında hazırlanan yemden yem
örneği alınarak Ham Protein (HP), Ham yağ (HY), NDF, ADF, Linoleik Asit, Ca ve P
analizleri ile hesaplama yöntemi ile Metabolik enerji değerleri tespit edilecektir. Denemenin
başlangıcında (0. Gün), 30. 48. Ve 66. Günlerde tüm hayvan materyalinden kan alınacaktır.
Toplamda 4 kez kan alınmış olacaktır. Kanlar vena jugularis’ den normal tüpe alınarak
etkileşimleri minimize etmek amacıyla 1 saat içerisinde santrifüj edilip serumları ayrılarak 20 C de analiz zamanına kadar muhafaza edilecektir. Alınan kanlardan elde edilen serumda
BUN, Glikoz, NEFA, BHB, Total Kolesterol, Prostoglandin ve progesteron analizleri ticari
kitlerle yapılacaktır. BUN, Glikoz, Total Kolesterol, NEFA UV Spectrometrede, BHB,
Prostoglandin ve Progesteron analizleri ise ELİSA cihazında yapılacaktır.
Ultrason Muayenesi: Koç katım döneminde kızgınlık öncesinde koyunlarda abdominal
bölgeden ultrason yardımı ile Korpus Luteum sayımı yapılacaktır.
Döl Verimi Kayıtlarının Alınması: Kuzulama döneminde tüm sürülerde koç altı koyun
başına canlı doğan kuzu sayısı, ölü doğan kuzu sayısı, ikizlik oranı alınacaktır.
Denemede Kullanılacak İstatistik Metotları:
Hayvan denemeleri tesadüf parselleri
deneme deseninde kurgulanacaktır. Kan parametreleri ile ikizlik ve kuzu verimi arasındaki
ilişki korelasyon ve lojistik regresyon analizi ile incelenecektir.
Yapılacak
Faaliyetler
ÇALIŞMA TAKVİMİ
Çalışma Takvimi Çizelgesi
2015 AYLAR
06
07
08
09
10
2016 AYLAR
11
12
01
02
03
04
05
06
07
Ön hazırlıklar ve gerekli
alımların yapılması
Yemleme programının
uygulanması, ultrason ile
yumurtalık kontrolü, yem, kan
örneklerin toplanması
Analizlerin yapılması
Kuzu verim kayıtlarının
alınması
Sonuç raporunun hazırlanması
YÖNETİM DÜZENİ
Proje Yürütücülerinin Projeye Katkıları
Adı Soyadı
Engin ÜNAY
Dr. Sema YAMAN
Engin ÜNAY
Dr. Sema YAMAN
İlke ÜNLÜSOY
Zulal Tavlı YILDIRIR
İlke ÜNLÜSOY
Arzu EROL
Engin ÜNAY
Yapılacak Faaliyetlerdeki Sorumlulukları
Çalışma Takvimi
Ön hazırlıklar ve gerekli alımların yapılması
2014 06-07-08. Aylar
Yemleme programının uygulanması ve yem
ve kan örneklerinin toplanması, Ultrason
muayenesi
2014 09-10-11. Aylar
Ultrason yardımı ile yumurtalık kontrolü,
2014 09-10-11. Aylar
Yem ve Kan Analizlerin Yapılması
2014 11-12. /2015 01-02.
Aylar
38
Zülal TAVLI YILDIRIR
Engin ÜNAY
İlke ÜNLÜSOY
Pınar ÖZDEMİR
Engin ÜNAY
Dr. Sema YAMAN
Kuzu Verim Kayıtlarının Alınması
2015 02-03-04. Aylar
Analiz Sonuçlarının Değerlendirilmesi ve
Sonuç Raporunun Hazırlanması
2015 05-06-07. Aylar
Proje Sonuçları Uygulama Aktarımı
Akkaraman Koyun Irkında Koç Katım Döneminde Rasyona İlave Edilen
Proje Adı
Konjuge Linoleik Asidin Döl Verimine Etkisi
PROJENİN AMACI: Koyunlarda Koç Katım döneminde rasyona ilave edilen CLA nın
kuzu verimini arttırması, ikizlik oranının arttırılması amaçlanmaktadır.
ÇIKTILARIN UYGULAMAYA AKTARILMASI VE YAYGINLAŞTIRILMASI
· Proje sonunda yapılacak yayın, sempozyum sunumu ile hedef kitle olan
yetiştiricilerin daha kaliteli yeme ulaşmaları amacıyla araştırma sonuçları yem
sanayicilerine aktarılacaktır
· Hazırlanacak poster ve sunumlar ile İl Müdürlüğü yayım personeli ve Koyun Keçi
Yetiştirici Birliği üyesi yetiştiricilerle ortaklaşa düzenlenecek kurslarla koyun
yetiştiricilerine koç katım döneminde daha bilimsel bir besleme programı
uygulamalarının anlatılması uygulamalı olarak gösterilecektir.
· Araştırma sonucunda elde edilen veriler ışığında belirlenen en uygun dozda yetiştirici
koşullarında (Halk Elinde Islah Sürülerinde) deneme tekrarlanacaktır.
Sıra
Proje Çıktıları
Çıktıların Uygulamaya Aktarılma
Mekanizmaları
1
Yetiştirmeye yönelik bilgi
Yayın ve BAV toplantıları yoluyla
TALEP EDİLEN BÜTÇE
I. Yatırım Tutarı
06 SERMAYE GİDERLERİ
1.Yıl
06.1- Mamul Mal Alımları
06.2- Menkul Sermaye Üretim Giderleri
06.2.1.90 Diğer Ödemeler(3 Ay 1 işçi gideri)
06.2.7.01 Laboratuvar Sarf ve Kimyasal Alımı
06.2.8.01 Metal Alımları (Bireysel Kafesler için)
Toplam
Genel Toplam
6.000,00
15.000,00
10.000,00
31.000,00
31.000,00
YILLARA GÖRE DAĞILIM
2.Yıl
3 Yıl
4.Yıl
5 Yıl
II. Bütçe Gerekçesi ve Yatırım Tutarının Dağılımı
Maliye Bakanlı kodlarına göre; 06.2- Menkul Sermaye Üretim Giderleri ana kodundaki
06.2.1.90 alt kodlu ödenek 90 gün boyunca mera dönüşü deneme hayvanlarının sürüden
ayrılarak kafeslere alınması, yemlemelerin yapılması işi için işçi çalıştırılması işi için,
06.2.07.01 Kimyevi Madde Alımı kaleminden analizler için gerekli olan kimyasal malzeme
ile kitler için, 06.2.8.01 alt kodlu metal ürün alımı ise 40 adet bireysel kafes yapılması işi için
istenmektedir.
TEKLİF ONAYI
Proje /Alt Proje Lideri
Adı Soyadı
Engin ÜNAY
Tarih
27.12.2013
İmza
39
Öneren Kuruluş Müdürü
Muharrem SATILMIŞ
27.12.2013
DESTEK BAŞVURUSUNDA BULUNULAN PROJENİN
BAŞLIĞI
Şanlıurfa İklim Koşullarında Şarole Irkı Koyunların Entansif
Yetiştiricilikte Verim Performansı ve Adaptasyon Kabiliyeti
ARAŞTIRMA
FIRSAT
A-07
ALANI
ARAŞTIRMA
P-01
PROGRAMI
PROGRAM ÖNCELİĞİ Yüksek
PROJE ÖNERİSİ YAPAN KURULUŞUN
GAP Tarımsal Araştırma Enstitüsü Müdürlüğü
ADI
Paşabağı Mahallesi Recep Tayyip Erdoğan Bulvarı No:106
ADRESİ
ŞANLIURFA
PROJE / ALT PROJE LİDERİ
Zeliha SAVRUNLU
ADI SOYADI
GAP Tarımsal Araştırma Enstitüsü Müdürlüğü
KURUMU
05357042174
TELEFONU
[email protected]
E-POSTA
PROJE / ALT PROJE YÜRÜTÜCÜLERİ
ADI SOYADI
KURUMU
GAP Tarımsal Araştırma
Sevil ARSLAN
Müdürlüğü
GAP Tarımsal Araştırma
Reşit DEMİR
Müdürlüğü
GAP Tarımsal Araştırma
Esma PAYDAŞ
Müdürlüğü
GAP Tarımsal Araştırma
İrfan GÜNGÖR
Müdürlüğü
GAP Tarımsal Araştırma
Deha Ali DENİZ
Müdürlüğü
GAP Tarımsal Araştırma
Mehmet BADILLI
Müdürlüğü
GAP Tarımsal Araştırma
Mustafa Şeref ŞELLİ
Müdürlüğü
GAP Tarımsal Araştırma
Mahmut YÜKSEL
Müdürlüğü
Oğuz
Yaşar
GAP Tarımsal Araştırma
UZUNMEHMETOĞL
Müdürlüğü
U
Fatma
Pınar GAP Tarımsal Araştırma
KARADUMAN
Müdürlüğü
Enstitüsü
Enstitüsü
Enstitüsü
Enstitüsü
Enstitüsü
E-POSTA
[email protected]
om
[email protected]
m
[email protected]
l.com
[email protected]
m
[email protected]
Enstitüsü [email protected]
.com
Enstitüsü
[email protected]
Enstitüsü [email protected]
ail.com
Enstitüsü
[email protected]
Enstitüsü [email protected]
m
40
Muhammed
BAYRAKTAR
Sami GAP Tarımsal Araştırma Enstitüsü
Müdürlüğü
Harran Üniversitesi Veteriner Fakültesi,
Yard. Doç. Dr. Ömer
Dölerme ve Suni Tohumlama Anabilim
VARIŞLI
Dalı
Yard.
Doç.
Dr. Harran Üniversitesi Veteriner Fakültesi,
Durhasan MUNDAN
Zootekni Anabilim Dalı
PROJE TOPLAM
BÜTÇESİ (TL)
294.550
[email protected]
mail.com
[email protected]
[email protected]
n.edu.tr
PROJE
BAŞLAMA
PROJE
BİTİŞ
TARİHİ
TARİHİ
(GÜN/AY/YIL)
(GÜN/AY/YIL)
01.01.2015
31.12.2018
İŞBİRLİĞİ
İŞBİRLİĞİ
YAPILAN
İŞBİRLİĞİ ŞEKLİ
KURULUŞ
Harran
Üniversitesi
Veteriner
Teknik
Fakültesi
PROJEDEKİ KATKISI
Danışman
PROJE ÖZETİ
Mevcut koyun varlığı ile dünyanın sayılı ülkeleri arasında yer alan Türkiye’de, hayvan
başına düşen verim miktarının az olması sebebi ile hayvansal üretim açısından istenilen
düzeyde bulunmamaktadır. Şarole koyun ırkı hızlı büyüyen, kaliteli yavrusu olan ve et/yağ
oranı çok iyi bir ırktır. Bu çalışmanın amacı Şarole ırkı koyunların Şanlıurfa iklim yapısında
verim performansının ve adaptasyon kabiliyetinin tespit edilmesidir.
Bu çalışmada 8-12 aylık 40 baş Şarole ırkı koyun ve 4 baş koç kullanılacaktır. Koyunların
bakım ve beslenmeleri GAP Tarımsal Araştırma Enstitüsü, Tek Tek Araştırma İstasyonu’nda
gerçekleştirilecektir. Çalışma süresince koyunların dölverimi, büyüme performansı ve
yaşama gücü değerlendirilecektir.
Anahtar kelimeler: Şarole koyunu, Verim Performansı, Adaptasyon Kabiliyeti
Projenin Amacı ve Gerekçesi:
Hayvansal gıda tüketim kalemlerinde Avrupa Birliği ülkelerinin gerisinde olan
Türkiye’de, özellikle kırmızı ette bu fark daha da fazladır. 2009 yılında kişi başına kırmızı et
tüketimi Türkiye’de 12 kg iken Avrupa Birliğinde 19.7 kg olup, tüketimin 2009 yılında bir
önceki yıla göre gerileme gösterdiği bildirilmiştir42. Türkiye’de dünya ortalamasının
üzerinde et fiyatlarının oluşması, tüketimi azaltmakta ve aynı zamanda üretimin de pahalı
olduğunu göstermektedir. Et fiyatlarının azalması ancak birim hayvandaki üretim miktarının
artmasına bağlıdır.
Bu amaçla modern yetiştiriciliğin ve yüksek verimli kültür ırklarının yaygınlaşması
gerekmektedir. Sığırcılıkta büyük ölçüde entansif veya yarı entansif yetiştiricilik önem
kazanmış12 ve kültür ırkı hayvan oranında dikkate değer bir artış olmuştur. 2007 yılında
kültür ırkı hayvan sayısı 3.295.678 adet iken, 2012 yılında hayvan sayısı 5.679.484 adet
olarak belirtilmiştir. Ancak koyunculuk sektöründe hayvan sayısında görülen azalma ve
hayvan başına düşen verim miktarında iyileşme olmaması (kültür ırkı ve seleksiyon
çalışmalarında önemli bir artış olmaması) nedeniyle üretim miktarı ciddi anlamda düşmüştür.
1991 yılında kesilen hayvan sayısı 7.926.513 baş ve et üretim miktarı 128.626 ton iken 2012
yılında kesilen hayvan sayısı 4.541.122 başa ve et üretim miktarı da 97.334 tona düşmüştür.
41
Koyun eti üretiminin, Türkiye’de ki yıllık toplam kırmızı et üretimindeki payı 2001 yılında
% 19,66 iken 2012 yılında % 10,63’e gerilemiştir40.
Türkiye’de koyunculuk sektörü; şehirleşmenin artması, sosyal yapının değişmesi,
bölgesel güvenlik sorunları, mera alanlarının azalması, yem bitkilerinin artmaması, et
fiyatlarında meydana gelen dalgalanma ve çoban bulunamaması gibi nedenler ile son
yıllarda gerileme dönemine girmiştir. Örnek olarak Türkiye’de 1991 yılında toplam koyun
varlığımız 40.4 milyon iken bu sayı günümüzde 27 milyona düşmüştür. İyimser bir veri ise
aynı yıllar içerisinde kültür ırkı koyun sayısının 0.8 milyondan 1.5 milyona çıkmasıdır40.
Türkiye’de koyunculuk sektörünün gelişmesi için; yeni sosyal ve ekonomik şartlara uygun
bir üretim yapısının oluşturulması gerekmektedir. Yem bitkisi üretiminin yüksek olduğu ve
işgücünün bol olduğu bölgelerde, besi performansı yüksek kültür ırkı koyunların
yetiştirilmesi, gerilemekte olan koyunculuk sektörüne cazibeyi artırabilir. Güneydoğu
Anadolu bölgesinin bu amaca uygun olduğunu düşünmekteyiz. Ancak, öncelikle
yetiştiriciliği yapılacak ırkların denenmesi, ileride oluşabilecek sorunların azaltılması
bakımından önemlidir. Hayvanlarda, adaptasyon yeteneği fizyolojik ve morfolojik kriterlerle
ilgili bazı ölçütler belirlenerek ortaya konulmaktadır. Bu ölçütlerin en önemlileri; dölverimi,
yavruların yaşama gücü ve canlı ağırlıklarıdır13. Bu çalışma ile, dünyada üretimi yaygın
olarak yapılan ve besi performansı iyi olan Şarole ırkının entansif şartlarda Şanlıurfa iklim
yapısına adaptasyon kabiliyeti belirlenmiş olacaktır.
Proje ile Elde Edilmek İstenilen Çıktılar ve Kullanım Alanlarını Açıklanmalıdır.
Güneydoğu Anadolu Bölgesinde küçükbaş hayvancılık genel olarak düşük verimli yerli
ırklarla ekstansif yetiştiriciliğe dayanmaktadır. Bölgemizdeki mera varlıklarının yıllık kuru
ot miktarlarının düşük olması bakımından hayvanlara mevcut yetiştirme şartlarında 5-6 ay
süreyle ek besleme yapılmaktadır. Bahsedilen bu durum yetiştiriciliği yapılan yerli ırklarla
ekonomik ve karlı bir hayvancılığı mümkün kılmamaktadır. Bu bağlamda hayvancılıkla
uğraşan çiftçi gelirinin ve refahının yükseltilmesi, küçükbaş hayvancılıkta hayvan başına
düşen verim miktarının artırılması ve yüksek verimli ırkların yetiştirilmesi ile mümkün
olmaktadır. Yapılan bu çalışmayla;
- Şarole ırkının adaptasyon yetenekleri tespit edilecektir.
- Damızlık bir sürü oluşturulacaktır.
- Elde edilecek yüksek verimli, bölgeye adapte olmuş Şarole ırkı koyunlar yaygınlaştırılarak
bölge halkı tarafından sevilen ve tüketilen kuzu eti miktarı ve kalitesi arttırılacaktır.
- Hayvancılıkla uğraşan bölge çiftçisine alternatif bir koyun ırkı sunularak gelirlerinin ve
refah seviyesinin arttırılması sağlanacaktır.
- Adaptasyon süresince işletmede bulunan hayvanların her yıl düzenli olarak üretim-girdi
maliyetleri hesaplanarak, işletmenin karlılık oranı belirlenecektir ve bu sayede yetiştiricilere
yol gösterici olacağı düşünülmektedir.
- Oluşturulan sürü ile bölgedeki yerel ırkların ticari melezlemesinde erkek damızlıklar baba
hattı olarak kullanılabilecektir.
- Yapılacak olan araştırma sonucunda elde edilen veriler yeni çalışmalara öncülük edecek ve
bilimsel birikime katkı sağlayacaktır.
LİTERATÜR ÖZETİ
Türkiye'de koyun yetiştiriciliği ekstansif olarak yapılmaktadır. Ekstansif
yetiştiricilikte hayvanın birden fazla verim yönü dikkate alınmaktadır. Bu nedenle mevcut
yerli koyun ırklarımızın verimleri, koyunculuğu gelişmiş ülkelere göre daha azdır.
42
Türkiye'de ortalama kuzu ve koyun karkas ağırlığı 13 kg iken, koyunculuğu gelişmiş
ülkelerden olan Yeni Zelanda'da 16 kg, Almanya'da 19 kg ve Amerika Birleşik
Devletleri'nde ise 28 kg dır.1,12,30,35,43
Şarole koyun ırkının orijini Fransa’nın ünlü Şarole (Charollais) sığırlarının
yetiştirildiği bölge olan Saone et Loire’dır. Orta Fransa’da daha çok Charollais Morvan
Nivernais bölgelerinde yaygındır. 1825 yılında İngiltere’den getirtilen Leicester koçları ile
yerli Barrois ve Auxois koyunlarının melezlenmesi ile elde edilmiştir. 1. Dünya Savaşından
sonra Charolles bölgesine İngiliz Soutdown ırkı girmesine rağmen Şarole yetiştiricileri
koyun tiplerini saf olarak elde tutmuşlar ve diğer ırklarla melezlenmesine engel olmuşlardır.
İngiltere’ye ırk ilk defa 1976 yılında ithal edilmiş ve aynı zamanda pek çok Avrupa ülkesi,
Çin, Afrika, Kanada ve ABD’ ye götürülmüştür2.
Şarole koyunu ağır yapılı olup, uzun, derin ve iyi bir kas yapısına sahiptir. Baş tüysüz
pembemsi/kahverengi renkli ve bazen lekelidir. Kolay doğum için önemli olan arka but
hattı iyi yerleşmiştir. Bacaklar kısa, kusursuz, renkli fakat asla siyah renkli değildir. Yapağı
rengi beyaz, kalitesi iyi, kopma direnci yüksek ve kısa uzunluktadır17.
Şarole ırkı İngiltere’de koyunculuk sektörü içinde baba hattı olarak yaygın biçimde
kullanılmaktadır. İngiltere’de ticari kuzu eti üretimi için pazarın yaklaşık % 20’sini bu ırk
elinde tutmaktadır. Şarole koyununun kendine özgü hızlı büyüme özelliği, yağsız kasaplık
et ve bir örnek olması, kuzu eti üretimi için ırkı ideal bir baba hattı yapmaktadır. Bu ırk çok
güçlü analık özelliğine sahiptir ve kolay doğum ırkın önemli bir özelliğidir. Ergin
koyunların Aralık ayındaki kuzu verimi ortalama % 180’dir. Bu oran Şubat’ta % 210220’ye yükselir. Kuzular 7 aylık yaşta koça gelmekte ve bu yaşta kuzu verimleri % 130’un
üzerinde olmaktadır17.
Şarole ırkı koyunların dünyanın çeşitli bölgelerinde gerek melez gerekse saf
yetiştiriciliği yapılmaktadır. Bu ırkın tercih edilmesinin bir kaç sebebi vardır. Kısaca
bunlar;
· Erken olgunlaşma (kısa sürede 22-26 kg ideal karkas ağırlığına ulaşma)
· 50 kg canlı ağırlığa hızlı ulaşma
· Kolay doğum
· Dayanıklı yeni doğan yavru
· Uzun karkas yapısı ve büyük sırt (loin) eti
· Kaslı ve az yağlı karkas
· % 180 yavru oranı
· Aktive ve fertil koç6
Şarole ırkı koyunlarla ilgili yapılan çeşitli araştırmalarda bu ırkın döl veriminin
%170.08, % 171.15 ve % 175.4 oranlarında26,27,37, kuzu doğum ağırlığının 4.10 kg, 5.17 kg
ve 5.5 kg10,27,24, günlük canlı ağırlık artışının 198 gr, 221 gr, 267 gr ve 281 gr, 305
gr17,22,23,24,28, ortalama 120 günlük karkas veriminin % 67.21 ve % 68.823,24 olduğu
belirtilmiştir. İvesi ırkında ise kuzu doğum ağırlıkları 3.8-4.4 kg, günlük canlı ağırlık artışı
123-182.1 gr olarak belirtilmiştir38.
Koyunlarda seksüel siklus mevsimsel olup; fotoperiyot, feromen, melatonin gibi
değişik faktörlerin etkisiyle siklus başlar15,33. Şarole koyunlarının üreme mevsimi Batı
Avrupa’da Ekim-Kasım25,44 ayları olmakla birlikte Nisan-Mayıs aylarında da üreme
faaliyetleri yapılabilmektedir. Koyunlarda östrusta birden fazla foliküler dalga
oluşmaktadır. Östrus siklus süresi 16-17 gündür. Östrus süresi ise 24-36 saattir ve
ovulasyon östrus sonuna doğru gerçekleşir15. Östrus ve ilk iki gün progesteron hormonu 1
ng/ml’nin altında olup36 östrusta östrojen hormonu 19-36 pg/ml seviyesindedir20.
Güneydoğu Anadolu Bölgesinde yetiştiriciliği yapılan İvesi koyun ırkının üreme mevsimi
Haziranda başlar. Koyunculukta çiftleştirme mevsimi önemlidir, çünkü çiftleştirmelerin
43
erken olması, yavrunun erken doğmasını sağlar. Erken doğan yavrular soğuk ve yağışlı
havaya göre daha çok stres faktörü olan sıcak mevsimden daha az etkilenerek, daha hızlı
gelişim gösterebilirler.11
Türkiye’de koyun ıslah çalışmalarının, Cumhuriyet’in kuruluşu ile başladığı
söylenebilir. İlk çalışmalar, nitelikli yapağı üretmek amacıyla merinoslaştırma ile gündeme
gelmiştir. Daha sonraları ise, yerli ırkların kuzu, et ve süt verim yönünde ıslahı çalışmaları
yoğunluk kazanmıştır. Ancak bu çalışmalarda yerli koyun ırklarının seleksiyona yanıt
veremeyecek bir düzeyde olduğu yargısına varılmış, araştırmalarda melezleme
programlarına ağırlık verilmiştir. Melezleme çalışmalarında yapağı (Karacabey Merinosu,
Malya Koyunu, Anadolu Merinosu, Konya Merinosu), et-yapağı (Ramlıç, Menemen,
Hasmer, Hasak ) ve süt verim yönlü (Tahirova, Sönmez, Acıpayam, Türkgeldi, Bafra,
Çukurova, Çukurova Asaf) birçok yeni koyun tipleri oluşturulmuştur. Diğer yandan 1970’li
yılların başlarında etçi tip koyun oluşturmak amacıyla Texel x Kıvırcık melezlemesi
yapılmış, ancak Texel ırkı ve melezlerinin hastalıklara duyarlı olmasından dolayı çalışmalar
devam edememiştir. 1986 yılında yine ıslah amacıyla kültür ırkları (B. Leicester, Dorset
Down, Hampshire Down, Ile de France, Alman Siyah Başlı) ithal edilmiştir. Çeşitli yerli
ırklar bu etçi ırklarla melezlenmiş, ancak yeni tiplerin elde edilebilmesi için daha ileriki
düzeydeki melezlemeler ile tip sabitleştirilmesi etkinlikle yürütülememiştir. Ayrıca
Balıkesir’de bulunan Bandırma Koyunculuk Araştırma Enstitüsü’nde bu kültür ırkı
koyunlarla ilgili adaptasyon çalışması da yapılmıştır (Başpınar H. ve ark. 1991). Diğer
yandan, kasaplık kuzu üretimine yönelik araştırmalar da yapılmıştır. Bu amaçla yine bazı
yerli ırklarımız çeşitli etçi ırklarla (Ile de France, B. Leicester, Suffolk) melezlenmiştir. Son
yıllarda ise öne çıkan melezleme çalışmalarından birisi ise Romanov’a dayalı ıslah
çalışmalarıdır. Bu çalışmalarda Romanov koçları, İvesi, Morkaraman, Tuj, Akkaraman,
Kangal ve Kıvırcık koyunlarıyla melezlenmektedir.21,38
Türkiye'de koyunculukta ıslah çalışmaları daha çok devlet üretme çiftlikleri tarafından
yapılmıştır. Örnek adaptasyon çalışmaları ise araştırma boyutunda kalmıştır. Bunun nedeni
ise ülkenin ekonomik seviyesi ve özel girişimciliğin katkısının az olması olabilir. Ancak
Şarole ırkı koyunların yetiştiriciliğinin yaygınlaşması için Trakya bölgesinde özel sektör
kaynaklı işletmelerin kurulması, ırkın Türkiye’de gelişmesi için iyi bir potansiyel olarak
görülmektedir. Şanlıurfa bu açıdan yüksek potansiyele sahiptir. Bölgede koyun eti ve
sakatatlarına olan yoğun talep, yüksek yem bitkisi üretim potansiyeli, hayvancılığa verilen
yüksek devlet desteği ve bol işgücünün bulunması hayvancılığın gelişmesi açısından önemli
avantajları göstermektedir.
MATERYAL ve METOT:
Materyal
Bu araştırmanın materyalini 8-12 ay arası Şarole ırkı 40 baş koyun ve 4 baş koç
oluşturacaktır. Hayvanlar, Trakya bölgesinde Şarole ırkı koyun yetiştiriciliği yapılan özel bir
çiftlikten temin edilecektir.
Metot
Koyunların Tohumlanması ve Reprodüktif (dölverimi) Verilerin Alınması
Koyunların dölverim özelliklerinin belirlenmesi için kızgınlık (östrus) oranı, gebe
kalma (fertilite) oranı, kısırlık (infertilite) oranı, abort oranı, doğum oranı, bir doğumdaki
ortalama yavru sayısı, tek doğum oranı, ikiz doğum oranı, üçüz doğum oranı, kuzu verim
oranı, sütten kesilen yavru oranı, iki yavrulama arası süre ve doğum zorluğu hesaplanacaktır.
Bu çalışmada Şarole ırkı koyunlarda, mevsimsel etkinin değerlendirilmesi ve uygun üreme
mevsiminin seçimi için ilkbahar ve sonbaharda olmak üzere iki ayrı tohumlama zamanı
44
planlanmıştır. Fertilitenin artırılması için senkronizasyon öncesi koç etkisi ve flushingden
yararlanılacaktır. Senkronizasyonun iki farklı dönemde ve iki farklı grupta yapılması
dölverim kriterlerinde ve doğacak yavruların yaşama gücünde değişikliklere neden olacaktır.
Çalışma sonrası gerek fertilite ve gerekse yaşama gücü açısından karşılaştırma yapılarak
uygun üreme mevsimi seçilmiş olacaktır. Ayrıca hormonal kontroller yapılarak sonuçlar
daha etkin biçimde değerlendirilebilecektir.
Bu çalışmada koyunlar iki gruba ayrılacak ve ilk grup Nisan, ikinci grup ise Eylül
ayında tohumlanacaktır. Bu amaçla koyunların senkronizasyonundan en az 2 ay önce koçlar
sürüden uzaklaştırılacak, senkronizasyon başlangıç tarihinden bir ay önce flushing besleme
yapılacak ve 15 gün öncesi arama koçları katılarak östrus uyarılacaktır.5,41 Koyunların
östrusa gelmeleri ve östrusun toplulaştırılması için progesteron hormonu ile senkronizasyon
yapılacaktır. Bu amaçla; koyunlara 20 mg kronolon (flugeston asetat) içeren sünger
uygulanacaktır (sünger 12 gün uygulanacak, sünger çıkarıldıktan sonra 400 IU PMSG
yapılacak). Suni tohumlama işlemi sünger çıkarıldıktan 48 ve 65. saatlerde olmak üzere iki
kez yapılacaktır31,34. Koçlardan alınan sperma kontrol edilip, 300-400X106/ml spermatozoa
olacak şekilde Tris solüsyonu34 ile sulandırılacak ve 0.5 ml payetlere çekilip, servikal
yöntemle suni tohumlama yapılacaktır. Suni tohumlama sonrası gebe kalmayıp geri dönen
koyunlar günlük arama koçu kontrolleri ile tespit edilip yeniden aynı koçla tohumlanacaktır.
Koçların, spermatolojik özellikleri (miktar, motilite, anormal sperm oranı) tespit edilecektir.
Koyunlardan; koç katım öncesi, sünger uygulama sırasında, 1. ve 2. tohumlama
sırasında, tohumlama sonrası 7. günde kan alınacaktır. 10 ml’lik tüplere alınan kanlar, hemen
santrifüj edilerek serumları çıkartılacak ve analiz edilinceye kadar -20 0C’de saklanacaktır.
Alınan tüm kanlarda progesteron (P4) hormonu bakılacaktır. Estradiol-17β hormonu ise 1. ve
2. tohumlama sırasında alınan kanlardan bakılacaktır. Kanda hormon kontrolleri ilk yıl
uygulama için planlanmıştır. Progesteron ve Estradiol-17β testleri, ECLIA
(Electrochemiluminescence Immunoassay) metodu ile Roche E170 modüler cihazda hizmet
alım biçiminde yapılacaktır.
Büyüme ve Yaşama Gücünün Belirlenmesi
Her kuzunun doğum ağırlığı, doğum tarihi, cinsiyeti, doğum tipi, ana ve baba numarası
kaydedilecektir. İlk doğumdan 20 gün sonra tartımlar başlayacak, 15 gün aralıklarla 180.
güne kadar kuzuların ağırlıkları 100 g’a hassas kantarla belirlenecektir.
Şanlıurfa’ya getirilen Şarole koyunlarından elde edilecek kuzularda 90. güne kadar
yaşama gücü ve 180. güne kadar büyüme özellikleri tespit edilecektir.
Ayrıca anaçlarda ve kuzularda meydana gelen ölüm ve mecburi kesim nedenleri
araştırmada belirtilecektir. Araştırma süresince, barınağın sıcaklık ve nisbi nem oranları
kayıt edilerek sıcaklık-nem indeksi değerleri de belirlenecektir.
Canlı Ağırlık ve Vücut Ölçülerinin Alınması
Sıfat öncesi damızlık hayvanların canlı ağırlıkları 100 gr’a hassas kantarla tartılacaktır.
Doğan kuzular kuruduktan sonra 50 g’a hassas terazi ile tartılacak ve kulak küpesi
takılacaktır.
Anaç koyunların doğum, kırkım ve sıfat öncesi dönemde vücut ölçüleri alınacaktır.
Kuzularda ayda 1 olmak üzere 180. gün ve 1. yaş vücut ölçüleri tespit edilecektir. Vücut
ölçüleri olarak cidago yüksekliği, sağrı yüksekliği, vücut uzunluğu, göğüs çevresi, göğüs
genişliği, göğüs derinliği, baş uzunluğu ve alın genişliği ele alınacaktır. Cidago yüksekliği,
vücut uzunluğu, göğüs derinliği ve göğüs genişliği ölçü bastonu ile göğüs çevresi, baş
uzunluğu ve alın genişliği ise ölçü şeridi ile ölçülecektir2.
Kuzuların ve Anaçların Beslenmesi
Kuzular doğumu takiben 3 gün süreyle analarıyla birlikte bırakılacak ve kolostrumu
(ağız sütü) emmesi sağlanacaktır. Daha sonra analarından ayrılarak sabah ve akşam olmak
45
üzere günde iki kez emzirilecektir. İkinci haftadan itibaren kuru yonca ve kuzu büyütme
yemi verilmeye başlanacaktır. Kuzular 90 günlükken sütten kesileceklerdir. Sütten kesimden
sonra kuzu başına ortalama 250 g/gün kesif yem verilecektir.
Anaçlara ise günlük olarak canlı ağırlığın % 3’ü hesabıyla kaba ve konsantre yem
karışımı verilecektir.
Verilerin İstatistiksel Olarak Değerlendirilmesi
Kuzuların 30., 45., 60., 75., 90., 105., 120., 150. ve 180. gün ağırlıkları interpolasyon
yöntemiyle hesaplanacaktır. Kuzularda yaşama gücü, 30. ve 90. güne kadar yaşayan kuzu
sayısının canlı doğan kuzu sayısına oranı şeklinde hesaplanacaktır. Kuzularda büyüme ile
vücut ölçülerine etki eden yıl, cinsiyet, doğum tipi ve doğum ağırlığı gibi çevresel faktörler
en küçük kareler yöntemi ile incelenecektir. Hesaplamalarda herhangi bir çevre faktörü
içindeki etki paylarının toplamı sıfır olarak kabul edilecektir. Çevre faktörlerinin etkileri
variyans analizi ile yapılacak ve gruplar arası farklılık düzeyi Duncan testi ile tespit
edilecektir8. İstatistiki analizler SPSS 17 paket programında % 95 güven seviyesinde
yapılacaktır39.
Dölverimi kriterleri aşağıdaki gibi hesaplanacaktır.
Kızgınlık (östrus) oranı=Kızgınlık gösteren koyun sayısı / koç altı koyun sayısı
Gebe kalma (fertilite) oranı=Gebe kalan koyun sayısı/ koç altı koyun sayısı
Kısırlık oranı=Kısır kalan koyun sayısı / koç altı koyun sayısı
Abort oranı=Yavru atan koyun sayısı / gebe kalan koyun sayısı
Doğum oranı=Doğum yapan koyun sayısı / koç altı koyun sayısı
Bir doğumdaki ortalama yavru sayısı=Doğan yavru sayısı / doğuran koyun sayısı
Tek doğum oranı=Tek doğuran koyun sayısı / doğum yapan koyun sayısı
İkiz doğum oranı= İkiz doğuran koyun sayısı / doğum yapan koyun sayısı
Üçüz doğum oranı= Üçüz doğuran koyun sayısı/ doğum yapan koyun sayısı
Kuzu verim oranı= Doğan kuzu sayısı / koç altı koyun sayısı
Sütten kesilen yavru oranı=Sütten kesilen kuzu sayısı / koç altı koyun sayısı
İki kuzulama arası süre
Doğum zorluğu: Dişi hayvanlarda doğum 5’li bir puanlama cetveliyle gösterilir. 0=bilgi yok,
1=yardımsız ya da bir yardımcı, normal doğum, 2=iki veya daha fazla yardımcı,
3=operasyonsuz veteriner hekim müdahalesi, 4=sezeryan3.
46
ÇALIŞMA TAKVİMİ
Yapılacak
Faaliyetler
Alet ve
ekipmanların
temini ve
hazırlanması
Damızlık koç
ve koyunların
alınması
Damızlık
koçlardan
sperma alımı
Damızlık
koyunların
sıfat öncesi
tartımı
1. grup 20 baş
koyunun
tohumlanması
2. grup 20 baş
koyunun
tohumlanması
Doğum
kayıtlarının
tutulması
Kuzu
tartımlarının
yapılması,
vücut
ölçülerinin
alınması
Koyunlarda
vücut
ölçülerinin
alınması
İstatistiksel
analizlerin
yapılması,
sonuç
raporunun
hazırlanması
Aylar
1
2
X
X
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
X
X
X
X
X
X
X
33
34
35
36
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
47
YÖNETİM DÜZENİ
Adı Soyadı
Sevil ARSLAN
Reşit DEMİR
Esma PAYDAŞ
İrfan GÜNGÖR
Deha Ali DENİZ
Mehmet BADILLI
Mustafa Şeref ŞELLİ
Mahmut YÜKSEL
Oğuz
Yaşar
UZUNMEHMETOĞLU
Fatma
Pınar
KARADUMAN
Muhammed
Sami
BAYRAKTAR
Yrd. Doç. Dr. Ömer
VARIŞLI
Yrd. Doç.Dr. Durhasan
MUNDAN
Proje yürütücülerinin projeye katkıları
Yapılacak faaliyetlerdeki Sorumlulukları
Doğum kayıtlarının tutulması, kuzu
tartımlarının ve vücut ölçülerinin alınması,
koyunlarda vücut ölçülerinin alınması,
İstatistiksel analizlerin yapılması, sonuç
raporunun hazırlanması
Doğum kayıtlarının tutulması, kuzu
tartımlarının ve vücut ölçülerinin alınması,
koyunlarda vücut ölçülerinin alınması
Doğum kayıtlarının tutulması, kuzu
tartımlarının ve vücut ölçülerinin alınması,
koyunlarda vücut ölçülerinin alınması
Doğum kayıtlarının tutulması, kuzu
tartımlarının ve vücut ölçülerinin alınması,
vücut ölçülerinin alınması
Doğum kayıtlarının tutulması, kuzu
tartımlarının ve vücut ölçülerinin alınması,
koyunlarda vücut ölçülerinin alınması
Doğum kayıtlarının tutulması, kuzu
tartımlarının ve vücut ölçülerinin alınması,
koyunlarda vücut ölçülerinin alınması
İstatistiksel analizlerin yapılması, sonuç
raporunun hazırlanması
Doğum kayıtlarının tutulması, kuzu
tartımlarının ve vücut ölçülerinin alınması,
koyunlarda vücut ölçülerinin alınması
İstatistiksel analizlerin yapılması, sonuç
raporunun hazırlanması
İstatistiksel analizlerin yapılması, sonuç
raporunun hazırlanması
İstatistiksel analizlerin yapılması, sonuç
raporunun hazırlanması
Damızlık hayvanların seçimi ve alınması,
damızlık koçlardan sperma alımı, damızlık
dişilerin suni tohumlamaları, döl verimi
parametrelerinin
takibi,
istatistiksel
analizlerin yapılması, sonuç raporunun
hazırlanması
Damızlık hayvanların seçimi ve alınması,
doğum kayıtlarının tutulması, kuzu
tartımlarının ve vücut ölçülerinin alınması,
koyunlarda vücut ölçülerinin alınması,
istatistiksel analizlerin yapılması, sonuç
raporunun hazırlanması.
Çalışma Takvimi
01.01.2015/31.12.2017
01.01.2015/31.08.2017
01.01.2015/31.08.2017
01.01.2015/31.08.2017
01.01.2015/31.08.2017
01.01.2015/31.08.2017
01.09.2017/31.08.2017
01.01.2015/31.08.2017
01.09.2017/31.12.2017
01.09.2017/31.12.2017
01.01.2015/31.12.2017
01.01.2015/31.12.2017
01.01.2015/31.12.2017
Proje Sonuçları Uygulama Aktarımı
Proje Adı
Projenin
Amacı
Şanlıurfa İklim Koşullarında Şarole Irkı Koyunların Entansif Yetiştiricilikte Verim
Performansı ve Adaptasyon Kabiliyeti
Bu proje sayesinde elde edilecek yüksek verimli, bölgeye adapte olmuş Şarole ırkı
koyunlar yaygınlaştırılarak bölge halkı tarafından sevilen ve tüketilen kuzu eti miktarı ve
kalitesi arttırılacak, hayvancılıkla uğraşan bölge çiftçisine alternatif bir koyun ırkı
48
Sıra No
1
2
3
4
5
sunularak gelirlerinin ve refah seviyesinin arttırılması sağlanacaktır.
Proje Çıktıları
Uygulamaya Aktarılma mekanizmaları
Elde edilecek bilgiler değerlendirilerek söz konusu özellikleri
Şarole
ırkının içeren makale ile bilgiler tarım sektörü, ilgili kurum ve
Şanlıurfa
İline kuruluşlara kongre, sempozyum veya bildiri şeklinde
adaptasyon yetenekleri ulaştırılarak bilimsel bilgi birikimine katkılar sağlanacak ve yeni
tespit edilecektir.
çalışmalara öncülük edilecektir.
Proje sonunda elde edilen sürü, bölge yetiştiricisinin kasaplık
kuzu üretiminde baba hattı olarak kullanılabileceğinden, bu
yetiştiriciliğin devamlılığı için gereklidir. Elde edilecek bilgiler
Damızlık bir sürü değerlendirilerek söz konusu özellikleri içeren makale ile
oluşturulacaktır.
bilgiler tarım sektörü, ilgili kurum ve kuruluşlara kongre,
sempozyum veya bildiri şeklinde ulaştırılarak bilimsel bilgi
birikimine katkılar sağlanacak ve yeni çalışmalara öncülük
edilecektir.
Alternatif koyun ırkı
sayesinde
bölge Proje sonunda elde edilen koyunların bir kısmı uygun ücret
çiftçisinin
geliri karşılığında önder çiftçilere dağıtılarak halk elinde
arttırılacaktır.
yaygınlaştırılması sağlanacaktır.
Oluşturulan sürü ile
bölgedeki
yerli
koyunların
ticari
melezlemesinde erkek
damızlıklar baba hattı
olarak
kullanılabilecektir.
Bölgedeki et üretim
miktarının arttırılması
ve buna bağlı olarak
insan beslenmesinde
önemli bir protein
kaynağı olan etin
tüketiminin
kolaylaşması
sağlanacaktır.
Proje sonunda elde edilen damızlık koçlar yerli koyunlarla
melezlenerek kasaplık kuzu üretimi yapılabilecektir.
Birim hayvan başına düşen et üretim miktarının artmasıyla, kg
başına düşen maliyet azalacaktır. Buna bağlı olarak etin son
tüketici fiyatında azalma görülecek ve düşük gelirli ailelerin et
tüketimleri de arttırılabilecektir.
TALEP EDİLEN BÜTÇE
I. Yatırım Tutarı
06 SERMAYE GİDERLERİ
06.1- Mamul Mal Alımları
06.2- Menkul Sermaye Üretim Giderleri
06.3- Gayri Maddi Hak Alımları
06.4- Gayrimenkul Alımları ve Kamulaştırılması
06.5- Gayrimenkul Sermaye Üretim Giderleri
06.6- Menkul Malların Büyük Onarım Giderleri
06.7- Gayrimenkul Büyük Onarım Giderleri
06.8- Stok Alımları
06.9- Diğer Sermaye Giderleri
Toplam
Genel Toplam
1.Yıl
7.800
113.250
YILLARA GÖRE DAĞILIMI (TL)
2.Yıl
3 Yıl
500
1.500
33.000
37.000
5.000
18.000
20.000
5.000
19.000
5.000
20.000
5.500
169.550
2.000
59.500
2.000
65.500
294.550
49
II. Bütçe Gerekçesi ve Yatırım Tutarının Dağılımı
Ödenecek miktar
Ekonomik
kod
06
06
1
06
1
2
06
06
1
1
2
3
04
Sermaye Giderleri
Mamul Mal Alımları
Büro ve İşyeri Makine
Teçhizat Alımları
Laboratuar Cihazı Alımları
Avadanlık Alımları
1.yıl
2.yıl
3.yıl
7.800
500
1.500
500
500
3.850
3.850
3.950
06
1
3
04
Laboratuar Gereçleri alımları
3.450
06
1
3
05
Zirai Gereç Alımları
500
06
1
6
06
1
6
06
2
06
2
1
06
2
1
01
06
06
2
2
2
2
01
06
2
7
06
2
7
06
2
9
06
2
9
06
5
06
06
5
5
06
6
06
06
6
6
06
7
06
06
06
06
06
06
06
7
7
9
9
9
9
9
4
4
7
7
7
7
2
2
2
2
01
01
01
02
01
90
01
05
06
Mal ve hizmet alımının cinsi
miktarı vb özellikleri
Açıklama
Yayın Alımları ve Yapımları
Basılı Yayın Alımları ve
Yapımları
Menkul Sermaye Üretim
Giderleri
Müşavir Firma ve Kişilere
Ödemeler
Su Banyosu
500
500
1.000
1.000
113.250
33.000
Yayının çoğaltılması
37.000
3.750
100 adet estradiol ve 200 adet
progesteron
hormon
analizi
hizmet alımı.
Proje Giderleri
3.750
Hammadde Alımları
Hammadde Alımları
Kimyevi Madde İle Kauçuk
ve Plastik Ürün Alımları
Kimyevi Madde İle Kauçuk ve
Plastik Ürün Alımları
Diğer Alımlar
25.000
25.000
82.000
6.000
7.000
Diğer Alımlar
82.000
6.000
7.000
5.000
5.000
5.000
5.000
5.000
5.000
5.000
5.000
5.000
18.000
19.000
20.000
18.000
18.000
19.000
19.000
20.000
20.000
2.000
2.000
2.000
2.000
2.000
2.000
Gayrimenkul Sermaye
Üretim Giderleri
Enerji Giderleri
Akaryakıt ve Yağ Alımları
Menkul Malların Büyük
Onarım Giderleri
Müteahhitlik Giderleri
Müteahhitlik Giderleri
Gayrimenkul Büyük Onarım
Giderleri
Müteahhitlik Giderleri
Diğerleri
Diğer Sermaye Giderleri
Yolluk Giderleri
Yurtiçi Geçici Görev Yollukları
Yolluk Tazminatları
Arazi Tazminatları
Ölçü Bastonu, Ölçü Şeridi, Koç
Suni Vajen, Koç̧ Suni Vajen İçin
Külah, Koç̧ Suni Vajen İçin İç
Lastik 5'li, Koyu Spekulum,
Hafızalı
Termometre
ve
higrometre, Laboratuvar sarf
malzemesi( serum saklama tüpü,
vakumlu cam tüp, kan alma
iğnesi vb.)
Fırça,
Süpürge,
Temizlik
malzemeleri vs.
27.000
27.000
30.000
30.000
Hayvan Yemi Alımları
2.500
2.500
Laboratuvar Kimyasal Madde
Hayvan Alımı (4 Adet Damızlık
Koç(7.000), 40 Adet Damızlık
Koyun(70.000), Veteriner İlaç,
Aşı ve Tedavi Giderleri(5.000)
Akaryakıt ve yağ alımları
Hayvan Bakıcısı (çoban)
20.000
20.000
20.000
5.500
5.500
3.500
2.000
Ağıl bakım ve onarımı
TEKLİF ONAYI
Adı Soyadı
Tarih
İmza
50
Proje/Proje Alt Lideri
Öneren Kuruluş Müdürü
İşbirliği Yapılan Kuruluş Yetkilisi
Zeliha SAVRUNLU
İbrahim Halil ÇETİNER
Prof. Dr. Mehmet İRİADAM
DESTEK BAŞVURUSUNDA BULUNULAN PROJENİN
Akkaraman ve Orta Anadolu Merinosu Kuzularında Sütten
Kesim Dönemindeki Bazı Vücut Ölçülerinin Erken Seleksiyon
BAŞLIĞI
Kriteri Olarak Kullanılma İmkanının Araştırılması
ARAŞTIRMA FIRSAT
A 07 (Küçükbaş Hayvancılık)
ALANI
ARAŞTIRMA
P-01 (Islah ve Yetiştirme)
PROGRAMI
PROGRAM ÖNCELİĞİ Yüksek
PROJE ÖNERİSİ YAPAN KURULUŞUN
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
ADI
Ereğli yolu üzeri 1. Km. Karatay/KONYA
ADRESİ
PROJE / ALT PROJE LİDERİ
Şükrü DOĞAN
ADI SOYADI
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
KURUMU
0 505 858 39 65
TELEFONU
[email protected]
E-POSTA
PROJE / ALT PROJE YÜRÜTÜCÜLERİ
ADI SOYADI
KURUMU
Bahri Dağdaş Uluslararası
Şükrü DOĞAN
Tarımsal Araştırma Enstitüsü
Bahri Dağdaş Uluslararası
Uğur DEMİRCİ
Tarımsal Araştırma Enstitüsü
Bahri Dağdaş Uluslararası
Mesut KIRBAŞ
Tarımsal Araştırma Enstitüsü
Selçuk Üniversitesi Ziraat
Dr. İbrahim AYTEKİN
Fakültesi Zootekni Bölümü
Selçuk Üniversitesi Ziraat
Doç. Dr. İsmail KESKİN
Fakültesi Zootekni Bölümü
PROJE TOPLAM
BÜTÇESİ (TL)
118.000
PROJE BAŞLAMA
TARİHİ
(GÜN/AY/YIL)
01/01/2015
E-POSTA
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
PROJE BİTİŞ TARİHİ
(GÜN/AY/YIL)
31/12/2017
PROJE ÖZETİ
Proje; Akkaraman ve Orta Anadolu Merinosu kuzularının sütten kesim dönemindeki
bazı vücut ölçülerinin, kuzuların ilk kez damızlıkta kullanma çağına kadarki canlı
ağırlıklarına ve ilk kırkım yapağı verimine olan etkisini incelemek ve bu özelliklerin erken
seleksiyon kriteri olarak kullanılma olanaklarını araştırmak amacıyla hazırlanmıştır.
51
Bu amaçla, Enstitü bünyesinde yetiştiriciliği yapılan Akkaraman ve Orta Anadolu
Merinosu koyunlarından 2015 ve 2016 yıllarında doğan kuzular (ortalama doğum tarihinden
±5 gün içerinde doğan bütün kuzular) materyal olarak kullanılacaktır. Sütten kesim
döneminde (90. Gün) ve bu dönemi takip eden 6. 12. ve 18. aylarda kuzuların vücut ölçüleri
ile canlı ağırlıkları tespit edilerek veri setleri oluşturulacaktır. Elde edilen veri setleri
arasındaki ilişki çok değişkenli istatistik yöntemlerinden biri olan “Kanonik Korelasyon
Analizi” ile incelenecektir. Ayrıca kuzuların sütten kesim dönemindeki vücut ölçüleri ile 6,
9, 12, 15 ve 18. aylardaki canlı ağırlıkları ve ilk kırkım kirli yapağı verimi arasındaki ilişki
“Path Analizi” ve “Çoklu Regrasyon Analizi” kullanılarak incelenecektir. Yapılan
incelemelerden elde edilen veriler ışığında Akkaraman ve Orta Anadolu Merinosu
koyunlarının verim yönüne uygun olarak damızlık seçiminde kullanılacak erken seleksiyon
kriterleri tespit edilmeye çalışılacaktır.
Anahtar Kelimeler: Damızlık Seçimi, Seleksiyon, Kanonik Korelasyon, Vücut Ölçüleri
PROJENİN AMACI VE GEREKÇESİ:
Bu araştırmanın amacı; Akkaraman ve Orta Anadolu Merinosu kuzularının sütten
kesim dönemindeki bazı vücut ölçülerinin, kuzuların ilk kez damızlıkta kullanma çağına
kadarki canlı ağırlıklarına ve ilk kırkım yapağı verimine olan etkisini incelemek ve bu
özelliklerin erken seleksiyon kriteri olarak kullanılma imkanını araştırmaktır.
Damızlık seçiminde koyunların verim özellikleri, genetik yapı ve geçmişi ile ilgili
bilgiler yanında vücutta uyumluluk (tenasüp), vücut yapısı, konstitüsyon, deri ve kılların
durumu, renk, yaş gibi hususlar da önem taşır. Koyunlarda gerek verimlerinden gerekse
damızlık için yapılacak seleksiyonlarda; pedigri ve genetik yapı, verim kabiliyeti, fiziksel
özellikler üzerinde durulur. Vücut yapısı genel olarak incelenirken her zaman koyunun
yetiştirme durumu ve verim yönü göz önünde tutulmalıdır. Çünkü hayvan vücudunun çeşitli
dokularının ve organlarının gelişme durumu, hayvanın konstitüsyonunda kendini gösterir.
Koyunlar incelendiğinde, genelde yapağı, et ve süt olmak üzere üç verim tipi görülür. Bu
verim tiplerinde vücudun yapılışı ve dış görünüşü bakımından farklılıklar gösterülür.
(Akçapınar, 1994).
Hayvanların vücut ölçüleri onların morfolojik yapıları hakkında önemli bilgiler
vermektedir. Ayrıca vücut ölçüleri ile canlı ağırlık arasında önemli ilişkilerin olduğu
bilinmektedir (Çankaya ve ark., 2009). Belirli dönemlerde hayvanlardan alınan bu ölçüler
ırkların tanımlanmasında ve ayırımında kullanılabilmektedir. Bunun yanında, hayvanların
büyüme ve gelişmelerinin takibinde de vücut ölçüleri önemli bir yer tutmaktadır (Zülkadir
ve ark., 2008). Üzerinde durulan bu ölçülerin yetiştiriciye çok fazla bir yük getirmeden ve
kolaylıkla tespit edilen özellikler olması gerekir. Aksi takdirde bu ölçülerin ve verimlerin
hatta aralarındaki ilişkilerin dolaylı yöntemlerle tespit edilmesi gerekecektir. Canlı ağırlık
ile vücut ölçüleri arasındaki ilişkilerin tespitinde en çok kullanılan yöntemlerden biri de
çoklu regresyon denklemleridir (Çankaya ve ark., 2009).
Canlı ağırlık ve vücut ölçüleri arasındaki ilişkileri inceleyen bir çok araştırma
yapılmıştır (Şengonca ve Gücük, 1991; Öztürk ve ark., 1994; Boztepe ve Dağ, 1995; Fasae
ve ark., 2005). Bu araştırmalarda canlı ağırlık ile özellikle göğüs çevresi, cidago yüksekliği,
sağrı yüksekliği ve vücut uzunluğu arasında istatistik olarak önemli korelasyonlar tespit
edilmiş ve bunlara ait regresyon denklemleri geliştirilmiştir.
Ayrıca koyunların ergin canlı ağırlığının ve kirli yapağı veriminin tekrarlanma
derecesi yüksek bir değere sahiptir (sırasıyla 0.50-0.70 ve 0.50-0.80) ve bu değerin
tespitinde sadece ilk verim kayıtlarının dikkate alınması yeterlidir (Kaymakçı, 2013). Bunun
için koyunların ilk çiftleşme çağına kadar bekletilmesi ve bu döneme ait canlı ağırlık ve
yapağı veriminin tespit edilmesi ile seleksiyonun gerçekleşmesi gerekmektedir. Bu durum
52
yetiştirici ve ıslah çalışması yapan bilim insanları için kayıp zaman olarak tanımlanabilir.
Bu araştırma bu zamanı kısaltmayı ve en doğru damızlık seçimini gerçekleştirmek için
kullanılacak dolaylı seleksiyon kriterlerini ortaya koymayı amaçlamıştır.
Koyunlarda canlı ağırlığa bağlı olarak eşeysel etkinlik artmaktadır. Canlı ağırlık
artışına bağlı olarak kuzulama oranı ve doğumda kuzu sayısı yükselmektedir. Sakız
koyununda canlı ağırlık ile doğumda kuzu sayısı 24 kg da 1.61, 35-44 kg da 1.82, 45-54 kg
da 2.37 ve 54< kg da 2.83 olarak bildirilmiştir (Kaymakçı, 2013). Bundan dolayı koyunların
ergin canlı ağırlıklarının erken dönemde tahmin edilebilmesi emek ve zaman tasarrufunun
yanında kuzu üretiminde de bir artış sağlayacaktır.
Bu değerlendirmelerin ışığında; hayvan ıslahında asıl amaç ele alınan karakterlerin
ve bunları belirleyen ölçütlerin kolay, erken zamanda ve daha az gider karşılığında
belirlenmesidir. Üzerinde çalışılan özellikleri belirleyen ölçütler güç ve masraflı
yöntemlerle elde ediliyorsa bunun yerine dolaylı ölçütler üzerinde durulması her zaman
başvurulan bir yol olmuştur. Ortaya çıkmaları uzun zamana bağlı, belirlenmeleri zor,
masraflı hem de düşük düzeyde kalıtsallık gösteren karakterler üzerinde seleksiyon söz
konusu olduğunda bunlarla olumlu yönde ve yüksek düzeyde ilişkileri olan karakterlere
başvurulmaktadır. Hayvan ıslahında bu tür girişimler dolaylı seleksiyon adıyla bilinmekte
ve yaygın olarak kullanılmaktadır (Düzgüneş, 1976).
Özetlenecek olursa, vücut ölçüleri ile ilgili yapılan çalışmaların çoğunluğu ırk
özelliklerinin tanımlanması, melezleme çalışmalarında kullanılan ırk ile melezleri
arasındaki morfolojik özelliklerin kıyaslanması ve vücut ölçülerinden canlı ağırlığın tahmin
edilmesi amaçlarıyla gerçekleştirilmiştir. Ancak son zamanlarda yapılan çalışmalarda
(özellikle karkas çalışmalarında) görülmektedir ki; karkas özelliklerinin tahmininde vücut
ölçülerinden yararlanılabileceği ve bazı çalışmalarda ise vücut ölçülerinin erken seleksiyon
kriteri olarak kullanılabileceği bildirilmiştir. Bu durum, her birinde en az iki değişken
bulunan ve bu iki değişken veri seti arasındaki ilişkiyi inceleyen kanonik koreslasyon
analizi gibi metotların daha yaygın olarak kullanılması ile sağlanabilmiştir. Çok değişkenli
istatistik tekniklerinden birisi olan kanonik korelasyon analizi dolaylı seleksiyona temel
oluşturabilecek bilgiler sağlamaktadır.
Bu proje ile Akkaraman ve Orta Anadolu Merinosu koyunlarında sık olarak
incelenmesine rağmen seleksiyon kriteri olarak değerlendirilmeyen vücut ölçülerinin erken
seleksiyon kriteri olarak kullanılma imkanı araştırılacaktır.
PROJE İLE ELDE EDİLMEK İSTENİLEN ÇIKTILAR VE KULLANIM ALANLARI
Bu çalışma sonucu elde edilen veriler halk elinde uygulanan ıslah projeleri için kriter
oluşturabilecektir.
Canlı ağırlık ve yapağı verimi bakımından verimi yüksek genotiplerin sürülerdeki
nispi miktarını artıracak seleksiyon kriterleri ortaya konacaktır. Dolaylı olarak doğum oranı
ve kuzu verimi artırılabilecektir.
Akkaraman ve Orta Anadolu Merinosu koyunlarında her genotip için ayrı olmak
üzere damızlık seçiminde kullanılacak kriterler belirlenmiş olacak, diğer ırklar üzerinde
çalışma yapmak isteyen araştırmacılar için örnek oluşturacaktır.
Vücut ölçülerinin büyümenin çeşitli dönemlerindeki etkisi ortaya konmuş olacaktır.
Kuzuların çeşitli dönemlerde ölçülecek olan canlı ağırlıklar bakımından damızlık
değerler ile genotipik ve fenotipik ilişkiler Hayvan Modeli (Animal Model) esas alınarak
tahmin edilecek ve vücut ölçüleri ile arasındaki ilişkiler incelenmiş olacaktır.
LİTERATÜR ÖZETİ:
Esen ve Yıldız (2000) Akkaraman ve Sakız x Akkaraman (F1) melezi kuzuların
53
büyüme, yaşama gücü ve vücut ölçülerinin araştırılması amacıyla yaptıkları çalışmada, Saf
ve melez kuzularda sırasıyla ortalama doğum ağırlığı 3.73 ve 3.78 kg, sütten kesim ağırlığı
20.23 ve 19.03 kg, doğumdan itibaren sütten kesime kadar günlük canlı ağırlık artışı 157 ve
145 g ve sütten kesimdeki (105 günlük yaş) yaşama gücü % 68.96 ve 78.57 olarak tespit
etmişlerdir. Ayrıca araştırmacılar kuzuların 6 aylık yaştaki önemli vücut ölçülerinden
cidago yüksekliği, sağrı yüksekliği, sırt yüksekliği, vücut uzunluğu, göğüs genişliği, göğüs
derinliği, göğüs çevresini Akkaraman kuzularında (n=8) aynı sıra ile 58.37, 57.12, 57.62,
56.25, 21.25, 27.12, 74.50 cm, Sakız x Akkaraman (F1) melezi kuzular için (n=9) aynı sıra
ile 59.66, 59.44, 59.55, 54.70, 20.11, 26.55, 74.88 cm olduğunu bildirmişlerdir.
Esen ve Özbey (2001) Sakız x Akkaraman melez (F1) ve Sakız x F1 melez (G1)
kuzuların büyüme, yaşama gücü ve vücut ölçülerinin araştırılması amacıyla yaptıkları
çalışmada, üç aylık yaştaki dişi kuzuların cidago yüksekliği, sağrı yüksekliği, sırt
yüksekliği, vücut uzunluğu, göğüs genişliği, göğüs derinliği ve göğüs çevresini F1 dişi
kuzuları için (n=9) sırasıyla 53.77, 54.77, 53.76, 54.55, 16.55, 25.25, 70.11 cm, G1 dişi
kuzuları için (n=12) sırasıyla 52.16, 53.91, 50.58, 51.41, 14.75, 23.50, 72.50 cm, F1 dişi
kuzuların 6 aylık vücut ölçülerini aynı sırayla 58.75, 58.50, 58.37, 54.75, 19.87, 26.12,
74.87 cm, G1 dişi kuzuların 6 aylık vücut ölçülerinin aynı sırayla 58.41, 58.50, 58.66,
52.50, 17.75, 26.16, 76.50 cm olduğunu bildirmişlerdir.
Akçapınar ve ark (2001) Akkaraman, Sakız x Akkaraman F1 (SAF1) ve Kıvırcık x
Akkaraman F1 (KAF1) kuzularda bazı vücut ölçüleri, bu ölçülerle canlı ağırlık arasındaki
fenotipikkorrelasyonlar; SAF1 ve KAF1 dişi toklularda canlı ağırlık, kirli yapağı verimi ve
özelliklerinin incelenmesi amacıyla yaptıkları çalışmada; Akkaraman, SAF1 ve KAF1
kuzularda sütten kesimde (90. gün) sırasıyla düzeltilmiş ortalama cidago yüksekliği 52.13,
52.34 ve 50.47 cm; vücut uzunluğu 50.56, 51.44 ve 51.19 cm; göğüs çevresi 64.84, 64.76 ve
64.80 cm; göğüs derinliği 23.67, 23.89 ve 23.32 cm ve incik çevresi 7.01, 7.00 ve 6.83 cm
olduğunu, SAF1 ve KAF1 dişi toklularda kırkım sonu ve çiftleşme öncesi canlı ağırlık ile
kirli yapağı verimini ise sırasıyla 47.36 ve 48.69 kg; 55.83 ve 55.62 kg; 2.42 ve 2.30 kg
olarak tespit etmişlerdir.
Ünal (2002) Akkaraman ve Sakız x Akkaraman F1 kuzuların 90. güne kadar yaşama
gücü, 180. güne kadar bazı vücut ölçüleri ve bir yaşına kadar büyüme kabiliyetini incelediği
çalışmada; kuzularda doğum, sütten kesim, 180. gün ve bir yaş düzeltilmiş ortalama canlı
ağırlıkları aynı genotip sırasıyla 4,39 ve 4,32 kg; 26,38 ve 25,48 kg; 36,55 ve 35,47 kg;
49,90 ve 49,10 kg olduğu, kuzularda sütten kesimde cidago yüksekliği, vücut uzunluğu,
göğüs çevresi, göğüs derinliği, incik çevresi, kuyruk genişliği, kuyruk uzunluğu ve kuyruk
çevresi ölçülerine ait düzeltilmiş ortalama değerlerini aynı genotip sırasıyla 54,81 ve 55,52
cm; 53,61 ve 54,43 cm; 69,65 ve 68,27 cm; 24,53 ve 24,91 cm; 7,18 ve 7,11 cm; 21.54 ve
14.93 cm; 21.50 ve 24.14 cm; 44,22 ve 32,83 cm olduğunu bildirmiştir.
Ünal (2002) Akkaraman ve Akkaraman x Sakız (F1) kuzularında yaptığı bir
çalışmada Akkaraman kuzularının doğum, sütten kesim, 180. gün ve bir yaş canlı
ağırlıklarının sırasıyla 4.39, 26.38, 36.55 ve 49.90 kg olduğunu, kuzuların sütten kesimde
(90.gün) cidago yüksekliği, vücut uzunluğu, göğüs çevresi, göğüs derinliği, incik çevresi;
kuyruk ölçüleri olarak kuyruk genişliği, uzunluğu ve çevresi ölçülerine ait düzeltilmiş
ortalama değerlerini ise sırasıyla 54.81, 53.61, 69.65, 24.53, 7.18, 21.54, 21.50 ve 44.22 cm
olduğunu bildirmiştir.
Yıldız ve Denk (2006) halk elinde yetiştirilen Akkaraman koyunların kirli yapağı
verimleri, lüle uzunlukları, beden ölçüleri, kuzuların doğum ağırlıkları ve yaşama güçlerinin
tespit edilmesi amacıyla yaptıkları çalışmada kirli yapağı verimi 1.81 kg, cidago yüksekliği
60.96 cm, sırt yüksekliği 60.20 cm, sağrı yüksekliği 61.60 cm, beden uzunluğu 59.89 cm,
göğüs derinliği 28.11cm, göğüs genişliği 20.45 cm, göğüs çevresi 80.08 cm ve ön incik
54
çevresi 8.46 cm olduğunu bildirmişlerdir.
Şireli ve Ertuğrul (2005)’un Bala Tarım İşletmesinde yetiştirilen Akkaraman, GD1 x
GD1 (Dorset Down x Akkaraman) ve Akkaraman x GD1 kuzularının, doğumdan itibaren 6
aylık yaşa kadar olan dönemde; canlı ağırlık, cidago yüksekliği, göğüs derinliği, göğüs
çevresi ve vücut uzunluğu özelliklerine ilişkin tekrarlanma derecelerinin tahmin edilmesi ve
söz konusu parametrelerin erken seleksiyon kriteri olarak kullanılıp kullanılmayacağının
tespiti amacıyla yaptıkları çalışmada, canlı ağırlık, cidago yüksekliği, vücut uzunluğu,
göğüs derinliği ve göğüs çevresi özellikleri için tekrarlanma dereceleri sırası ile GD1 x GD1
kuzularında; 0.59±0.04, 0.39±0.04, 0.50±0.04, 0.46 ±0.04ve 0.45±0.04, Akkaraman
kuzularında; 0.53±0.03, 0.38±0.03, 0.44±0.03, 0.30±0.03 ve 0.39±0.03, Ak x GD1
kuzularında ise yine aynı sıra ile 0.56±0.04, 0.31±0.04, 0.33±0.04, 0.57±0.03 ve 0.37±0.04
olarak hesaplamışlardır. Ağırlık için hesaplanan tekrarlanma derecesinin, vücut ölçüleri için
hesaplanan tekrarlanma derecelerine göre daha yüksek olması, ağırlık için yapılacak bir
erken seleksiyonun oldukça isabetli olabileceğini, bu yargının vücut ölçülerine ilişkin,
yüksek tekrarlanma derecelerine sahip olan genotipler için de söz konusu olabileceğini
bildirmişlerdir.
Öztürk ve ark (1994)’ları Konya Merinoslarında canlı ağırlıkla bazı vücut ölçüleri
arasındaki ilişkileri araştırmış ve vücut ölçüleri arasındaki korelasyon katsayılarını, canlı
ağırlığın vücut ölçülerine regresyon ve kısmi regresyon katsayılarını hesaplamışlardır. Canlı
ağırlık ve incelenen vücut ölçüleri arasındaki korelasyon katsayılarını önemli bulmuşlardır
(P<0.01). Canlı ağırlığın tahmininde, göğüs çevresi ölçüsünün en uygun ölçüt olacağını
bildirmişlerdir.
Gürcan ve Akçapınar (2002) Alman Et ve Karacabey Merinosu koyunları canlı
ağırlıkları, vücut ölçüleri ve yapağı inceliği yönünden kümeleme analizi ile incelenmesi
amacıyla yaptıkları çalışmada Karacabey Merinosu’nun, atası olan Alman Et Merinosu
özelliklerine sahip olduğunu, iki genotip arasında vücut ölçüleri bakımından önemli bir
farkın bulunmadığını, Karacabey Merinosu’nun elde edildiği yıllardan bu yana Türkiye
şartlarına adapte olarak geliştiğini ve saf Alman Et Merinosu özelliğini gösterdiğini
bildirmişlerdir.
Akçapınar H (1983) Alman Et Merinosu ve Karacabey Merinoslarının canlı ağırlık,
beden yapısı ve yapağı verimi yönünden karşılaştırılması amacıyla yapmış olduğu
çalışmada ortalama canlı ağırlık Alman Et Merinoslarında 50.18 kg ve Karacabey
Merinoslarında 51.39 kg olduğunu, önemli beden ölçülerinden cidago yüksekliği, göğüs
çevresi ve sırt uzunluğu için ortalama değerlerin Alman Et Merinoslarında sırası ile 67.94,
94.02 ve 67.50 cm, Karacabey Merinoslarında ise 68.35, 94.43 ve 67.69 cm olduğunu,
ortalama yapağı verimi ise aynı sıra ile 3.20 ve 3.00 kg olarak bildirmiştir.
Batu ve ark (1966) Karacabey Harası Türk merinos sürüsünde yapağı verimi, bazı
yapağı özellikleri, canlı ağırlık, beden ölçüleri ve döl verimine ait hususların tesbit edilmesi
amacı yaptıkları çalışmada 1, 2 ile 3 yaş ve üzeri koyunların verim özelliklerini
incelemişlerdir. Koyunların canlı ağırlıklarını aynı yaş sırasıyla 52.4, 51.0 ve 46.7 kg
olduğunu, 1 yaşlı koyunların vücut uzunluğu, cidago yüksekliği, göğüs çevresi ve ön incik
çevresini sırasıyla 67.7, 67.9, 102.7 ve 5.8 cm olduğunu, 2 yaşlı koyunları vücut ölçülerini
aynı sıra ile 74.2, 68.9, 110.3 ve 6.0 cm olduğunu, 3 yaş ve üzeri koyunları vücut ölçülerini
ise aynı sıra ile 73.3, 69.2, 106.2 ve 5.8 cm olarak tespit etmişlerdir.
Tellioğlu ve Sabas (1976) dişi Morkaraman koyunlarında yaptıkları çalışmada
koyunların ortalama canlı ağırlığı, cidago yüksekliği, sağrı yüksekliği, vücut uzunluğu,
göğüs genişliği, göğüs derinliği ve göğüs çevresini sırasıyla 52.83 kg, 70.23, 69.79, 64.59,
18.94, 31.51 ve 91.27 cm olarak bildirmiştir.
Özbey ve Akcan (2003) Morkaraman, Sakız x Morkaraman (F1) ve Kıvırcık x
55
Morkaraman (F1) melezi kuzuların büyüme, yaşama gücü ve vücut ölçülerinin araştırılması
amacıyla yaptıkları çalışmada kuzularda sırasıyla ortalama doğum ağırlığı 3.25, 3.25 ve
3.26 kg; sütten kesim (105. Gün) ağırlığı 17.71, 17.71 ve 17.69 kg olarak tespit etmişlerdir.
Aynı genotip sırasıyla 12. aydaki cidago yüksekliği 62.03, 66.40 ve 62.19 cm; sağrı
yüksekliği 63.24, 66.96 ve 63.14 cm; sırt yüksekliği 62.46, 66.30 ve 62.52 cm; vücut
uzunluğu 59.19, 67.49 ve 64.11 cm; göğüs genişliği 18.61, 23.83 ve 24.97 cm; göğüs
derinliği 26.99, 28.52 ve 27.27 cm; göğüs çevresi 81.67, 84.56 ve 92.59 cm; bacak uzunluğu
34.38, 37.88 ve 35.00 cm olarak bildirmişlerdir.
Koncagül ve ark (2012) Zom koyunlarının tanımlanması amacıyla yaptıkları
çalışmada koç ve koyunlarda sırasıyla canlı ağırlık 65.0 ve 46.0 kg, cidago yüksekliği 76.2
ve 67.9 cm, sağrı yüksekliği 75.5 ve 67.9 cm, vücut uzunluğu 66.1 ve 60.2 cm, göğüs
çevresi 99.8 ve 94.7 cm, göğüs derinliği 34.4 ve 29.9 cm, göğüs genişliği 21.1 ve 18.2 cm
olarak tespit etmişlerdir. Zom koyunlarının morfolojik özellikler bakımından Karakaş, İvesi
ve Akkaraman koyunlarıyla benzerlik gösterdiği bildirmişlerdir.
Arık ve ark (2002)Ile de France x Anadolu Merinosu (IFxAM) ve Ile de France x
Akkaraman (IFxAK) melezi (F1) koyunlar ilk kırkım canlı ağırlığı ve kirli gömlek ağırlığı
bakımından Anadolu Merinosu (AM) ve Akkaraman (AK) ırklarıyla karşılaştırmıştır. 1.5
yaşlı AM, AK, IFxAM (F1) ve IFxAK (F1) genotip gruplarında sırasıyla ilk kırkım canlı
ağırlığı 52.08, 53.98, 51.41 ve 52.48 kg; kirli gömlek ağırlığı ise 2.87, 2.14, 3.22 ve 3.25 kg
olarak bildirmişlerdir.
Karabacak ve ark (2010)’ları Akkaraman kuzularda besi başı vücut ölçüleriyle soğuk
karkas ağırlığı arasındaki doğrudan ve dolaylı ilişkileri path analizi yöntemiyle belirlemeye
çalıştıkları çalışmada, Akkaraman kuzularına ait soğuk karkas ağırlığına en fazla etki eden
faktörlerin cidago yüksekliği, göğüs çevresi ve vücut uzunluğu olduğunu belirlemişler ve
erken dönemde göğüs çevresi ve cidago yüksekliği fazla olan hayvanların besiye alınması
ile hayvanların yüksek soğuk karkas ağırlığına sahip olabileceklerini bildirmişlerdir.
Karabacak ve ark. (2009)’ı beş farklı koyun ırkında (Akkaraman, Dağlıç, Kıvırcık,
Malya ve Karacabey Merinosu) besi başı vücut ölçüleri ile soğuk karkas ağırlığı arasındaki
ilişkileri path analizi ile araştırmıştır. Çalışma sonunda canlı ağırlık, vücut uzunluğu ve
göğüs derinliğinin et üretimi amacıyla yapılacak bir seleksiyonda dolaylı seleksiyon kriteri
olarak kullanılabileceğini ve aynı zamanda karlı bir besicilik için bu özellikler bakımından
yüksek değere sahip kuzuların tercih edilmesi gerektiğini bildirmişlerdir.
Karabacak ve ark (2011)’ları Akkaraman kuzularında besi başında tespit edilen canlı
ağırlık ve vücut ölçüleri ile besi sonunda tespit edilen kesim, sıcak ve soğuk karkas
ağırlıkları arasındaki ilişkinin regresyon analizi yöntemi ile belirlemeye çalıştıkları
çalışmada, yükseklik ve çevre ölçülerinin bağımsız değişken olarak alınması ile belirleme
katsayılarının yükseldiğini, tüm vücut ölçülerinin birlikte bağımsız değişken olarak
kullanılmasıyla da kesim ağırlığının belirlenmesindeki etkisinin % 85.5 olduğunu
bildirmişlerdir. Ayrıca araştırmacılar, besi başında yetiştiriciye çok fazla bir yük getirmeden
ve kolaylıkla tespit edilen özelliklerden olan vücut ölçülerinin alınması kesim ağırlığı veya
soğuk karkas ağırlığının arttırılmasına önemli katkı sağlayabileceğini bildirmişlerdir.
Keskin ve ark (2005)’ları Anadolu Merinosu erkek kuzularının besi başındaki vücut
ölçüleri (cidago yüksekliği (X1), göğüs çevresi (X2), göğüs derinliği (X3), vücut uzunluğu
(X4), but çevresi (X5) ve canlı ağırlık (X6)) ile besi sonunda tespit edilen sıcak karkas
ağırlığı (Y) arasındaki doğrudan ve dolaylı ilişkileri pathanailizi ile incelemişler ve canlı
ağırlık, vücut uzunluğu ve göğüs derinliğinin et üretimi amacıyla yapılacak bir seleksiyonda
dolaylı seleksiyon kriteri olarak kullanılabileceğini bildirmişlerdir.
Ünal ve Akçapınar (2001) Orta Anadolu Merinoslarında önemli verim özelliklerinin
düzeylerinin belirlenmesi, bazı çevre faktörlerinin bu özellikler üzerindeki etkilerinin
56
incelenmesi, bazı verim özelliklerine ait fenotipik ve genetik parametrelerin hesaplanması,
seleksiyon indeksi denkleminin kurulması ve böylece verimlerin seleksiyonla geliştirilmesi
imkanlarının ortaya konması amacıyla yaptıkları çalışmada; kuzularda doğum, sütten kesim
ve 180. gün düzeltilmiş ortalama canlı ağırlıkları sırasıyla 4.65, 24.51 ve 37.10 kg
bulunmuştur. Kırkım sonu canlı ağırlığı, kirli yapağı verimi ortalama değerleri toklularda ve
koyunlarda sırasıyla 48.98 ve 60.05 kg, 3.79 ve 3.35 kg olarak tespit etmişlerdir. Orta
Anadolu Merinosu döl verimi, kuzularda büyüme ve koyunlarda yapağı özellikleri
bakımından Türkiye’de ve diğer ülkelerde yetiştirilen et merinoslarına benzer veya daha
yüksek, kuzularda yaşama gücü bakımından ise biraz daha düşük değerler gösterdiği, döl
verimi ve kuzularda büyüme kabiliyetinin iyi olması nedeniyle bu ırkın, kuzu eti üretiminin
artırılması yönünde kullanılabileceğini bildirmişlerdir.
Şahin ve ark (2011)’ları Karacabey Merinoslarının sütten kesim dönemi ile 6 aylık
yaştaki vücut ölçüleri arasındaki ilişkiyi kanonik korelasyon analizi ile inceledikleri
çalışmada, sütten kesim döneminde ölçülen göğüs çevresi ve canlı ağırlığın genetik
iyileştirme için erken seleksiyon kriteri olarak kullanılabileceğini bildirmişlerdir.
Çankaya ve ark (2009) 57 baş Karayaka erkek tokludan kesim öncesi almış oldukları
6 farklı morfolojik özellik (X kümesi – canlı ağırlık, göğüs çevresi, göğüs derinliği, vücut
uzunluğu, but çevresi ve cidago yüksekliği) ile 5 farklı karkas özelliği (Y kümesi – sıcak
karkas, bas, deri, but ve kol ağırlıkları) arasındaki ilişkiyi ortaya koymak amacıyla kanonik
korelasyon analizi uygulamışlar ve elde edilen veriler ışığında Karayaka toklu besiciliğinde
birim hayvandan sağlanan karkas verimini arttırmak için kesim öncesi dönemdeki canlı
ağırlık ve göğüs çevresi ölçümlerinden yararlanılması gerektiğini bildirmişlerdir.
Çankaya ve ark (2009)’ı Karayaka toklularının sütten kesim veya altı aylık yaş ile 12
aylık yaştaki morfolojik özellikler arasındaki ilişkilerin kanonik korelasyon analizi ile
belirlenmesi ve ilişkinin açıklanmasında etkili olan vücut ölçülerine göre seleksiyon
yapılması besi performansına yönelik araştırma ve ıslah uygulamalarında hem
generasyonlar arası sürenin kısaltılmasına hem de ekonomik kazancın artmasına yardımcı
olacağını bildirmişlerdir.
Tahtalı ve ark (2012)’ları Karayaka kuzularından doğumda ölçtükleri 6 farklı
morfolojik özellik ile (X veri seti- doğum ağırlığı, vücut uzunluğu, cidago yüksekliği, göğüs
derinliği, göğüs genişliği ve göğüs çevresi) sütten kesim döneminde ölçtükleri morfolojik
özellikler (Y veri seti – sütten kesim ağırlığı, vücut uzunluğu, cidago yüksekliği, göğüs
derinliği, göğüs genişliği ve göğüs çevresi) arasındaki ilişkiyi kanonik korelasyon analizi
tahmin etmişler ve doğumda ölçülen cidago yüksekliği, doğum ağırlığı ve göğüs çevresinin,
Karayaka kuzularının ıslah çalışmalarında erken seleksiyon kriteri olarak kullanılabileceğini
bildirmişlerdir.
Bilgin ve Esenbuğa (2009) Morkaraman erkek kuzularından aldıkları 10 adet vücut
ölçüsü ve 11 adet karkas parça ağırlığı arasındaki ilişkiyi incelenmişlerdir. Kanonik
ağırlıklar, kanonik yükler ve çapraz yükler incelenerek, kanonik varyetelerin anlamları
orjinal değişkenler cinsinden yorumlamaya çalışmışlardır. İlk kanonik varyete çifti
arasındaki kanonik korelasyon 0.991 olarak belirlemişlerdir. Bu ilişkinin yüksek olması ile
söz konusu hayvanların vücut ölçümlerine bağlı olarak, karkas parça ağırlıklarını
tahminlemedeki isabet derecesinin de yüksek olacağını bildirmişlerdir. Ayrıca
araştırmacılar, Morkaraman erkek kuzularının karkas özelliklerinin aralarındaki yüksek
kanonik korelasyondan dolayı vücut ölçülerinden tahmin edilebileceğini ortaya koymuştur.
Bu sonuca göre, daha az masrafla daha erken yaşlarda belirlenebilen vücut ölçümlerinin
karkas ağırlıkları için dolaylı seleksiyon kriteri olarak kullanılmasının yararlı olacağını,
ancak gelecekte yapılacak çalışmalarda değişken sayısı ve örnek büyüklüğü arasındaki
dengenin sağlanması ile çok daha güvenilir sonuçların elde edilebileceğini bildirmişlerdir.
57
Keskin ve ark (2005) 6 aylık yaştaki Akkeçi oğlaklarının, kesim öncesi ve kesim
sonrası ölçülen bazı özellikleri arasındaki ilişki yapısını kanonik korelasyon analizi ile
incelemişler ve kesim öncesinde tespit edilen; kesim ağırlığı, cidago yüksekliği, vücut
uzunluğu, göğüs derinliği, kürekler arkası göğüs genişliği, göğüs çevresi ve but çevresi
olmak üzere 7 adet özelliği X değişken seti; baş ağırlığı, ayak ağırlığı, post ağırlığı, iç yağ
ağırlığı, takım ağırlığı, dalak ağırlığı, sıcak karkas ağırlığı ve soğuk karkas ağırlığı olmak
üzere 8 adet özelliği de Y değişken seti olarak almışlar ve birinci kanonik değişken çifti
arasında hesaplanan kanonik korelasyonun 0. 962 olduğunu (p< 0.01) bildirmişlerdir.
Barıtçı ve Eliçin (2002)’in Kilis keçisi oğlaklarının doğum, 3 ve 6 aylık yaştaki vücut
ölçüleri arasındaki ilişkileri kanonik korelasyon analizi ile inceledikleri çalışmada, doğum
dönemindeki yükseklik ve çevre setleri ile üç aylık dönem için bütün vücut ölçülerinde,
setler arası korelasyonun büyük olmasından dolayı, üç aylık verileri doğum değerlerinden
ve altı aylık değerleri ise üç aylık verilerden yararlanarak seleksiyon yapılmasını
önermişlerdir.
Çankaya ve Kayaalp (2007) Alman Alaca x Kıl melezi oğlaklarından ölçülen 8 farklı
morfolojik özellik (X değişken kümesi – cidago yüksekliği, vücut uzunluğu, göğüs
genişliği, göğüs çevresi, göğüs derinliği, ön, orta ve arka sağrı genişliği) ile üç farklı
dönemde alınan canlı ağırlıklar (Y değişken kümesi – oğlağın doğum ağırlığı, sütten kesim
ağırlığı ve altıncı ay ağırlığı) arasındaki ilişkiyi tahmin etmek için kanonik korelasyon
analizi uygulamışlar ve birinci kanonik değişken çift arasında, tahmin edilen kanonik
korelasyon katsayısının, (0.931) önemli olduğunu (P<0.01) bildirmişlerdir. Ayrıca
araştırmacılar, sütten kesim döneminde ölçülen göğüs derinliği ve göğüs çevresinin, Alman
Alaca x Kıl melezi keçilerinin canlı ağırlıklarını artırmak için erken seleksiyon kriteri olarak
kullanılabileceğini bildirmiştir.
Keskin (2012) Malta keçilerine ait vücut ölçüleri (cidago yüksekliği, sağrı yüksekliği,
göğüs çevresi, göğüs derinliği, vücut uzunluğu ve canlı ağırlık) ile laktasyon süt verimi
arasındaki doğrudan ve dolaylı ilişkileri path analizi ile incelemiş ve cidago yüksekliği,
sağrı yüksekliği ve canlı ağırlığın laktasyon süt verimi için yapılacak bir seleksiyonda
dolaylı seleksiyon kriteri olarak kullanılabileceğini bildirmiştir.
Çankaya ve Abacı (2012) Alman Alaca x Kıl melezi oğlaklarının canlı ağırlıkları
üzerine bazı vücut ölçümlerinin doğrudan, dolaylı ve toplam etkilerini path analizi
kullanarak incelemişler ve oğlakların canlı ağırlık üzerine göğüs çevresi, cidago yüksekliği,
ön sağrı genişliği ve vücut uzunluğu etkilerinin istatistiki olarak önemli olduğunu, Alman
Alaca x Kıl melezi oğlaklarının kesim dönemlerindeki hayvan başına karkas verimini
arttırmak amacıyla, canlı ağırlık tahminlerinde göğüs çevresi ölçüsünün kullanılabileceğini
bildirmişlerdir.
MATERYAL ve METOT:
Hayvan Materyali : Araştırmanın hayvan materyalini Enstitünün koyunculuk ünitesinde
bulunan ve 2015 ile 2016 yıllarında ortalama doğum tarihinden ±5 gün içerisinde doğan
bütün Akkaraman, Orta Anadolu Merinosu kuzular oluşturacaktır.
Metod :
Enstitüde tohumlamalar kayıt altına alındığından tohumlama kayıtlarına göre
beklenen ortalama doğum tarihi hesaplanacak ve bu doğum tarihinden ±5 gün içerisinde
doğan bütün kuzular proje kapsamına alınacaktır. Doğum ile birlikte kuzunun doğum
ağırlığı, cinsiyeti, doğum tipi, ana ve baba yaşı ve gebelik süresi gibi faktörler
kaydedilecektir. Projedeki kuzuları işletmedeki diğer kuzulardan ayırt edebilmek için farklı
renkte işaret küpesi (RFID içeren küpeler) kullanılacaktır. Projeye dahil edilmesine rağmen
farklı bir araştırmada kullanılması gereken kuzular muamele farkı olacağı düşüncesiyle
58
projeden çıkartılacaktır. Proje kapsamındaki kuzuların bakım ve beslemesi enstitü şarlarında
yapılacak olup farklı bir uygulama yapılmayacaktır. Proje kapsamındaki kuzular 90 günlük
yaşta sütten kesilecek ve kuzuların bu dönemine ait vücut ölçüleri ve canlı ağırlıkları tespit
edilecektir. Kuzuların çeşitli dönemlerde ölçülecek olan canlı ağırlıklar bakımından
damızlık değerler ile genotipik ve fenotipik ilişkiler Hayvan Modeli (Animal Model) esas
alınarak tahmin edilecektir.
Canlı Ağırlık Tespiti
Kuzuların doğumu ile birlikte doğum ağırlığı kayıt altına alınacaktır. Sütten kesim
döneminde (90. Gün) ve bu dönemi takip eden her üç ayda bir kuzuların canlı ağırlıkları (18
aylık döneme kadar) 200 g hassasiyetli kulak küpesinden hayvanları tanımlayan EID
(RFID) sistemine uygun otomatik tartı ile tespit edilecektir. Kuzuların tartımı sabah yem
verilmeden veya meraya gönderilmeden saat 8:15’de başlayacaktır. Kullanılacak tartı
sistemi hayvanları otomatik olarak algılayıp canlı ağrılığını dahilinde bulundurduğu
datasına kayıt edecek ve istenildiği zaman Excel formatında çıktı verebilecektir. Bu şekilde
tartımlar daha kısa sürede tamamlanacak ve uygulayıcı kaynaklı hatalar en az seviyeye
indirilecektir. Ayrıca enstitümüz araştırma konularında faaliyet gösterdiği için koyunculuk
üretim bölümündeki diğer hayvanların tartımı ve performans değerlendirmesinde de
kullanılabilecektir. Bu tartı sistemi istenildiğinde koyunları canlı ağırlık, cinsiyet gibi
faktörlere göre tasnif edebilme özelliğine sahip olacaktır. Bakanlığımızın çipli kulak küpesi
uygulamasına geçmesi ile birlikte ilave kulak küpesi masrafı olmadan etkin bir şekilde
kullanılacağı düşünülmektedir.
Yapağı Verimi
Proje kapsamındaki bütün kuzuların ilk kırkım kirli yapağı verimi tespit edilecektir.
Enstitüde kırkım işlemi mevsim gereği Mayıs-Haziran ayları içerisinde yapılmakta olup bu
dönemde kuzular yaklaşık 16-17 aylık yaşta olacaklardır. Kirli yapağı verimini tespit etmek
amacıyla 10 g hassasiyetli tartı kullanılacaktır.
Vücut Ölçülerinin Alınması;
Vücut ile ilgili ölçülerden; Vücut uzunluğu (VU), Cidago yüksekliği (CY), Sırt yüksekliği
(SY), Sağrı yüksekliği (SĞY), Göğüs derinliği (GD), Göğüs genişliği (GG), Göğüs çevresi
(GÇ), Ön incik çevresi (ÖİÇ) ve Bacak yüksekliği (BY),
Baş ile ilgili ölçülerden; Baş uzunluğu (BU), Baş genişliği (BG), Alın uzunluğu (AU)ve
Kuyruk ile ilgili ölçülerden; Kuyruk uzunluğu (KU), Kuyruk bağlantı noktası genişliği
(KBG), Kuyruk çevresi (KÇ) 3 aylık sütten kesim döneminde ve bu dönemden itibaren 6.
12. ve 18. aylarda canlı ağırlığın ölçümünden en geç 1 hafta içinde tekrarlı olarak
gerçekleştirilecektir. Ölçümler Ertuğrul (1996)’un bildirdiği metoda göre; ölçü bastonu,
ölçme şeridi ve ölçme pergeli kullanılarak aşağıdaki gibi yapılacaktır.
Özelliklerin Ölçüm Biçimi Aşağıda Tarif Edilmiştir:
Vücut uzunluğu: Omuz ucundan (articulatiohumeri) oturak yumrusuna (tuberischi) kadar
olan uzaklıktır (Ölçü bastonu).
Cidago yüksekliği: Cidagonun en yüksek yerinden yere olan düşey uzaklıktır (Ölçü
bastonu).
Sırt Yüksekliği: Son sırt omuru diken çıkıntısı ile yere kadar olan dikey mesafe (Ölçü
Bastonu).
Sağrı yüksekliği: Sağrının en yüksek yerinden yere olan uzaklıktır (Ölçü bastonu).
Göğüs derinliği: Cidagonun en yüksek noktası ile sternum (göğüs kemiği) arasındaki dikey
uzaklıktır (Ölçü bastonu).
Göğüs Genişliği:Caputhumeriler arasındaki mesafe. (Ölçü Bastonu)
Göğüs Çevresi:Cidago ve göğüs kemiği (sternum) üzerinden geçen ve göğsü tamamen
çevreleyen ölçüdür (Ölçü Şeridi).
59
İncik Çevresi: Ön incik kemiğinin (Metacarpus) en ince yerindeki çevresi (Ölçü şeridi)
Bacak Yüksekliği: Cidago yüksekliğinden göğüs derinliğinin çıkarılması sonucu bulunarak
kayıt altına alınacaktır.
Baş Uzunluğu: Alın çıkıntısının en yüksek noktasından (Crista Occipitalis) üst dudağın alt
kenarına (Osincicivum) kadar olan mesafe (Ölçü pergeli)
Baş Genişliği: Başın en geniş yerinde (Her iki göz açısından) ölçülen genişlik (Ölçü pergeli)
Alın uzunluğu:Alın çıkıntısının en yüksek noktasından gözlerin iç açılarını birleştiren
mevhum hat arasındaki mesafe (Ölçü pergeli)
Kuyruk uzunluğu: Kuyruğun iç yüzeyinden kuyruk sokumu ile kuyruğun sonu arası mesafe
(Ölçü Şeridi)
Kuyruk genişliği: Kuyruğun en geniş bölgesi (Ölçü bastonu).
Kuyruk çevresi: Kuyruğun en geniş yerinden (Ölçü şeridi).
İstatistik Analiz
İstatistik analizlerde kullanılmak üzere sütten kesim döneminde ve 6., 12. ve 18.
aylardaki tespitler için veri setleri oluşturulacaktır. Kuzuların sütten kesim döneminde tespit
edilen; Canlı ağırlık (CA-3), Vücut uzunluğu (VU-3), Cidago yüksekliği (CY-3), Sırt
yüksekliği (SY-3), Sağrı yüksekliği (SĞY-3), Göğüs derinliği (GD-3), Göğüs genişliği
(GG-3), Göğüs çevresi (GÇ-3), Ön incik çevresi (ÖİÇ-3), Bacak yüksekliği (BY-3), Baş
uzunluğu (BU-3), Baş genişliği (BG-3), Alın uzunluğu (AU-3), Kuyruk uzunluğu (KU-3),
Kuyruk bağlantı noktası genişliği (KBG-3), Kuyruk çevresi (KÇ-3) birinci değişken setini
(X), sütten kesim döneminden sonraki dönemlerde alınan değerler ikinci değişken setini
(Yn) oluşturacak ve Canlı ağırlık (CA-n), Vücut uzunluğu (VU-n), Cidago yüksekliği (CYn), Sırt yüksekliği (SY-n), Sağrı yüksekliği (SĞY-n), Göğüs derinliği (GD-n), Göğüs
genişliği (GG-n), Göğüs çevresi (GÇ-n), Ön incik çevresi (ÖİÇ-n), Bacak yüksekliği (BYn), Baş uzunluğu (BU-n), Baş genişliği (BG-n), Alın uzunluğu (AU-n), Kuyruk uzunluğu
(KU-n), Kuyruk bağlantı noktası genişliği (KBG-n), Kuyruk çevresi (KÇ-n) şeklinde kayıt
altına alınacaktır.
İki veri seti arasındaki ilişki çok değişkenli istatistik yöntemlerinden biri olan
“Kanonik Korelasyon Analizi” ile incelenecektir.
Kanonik korelasyon analizinin yapılabilmesi için veri setinde bazı varsayımların
sağlanması gerekmektedir. Bu varsayımlar; özelliklerin çok değişkenli normal dağılım
göstermesi, üzerinde durulan özellikler bakımından ölçüm hatasının minimum seviyede
olması, özellikler arasında çoklu bağlantının (multicolinearty) olmaması ve elde edilen
sonuçlara güvenilirlik bakımından örnek genişliğinin değişken sayısının 5 katı kadar olması
şeklinde özetlenebilir (Keskin ve ark, 2005). Çok değişkenli istatistik tekniklerinden birisi
olan kanonik korelasyon analizi dolaylı seleksiyona temel oluşturabilecek bilgiyi
sağladığından, zootekni araştırmalarında aynı hayvandan farklı dönemde alınan birden fazla
ölçüm arasındaki ilişkinin doğru olarak belirlenmesinde yaygın olarak kullanılmaktadır
(Çankaya ve Kayaalp, 2007).
Ayrıca kuzuların sütten kesim dönemindeki vücut ölçüleri ile 6, 9, 12, 15 ve 18.
aylardaki canlı ağırlıkları ve ilk kırkım kirli yapağı verimi arasındaki ilişki “Path Analizi”
ve “Çoklu Regresyon Analizi” kullanılarak incelenecektir.
İstatistik analizler Statistica ve Minitab paket programları ile yapılacaktır.
60
ÇALIŞMA TAKVİMİ
Çalışma Takvimi Çizelgesi
2015 Yılı Doğum ve
Kayıtların Tutulması
Sütten Kesim
Dönemi Ölçümlerin
Yapılması
Canlı Ağırlığın
Tespiti
Vücut Ölçülerinin
Tespiti
Yapağı Verimi
Tespiti
İstatistik Analizler
ve Ara Raporu
2016 Yılı Doğum ve
Kayıtların Tutulması
Sütten Kesim
Dönemi Ölçümlerin
Yapılması
Canlı Ağırlığın
Tespiti
Vücut Ölçülerinin
Tespiti
Yapağı Verimi
Tespiti
İstatistik Analizler
ve Sonuç Raporu
35
36
34
33
32
31
30
29
28
27
26
25
24
23
22
21
9
20
8
19
7
18
6
17
5
16
4
15
3
14
2
13
1
11
12
Aylar
10
Yapılacak
Faaliyetler
X X
X X
X X
X X
X X
X X
X X
X X
X X
X X
X X
X X
X
X X X X
X X
X X
X X
X X
X X
X X
X X
X X
X X
X X
X X
X X
X
X X X X
(*)Yazım vb. alanları gerektiği kadar uzatılabilir.
61
YÖNETİM DÜZENİ
Adı Soyadı
Şükrü DOĞAN
Uğur DEMİRCİ
Mesut KIRBAŞ
Dr. İbrahim AYTEKİN
Doç. Dr. İsmail KESKİN
Proje Yürütücülerinin Projeye Katkıları
Yapılacak Faaliyetlerdeki
Çalışma Takvimi
Sorumlulukları
Doğum kayıtlarının alınması
Ocak-Şubat 2015-2016
Vücut ölçülerinin alınması ve tartım
Nisan- Mayıs 2015-16,17
Temmuz-Ağustos 2015-16,17
Ocak-Şubat 2016-2017
Yapağı veriminin tespiti
Mayıs 2016-2017
İstatistik analiz ve ara raporun
Eylül-Aralık 2016
hazırlanması
İstatistik analiz ve sonuç raporun
Eylül-Aralık 2017
hazırlanması
Vücut ölçülerinin alınması ve tartım
Nisan- Mayıs 2015-16-17,
Temmuz-Ağustos 2015-16,17
Ocak-Şubat 2016-2017
Yapağı veriminin tespiti
Mayıs 2016-2017
Vücut ölçülerinin alınması ve tartım
Nisan- Mayıs 2015-16-17,
Temmuz-Ağustos 2015-16,17
Ocak-Şubat 2016-2017
Yapağı veriminin tespiti
Mayıs 2016-2017
İstatistik Analizlerin yapılması ve
Eylül-Aralık 2016-2017
Danışmanlık
İstatistik Analizlerin yapılması ve
Eylül-Aralık 2016-2017
Danışmanlık
Proje Sonuçları Uygulama Aktarımı
Akkaraman ve Orta Anadolu Merinos Kuzularının Sütten Kesim
Dönemindeki Bazı Vücut Ölçülerinin Erken Seleksiyon Kriteri Olarak
Proje Adı
Kullanılma İmkanının Araştırılması
PROJENİN AMACI:
· Elde edilen çıktılar Halk Elinde Hayvan Islahı Projesi kapsamında yapılan bilgi alış
verişi toplantılarında sözlü bildiri olarak sunulacaktır.
· Hazırlanacak poster ve sunumlar ile İl Müdürlüğü ve Koyun Keçi Yetiştirici Birliği
yayım personeli ile ortaklaşa toplantılar düzenlenecektir.
· Akkaraman ve Orta Anadolu Merinos koyunu yetiştiren üreticilerle toplantılar
düzenlenecek ve damızlık seçimi uygulamalı olarak gösterilecektir.
· Irkın tanımlanmasında kullanılan morfolojik özelliklerin damızlık seçiminde kullanılma
imkanı teknik verilerle ortaya konacak ve ülkemizdeki diğer koyun ırkları için yapılacak
çalışmalar için örnek olacaktır.
ÇIKTILARIN UYGULAMAYA AKTARILMASI VE YAYGINLAŞTIRILMASI
Çıktıların Uygulamaya Aktarılma
Sıra
Proje Çıktıları
Mekanizmaları
1
Proje Sonuç Raporu
Sonuç Raporu Kitapçığı
2
Bildiriler
Ulusal kongreler ve sempozyumlar
3
Yayınlar (Makale)
Yurtiçi ve yurtdışı hakemli dergiler
4
Yetiştirici ve teknik elemanlara yönelik
toplantılar, BAV toplantıları
Seminer, toplantı, ziyaret, sunu, broşür,
kitapçık, CD
62
5
Proje çıktıları ve yayınları Enstitü’nün
web sitesine konacaktır.
Web Sitesi
TALEP EDİLEN BÜTÇE
I. Yatırım Tutarı
06 SERMAYE GİDERLERİ
06.1- Mamul Mal Alımları
06.2- Menkul Sermaye Üretim Giderleri
06.3- Gayri Maddi Hak Alımları
06.4- Gayrimenkul Alımları ve Kamulaştırılması
06.5- Gayrimenkul Sermaye Üretim Giderleri
06.6- Menkul Malların Büyük Onarım Giderleri
06.7- Gayrimenkul Büyük Onarım Giderleri
06.8- Stok Alımları
06.9- Diğer Sermaye Giderleri
Toplam
Genel Toplam
YILLARA GÖRE DAĞILIM
1.Yıl
2.Yıl
3 Yıl
85.000
4.000
3.000
7.000
12.000
7.000
92.000
16.000
118.000
10.000
II. Bütçe Gerekçesi ve Yatırım Tutarının Dağılımı
06. SERMAYE GİDERLERİ
6 1
0
2
9
6 1 2
0
6 1 6 1
6 1 2
YILLARA GÖRE DAĞILIM
2015
2016
2017
MAMUL MAL ALIMLARI
Bilgisayar Alımları
2.500
Diğer Makine Teçhizat Alımları (RFID Tartı Sistemi,
RFID Kulak Küpesi, Ölçü Bastonu, Ölçü Pergeli)
Basılı yayın alımları ve yapımları
6 2
MENKUL SERMAYE ÜRETİM GİDERLERİ
6 2 1
Müşavir firma ve kişilere ödeme (işçi gideri)
6 2 9 1 Diğer Alımlar (Yem alımı)
TOPLAM
GENEL TOPLAM
82.500
4.000
3.000
2.000
5.000
92.000
2.000
10.000
16.000
118.000
2.000
5.000
10.000
TEKLİF ONAYI
Proje /Alt Proje Lideri
Adı Soyadı
Şükrü DOĞAN
Öneren Kuruluş Müdürü
Fatih ÖZDEMİR
Tarih
İmza
63
DESTEK BAŞVURUSUNDA BULUNULAN PROJENİN
Sığla Yağının Biyo Element, Ham Besin Madde İçeriklerinin
Tespiti İle Koyunlarda Bazı Biyokimyasal Kan Parametreleri
BAŞLIĞI
Ve Antioksidan Kapasite Üzerine Etkisi
ARAŞTIRMA FIRSAT
Küçükbaş hayvancılık
ALANI
ARAŞTIRMA
Hayvan Besleme, Hayvan sağlığı ve refahı
PROGRAMI
PROGRAM ÖNCELİĞİ Düşük, orta
PROJE ÖNERİSİ YAPAN KURULUŞUN
Hayvancılık Merkez Araştırma Enstitüsü Müdürlüğü
ADI
06852 Lalahan, Ankara
ADRESİ
PROJE / ALT PROJE LİDERİ
Gülşen Yıldırım ŞENYER
ADI SOYADI
Hayvancılık Merkez Araştırma Enstitüsü Müdürlüğü
KURUMU
312 8651196/224
TELEFONU
[email protected]
E-POSTA
PROJE / ALT PROJE YÜRÜTÜCÜLERİ
ADI SOYADI
KURUMU
Dr. Sema YAMAN
HMAE
Engin ÜNAY
HMAE
Arzu EROL TUNÇ
HMAE
Prof.
Dr.
Gültekin Ankara Üniv. Vet. Fak. Hayv.
YILDIZ
Besl. ve Besl. Has. A. B.D
Yrd. Doç. Dr. Laçine Afyon Kocatepe Üniv. Fen
AKSOY
Edeb. Fak. Biyokimya A.B.D.
Aziz ÖZTÜRK
HMAE
Pınar ÖZDEMİR
HMAE
PROJE TOPLAM
BÜTÇESİ (TL)
E-POSTA
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
azizoztü[email protected]
[email protected]
PROJE BAŞLAMA TARİHİ
(GÜN/AY/YIL)
PROJE BİTİŞ TARİHİ
(GÜN/AY/YIL)
01/04/2015
01/04/2016
25.000
İŞBİRLİĞİ
İŞBİRLİĞİ YAPILAN KURULUŞ
Ankara Üniv. Vet. Fak. Hayv. Bes. ve
Besl. Hast. A B.D.
Afyon Kocatepe Üniv. Fen Edebiyat
Fak. Biyokimya A.B.D.
İŞBİRLİĞİ
ŞEKLİ
PROJEDEKİ KATKISI
Teknik
Bakteri ve Protozoa sayımı
Teknik
Kan antioksidan kapasite
analizleri, ICP-OES ile biyo
element analizi
64
PROJE ÖZETİ
Proje Özeti:
Bu çalışma, sığla ağacı yağının biyo element, ham besin madde içeriğinin tespiti ile in vivo
çalışma sonucu bazı biyokimyasal kan parametrelerine ve antioksidan kapasite üzerine
etkilerini araştırmak için planlanmıştır.
Bu amaçla sığla ağacından elde edilen sığla yağı öncelikle in situ ortamda 0,250, 500, 750
mg/kg KM dozlarında denenerek in vivo çalışma için doz tespiti yapılacaktır. Sığla yağı için
in vivo çalışmada in situ ortamda rumen parametreleri üzerinde en olumlu etkiye sahip doz
aralığından 2 doz tespit edilecektir. Ayrıca in situ çalışmada sığla yağının rumene infüze
edilmesiyle kesif yeme karıştırılarak yedirilmesi arasında fark olup olmadığı tespit edilmeye
çalışılacaktır. Sığla yağı için tespit edilen 2 doz kontrol grubu ile birlikte toplam 3 grup
olarak 24 baş Akkaraman ırkı 2 – 3 yaşlı koyunda in vivo denenecektir. İn vivo çalışmada
hayvanlar bireysel kafeslerde beslenecek, belirlenen dozlar günlük rasyona ilave olarak
(kesif yeme karıştırılarak) verilecektir.
İn vivo çalışmalar sırasında 10 günlük alıştırma döneminin öncesinde ve 5 günlük deneme
periyodun ise son gününde kan alınarak bazı biyokimyasal kan parameterelerine (Glikoz,
Kolesterol, Total protein, Trigliserit, Kan üre azotu, İnsülin, BHB, NEFA, Total lipid) ve
antioksidan kapasitesini belirleyen parametrelere (Malondialdehit, Glutatyon, Glutatyon
Peroksidaz, Süperoksit Dismutaz, Katalaz, TAS, TOS) ticari kitlerle spektrofotometrik
yöntemle bakılacaktır. Çalışmada ayrıca sığla yağının in situ koşullarda OM, KM, HP, NDF
ve ADF sindirilebilirlikleri ile rumende toplam protozoa ve bakteri sayılarına etkisi
incelenecektir.
Anahtar Kelimeler: Sığla yağı, biyokimyasal kan parametreleri, koyun besleme
Projenin Amacı ve Gerekçesi:
Sığla ağacı (Liquidambar orientalis Miller ) sadece Türkiye’de özellikle Ege bölgesinde
yaygın olarak yetişen çınara benzer yapraklı bir bitkidir. Daha çok sığla yağı alınarak
kullanılmaktadır. Sığla yağı tıpta yaraların tedavisinde, astım, bronşit gibi üst solunum
yolu hastalıklarında, buharla dezenfeksiyon, balgam söktürücü olarak toz ve pastil, mantar
ve uyuz gibi cilt hastalıklarında pomat ve yakı halinde kullanılmaktadır. Sığla yağı ayrıca
ülser hastalığında ağrı kesici olarak değerlendirilmektedir. Sığla yağının antiseptik ve
parazit öldürücü etkisi olduğu bildirilmektedir (Bozkurt ve ark., 1990). Sığla yağının kan
ve organlardaki lipid ve kolesterolü düşürdüğü için hiperlipidemi ve hiperkolesterolemi
üzerine etkili olduğu bildirilmiştir (Cımbız ve ark.,2005). Bu veriler ışığında Sığla ağacı
yağının yem katkı maddesi olarak da kullanılma potansiyelinin olabileceği düşünülmüştür.
Bu çalışma ile sadece Türkiye’de yetişen sığla ağacının yağı incelenerek in situ çalışma ve
sonrasında yapılacak olan in vivo çalışma ile ruminantlar için sığlanın alternatif bir yem
katkı maddesi olarak değerlendirilip değerlendirilemeyeceği görülecektir.
Sığla için yapılacak olan in situ çalışmada sığla yağının rumene infüze edilmesiyle, kesif
yeme karıştırılarak ağızdan yedirilmesi arasındaki farkın ortaya konulması da
amaçlanmıştır.
Projede, yem katkı maddesi olarak kullanma potansiyeli araştırılacak olan sığla yağının
ham besin maddeleri, biyo element içeriği, , biyokimyasal kan parametrelerine ve
antioksidan kapasiteye etkisinin tespitinin yanı sıra bu konudaki literatür yetersizliğinin
giderilmesine katkı sağlanması amaçlanmıştır.
Proje ile Elde Edilmek İstenilen Çıktılar ve Kullanım Alanları
1)Daha önce ruminant besleme alanında çalışılmamış olan sığla yağının ham besin madde
içerikleri belirlenerek literatüre katkı sağlanacaktır.
65
2) Rasyona katılacak olan sığla yağının optimum düzeyinin belirlenmesine katkı
sağlanacaktır.
3) Sığla yağının metabolik kan parametrelerine ve antioksidan kapasiteye etkileri ortaya
konularak bu alanda yapılan ilk çalışma olma özelliğini taşıyacaktır.
4)Sığla yağının oral yol uygulamasıyla rumene infüze edilmesi arasındaki fark
belirlenecektir.
Bu çıktılar makale, bildiri ve posterler yoluyla bilimsel kongre ve sempozyumlarda
sunularak paydaşlara iletilecektir. Ayrıca yapılacak yayınlarla literatüre katkı sağlanacaktır.
LİTERATÜR ÖZETİ:
Adıyaman ve Ayhan (2010)’ın bildirdiğine göre antibiyotikler; bakteri, mantar gibi
mikroorganizmalar tarafından üretilen ve bulundukları ortamı zararlı mikroorganizmaların
etkilerinden koruyan kimyasal maddelerdir. Verimi artırarak önemli ekonomik yarar
sağlayan antibiyotiklerin, küçük dozlarda ve sürekli olarak tüketildikleri zaman kimi
olumsuzluklara neden oldukları ortaya konmuş bulunmaktadır. Bu olumsuzluklar içinde en
önemlisi, yeme katılan antibiyotiklerin hayvansal ürünlerde önemli düzeyde kalıntı
bırakması ve bu antibiyotiklere karşı mikroorganizmaların direnç kazanmasıdır. Bu direnç
bir mikroorganizmadan diğerine, bir antibiyotikten diğerine taşınabilmekte, böylece
hastalıkların sağıtımında kullanılan antibiyotiklere karşı çapraz direnç oluşturmaktadır
(Özkan ve Açıkgöz, 2007). Bu olumsuzlukların tüketici sağlığını gün geçtikçe tehdit etmesi
günümüzde güvenilir ve kaliteli hayvansal ürün üretmeyi zorunlu hale getirmiştir. Buradan
hareketle, önce Avrupa Birliği ülkelerinde daha sonrada ülkemizde gelişmeyi teşvik edici
yem katkı maddesi olarak antibiyotik kullanımı yasaklanmıştır. Antibiyotiklerin ve büyütme
faktörü olarak kullanılan diğer bazı kimyasal maddelerin kullanımının yasaklanmasıyla bu
maddelere alternatif olabilecek yem katkı maddeleri arayışı gündeme gelmiştir. Tıbbi ve
aromatik bitkilerin çeşitli yararlarından dolayı geçmişten günümüze gıda sektörü başta
olmak üzere çeşitli alanlarda kullanıldığı bilinmektedir. Ekolojik tarımın önem kazandığı
günümüzde hayvancılık sektöründe de doğal maddelerden yararlanma ön plana çıkmıştır.
Tıbbi ve aromatik bitkilerden elde edilen bitkisel ekstraktlar antifungal (İlçim ve ark., 1995;
Türküsay ve ark., 1996; Hammer ve ark., 1999; Svoboda ve Hampson, 1999; Guynot ve
ark., 2005), antibakteriyel, antiviral (Svoboda ve Hampson, 1999; Dorman ve Deans, 2000;
Rauha ve ark., 2000; Lambert ve ark., 2001) antioksidan (Svoboda ve Hampson, 1999;
Botsoglou ve ark., 2002) ve antilipidemik özellikleri ile ön plana çıkmaktadır.
Bitkisel ekstraktlar genellikle, saponinler, taninler ve bitki esans yağları olarak
gruplandırılır. Bu bileşikler bitkilerin savunma sisteminde, polinatörleri çekici olarak üreme
olaylarında ve renk, koku gibi fiziksel özelliklerinin ortaya çıkmasında etkili olmaktadır
(Wallace, 2004; Acamovıc ve Brooker, 2005; Calsamıglıa ve ark., 2007). Esans yağlar
(eterik yağlar) bitkilerin kök, gövde, yaprak, çiçek, kabuk, meyva, tohum gibi kısımlarında
bulunabilmekte (Benchaar ve ark., 2008) ve miktarları bitki sağlığı, büyüme dönemi,
çevresel faktörlere (ışık, sıcaklık ve nem vb.) bağlı olarak değişebilmektedir (Dudareva ve
ark., 2004).
Doğada bol miktarda bulunan aromatik bitkiler yüzyıllarca hastalıkların tedavisinde ilaç
olarak kullanılmıştır. Son yıllara kadar modern hayvan beslemede, aromatik bitkilerin
büyüme uyarıcı ve antimikrobiyal olarak kullanımı pek dikkate alınmamıştır. Fakat
büyümeyi uyarıcı antibiyotiklerin yasaklanmasından dolayı, günümüzde bitkisel ekstraktlar
antibiyotiklere alternatif yem katkısı ve büyüme uyarıcı olarak önem kazanmaya
başlamıştır. Bitkisel ekstraktların ve ekstrakt yağların faydalarını belirlemek ve gelecek için
66
geçerli bir alternatif olabilmesi için çalışılmaktadır (Kamel, 2000).
Erenel ve ark. (1992) bildirdiğine göre uzun zamandan beri yüksek konsantrasyonlardaki
oksijenin hayvanlar, bitkiler ve mikroorganizmalar üzerinde şiddetli fizyolojik ve hatta letal
etkilere neden olabildiği bilinmektedir. 1950’lerin başında Gilbert serbest oksijen
radikalinin insanlardaki birçok patolojide etken olduğunu göstermiştir (Saltman, 1989).
Serbest radikal mekanizmaları in vivo olarak hem yararlı, hem de zararlı etkilere sahiptir.
Son 20 yılda serbest radikaller üzerine olan yoğun bilimsel ilgi, bu maddelerin rollerini daha
iyi anlamamıza yardım etmiş ve serbest radikallerin neden olduğu doku hasarını
sınırlandıran intrensek defans sistemlerinin (antioksidantlar) yararlarının anlaşılmasında
önemli ölçüde yol alınmasını sağlamıştır. Serbest radikallerin aracılık ettiği doku hasarı,
tüm hasarların sonunda gelişen ortak bir yol ve farklı patofizyolojik, hatta fizyolojik
süreçlerin bir komponentidir.
Sağdıç ve ark. (2005) bildirdiğine göre Liquidambar orientalis Mill. ağacı Türkiye’de
genellikle 'Sığla ağacı' ya da 'Günlük ağacı' olarak bilinir ve Türkiye'nin güney-batı sahil
bölgesinde yerel bir dağılımı vardır ( Hill, 1952; Tyler et al., 1981; Davis, 1982; Baytop,
1984; Duru et al., 2002). Sığla ağacı tıbbi ve kozmetik özellikleri bilinen ve yaygın olarak
Akdeniz bölgesinde fitoterapide kullanılan bir bitkidir. Sığla ağacının dış kabuklarının
yarılmasıyla üretilen yağının iyi antiseptik özellikleri vardır. Ayrıca topikal parazitide,
balgam söktürücü olarak ve Türk halk hekimliğinde bazı deri hastalıklarının tedavisinde
kullanılır. Kozmetik sanayinde geniş bir uygulama alanı vardır (Hafizoğlu, 1982; Duru et
al., 2002). Yayımlanan çalışmaların çoğu sığla yağının temel yağ bileşimi üzerinde
yapılmıştır (Berkel and Huş, 1944; Hafizoğlu et al., 1996; Duru et al., 2002). Sığla ağacının
uçucu yağ içeriği Hafizoglu ve ark. (1996) ve Duru ve ark. (2002) tarafından GC-MS
kullanarak analiz edilmiştir. Birçok bileşeni karakterize edilmiş, büyük çoğunluğunu
terpinen-4-ol, α-terpinol, sabinene ve γ-terpinenin teşkil ettiği tespit edilmiştir. Karadeniz ve
ark.(2011) bugüne kadar, çeşitli araştırmacıların sığla yağının birçok bakteri türü,
fitopatojenik mantar ve nematod koruyucu aktivitesi olduğunu bildirmiştir (Bayramoglu,
2010; Kim and Seo, 2008; Lee et al., 2009; Oskay and Sari, 2007; Sagdic et al., 2005).
Sığla yağının %10’luk konsantrasyonunun çoğu bakteriye (B. brevis, B. cereus, B. subtilis,
Corynebacterium xerosis, Enterobacter aerogenes, Enterococcus faecalis, Klebsiella
pneumoniae, Micrococcus luteus, Mycobacterium smegmatis, Proteus vulgaris,
Pseudomonas aeruginosa, P. fluorescens, Staphylococcus aureus) karşı anti bakteriyel
aktivitesi olduğu görülmüştür. Ayrıca bazı bakterilere karşı da % 1.0, % 0.4 ve % 0.2’lik
konsantrasyonlarda anti bakteriyel aktivite tespit edilmiştir (Sağdıç ve ark.,2005).
Sığla yağı ekstraktının sitotoksik ve genotoksik etkileri nedeniyle alternatif antibakteriyel ve
antipathogenic madde olarak kullanılabileceği görülmektedir (Karadeniz ve ark.,2011).
Farmakolojik deneylerde, 150 ve 300 mg / kg dozlarda sıçanlara oral yoldan sığla yağı
verildiğinde önemli bir gastrik koruma sağladığı görülmüştür. GC-MS analizi ile sığla
yağının %99.8 ’inin 31 bileşenden oluştuğu, temel olarak stiren (% 81.9), sinnamil alkol (%
6.9) ve α-pinen (% 3.5) ana bileşenlerinin yer aldığı tespit edilmiştir. Bu çalışma sığla
yağının, Türkiye’deki anti-ülserojenik aktivite için kullanımının uygunluğunu doğrulamıştır
(Gürbüz ve ark., 2013).
Cımbız ve ark. (2005) ökaliptus (Eucalyptus globulus), zeytin (Olea europae), ökse otu
(Viscum album) ve günlük sakızı (Liquidambar orientalis) 'nın alkolde hazırlanmış
özütlerinin hiperlipidemi ve hiperkolesterolemili erkek farelerde ( Mus musculus ) kan, kalp
ve karaciğerdeki toplam kolesterol ve toplam lipid konsantrasyonlarına etkilerini
araştırdıkları çalışmalarında denemede kullanılan bitkilerin, kan ve organlardaki lipid ve
kolesterolü düşürdükleri için hiperlipidemi ve hiperkolesterolemi üzerine etkili olduklarını
bildirmişlerdir.
67
Bozkurt ve ark. (1990) bildirdiğine göre Sığla yağı tıpta yaraların tedavisinde, astım, bronşit
gibi üst solunum yolu hastalıklarında, buharla dezenfeksiyon, balgam söktürücü olarak toz
ve pastil, mantar ve uyuz gibi cilt hastalıklarında pomat ve yakı halinde kullanılmaktadır.
Sığla yağı ayrıca ülser hastalığında ağrı kesici olarak değerlendirilmektedir. Sığla yağı
antiseptik ve parazit öldürücüdür.
Öçsel ve ark.(2012) günlük ağacı sakızının (Liquidambar orientalis . Mill) kısmi-kalınlıktaki
ve tam kalınlıktaki yaraların geleneksel pansumanındaki etkilerini değerlendirmek için
yaptıkları çalışmada altı genç Yorkshire domuzu kullanmıştır. 3 × 3 cm boyutlarında on altı
kare eksizyonel yara hayvan başına uygulanmıştır. Yaralara dört tedavi yönteminden
(Storax, hidrokolloid pansuman, gümüş sulfadiazine ve kontrol grupları) biri uygulanmıştır.
Kısmi kalınlıktaki yaralar iki domuz üzerinde oluşturulmuş ve doku örnekleri sırasıyla 4 ve
8’inci günlerde incelenmiştir. Tam kalınlıktaki yaralar dört domuz üzerinde oluşturulmuş ve
doku örnekleri sırasıyla 4, 8, 14 ve 21’inci günlerde incelenmiştir. Bütün yaralar,
reepitelizasyon ve granülasyon dokusu oluşumu için incelenmiştir. Doku hidroksiprolin
içeriği ve yara daralma alanları ölçülmüş, tüm diğer gruplarla karşılaştırıldığında, günlük
ağacı sakızı uygulanan grupta, 4 ve 8’nci günlerdeki granülasyon dokusu daha büyük bir
derinliğe sahiptir ve tam kalınlıktaki yaralarda hidrokolloid pansuman ve kontrol gruplarının
her ikisi ile karşılaştırıldığında 21’inci günde daha hızlı reepitelizasyon vardır. Doku
hidroksiprolin içeriği ve yara daralması gruplar arasında farklılık göstermemiştir. Bu
çalışmanın sonuçları, günlük ağacı sakızının topikal uygulamasının, reepitelizasyon ve
granülasyon dokusu oluşumunu tam kalınlıktaki yaralarda geliştirdiğinin görüldüğü
bildirilmiştir.
Andrikopoulos ve ark. (2003) yararlı farmasötik ve nutrasötik özellikleri olan doğal olarak
meydana gelmiş sakızlar ve reçinelerin, in vitroda bakırla indüklenmiş LDL oksidasyonuna
karşı muhtemel koruyucu etkisini araştırdıkları çalışmalarında, sakız ağacı sakızının (CMG)
( Pistacia lentiscus var. Chia reçinesi), insan LDL’sini oksidasyondan korumada en etkili
olduğunu bildirmişler bununla birlikte diğer doğal sakızlar ve reçinelerin (CMG reçine 'sıvı
toplama' , P. terebinthus var. Chia reçinesi, dammar reçinesi, akasya sakızı, kitre sakızı,
sığla sakızı ) de %27.0 -78.8% arasında maksimum LDL koruması gösterdiğini
açıklamışlardır.
Sığla yağının özellikle ruminantlarda yapılan in situ ve in vivo çalışmalarına
rastlanılamamıştır. Literatürde sığla yağıyla ilgili biyokimyasal kan parametreleri ve
antioksidan parametreleri içeren kapsamlı bir çalışma bulunamamıştır. Bu çalışma ile sığla
yağının yem katkı maddesi olarak kullanımının etkileri incelenecektir.
MATERYAL ve METOT:
Hayvan Materyali:
İn situ deneme 2-3 yaşlarında 4 baş rumen kanüllü Akkaraman ırkı koçta yapılacaktır. İn
vivo denemede ise 2-3 yaşlarında Akkaraman ırkı 24 baş koyun kullanılacaktır. Koyunlar
Hayvancılık Merkez Araştırma Enstitüsü Koyun ve Keçi Yetiştirme Şubesinden temin
edilecektir. İn vivo denemede (yemleme), hayvanlar kontrol ve deneme gruplarına (2 grup)
8’er baş olmak üzere tesadüfi olarak dağıtılacaktır. Denemede kullanılan hayvanlar %30
kesif (enstitüde hazırlanan ve %12 ham protein içeren kesif yem), %70 kaba yem (yonca
kuru otu, çayır kuru otu, arpa samanı karışımı) ile beslenecektir. Çalışmanın in vivo
kısmında hayvanlara verilecek bazal rasyon aynı olacaktır. Sadece katkı maddesinin dozları
değişecektir. Yemler hayvanlara 08.00 ve 17.00 saatlerinde iki eşit öğün olarak verilecektir.
İn vivo denemede hayvanlar NRC (1985) koyun ihtiyaçlarına göre canlı ağırlık üzerinden,
canlı ağırlığının %2 KM/gün oranında beslenecektir. İn situ denemede koçlar deneme
süresince, canlı ağırlığın %1,4 KM/gün düzeyinde beslenecektir.
68
Yem Katkı Maddesi:
Sığla yağı, sığla (günlük) ağacı olarak bilinen Liquidambar Orientalis Miller ağacının
gövdesine tekniğine uygun açılan yaralardan toplanan balzamın kaynatılması ve
preslenmesi sonucu elde edilen bitkisel bir üründür. Kahverengimsi (tahin) renkte, bal
kıvamında, yapışkan, donuk ve mat yapıda olup kendine özgü aromaya sahiptir. Sığla yağı
Güney-batı Ege bölgesindeki ticari işletmelerden temin edilecektir.
Naylon torbalar
Araştırmada kullanılacak naylon torbaların boyutları 5×10 cm olup, rumen ortamında
parçalanmayan, gözenek açıklığı 50 mikron olan azot içermeyen polyester kumaştan
yapılmıştır (Ankom R510).
İn situ deneme
İn situ rumen ham besin maddeleri parçalanabilirliği naylon torba tekniği (Orskov ve
McDonald 1979) ile ölçülecektir.
Rumene salınacak olan yemler, 1 mm elekten geçecek şekilde öğütülerek torbalara 3.0 g
olacak şekilde tartılarak konulacaktır. Denemede 0, 250, 500, 750 mg/kg KM sığla yağı
dozları rumene yemlemeden önce 250 mL vücut sıcaklığında su ile infüze edilecektir.
Ayrıca, ikinci bir latin kare (4X4) denemesinde bu dozlar kesif yemle koçlara yedirilerek
ağızdan yedirmeyle rumene infüze edilmesi arasındaki fark değerlendirilecektir. Denemede
10 gün alıştırma dönemi sonunda yemler rumene sarkıtılacaktır. Denemede kullanılan
yemler 4 koçun rumenine her inkübasyon süresi ve yem örneği için 2'şer paralel olacak
şekilde sarkıtılacak (8 replikasyon) ve bütün yem örnekleri 2, 4, 8, 16, 24, 48 ve 72 saat
sürelerinde rumende inkübasyona terkedilecektir. İn situ denemede, sığla yağının yemlerin
rumen sindirilebilirliklerine etkisini belirlemek için, yemlemede kullanılacak olan kesif
yem, yonca ve kaba yem (yonca kuru otu, çayır kuru otu ve arpa samanı karışımı) rumende
inkübasyona terkedilecektir. Sığla yağının, beslemede kullanılan yemlerin (kesif yem, yonca
ve kaba yem karışımı) in situ KM, OM, HP, NDF ve ADF sindirilebilirlikleri üzerine etkisi
ile rumende toplam protozoa ve bakteri sayılarına bakılacaktır. Sindirilebilirlik ve rumen
parametreleri uygun olan 2 doz tespit edilerek in vivo denemede kullanılacaktır. Her bir in
situ denemede kanüllü koçlardan rumen sıvısı yemlemeden hemen önce ve yemlemeden 2,
4, 6 ve 8 saat sonra (Pen ve ark., 2007) rumen kanülünden alınacaktır. Rumen sıvısında pH
hemen ölçülecektirProtozoa sayımı için 0., 2., 4. ve 8. saatlerde alınan rumen sıvısından 1ml
rumen sıvısı, 14 ml metil gren: formalin: salin solüsyonunda (Ogimoto ve Imai, 1981) ağzı
sıkı kaplarda karanlık bir alanda saklanacaktır. Protozoa sayıları ışık mikroskobunda FuchsRosental sayma metoduna göre yapılacaktır. Bakteri sayımı Karahan ve ark. (2002)’nın
belirttiği metoda göre modifiye edilecektir. 16x150 mm’lik kültür tüplerinin içerisine
1ml’lik rumen içeriği mikropipet yardımıyla alınacak ve üzerine bakterilerin hareketlerini
kısıtlamak için %50’lik formalinden 0.16 ml ilave edilecektir. Örnek 1/500 oranında
seyreltilecek, seyreltilen örnekten bir miktar mikropipet yardımıyla alınarak, Thoma lamına
aktarılacak ve X 40 büyütmede mikroskopta sayılacaktır. Her bir deneme için 10 sayım
yapılacaktır.
İn vivo deneme
Sığla yağı için belirlenen 2 doz 2 deneme grubunu ve 0 mg/kg KM de kontrol grubunu
oluşturacaktır. Toplamda, kontrol + 2 deneme grubu = 3 grup olacaktır. Deneme süresi 10
gün alıştırma ve 5 gün deneme olmak üzere toplam 15 gün olacaktır. 10 günlük alıştırma
döneminin öncesinde ve 5 günlük deneme süresinin son gününde kan alınacaktır. Kanlar
vena jugularisten yemlemeyi müteakip 60. dakikada heparinsiz tüplere alınarak laboratuvar
ortamında 3000 g’de 5 dk. Santrifüj edilerek kan serumları alınacak ve analiz tarihine kadar
-20 ˚C’de derin dondurucuda saklanacaktır.
Laboratuvar Analizleri: Sığla yağının, ICP-OES cihazıyla biyo element analizleri (Al, Ba,
69
Be, Ca, Cd, Co, Cu, Cr, Fe, Ga, K, Li, Mg, Mn, Na, Se, Te, Zn) yapılacaktır.
Sığla yağında KM, OM, N (Kjeldahl method), AOAC (1995)’e göre analiz edileceklerdir.
NDF, ADF, HS ve ADL analizleri Van Soest ve ark. (1991)’e göre yapılacaktır.
Biyokimyasal kan analizleri (Glikoz, Kolesterol, Total protein, Trigliserit, Kan üre azotu,
İnsülin, BHB, NEFA, Total lipid), ticari kitlerle spektrofotometrik yöntemle yapılacaktır.
İn vitro antioksidan kapasitesi DPPH (1,1 -diphenyl-2-picrylhydrazyl) metodu Amarowicz
ve ark. (2004) ve TEAC (Troloks eşiti antioksidan kapasite) Re ve ark. (1999)'a göre
spektrofotometrik yöntemle saptanacaktır. Sığla yağının total fenolik içeriği Folin-Ciocalteu
(1927) metoduyla belirlenecektir.
Malondialdehit (MDA), Glutatyon (GSH), Glutatyon Peroksidaz (GSH-Px), Süperoksit
Dismutaz (SOD), Katalaz (CAT), Toplam Antioksidan Durum (TAS), Toplam Oksidan
Durum (TOS) analizleri ticari kitlerle spektrofotometrik yöntemle yapılacaktır.
İstatistik Analiz: İn situ çalışmalar 4x4 latin kare deneme deseninde (4 doz x 4 tekerrür), in
vivo çalışma ise tesadüf parselleri deneme deseninde ( 3 grup x 8 tekerrür) yapılacak olup
gruplar arasındaki farkın önemli çıkması halinde DUNCAN testi yapılarak önem dereceleri
belirlenecektir.
ÇALIŞMA TAKVİMİ
9
2016 Aylar
10
4 5 6 7
8
Yapılacak
Faaliyetler
2015 Aylar
1 1
1 2
1 2 3 4 5
Ön hazırlıklar ve gerekli alımların yapılması
İn situ çalışma (oral)
Dinlenme Periyodu (10 gün)
İn Situ çalışma (infüze)
İn Vivo Çalışma
Laboratuvar Analizleri
Sonuçların Değerlendirilmesi ve Rapor Yazılması
YÖNETİM DÜZENİ
Adı Soyadı
Gülşen Y.ŞENYER
G.Y. ŞENYER-Dr. S.YAMANE.ÜNAY- A.E.TUNÇP. ÖZDEMİR
G.Y. ŞENYER
G.Y. ŞENYER- Dr.
S.YAMAN-E.ÜNAYA.E.TUNÇ
G.Y. ŞENYER Dr. S.YAMANE.ÜNAY-A.E.TUNÇ
Prof. Dr. G.YILDIZ, G.Y.
ŞENYER
A.ÖZTÜRK
Proje Yürütücülerinin Projeye Katkıları
Yapılacak Faaliyetlerdeki Sorumlulukları
Çalışma Takvimi
2015 4.ve 5. ayları
Ön hazırlıklar ve gerekli alımların yapılması
2015 4. 5.6.ayları
İn situ çalışma (oral yol)
Dinlenme Periyodu (10 gün)
2015 6. ayı
2015 6.7.8. ayları
İn Situ Çalışma (infüze)
İn Vivo Çalışma
2015 10. ayı
Protozoa sayımlarının yapılması
2015 8. ve 9. ayı
Kan alımı
2015 10. ayı
70
Proje Sonuçları Uygulama Aktarımı
Proje Adı
Sığla yağının biyo element, ham besin madde içeriklerinin tespiti ile koyunlarda
bazı biyokimyasal kan parametreleri ve antioksidan kapasite üzerine etkisi
PROJENİN AMACI:
· Sığla yağının ham besin maddeleri sindirilebilirliğine etkisinin belirlenmesi
· Sığla yağının biyo element, ham besin madde içeriklerinin tespit edilmesi
· Rasyona katılacak sığla yağının düzeyinin belirlenmesi,
· Sığla yağının protozoa sayılarına etkisinin belirlenmesi
· Sığla yağının biyokimyasal kan parametreleri ve antioksidan kapasite üzerine etkisi
ÇIKTILARIN UYGULAMAYA AKTARILMASI VE YAYGINLAŞTIRILMASI
Sıra Proje Çıktıları
Çıktıların Uygulamaya Aktarılma Mekanizmaları
1
Sığla
Yağının
koyun Gıda Tarım ve Hayvancılık Bakanlığı İl Müdürlükleri ile
rasyona katılmasının etkisi, araştırma enstitülerinin aylık bilgi alışveriş toplantılarında,
araştırma sonucu sunulacaktır. Bu şekilde eğiticilerin
bilgilendirilmesi ile çiftçilere ulaşılacaktır.
2
Sığla yağının biyokimyasal Araştırma sonucu yem sanayicileri, farmakoloji grubuna ve
kan parametrelerine ve araştırmacılara sempozyum ve kongrelerde sunum yapılarak
antioksidan
kapasiteye aktarılacaktır
etkisi
3
Sığla yağının sindirime Araştırma sonucu yem sanayicilerine TUYEM
olumlu etkisi bulunması kongrelerinde aktarılacaktır. Araştırmacılara sempozyum
durumunda
ve kongrelerde sunum yapılarak aktarılacaktır
TALEP EDİLEN BÜTÇE
I. Yatırım Tutarı
06 SERMAYE GİDERLERİ
06.2- Menkul Sermaye Üretim Giderleri
Toplam
Genel Toplam
II. Bütçe Gerekçesi ve Yatırım Tutarının Dağılımı
06 SERMAYE GİDERLERİ
06.2.1.90 Diğer giderler (özel hizmet alımı)
06.2.7.01 Kimyevi madde ve kauçuk ve plastik ürün
alımları (kimyasal madde ve kit alımı)
Toplam
Genel Toplam
YILLARA GÖRE DAĞILIM
1.Yıl
2.Yıl 3 Yıl 4.Yıl
25.000
5 Yıl
25.000
YILLARA GÖRE DAĞILIM
1.Yıl
2.Yıl 3 Yıl 4.Yıl 5 Yıl
2.500
22.500
25.000
TEKLİF ONAYI
Proje /Alt Proje Lideri
Adı Soyadı
Gülşen YILDIRIM ŞENYER
Tarih
27.12.2013
Öneren Kuruluş Müdürü
Muharrem SATILMIŞ
27.12.2013
Prof. Dr. Gültekin YILDIZ
27.12.2013
Yrd. Doç. Dr. Laçine
AKSOY
27.12.2013
Ankara Üni. Vet. Fak. Hayv.
Besl. ve Besl. Has. A. B.D
Afyon Kocatepe Üni. Fen Fak.
Biyokimya ABD
İmza
71
DESTEK BAŞVURUSUNDA BULUNULAN PROJENİN
Yapay Merada Otlatma ile Yapay Meraya ilaveten Konsantre
Yem Verilmesinin Dağlıç ve Akkaraman Irkı Erkek Kuzuların
BAŞLIĞI
Besi Performansı, Karkas ve Et Kalitesi Özellikleri Üzerine
Etkisi
ARAŞTIRMA FIRSAT
Küçükbaş Hayvancılık
ALANI
ARAŞTIRMA
Islah ve yetiştirme
PROGRAMI
PROGRAM ÖNCELİĞİ Yüksek
PROJE ÖNERİSİ YAPAN KURULUŞUN
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
ADI
Müdürlüğü
Ereğli Yolu Üzeri P.K.125 Karatay - KONYA
ADRESİ
PROJE / ALT PROJE LİDERİ
Tülay CANATAN
ADI SOYADI
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
KURUMU
Müdürlüğü
332 3551290
TELEFONU
[email protected]
E-POSTA
PROJE / ALT PROJE YÜRÜTÜCÜLERİ
ADI SOYADI
KURUMU
Tülay CANATAN
B.D.U.T.A.E.M (Zooteknist)
Şükrü DURSUN
B.D.U.T.A.E.M (Vet.Hek)
Kürşat AKBULUT
B.D.U.T.A.E.M (Vet.Hek)
Mesut KIRBAŞ
B.D.U.T.A.E.M (Vet.Hek)
Mustafa KAN
B.D.U.T.A.E.M (İstatistik)
B.D.U.T.A.E.M (Hayvan
İbrahim HALICI
besleme)
Gazi ÖZCAN
B.D.U.T.A.E.M (Çayır mera)
Havva TEKİK
B.D.U.T.A.E.M (Zooteknist)
Mehmet TEZEL
B.D.U.T.A.E.M(Çayır mera)
B.D.U.T.A.E.M
Sümerya HAMZAOĞLU
(Laboratuvar)
Ankara Üniv. Zir. Fak.
Prof.Dr. Zehra SARIÇİÇEK
Hay.Bes.ABD
İstanbul Üniv Vet.
Prof.Dr. Alper YILMAZ
Fak.Zootekni ABD
Yüz. Yıl Üniv.Tıp Fak.
Doç.Dr. Sıddık KESKİN
Biyoistatistik ABD
E-POSTA
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
om
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
72
Yard. Doç.Dr. Sibel
ÖNENÇ
PROJE TOPLAM
BÜTÇESİ (TL)
300.000 TL
İŞBİRLİĞİ
İŞBİRLİĞİ YAPILAN
KURULUŞ
Ankara Üniv. Zir. Fak
İstanbul Üniv. Vet. Fak
Yüzüncü Yıl Üniv. Tıp Fak.
Namık Kemal Üniv.
Zir.Fak.
Namık Kemal Üniv. Hay.
Bes.ABD
PROJE BAŞLAMA
TARİHİ
(GÜN/AY/YIL)
01/01/2015
İŞBİRLİĞİ
ŞEKLİ
Danışmanlık
Danışmanlık
Danışmanlık
Danışmanlık
[email protected]
PROJE BİTİŞ TARİHİ
(GÜN/AY/YIL)
31/12/2017
PROJEDEKİ KATKISI
Besi çalışmasında teknik bilgi alışverişi
Et kalitesi çalışmasında teknik bilgi alışverişi
İstatistiki analizlerde teknik bilgi alışverişi
Etteki yağ asitleri analiz çalışmasında teknik
bilgi alışverişi
PROJE ÖZETİ
Proje Özeti: Bu proje ile ülkemizin yerli koyun ırklarımızdan Dağlıç ve Akkaraman ırkının
yapay merada besi performansları, karkas özellikleri, et kalite özellikleri ile yağ asidi
kompozisyonu belirlenecektir. Çalışmanın hayvan materyalini Dağlıç (20 baş) ve
Akkaraman (20 baş) ırkı kuzular oluşturacaktır. Deneme için her biri 12,5 da olmak üzere 2
parselden oluşan yapay mera (toplamda 25 da)kurulacaktır. Yapay mera karışımı 3 baklagil
ve 3 buğdaygil tohumlarından oluşacaktır. Mera otomatik sulama sistemi ile sulanacaktır.
Yapay merada 2 farklı besleme metodu uygulanacak. I.sadece mera, 2. Mera + ilave
konsantre yemleme. 2. gruptaki kuzulara ek yem olarak besi sonuna kadar hayvan başına
500 gr kesif yem verilecektir. Kesif yemler dışarıdan satın alınacak ve pelet formunda
verilecektir. Hayvanlar portatif bireysel bölmelerde otlatılacaktır. Besi süresi 75 gündür.
Kuzular 14 günde bir tartılacak, besinin belirli dönemlerinde ve besi süresi toplamında
hayvanların; günlük canlı ağırlık artışları, yem tüketimleri ve yemden yararlanma değerleri
gibi verim kayıtları tutulacaktır. Yine besinin belirli dönemlerinde besi başı ve besi sonunda
hayvanlarda kas ve yağ oluşumunu izlemek amacıyla ultrason cihazı ile ölçümler
yapılacaktır. Besi süresi sonunda toplam 40 baş hayvanın tamamı kesime sevk edilecektir.
Kesim ve karkas değerlendirmesi Enstitüde yapılacaktır. Proje 3 seneliktir. 1. yıl Meranın
kurulması ve yetiştirilmesi 2. yıl hayvan denemesi (karkas, et kalitesi çalışması) 3. yıl
verilerin analizi ve sonuç raporunun yazılması şeklinde olacaktır. Alınan et örneklerinde pH
ölçümleri, tekstür, su tutma kapasitesi, et rengi ve pişirme kaybı analizleri İstanbul
Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Karkas ve Et Kalitesi
Laboratuarında, Ette yağ ve yağ asitleri analizi ile besin madde analizleri (Ette kuru madde,
ham kül, ham protein analizleri) ise Namık Kemal Üniversitesi Merkezi Laboratuarında,
mera ot kalitesi ile ilgili analizler Enstitüdeki laboratuarda, yapılacaktır.
İstatistik analiz: Üzerinde durulan özellikler için tanımlayıcı istatistikler; Ortalama,
Standart Hata, Minimum ve Maksimum değer olarak ifade edilecektir. Hayvanlardan kesime
kadar alınacak özellikler için grup ortalamalarını ve periyotları (14 gün ara ile yapılan
ölçümler) karşılaştırmada iki faktörlü ve faktörlerden biri tekrarlanan ölçümlü varyans
analizi kullanılacaktır. Varyans analizini takiben farklı periyotları belirlemede Tukey çoklu
karşılaştırma testi kullanılacaktır. Kesim sonrası alınacak ölçümleri karşılaştırmada ise Tek
yönlü varyans analizi (One-way ANOVA) kullanılacaktır. Gruplar ve et kalitesi ile ilgili
özellikler arası ilişkileri belirlemede ise Çoklu faktör analizi veya Procrustes analizi
kullanılacaktır. Hesaplamalarda istatistik anlamlılık düzeyi %5 olarak alınacak ve
73
hesaplamalar için SPSS(ver:13) ve XLSTAT istatistik paket programlarından
yararlanılacaktır.
Anahtar Kelimeler: Dağlıç, Akkaraman, Mera, Karkas, Et kalitesi, Yağ asidi, Ultrason
Projenin Amacı ve Gerekçesi:
Hayvanların besin madde ihtiyaçlarının karşılanmasında ihtiyaç duydukları kaba
yemin sağladığı kaynakların başında meralar gelmektedir. Kaliteli kaba yemler esas olarak
çayır ve meralar ile yem bitkileri yetiştiriciliğinden sağlanmaktadır. Mesela; dünyada evcil
hayvanların kaba yem ihtiyacının yaklaşık % 70 inin meralaradan karşılandığı tahmin
edilmektedir (Brown ve Thorpe, 2008). Ülkemizde ise bu oranın % 28.6 olduğu
hesaplanmıştır (Gökkuş,1994). Bunun yanında uzun yıllar devam eden erken ve aşırı otlatma
ile ıslah ve bakım işlerinin yapılmaması, kullanıcılara belli bir yetki ve yükümlülük
getirilememesi nedeniyle meraların bitki örtüsü büyük oranda bozulmuş ve ot verimleri
azalmıştır(Gökkuş ve Koç,2001).
Ülkemiz hayvancılık sektörünün problemlerin başında yem sorunu gelmektedir.
Hayvancılık işletmelerinde yem girdilerin payı %60-70 arasındadır. Dolayısıyla bir
işletmenin yada ülkenin yem problemi çözülmeden hayvancılık ile ilgili sorunlara çözüm
üretmeye çalışmak mümkün değildir. Bu nedenle, hayvancılığın ekonomik olabilmesinin
önemli şartlarından birisi meraya dayalı olmasıdır. Konuyu bu noktadan bakıldığında,
özellikle İç Anadolu Bölgesi hayvancılığın yazları meraya, kışları da kuru kaba yemlere
dayalı olduğu, yani ekstansif bir yapı gösterdiği söylenebilir. Ülkemiz hayvanlarının bir
yılda tüketmiş olduğu, ham protein %68.7 ve enerjinin ise % 62.2’sinin çayır- mera ve
yaylalardan sağlandığı dikkate alındığında, meraların ülke hayvancılığı açısından önemi
daha iyi anlaşılmaktadır.
İç Anadolu Bölgesinde besi için çoğunlukla genç hayvanlar tercih edilse de, besi
süresi, kullanılan yemin yapısı, elde edilecek etin özelliği ve uygun kesim zamanı gibi
faktörler dikkate alınmamaktadır. Buda karlı ve kaliteli et elde etmede önemli bir sorun
oluşturmaktadır. Oysa ki etin, yağ oranının istenilen sevide, renginin taze ve sağlıklı et
görünümünde olması gibi özellikleri tüketici tarafından kabul edilir yapıda olması ve
bileşiminde insan sağlığı için faydalı unsurları bulundurur özellikte olması her zaman arzu
edilmektedir.
Bölgede besi genellikle yerli hayvanlar ve bunların melezleri ile yapılmaktadır. Besiye
alınan hayvanlara genel olarak otlatma döneminde hemen hemen hiç konsantre yem
verilmez. Hayvanlar mera sonundan itibaren 2 ve 3 aylık bir besi periyoduna tabi tutulduktan
sonra kesime sevk edilirler. Uygulanan bu geleneksel modelin dışındaki uygulamaların
Dağlıç ve Akkaraman eti özellikleri üzerine olan etkisinin bilinmemesi önemli bir eksikliktir.
Yani besi süresince yapay merada taze yeşil yemleri otlatmanın yanında meraya ilaveten ek
konsantre yemin kullanım döneminin ve miktarının belirlenmesi, bu hayvanlarının et
özelliklerinin belirlenmesine yardımcı olacağı gibi, bu iki yerli ırkın daha iyi tanınmasına
katkı sağlayacaktır. Böylelikle et kalitesi hakkında gerekli bilginin edinilmesi koruma altına
alınan bu yerli gen kaynaklarımızın yetiştiriciliği için bir gerekçe oluşturacak ve yetiştiriciye
belirli düzeyde teşvik edecektir.
Son yıllarda tüketicinin hayvansal gıda tercihini belirleyen en önemli öğelerden biri
hayvansal ürünün yağ asidi ve kolestrol kompozisyonudur. Doymuş ve doymamış yağ asidi
oranının kalp damar hastalıkları üzerine etkili olduğu, doymuş yağ asitlerince zengin
gıdalarla beslenmenin kalp damar hastalıklarına yakalanma riskini artırdığı bildirilmektedir.
Bu nedenle bazı tüketicilerin kırmızı et tüketiminden kaçındığı görülmektedir. Diğer yandan
koyun ve keçi ırkları üzerinde yapılan çalışmalarda etin yağ kompozisyonu bakımından
74
ırklar arasında farklılıklar bulunduğunu ve bazı ırkların doymamış yağ asitleri yönünden
diğerlerine oranla daha zengin olduğunu göstermektedir (Hoffman ve ark.,2003; Fisher ve
ark.,2000; Demirel ve ark.,2004).
Yetiştiriciler kasaplık hayvanlardan elde edilecek et miktarını önceden bilmek isterler.
Bunun için kullanılan en yaygın yöntem subjektif değerlendirme yöntemi olan puantajdır.
Fakat, hayvan vücudunun belirli bölgelerinin elle yoklanması şeklinde yapılan bu yöntem
uzun süreli uygulamalı çalışmalar yapmış deneyimli eksperler tarafından yapılması halinde
başarılı olabilmektedir. Son yıllarda geliştirilen Ultrason yöntemi ile vücudun bazı
bölgelerinde et, yağ, kemik alanları ve kalınlıkları ölçülerek, hayvan kesildiğinde elde
edilecek karkas ağırlığı, randımanı et, yağ, kemik miktarları ve oranları önceden
belirlenebilmektedir (Yardımcı ve Özbeyaz 1999). Objektif kasaplık canlı hayvan
değerlendirme yöntemlerinden Ultrason ile karkas değerlendirme yönteminin, ırk üzerinde
uygulanabilirliği denenmiş olacaktır.
Türkiye’de et koyunculuğunu geliştirmek amacı ile yurt dışından kültür ırkı koyunların
ülkemize yoğun girmesi sonucu zootekni alanındaki araştırmalar neredeyse bu ırklara doğru
yönlenmiş, yerli ırklarımız ile ilgili çalışmalar rafa kaldırılmıştır. Irk tescil çalışmalarında
yerli koyun ırklarımızı tanımlayıcı özellikler ile ilgili yakın tarihli literatürlere sık
rastlanılmaması bunu doğrulamaktadır. Dağlıç ve Akkaraman koyun ırkların etlerinin kalite
özellikleri konusunda ise yapılmış çalışma bulunmamaktadır. Kitabi bilgi olarak Dağlıç ırkı
etinin lezzet bakımından Kıvırcık ve Karayakadan sonra 3.sırada yer aldığı ayrıca Dağlıç
etinin Akkaramana nazaran daha kaliteli olduğu belirtilmektedir (Özcan,1990).
Türkiye yerli ırklarından Dağlıç koyun ırkının eti yerel halk tarafından beğenilmekte
ve kaliteli olarak nitelendirilmektedir. Ancak, gerek Dağlıç ırkının gerekse de Türkiye’de
yetiştirilen diğer koyun ve keçi ırklarının renk, gevreklilik, yağ asitleri ve kolestrol
kompozisyonu gibi et kalitesi özelliklerini belirlemeye yönelik yapılan araştırma sayısı
oldukça sınırlıdır.
Bu araştırmada, yerli gen kaynaklarımızdan Dağlıç ve Akkaraman ırkı kuzuların yapay
mera besisi ile meraya ilave ek yemlemenin besi, kesim karkas, et kalite özellikleri ile yağ
asidi kompozisyonu üzerine olan etkilerinin tespiti amaçlanmıştır.
Proje ile Elde Edilmek İstenilen Çıktılar ve Kullanım Alanlarını Açıklanmalıdır.
Yapay mera ve yapay meraya ilaveten ek yemlemenin et kalitesi üzerine etkisi,
Besi süresince yapay mera ve yapay meraya ilaveten ek yemlemenin hayvanlarda kas
ve yağ oluşumunun tespitinde, ultrason cihazının kullanılabilirliğinin sağlanması.
Bölgenin coğrafik şartlarına uyum sağlamış olan yerli gen kaynaklarımızdan Dağlıç ve
Akkaraman ırkı koyunların et kalitelerinin belirlenerek et sektörüne kazandırılması ve
tanıtımının sağlanması.
Yapay meralarda kuzu besisi yapmanın kuzuların et kalitesi belirlenmiş olacaktır.
Yapay mera ve yapay mera + ilave konsantre yemleme ile Dağlıç ve Akkaraman ırkı
koyunlarının yağ asidi profili de belirlenmiş olacaktır.
LİTERATÜR ÖZETİ: Kaya ve ark.,(2011),nın yaptıkları bir çalışmada merada otlatma ve
meraya ilave konsantre yem verilen Tuj ırkı kuzuların günlük canlı ağırlık artışı merada
otlayan, meraya ilave 200 g ve 400 g konsantre yem verilen kuzularda sırasıyla günde 153,
161 ve 183 g olarak belirlenmiştir. Meranın KM ve HS içeriği vejetasyonun ilerlemesiyle
artarken(%31.33-74.89, %29.08-34.68) HP içeriği ise %11.01’den %6.25’e inmiştir.
Kaya ve ark.,(2004), merada otlayan sütten kesilmemiş 2 aylık erkek Morkaraman ve
Tuj ırkı kuzular üzerinde otlama mevsiminde yapılan bir çalışmada, hayvanlar merada
otlatılmış ve meraya ek canlı ağırlıklarının %0.75’i oranında konsantre yem ile beslemişler
75
günlük canlı ağırlık artışı merada otlayan ve ek yem verilen grupta 208 ve 248 g olarak
belirlenmiştir.
Karslı ve ark.,(2003), merada otlatma sezonu boyunca tokluların günde ortalama 122
g canlı ağırlık kazandığı ve vejetasyonun ilerlemesiyle günlük canlı ağırlık artışın da
düştüğü saptanmıştır.
Macit ve ark., (2003), nın yaptığı bir çalışmada, 2,5 aylık yaşta sütten kesilen İvesi,
Morkaraman ve Tuj ırkı kuzuları meraya ek 450 g konsantre yem (%16 HP, 2500 kcal/kg
metabolik enerji) verilerek yapılan bir denemede kuzuların günlük 155, 172 ve 148 g canlı
ağırlık artışı sağladıklarını ifade etmişlerdir.
Kemp ve ark.,(1981)’in yaptıkları araştırmada üç gruba ayrılan kuzulardan iki gruba
değişik oranlarda ham protein ilavesi amacıyla konsantre yem verip, bir gruba ise sadece
mera şartları tahsis edilmiş ve bu çalışmada yalnızca merada otlayan hayvanlarda daha
yüksek lezzet değerine sahip olduğunu tespit etmişlerdir.
Rousset-Akrim ve ark.,(1997), çayırlarda hızlı büyüme yapan erkek kuzularla,
çayırlarda toplam yemin %42’si oranında ilave konsantre yem verilen ve yavaş büyüme
yapan erkek kuzuları karşılaştırmışlar, ek konsantre yem verilen hayvanların lezzet
yoğunluğunun daha yüksek olduğunu tespit etmişlerdir.
Önenç ve Kaya.,( 2003), son yıllarda kalp ve damar hastalıkları ile hayvansal yağ
arasındaki ilişki doğrultusunda tüketicilerin eğilimi dikkate alınarak yağsız et üretimi önem
kazanmıştır. Ancak zamanla yağsız et üretimi tercihinin karkas ve et kalitesini olumsuz
yönde etkilediği görülmüştür. Gerek üreticiyi gerekse tüketicileri memnun etmek açısından
orta yağlı karkas üretimi daha uygundur denilebilir. Ayrıca, orta yağlı karkaslarda fazla
kabuk yağının sıyrılarak sucuk, sosis gibi ürünlerde değerlendirilmesi olasıdır. Öte yandan,
karkasın yağlanma durumunun etin lezzeti ve gevrekliliği üzerinde olumlu yönde bir
etkisinin olduğu da bilinmektedir.
Özdoğan ve ark.,(2004). Et ve et ürünlerinde kaliteyi ve dolayısı ile tüketici beğenisini
belirleyen en önemli kriterler arasında satın alma esnasında etin rengi ve hijyenik koşulları,
pişirme aşamasında etin pişirme kaybı ve tüketim aşamasında etin kıvamı- tekstürü yer
almaktadır. Koyu et rengine ve sarı yağ rengine sahip etler tüketiciler tarafından yaşlı
hayvanlardan elde edilmiş, sert lezzetsiz ve düşük aromalı etler olarak değerlendirilmektedir
Dolayısıyla koyu et rengine sahip etler hem zor pazarlanmakta, hem de düşük fiyattan alıcı
bulmaktadır.
Tekstür,etin çiğnenmesi sonucu ağızda bıraktığı yumuşaklık veya sertlik derecesi
demektir. Etin tekstürü içermiş olduğu kas ve liflerin büyüklüğüne, sayılarına, bağ dokunun
miktarına bağlı olarak değişir(Arslan,2002). Et tekstürü, tüketim açısından, özellikle parça
etlerde çok büyük öneme sahiptir. Et tekstürü çiğ ve pişmiş etlerde ayrı ayrı değerlendirilir.
Ancak etler pişirilerek değerlendirildiği için pişmiş et tekstürü önen kazanmaktadır. Pişmiş
et tekstürü yani gevrekliliği ölçmek için çeşitli yöntemler geliştirilmiştir. Örnek olarak tek
ve çok iğneli özel problu pentarometreler ve shear metreler verilebilir.
Doğum yılı, cinsiyet ve yaş etkisinin dahil edildiği bir araştırma sonucuna göre,
m.longissimus dorsi için ultrason ile karkas ölçümleri arasındaki korelasyon 0.79 ila 0.87
olarak tespit edilmiştir. Aynı bölgedeki yağ miktarı için bu değer bir miktar daha düşük
(0.64-0.86) olduğu ifade edilmiştir. Araştırıcılar, bilhassa sütten kesim ve bir yaş döneminde
elde edilen ultrason verileri ile karkas ölçüleri arasındaki yüksek korelasyona dikkat
çekmişlerdir (Crews ve ark.,2002).
Diğer bir çalışmada, kuyruk kökünün 10 cm yukarısından 4’er cm lik çevresel alan
içerisinde ölçülen but yağ kalınlığının kondüsyon skoru ile ilişkili olduğu (P<0.001) ve
toplam yağ kalitesindeki varyasyonun %71’ini açıklayabildiği kaydedilmiştir (Gee ve
ark.,2003).
76
Kıvırcık koyunlarında satış öncesi ultrason yöntemiyle elde edilen verilerin
değerlendirildiği bir çalışmada ise, canlı ağırlık ile ultrasonik bel gözü kas alanı arasındaki
ilişki pozitif ancak ultrasonik örtü yağı arasındaki ilişki negatif bulunmuştur (Yaralı ve
Karaca,2004).
Kıvırcık ve Sakız x Kıvırcık melezi kuzularda göz kası genişliği, alanı ve sırt yağı
kalınlığı ultrasonik ölçüm parametrelerinin kendi aralarındaki ve bu özellikler ile canlı
ağırlık arasındaki fenotipik korelasyonların tümü istatiksel olarak önemli bulunmuştur
(Cemal ve ark,2004).
Karakaş koyunlarında ve melezlerinde, ultrasonik belgözü derinliği ile gerçek ölçüm
arasında pozitif, ultrasonik belgözü yağ kalınlığı ile gerçek belgözü alanı arasında negatif
korelasyon olduğu saptanmıştır. Araştırma sonucunda, Karakaş ve Karakaş melezi erkek
kuzularda, 37 haftalık yaşta gerçek bel gözü alanı, derinliği ve yağ kalınlığı değerleri için
kuzular arasındaki farklılığın tanımlanmasında ultrasonik öşçümler ve kesimhane ağırlığı
değerlerinin birlikte kullanılabileceği anlaşılmıştır (Gökdal ve ark,2004).
Ultrason ölçümleriyle, karkasın derecelendirildiği başka çalışmalarda, özellikle bel
gözü kas- yağ oranı, sırt yağı ve bel gözü alanının karkas derecesini (grade) doğrulukla
ifade edebildiği bildirilmiştir (Keefe ve ark., 2004; Walburger ve Crews, 2004).
Falco 100(Pie Medical, 3,5 MHz) cihazı ile Şarole boğaların m.longissimus dorsi ve
but yağı derinliği ölçülmüş ve bu değerlerin hayvanların scrotum çevresi ölçümleriyle
yüksek seviyede korelasyon gösterdiği bildirilmiştir.Ultrason yöntemiyle ölçülen iki özellik
arasındaki korelasyonu ise ile sıfıra yakın bulunmuştur(Janos ve ark.,2005).
De Villiers ve ark.,(2002), süt emen kuzulara günlük ortalama 300-350 g ilave
konsantre yem verilmesiyle canlı ağırlık artışının 132 g dan 190 g a çıktığını, pazara
yetişme süresinin ise 119 günden 77 güne indiğini bildirmektedir. Bhatt (2008), benzer bir
çalışmada deneme sonu canlı ağırlığının ilave yem verilen kuzularda daha yüksek olduğunu
(27 x 33) kg bildirmektedir. Alcock’un (2006) çalışmasında, 98.gün sütten kesim CA ilave
yem verilen kuzularda verilmeyenlerden 7.2 kg daha ağır bulunmuştur.
Kadim ve ark.,(2003), Batina, Dhofari ve Jabal Akhdar ırklarından oğlakların karkas
ve et kalitelerini karşılaştırdıkları bir çalışmada, genotipin pH ve pişirme kaybı üzerine
etkisini önemli bulmuşlardır.Et rengi özellikleri bakımından parlaklık indeksi (L*) açısından
gruplar arasındaki farklılık MLD ve Musculus semimembranosus için önemli, Musculus
semitendinosus kasları ve Musculus biceps femoris kasları için önemsiz; kırmızılık indeksi
(a*)ve sarı indeksi (b*) açısından ise gruplar arası farklılık tüm incelenen kaslar için
önemsiz bulunmuştur.
Fisher ve ark.,(2000), Welsh Mountain, Soay ve Suffolk ırklarından kuzular üzerinde
yürüttükleri araştırmalarda, M.semimembronosus’taki yağ asidi kompozisyonu açısından
genotip grupları arasındaki farklılığın önemli olduğunu bildirmişlerdir. Araştırmada, Welsh
Mountain kuzuların en yoğun intramuscular yağ konsantrasyonuna (toplam yağ asidi),
palmitik ve oleik yağ asidi düzeyine sahip olduğu, Soay kuzuların ise önemli düzeyde düşük
palmitik ve oleik yağ asidi düzeyine sahip olduğu bildirilmiştir. Soay kuzularında et
parlaklılığı(L*) diğerlerine oranla daha düşük( daha koyu) bildirilmiştir.
Akdeniz ülkelerinde genellikle açık pembe renkli, yumuşak kuzu ve oğlak eti tercih
edilmektedir (Santos- Silva ve ark., 2002). Bu ülkelerde yetiştirilen koyun ve keçi ırklarının
et kalitelerini ortaya koymak üzere birçok araştırma yapılmıştır. Sanudo ve ark., (1997), nın
yaptıkları bir çalışmada Castellana ırkından kuzuların Churra, Marchega ve Awassi
ırklarından kuzulara oranla daha koyu et rengine (L*) ve daha düşük sarı indeksine (b*)
sahip olduklarını, ayrıca bu ırkta pişirme kaybının diğer ırklara oranla daha fazla olduğunu
bildirmişlerdir. Aynı çalışmada et pH’sı su tutma kapasitesi ve pik kesme kuvveti açısından
genotipler arasındaki fark önemli bulunmamıştır.
77
Santos-Silva ve ark.,(2002), genotip, besleme sistemi ve kesim ağırlığının kuzularda
karkas ve et kalitesi etkilerini araştırdıkları bir çalışmada, etin su tutma kapasitesi, pişirme
kaybı ve renk özellikleri (L*,a*,b*) için Merino Branca ve Ile de France x Merino Brance
kuzular arasındaki farklılığın önemli olmadığını bildirmişlerdir. Aynı çalışmada, etin pik
kesme kuvveti açısından genotip grupları arasındaki farklılık önemli bulunmuş ve Merino
Branca genotipindeki kuzuların etlerinin melez kuzulara oranla daha yumuşak olduğunu
bildirmişlerdir.
Et kalitesi tanımlamasında yağ asidi kompozisyonu önemli rol oynar (Melton, 1990;
Wood ve Enser 1997; Wood ve ark. 1999). İnsan beslenmesinde yağ miktarı özellikle de
doymuş yağ asitlerinin oranı koroner arter hastalıklarında majör risk faktörüdür. Bu nedenle
çoklu doymamış yağ asitleriyle (PUFA) doymuş yağ asitleri arasındaki oran ile n-6/n-3
arasındaki oran yağın besleme değerinin belirlenmesinde iki önemli indekstir (Santos-Silva
ve ark.,2002). Farklı üretim sistemlerinin et kalitesine etkisini belirlemeye yönelik yapılan
çalışmalarda, merada otlayan kuzularda omega-3 yağ asidinin daha yüksek, konsantre yemle
beslenen kuzularda ise omega-6 yağ asidinin daha yüksek olduğu bulunmuştur (Fisher ve
ark.,2000; Sanudo ve ark.,2000). Ot silajı ve kuru ota farklı oranlarda konsantre yem
ilavesinin etkisinin araştırıldığı bir çalışmada, konsantre yem oranının azalmasıyla kaslar
arasında PUFA oranında azalma olduğu belirlenmiştir (French ve ark.,2000).
MATERYAL ve METOT:
Hayvan Materyali
Araştırmada kullanılacak hayvan materyalini Bahri Dağdaş Uluslararası Tarımsal
Araştırma Enstitüsü Koyunculuk ünitesinde yetiştirilen Akkaraman ırkı ile Konya Selçuklu
İlçesi Tatköy’de Halk elinde Evcil Hayvan Genetik Kaynakları Projesi’nde yer alan Dağlıç
koyunu oluşturacaktır.
Deneme Lokasyonu
Deneme Konya, Bahri Dağdaş Uluslararası Tarımsal
Müdürlüğünde (37º51’ N, 32º33’ E, 1008 m a.s.l.) yürütülecektir.
Araştırma
Enstitüsü
Yapay Mera Karışımı
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsünde Koyunculuk ünitesi için
tahsis edilmiş olan araziye yapay mera kurulacaktır. Bitki materyali olarak Konya ekolojik
şartlarına uyum sağlamış olan çoklu karışımdan en iyi sonucu vermiş olan yem bitki türleri
ve karışımdaki oranları Tablo 1’de belirtilmiştir.
Tablo 1: Yapay merada kullanılacak olan yem bitki türleri ve oranları
Tür
Karışımdaki
Oranı %
Buğdaygillerden
Lolium perenne L(Çok yıllık çim)
% 30
Festuca arundinacea (Kamışsı yumak) % 20
Dactylis glomerata (Domuz ayrığı)
%20
Baklagillerden
Onobrychis sativa (Korunga)
%20
Trifolium repens (Ak üçgül)
%7
Medicago sativa (Yonca)
%3
Toplam ekilecek tohum miktarı
Kg/ a
Karışım
Miktarı (kg)
1,5
1
1
1,5*25=37,5kg
1,0*25=25 kg
1,0*25=25 kg
1
0,35
0,15
5 kg
1,0*25=25 kg
0,35*25=8,75kg
0,15*25=3,75kg
1 5 kg
78
Deneme Deseni
Tesadüf parsellerinde faktöriyel deneme deseninde (ırk*besleme sistemi) 10 tekerrürlü
olarak kurulacaktır. Denemeye alınan kuzular aynı cinsiyette 75 gün de sütten kesilmiş
kuzular olacaktır. Deneme girişinde kuzuların ağırlıkları ölçülecek ve varyans analiz
modeline besi başı ağırlıklar kovaryant olarak eklenecektir. Otlatma denemesi, her biri 12,5
da büyüklüğünde 2 adet parselden oluşacaktır. Yapay mera denemesinde iki ırk (Dağlıç ve
Akkaraman ) ve iki farklı besleme metodu uygulanacaktır. 1. Sadece mera 2. Meraya
ilaveten ek yemleme.
Meranın kurulması
Denemenin yürütüleceği mera alanları Koyunculuk ünitesinin mera ihtiyacını
gidermek için ayrılmış olan arazidir. Koyuncuk ünitesinin hemen yanında yer almaktadır.
Kurulacak olan mera alanı toplam 25 da dır. Çalışmada kullanılacak olan tohumların küçük
olması, çimlenme ve çıkış zorlukları dikkate alındığında tohum yatağı özenle hazırlanacaktır.
Mera tesis edilecek arazi sonbaharda pullukla sürülecek, ilkbaharda ikileme ile uygun
tesviye yapılarak tohum yatağı hazır hale getirilecektir. Tohum ekimi 2015 yılı Mart ayında
(iklim şartlarına göre) tahıl mibzeri ile yapılacaktır. Ekim derinliği 1- 1,5 cm olarak
ayarlanacaktır.
Projenin yürütüleceği araziden alınacak olan toprak örneklerinin analizi dikkate
alınarak (Kacar, 1972) dekara ne kadar gübre verileceği hesap edilerek ekim sırasında DAP
(Diamonyum fosfat), mera yetiştikten sonra ilk biçimden önce Fosfor ( trible süper fosfat)
diğer biçimlerde ise saf azot gübresi (amonyum nitrat) verilecektir. Ekim öncesinde ve
bitkilerin gelişme döneminde yabancı otlarla mücadele edilecektir. Mera parselleri deneme
başlangıcında kurulacak olan otomatik sulama sistemi ile sulanacaktır. Mera parsellerinin
etrafı kafesli tellerle çevrilecektir. İlk yıl meralar otlatılmayacak, bitkilerin büyüme ve
gelişme durumlarına bakılacaktır. 1. yıl otlatma yapılmayacağı için merada yetişen otlar
biçilerek hayvanların önlerine verilerek değerlendirilecektir. Otlatma denemesi 2016 yılında
Nisan ayı sonunda başlatılacaktır. Kafes muhafaza ve biçimleri ile otlatma öncesi ve
sonrasındaki meraya ait üretim değerleri kaydedilecektir. Kafesler (kuatratlar) 1mx1m=1m²
ebatlarında olacaktır. Diskmetre ile her parselde ve parsel dâhilindeki kafeslerde yapılacak
çoklu gözlemlerle kalibrasyon sağlanacaktır. Otlatma gün sayısının sonunda parselde kalan
yeşil ot biçilecek ve hesaplamalara dâhil edilecektir. Araştırma süresince meradan; yeşil ve
kuru ot verimi (kg/da), botanik kompozisyon (%) ve besin madde bileşimi gibi ölçüm ve
gözlemlerde alınacaktır. Her parsel 50 m x 250 m= 12,500 m² ebadında olacak şekilde,
toplam 12,500 m² x 2= 25,000 m² alan kullanılacaktır.
Meradan alınacak olan örneklerinin kimyasal Analizleri: Otlar 1 mm elek çapına sahip
değirmende öğütülerek analizlerde kullanılacaktır. Yemlerin kuru madde (KM) oranı (%);
örnekler 105ºC’de 4 saat etüvde kurutularak, ağırlık (su) kaybını belirleme esasına
dayanılarak nem oranı tespit edilecektir. Kül oranı (%) ise; örnekler kül fırınında 550 ºC’de 4
saat kül fırınında rengi beyaz ya da açık gri renk olana kadar yakılarak kül oranı tespit
edilecektir (Karabulut ve Canbolat 2005). Homojen şekilde öğütülen mera örneklerinin ham
protein oranı N*6,25 formülü ile hesaplanacak ve azot tayin cihazı LECO FP 528 ile
belirlenecektir (AOAC 1990). Ham yağ analizi de AOAC (1990) da bildirilen yönteme göre
Soxhelet cihazında yapılacaktır. Yemlerin hücre duvarı bileşenlerini oluşturan nötr deterjan
lif (NDF(Selüloz+lignin+hemiselüloz)), asit deterjan lif (ADF(Selüloz+lignin)) ve ham
selüloz analizleri ise Van Soest ve ark. (1991) tarafından bildirilen yöntemlere göre
ANKOM 200 Fiber Analyzer (ANKOM Technology Corp. Fairport, NY, USA) cihazı
kullanılarak analiz edilecektir. Mera ot kalitesi ile ilgili analizler Enstitüdeki laboratuarda
yapılacaktır. Mera analizleri için laboratuar malzemesi alımı yapılacaktır.
79
Hayvan Materyali
Kuzular, Enstitünün koyunculuk ünitesinden(Akkaraman erkek kuzu) ve Evcil Hayvan
Genetik kaynakları projesinde yer alan Konya İli Selçuklu ilçesi Tatköy köyündeki bir
işletmeden(Dağlıç erkek kuzu) satın alınacaktır. Her iki ırktan yaklaşık aynı yaş grubundan
sütten kesilmiş 20’şer baş kuzu toplamda 40 baş kuzu kullanılacaktır.
Anaç koyunlar 15-30 Eylül tarihleri arasında tohumlanacaktır. 3-4 yaşlı Akkaraman ve
Dağlıç anaç koyunlardan doğan yaşları birbirine yakın sütten kesilmiş 2,5 aylık yaşta (75.
gün) erkek tekiz kuzular seçilecektir. Kuzular 2,5 aylık yaşa kadar anaları ile birlikte
kalacaklar ve önlerinde rumen gelişimi için kuzu başlangıç yemi (% 18 HP 2800 kcal ME)
bulundurulacaktır. Deneme grupları her iki grup canlı ağırlıklar eşit ve 20 şer baş Dağlıç ile
Akkaraman kuzusu içerecek şekilde oluşturulacaktır. Araştırma 14 günlük alıştırma ve 75
günlük merada otlatma olmak üzere iki dönemde yürütülecektir. Alıştırma dönemi
başlangıcında iç ve dış parazitlerin olası etkilerini ortadan kaldırmak amacıyla ağız yoluyla
oxan ve meraya geçişte herhangi bir problemle karşılaşmamak amacıyla ise enterotoksemi
aşısı yapılacaktır.
Daha sonra kuzulara kulak numaraları takıldıktan sonra her bir muamelenin başlangıç
ağırlığı eşit olacak şekilde tesadüfî olarak tek tek dağıtılacaktır. Her bir parselde bireysel
bölmelerde 10 baş Dağlıç erkek kuzu, 10 baş Akkaraman erkek kuzu toplamda 20 baş kuzu
bulundurulacaktır. Böylece her iki parselde toplamda 40 baş kuzu ile çalışılacaktır.
Parsellerde 20’şer adet portatif bireysel bölmelerin yanında 20’şer adet de yedek portatif
bireysel bölmeler bulundurulacaktır. Portatif bireysel bölmelerin ebatları 2m x2m= 4m²
olacaktır. Kuzular portatif bireysel bölmelerde bir gün kalacaklar, 2. Gün yedekte
bulundurulan portatif bölmelere aktarılacaklardır (Şekil 1). Portatif bölmelerde suluklar ve
meraya ilaveten ek yemleme yapılan grubun bölmelerinde de yemlikler bulunacaktır. Ayrıca;
kuzu bölmelerinin dışında hiç otlatılmayan kısım da yer alacaktır. Kuzular diğer bölmelere
aktarıldıktan sonra kafes içi otlar biçilecektir. Otlatılmayan kısımdaki ot kapasitesinden,
otlatılan kısımdaki kalan ot kapasitesinin farkı bir kuzunun günlük yediği ot miktarını
verecektir (Şekil 1). Kuzular otlarken güneşin ultraviyole ışınlarından etkilenmemeleri için
portatif bölmelerin üzerine belirli yüksekte seyyar file örtü ile kapatılacaktır. Suluklar
düzenli olarak kontrol edilip, yeterli düzeyde temiz su bulunmasına özen gösterilecektir.
Kuzuların canlı ağırlıklarının belirlenmesinde 50 gr hassasiyetli elektronik tartı
kullanılacaktır. Canlı ağırlık tartımları 14 günde bir olmak üzere, deneme başı ve deneme
sonunda ise 3 gün ardışık tartım sonunda ortalaması alınarak belirlenecektir.
Şekil1. Kuzuların meradaki yerleşim planı
1.PARSEL: MERA 250m x 50m= 12.500m²
Otlatılmay
an kısım
Otlatılmay
an kısım
1.Gün
otlatma
2.gün
otlatma
3.gün
4.gün
Bireysel bölmeler
2m x 2m=4m²
Bu şekilde otlatma 75. gün son
bulacak.
Dağlıç erkek kuzu (10 baş) +Akkaraman erkek kuzu (10 baş) = 20 baş kuzu
80
2.PARSEL: MERA + EK YEMLEME (250mx50m=12.500m²)
Otlatılma
yan kısım
Otlatılma
yan kısım
Bireysel bölmeler
2m x 2m=4m²
Bu şekilde otlatma
75.gün son bulacak.
1.Gün
otlatma
2.gün
otlatma
3.gün
4.gün
Dağlıç erkek kuzu (10 baş) +Akkaraman erkek kuzu (10 baş) = 20 baş kuzu
Besi denemesi 75 gün sürecektir. 1. Parseldeki kuzular sadece meradan
yararlanacaklar, 2. Parseldeki kuzulara ise meraya ilave olarak 500 g/baş olacak şekilde ek
yemleme (% 16 HP, 2700 kcal/kg ME) uygulanacaktır. Kuzuların meradan daha fazla
yararlanabilmeleri amacıyla ek yemleme 500 g/baş/gün ile sınırlandırılacaktır. Ek yemleme
sabah (8:30) ve akşam (16:00) olmak üzere iki eşit miktarda verilecektir. Kuzu büyütme
yemi pelet formunda dışarıdan (yem fabrikasından) satın alınacaktır. Her gün önlerinde
kalan yemler toplanıp tartılacaktır. Verilen yemden artan yem farkı kuzuların günlük ne
kadar kesif yem tükettikleri de belirlenmiş olacaktır. Çalışmanın bu bölümünde araştırılacak
olan parametreler, canlı ağırlık (CA), canlı ağırlık artışı (CAA), yem tüketimi ve yemden
yararlanmadır.
Besinin belirli dönemlerinde (besi başı ve besi sonu) kuzularda kas ve yağ oluşumunu
izlemek amacıyla ultrason cihazı (saha amaçlı bataryalı, 5.0MHz linear problu) ile ölçümler
yapılacaktır. Ölçümler, yağlanmayı görmek için but üzerinden, M.longissimus dorsi (göz
kası) kesit alanı ve kabuk yağı kalınlığını ölçmek için 12. ve 13. kaburgalar üzerinden yatay
ve dikey olmak üzere 3 noktadan tespit edilecek, karkasların yağlanma dereceleri 1-5 puan
üzerinden (1- yağsız, 2- az yağlı,3- orta yağlı, 4- yağlı, 5- çok yağlı) (Şekil 2),
belirlenecektir.
3-4 yaşlı analardan doğan yaşları birbirine yakın tekiz erkek kuzuların oluşturduğu
sadece mera ve mera + ek yemleme besi grubunda bulunan toplam 40 baş kuzunun kesim ve
karkas özellikleri incelenecektir. Kesim ve karkas değerlendirmesi Bahri Dağdaş Uluslar
arası Tarımsal Araştırma Enstitüsü’nde yapılacaktır. Kuzular kesim öncesi yaklaşık 18 saat
aç kalacaklardır. Kuzular kesimden hemen önce tekrar tartılarak kesim ağırlıkları
belirlenecektir. Kesim sonrası karkaslar ayrı ayrı numaralandırılacak ve aşağıdaki özellikler
belirlenecektir.
Sıcak karkas ağırlığı (hayvanların kesilip yüzülmesinden sonra baş, dört ayak ve iç
organların ayrılması ile böbrek ve böbrek yağlarının da dahil edilerek alındığı kg cinsinden
sıcak gövde ağırlığıdır).
Sıcak karkas randımanı ( sıcak karkas ağırlığının kesim öncesi canlı ağırlığa %
oranıdır).
Soğuk karkas ağırlığı (soğuk hava deposunda +4 °C’de 24 saat dinlendirilen karkasın
böbrek ve böbrek yağlarının da dahil edildiği kg cinsinden ağırlığıdır).
Soğuk karkas randımanı (soğuk karkas ağırlığının kesim öncesi canlı ağırlığa %
oranıdır).
Soğutma kaybı (sıcak ve soğuk karkas ağırlıkları arasındaki farkın sıcak karkas
ağırlığına % oranıdır).
Deri, baş, dört ayak ağırlıkları tartılıp kaydedilecektir.
Bazı iç organların ağırlıkları ( kalp, akciğer, karaciğer, böbrekler, iç yağ)
Karkas ölçüleri (göğüs çevresi, göğüs derinliği, karkas uzunluğu, but çevresi, but
81
genişliği) Soğuk karkaslardan karkas ölçüleri Eliçin ve ark. (1976) ve Ertuğrul’un (1985)
bildirişlerine göre ölçü bastonu ve ölçme şeridi ile alınacaktır.
Böbrek ve leğen yağı ağırlığı
Karkas parçalanmasında Colomer-Rocher ve ark. (1987)’nin bildirdiği şekilde,
karkaslar askı üzerinde omurga boyunca iki eşit parçaya ayrılacak ve tüm parçalama
işlemleri sol yarım karkas üzerinde yapılacaktır. Bu yönteme göre sol yarım karkas, omuz
başı, sırt-bel, etek, ön kol, but ve boyun olmak üzere altı parçaya ayrılacaktır. Ayrıca 12-13.
kaburgalar arasından aydınger kağıdına çizilen Musculus longissimus dorsi(göz kası) alanları
planimetre ile ölçülerek kaydedilecektir.
Planimetre alan hesabında aşağıdaki formül kullanılacaktır.
F= n x q
F= Alan (cm²)
n= Planimetre okuması
q= Verniyer birim alanı (cm²)
Et Kalite Özellikleri
Alınan et örneklerinde pH ölçümleri, tekstür, su tutma kapasitesi, et rengi ve pişirme
kaybı analizleri İstanbul Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Karkas ve
Et Kalitesi Laboratuarında yapılacaktır.
· Karkas PH’sı ve karkas sıcaklığı ölçümleri
Kesimden hemen sonraki ve 24 saat sonraki kas pH’sı ve karkas sıcaklıkları 12-13.
costalar arasından M. longissimus thoracisten ölçülecektir. Bu amaçla ısı ayarlı et pH metresi
kullanılacaktır.
· Su tutma kapasitesinin belirlenmesi
Su tutma kapasitesini ölçmek için “pasif damlama kaybı” metodu (Honikel, 1998)
izlenecektir. Bu amaçla M. longissimus dorsi’den 2 cm kalınlığında bir örnek alınacak ve
tartılacaktır(Ağ1). Alınan örnek polietilen bir poşet içerisine, poşete temas etmeyecek
şekilde iple asılacak ve 24 saat +4 0C’de bekletildikten sonra tekrar tartılacaktır (Ağ2). Pasif
damlama kaybı, ilk tartım ağırlığının son tartım ağırlığına oranı şeklinde hesaplanacaktır.
· Et ve yağ renginin ölçülmesi
Et ve yağ rengi ölçümü için L*, a*, b* sistemi ile ölçüm yapan, bilgisayar bağlantılı bir
Chromometer (Minolta CR 400) kullanılacaktır. Bu sistemde yapılan ölçümlerde üç temel
renk parametresi (L*= parlaklık, a*= kırmızı renk indeksi, b*= sarı renk indeksi) rakamsal
olarak belirlenmektedir. Parlaklık (L*) için ölçüm aralığı 0 ila 100 arasında değişmekte olup
0 değeri siyahı, 100 değeri ise beyazı karşılamaktadır. Kırmızı renk indeksi (a*) ve sarı renk
indeksi (b*) için ise ölçüm aralığı -60 ile +60 arasında değişmektedir. Kırmızı renk
indeksinde düşük değerler daha yeşili, yüksek değerler daha kırmızıyı ifade ederken sarı renk
indeksinde düşük değerler daha maviyi, yüksek değerler ise daha sarıyı karşılamaktadır
(Murray, 1995).
Yağ rengi ölçümü karkaslar +4 0C’deki soğuk hava deposunda 24 saat bekletildikten
sonra kuyruk kökünden üç farklı noktadan ölçülerek belirlenecektir. Et rengi ölçümü için
alınan numuneler vakumla paketlenecek ve 3 gün +40C’de olgunlaştırılacaktır. Olgunlaşma
sonrasında et numunesinden 2 cm kalınlığında bir parça kesilecek ve kesit yüzeyi yukarı
gelecek şekilde plastik bir tabağa yerleştirilecek, üzerleri polietilen bir streçle kaplanacaktır.
Her numuneden kesit alınır alınmaz (0. dak.), 1 saat sonrası ve 24. saatlerde olmak üzere 3
kez renk ölçümü yapılacaktır. Bu süreçte numuneler +4 0C’de ve ışık altında muhafaza
edilecektir. Her bir renk ölçümünde alınan numunenin kesit yüzeyinin yağsız bölümünden
chromometer aracılığı ile 3 ölçüm yapılacak ve bu ölçümlerden elde edilen değerlerin
ortalaması alınacaktır. Ette renk canlılığı (Chroma=C*) ve renk tonu (Hue angle=H*) ise
kırmızı ve sarı renk indekslerinden yararlanılarak aşağıda verilen formüllerle hesaplanacaktır
82
(Murray, 1995).
C*=(a*2+b*2)1/2 , H*= tan-1 (b*/a*)
· Pişirme kaybının ölçülmesi
Pişirme kaybını ölçmek amacıyla Honikel (1998),tarafından bildirilen yöntem
uygulanacaktır. Bu amaçla M. longissimus dorsi’den yaklaşık 150’şer g örnek alınacak ve
ağırlıkları kaydedilecektir. Daha sonra örnekler ısıya dayanıklı polietilen poşetler içersine
konulacak, poşetler su geçirmeyecek şekilde vakumla paketlenecek ve 80 0C’deki su
banyosunda 45 dakika bekletileceklerdir. Bu süre sonunda örnekler su banyosundan
çıkarılacak ve akan su altında 60 dakika soğutulacaklardır. Daha sonra kas örnekleri
poşetlerinden çıkarılarak kağıt havlu ile kurulanacak ve pişirme sonrası ağırlıkları
kaydedilecektir. Pişirme kaybı (%), pişirme öncesi ve sonrası ağırlıklar arasındaki farkın
başlangıç ağırlığına oranı olarak hesaplanacaktır.
· Tekstür analizi
Tekstür analizi için Warner–Bratzler shear force cihazından yararlanılacaktır. Bu
analizde 80 0C’deki su banyosunda 45 dakika pişirilen örnekler kullanılacaktır. Bu etlerden
kas liflerine paralel olacak şekilde 1 x 1 cm kesitinde ve 3 cm uzunluğunda 6’şar örnek
alınacaktır. Her bir örnek için Warner–Bratzler bıçağının kesmesi sırası uygulanan en yüksek
kuvvet (kg/cm2) ve kuvvet x zaman grafiği bilgisayara kaydedilecektir. Bir hayvanın bir
kasına ait pik kesme kuvveti değeri (peak shear force), 6 örnekten elde edilen ölçümlerin
ortalaması alınarak belirlenecektir.
· Yağ asidi analizleri
Ette yağ ve yağ asitleri analizi; MLD kasından alınan örnekler öncelikle kıyılacak ve
homojen bir karışım haline getirilecektir. Kıymadaki yağ, Christie (1992) tarafından
bildirilen kloroform/metanol (2:1, v/v) standart karışımında homojenize edilerek
çıkartılacaktır. Elde edilen yağlara daha sonra esterleşme işlemi uygulanacaktır (Christie,
1992). Analiz edilecek yağ asidi metil esterleri (YAME), Namık Kemal Üniversitesi Merkezi
Laboratuarında
Shimadzu
QP2010-Ultra
Model
Gaz
kromatografisi
Kütle
spektrofotometresi ile belirlenecektir.
Besin madde analizleri
Ette kuru madde, ham kül, ham protein analizleri Weende analiz yöntemine göre
belirlenecektir (AOAC 2003). Besin madde analizleri Namık Kemal Üniversitesi Merkezi
Laboratuarında yapılacaktır.
İstatistik Analizler
Üzerinde durulan özellikler için tanımlayıcı istatistikler; Ortalama, Standart Hata,
Minimum ve Maksimum değer olarak ifade edilecektir. Hayvanlardan kesime kadar alınacak
özellikler için grup ortalamalarını ve periyotları (14 gün ara ile yapılan ölçümler)
karşılaştırmada iki faktörlü ve faktörlerden biri tekrarlanan ölçümlü varyans analizi
kullanılacaktır. Varyans analizini takiben farklı periyotları belirlemede Tukey çoklu
karşılaştırma testi kullanılacaktır. Kesim sonrası alınacak ölçümleri karşılaştırmada ise Tek
yönlü varyans analizi (One-way ANOVA) kullanılacaktır. Gruplar ve et kalitesi ile ilgili
özellikler arası ilişkileri belirlemede ise Çoklu faktör analizi veya Procrustes analizi
kullanılacaktır. Hesaplamalarda istatistik anlamlılık düzeyi %5 olarak alınacak ve
hesaplamalar için SPSS (ver:13) ve XLSTAT istatistik paket programlarından
yararlanılacaktır.
83
Şekil 2: Koyunda vücut kondüsyon dereceleri (Thompson ve Meyer 1994)
84
85
x
x
x
x
x
x
26
36
x
25
x
24
x
23
x
22
x
21
x
20
9
19
8
18
7
17
6
16
5
15
4
14
3
12
2
11
1
13
Alet ekipman ve sarf
malzemelerinin temini,
projeye kaynak teşkil
edecek literatür temini
için çalışma yapılması
Deneme
merasının
kurulması,
düzenlenmesi,
bakımı, gübrelenmesi
Mera etrafının çitlerle
çevrilmesi,otomatik
sulama
sisteminin
kurulması
Tohumlamalar
Kuzuların Doğumu ve
tartımı
Hayvanlarının portatif
bölmelere alınması ve
otlatılması
Besiye başlama
Meradaki ot verimlerinin
belirlenmesi
Kuzuların
kesime
gönderilmesi
ve
et
örmeklerinin ve karkas
değerlerinin alınması
Et
numunelerin
laboratuar aalizi
Mera otlarının laboratuar
analizi
Elde edilen tüm verilerin
toplanması
ve
istatistiksel analizi,sonuç
raporu
Aylar
10
Yapıla
cak
Faaliy
etler
ÇALIŞMA TAKVİMİ
Çalışma Takvimi Çizelgesi
x
x
x
x
x
x
x
x
x
x
x
x
x
x
86
YÖNETİM DÜZENİ
Proje Yürütücülerinin Projeye Katkıları
Adı Soyadı
Tülay CANATAN
Şükrü DURSUN
Kürşat AKBULUT
Mesut KIRBAŞ
Mustafa KAN
Gazi ÖZCAN
İbrahim HALICI
Havva TEKİK
Mehmet TEZEL
Sümerya HAMZAOĞLU
Prof.Dr.Zehra SARIÇİÇEK
Prof.Dr.Alper YILMAZ
Doç.Dr. Sıddık KESKİN
Yard.Doç.Dr.Sibel ÖNENÇ
Yapılacak Faaliyetlerdeki Sorumlulukları
Mera çalışmaları,tohumlama, doğum,tartım, besi
çalışması,karkas,et kalitesi laboratuar analizleri, sonuç
raporunun yazılması
yağlanmayı görmek için ultrason kullanımı
Tohumlama,tartım,karkas çalışması, yağlanmayı görmek
için ultrason kullanımı
Tohumlama, doğum, tartım, yağlanmayı görmek için
ultrason kullanımı
Verilerin analizi ,sonuç raporunun yazılması ve
yorumlanması
Meranın kurulması, bakımı,ot numunelerin alınması ve
analize hazır hale getirilmesi
Meranın kurulması, yetiştirilmesi, besi çalışması, karkas
çalışmalarında
Tartım, besi çalışması, karkas, mera laboratuar analizleri
Meranın kurulması, bakımı,ot numunelerin alınması ve
analize hazır hale getirilmesi
Mera ile ilgili laboratuvar çalışmaları
Besi çalışmasında danışmanlık,sonuç raporunun
yorumlanması
Et kalitesi laboratuar çalışmasında danışmanlık, sonuç
raporunun yorumlanması
Verilerin analizinde danışmanlık, sonuç raporunun
yorumlanması
Etteki yağ ve yağ asitleri analizinde danışmanlık, sonuç
raporunun yorumlanması
Çalışma Takvimi
2015-2017
2016-2017
2016-2017
2015-2017
2017
2015-2016
2015-2017
2016-2017
2015-2016
2015-2016
2016-2017
2016-2017
2017
2016-2017
Proje Sonuçları Uygulama Aktarımı
Yapay Merada Otlatma ile Meraya ilaveten Konsantre Yem Verilmesinin
Proje Adı
Dağlıç ve Akkaraman Irkı Erkek Kuzuların Besi Performansı, Karkas ve Et
Kalitesi Kalitesi Üzerine Etkisi
PROJENİN AMACI: Projenin genel amaçları değil, çıktılara yönelik amaçlar kısaca yazılır.
· Çalışma sonucunda Dağlıç ve Akkaraman erkek kuzuların et verimi, kalitesi ve yağ
asidi kompozisyonu bakımından ırkı tanımlayıcı bilgiler elde edilecektir. Elde edilen bu
bilgiler, ırk tescil formatında, bu iki ırk ile ilgili eksik bilgilerin tamamlanmasında
kullanılabileceği gibi bilimsel çalışmalara da yardımcı olacaktır.
· Yapay mera besisi yapmanın et kalitesi ve et tüketim güvenirliliği gibi faktörler
üzerine olan etkisinin yetiştiriciler tarafından bilinmesi kontrollü bir besicilik yapılmasını
teşvik edecektir.
· Bölgenin coğrafik konumuna uyum sağlamış yerli genetik kaynaklarımızdan Dağlıç
ve Akkaraman ırkı kuzuların et kaliteleri belirlenerek et üretim sektörüne kazandırılması ve
tanıtımının sağlanması.
· Araştırma sonuçlarının olumlu çıkmasıyla; yetiştiricilere yapay mera besisi ile ilgili
önemli tavsiyeler bulunulabilecek, aynı zamanda et kalitesi ön plana çıkarılarak etkin tanıtım
ve pazarlama stratejileri geliştirilmesine zemin hazırlanmış olacaktır.
ÇIKTILARIN UYGULAMAYA AKTARILMASI VE YAYGINLAŞTIRILMASI
Proje Çıktıları
Çıktıların Uygulamaya Aktarılma Mekanizmaları
Sıra
Proje sonuç raporu
Sonuç raporu kitapçığı
1
Bildiriler
Ulusal kongreler ve sempozyumlar
2
87
3
4
Yayınlar (Makale)
Yurt içi veya yurt dışı hakemli dergiler
Yetiştirici ve teknik elemanlara Seminer, toplantı, ziyaret, sunu, broşür, kitapçık vs.
yönelik toplantılar
TALEP EDİLEN BÜTÇE
I. Yatırım Tutarı
06 SERMAYE GİDERLERİ
06.1- Mamul Mal Alımları
06.2- Menkul Sermaye Üretim Giderleri
06.5- Gayrimenkul Sermaye Üretim Giderleri
06.6- Menkul Malların Büyük Onarım Giderleri
06.9- Diğer Sermaye Giderleri
Toplam
Genel Toplam
YILLARA GÖRE DAĞILIM
1.Yıl
2.Yıl
3 Yıl
69.250
35.000
44.500
13.000
500
162.250
68.250
15.000
22.500
3.500
1.500
110.750
300.000 TL
1.500
5.500
15.000
4.500
500
27.000
II. YATIRIM TUTARININ DAĞILIMI
Harcama Kalemi
ve Ekonomik Kodu
Harcama Adı
1. Yıl
Toplam
Ödenek
İhtiyacı
3.000
48.250
5.000
8.000
4.000
2. Yıl
Toplam
Ödenek
İhtiyacı
3. Yıl Toplam
Ödenek
İhtiyacı
06.1.2.02 Bilgisayar Alımları
0
06.1.2.04 Laboratuvar Cihazı Alımları
43.250
06.1.3.05 Zirai Gereç Alımları
5.000
06.1.2.05 İşyeri Makine Techizat Alımı
20.000
06.1.2.90 Diğer Makine Teçhizat Alımları
0
06.1.6.90 Diğer Yayın Alımları
1.000
0
1.500
ve Yapımları
06.2.6.01 Kağıt ve Kağıt Ürünleri Alımı
MENKUL
1.000
1.000
SERMAYE ÜRETİM 06.2.7.01Kimyevi Madde ile Kauçuk ve
10.000
5.000
GİDERLERİ
Plastik Ürün Alımları
(06.2.)
06.2.8.01Metal ürün Alımları
14.000
5.000
06.2.9.01 Diğer Alımlar
10.000
4.000
5.500
06.5.2.01 İnşaat Malzemesi Giderleri
GAYRİMENKUL
7.000
6.000
SERMAYE
06.5.2.04 Özel Tesisat Giderleri
20.000
ÜRETİM
06.5.4.02 Akaryakıt ve Yağ Alımları
5.000
4.000
3.000
GİDERLERİ (06.5.)
06.5.4.03 Elektrik Alımları
2.000
4.000
6.000
06.5.5.02 Telefon Abonelik ve Kullanım
500
500
Ücretleri
06.5.6.02 Taşıt Kiralaması Giderleri
6.000
6.000
6.000
06.5.2.90 Diğer Giderler
4.000
2.000
06.6.2 Malzeme Giderleri
MENKUL
MALLARIN
13.000
3.500
4.500
BÜYÜK ONARIM
GİDERLERİ (06.6.)
06.9.2.01Yurtiçi Geçici
DİĞER SERMAYE
500
1.500
500
Görev Yolluğu
GİDERLERİ(06.9.)
TOPLAM
162.250
110.750
27.000
GENEL TOPLAM
300.000 TL
MAMUL MAL
ALIMLARI
(06.1.)
0
II. Bütçe Gerekçesi ve Yatırım Tutarının Dağılımı
06.1.2.02. Bilgisayar alımı (Laptap): Projede kullanılmak üzere
06.1.2.03. Tıbbi cihaz alımı: Linear ultrason probu (Kas ve yağlanmayı ölçmek için)
88
06.1.2.05. İş yeri makine techizat alımı (Karkaslar için soğuk hava deposu, fotoğraf
makinesi)
06.1.3.04. Laboratuvar gereçleri alımı: (Colorimetre, pH metre, vakum paketleme makinası,
dijital planimetre, elektronik baskül, hassas terazi, desikatör, petri kapları, kemik kesme
testeresi, şarjlı pipet pompası, cam pipet, et numunelerini taşımak için seyyar mini buzdolabı,
ANKOM 200 Fiber Analyzer cihazı, Filip’s Electronic Folding Plate Meter (diskmetre), Electric
Grass Shears (merada ot numunesi almada kullanılacak olan traş makinesi))
06.2.6.01.Kağıt ve kağıt ürünleri alımı (mera biçiminde ot numunelerini koymak için, MLD
göz kası alanını çizmek için aydınger kağıdı ve verilerin yazılımında kullanmak üzere)
06.2.7.01. Kimyevi madde ile kauçuk ve plastik ürün alımları: Denemede kullanılmak
üzere, protein, ADF, NDF, selüloz için kimyasal madde alımı, Selüloz, ADF, NDF analizinde
kullanılmak üzere torba alımı, gübre ve merada kullanılmak üzere plastik boru alımı
06.2.9.01. Diğer Alımlar (yem alımı, mera tohumu, canlı hayvan alımı, kesim ücreti, analiz
ücretleri, çit malzemeleri(tel örgü, çimento),portatif bölmeler için demir alımı)
06.5.2.90. Diğer giderler (projeye ait olan işçilik hizmet alımı, (Tel çit işleri yapımında,
meranın sulanmasında ve denemede çalıştırılmak üzere)).
06.5.9.01.Diğer giderler (Karkas çalışması için kesimhane odasına masa ve hayvan
askılıklarının yaptırılması
06.6.4.02. Akaryakıt ve Yağ Alımları (Meranın kurulması sırasında kullanılacak olan alet ve
makinelerde ve ulaşımda kullanılmak üzere)
06.6.4.03. Elektrik Alımları (Kurulacak olan meranın sulanmasında)
06.9.2.01. Yurtiçi Geçici Görev Yollukları
TEKLİF ONAYI
Proje /Alt Proje Lideri
Öneren Kuruluş Müdürü
Adı Soyadı
Tülay CANATAN
Fatih ÖZDEMİR
Tarih
30.12.2013
İmza
89
DESTEK BAŞVURUSUNDA BULUNULAN PROJENİN
Konya Bölgesinde Yarı-Entansif Koşullarda Kıl, Saanen x Kıl
ve Alpin x Kıl Melezi Keçilerinin (F1, G1 ve F1 x G1) Bazı
BAŞLIĞI
Verim Özellikleri
ARAŞTIRMA
ALANI
FIRSAT
Küçükbaş Hayvancılık
ARAŞTIRMA PROGRAMI
A 07- P 01
PROGRAM ÖNCELİĞİ
Yüksek
PROJE ÖNERİSİ YAPAN KURULUŞUN
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
ADI
KONYA
ADRESİ
PROJE / ALT PROJE LİDERİ
Hakan ERDURAN
ADI SOYADI
KURUMU
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
TELEFONU
03323551290
E-POSTA
[email protected]
PROJE / ALT PROJE YÜRÜTÜCÜLERİ
ADI SOYADI
KURUMU
E-POSTA
Prof. Dr. Birol DAĞ
S.Ü. Ziraat Fak. Zootekni Bölümü [email protected]
PROJE
TOPLAM
PROJE BAŞLAMA
TARİHİ
42.000
01.09.2014
İŞBİRLİĞİ
İŞBİRLİĞİ
YAPILAN
KURULUŞ
Selçuk Üniversitesi
Ziraat
Fakültesi Zootekni Bölümü
İŞBİRLİĞİ ŞEKLİ
Danışman
PROJE BİTİŞ
TARİHİ
01.03.2017
PROJEDEKİ KATKISI
Verilerin değerlendirilmesi,
Sonuç raporunun yazılması
90
PROJE ÖZETİ:
Orta Anadolu Bölgesinde süt keçisi yetiştiriciliğine son yıllarda giderek artan bir ilgi söz
konusudur. Bölgede dondurma tüketimi alışkanlığının giderek yaygınlaşması, süt
fabrikalarının keçi sütüne olan talebinin artması, yeni süt işleme tesislerinin kurulması ve
bölgenin büyük tüketim merkezlerine yakın olması keçicilik işletmeleri için iyi bir pazar
oluşmaktadır. Bu nedenle keçiciliğin geleneksel olarak yapıldığı dağlık ve ormanlık
bölgelerde süt keçiciliğini teşvik etmek amacıyla Bahri Dağdaş Uluslararası Tarımsal
Araştırma Enstitü Müdürlüğü tarafından 2009 yılında 3 köyde yöre halkına, hem orman
yasağına karşı yeni bir alternatif sunmak, hem de süt ve döl verimlerini arttırarak gelir
seviyesini yükseltmek amacıyla Saanen ve Alpin tekeleriyle Kıl keçilerinin melezlenmesi
çalışması hayata geçirilmiştir. Bu proje şu an itibarıyla yazım aşaması sürecine girmiştir.
Yapılan bu çalışma ile Saanen x Kıl (F1) ve Alpin x Kıl (F1) keçilerinin ekstansif koşullarda
süt verimlerinde Kıl keçilerine nazaran %40-50 oranında bir artış tespit edilmiştir. Ancak
araştırmanın yürütüldüğü bölgede halen yarı entansif koşullarda Kıl, Saanen x Kıl (F1) ve
Alpin x Kıl (F1) keçilerin verim performansları bilinmemektedir. Bölgede süt keçiciliğinin
geliştirilmesinde önemli alternatifler olabilecek bu genotiplerin yarı entansif koşullarda
bilimsel verilere dayalı olarak döl ve süt verimleri ile oğlaklarda büyümeye ilişkin
özelliklerin karşılaştırılmalı olarak belirlenmesine ihtiyaç duyulmaktadır. Bu çalışmada
aynı bakım besleme koşulları altında yarı entansif yetiştiricilik yapan iki işletmede Kıl,
Saanen x Kıl (F1) ve Alpin x Kıl (F1) keçilerin çeşitli verim özelliklerinin bilimsel verilere
dayalı olarak ortaya konulması amaçlanmıştır.
Proje dâhilinde Kıl, Saanen x Kıl (F1) ve Alpin x Kıl (F1) keçilerine ait gebelik oranı,
kısırlık oranı, yavru atma oranı, teke altı keçi başına doğan oğlak sayısı (TKDO), doğuran
keçi başına düşen oğlak sayısı (DKDO) ve büyütme sonuçlarına göre teke altı keçi başına
sütten kesimde yaşayan oğlak sayısı (TKSO), doğuran keçi başına sütten kesimde yaşayan
oğlak sayısı (DKSO) ve yaşama gücü tespit edilecektir. Doğumdan itibaren oğlakların
büyüme performansını ortaya koymak amacı ile her işletmede bütün oğlakların doğum, 3.
ve 6. ay canlı ağırlıkları alınacaktır.
Proje kapsamında yer alan işletmelerdeki Kıl, Saanen x Kıl (F1) ve Alpin x Kıl (F1)
keçilerinde oğlaklamanın başlangıcından 25 gün sonra başlayarak laktasyonun sonuna
kadar ayda bir sabah ve akşam olmak üzere süt kontrolü yapılacaktır. Laktasyon süt
verimlerinin hesaplanmasında Fleischmann yöntemi kullanılacaktır. Ayrıca laktasyon
süresi, günlük ortalama süt verimi ve günlük maksimum süt verimleri de belirlenecektir.
İncelenen süt verimi özelliklerine yaşın ve doğum tipinin etkisi de araştırılacaktır. Sütün
bileşimine yönelik olarak ise ayda bir kez sabah ve akşam alınacak süt örneklerinde yağsız
kuru madde, yağ, ham protein, laktoz, yoğunluk, donma noktası pH ve iletkenlik düzeyleri
süt analiz cihazında, belirlenecektir.
Araştırmada, döl verimi özelliklerinin ve yaşama gücüne ait değerlerin karşılaştırılmasında
Khi-Kare analizi kullanılacaktır. Keçilerde süt verimi ve kompozisyonu özelliklerine yaşın
ve genotipin, oğlaklarda incelenen özelliklere genotip, cinsiyet, doğum tipi ve ana yaşı gibi
çevre faktörlerinin etkileri En Küçük Kareler Yöntemi ile tespit edilecektir. Alt grup
ortalamaları arası farklılığın önem kontrolü Duncan testi ile yapılacaktır. İstatistik
analizlerde Minitab 14 paket programı kullanılacaktır.
Araştırmadan elde edilecek bilimsel verilerle Orta Anadolu bölgesi için yarı entansif
koşularda Kıl, Saanen x Kıl (F1) ve Alpin x Kıl (F1) keçilerinin yetiştiriciler tarafından daha
iyi tanınması ve yararlanılması konusunda somut fikirlerin ortaya çıkması beklenmektedir.
Anahtar Kelimeler: Kıl Keçi, Saanen, Alpin, melezleme, süt verimi, yarı-entansif koşullar
91
Projenin Amacı ve Gerekçesi:
Türkiye'de süt Keçeciliğinin geliştirilmesine yönelik olarak yapılan çalışmalar uzun
yıllardan bu yana devam etmektedir. Bu çalışmaların başında kimi yabancı ırkların Türkiye
koşullarına adaptasyonu çalışmaları ve yerli keçi ırklarımızın verimlerini artırmaya yönelik
yabancı keçi ırklarıyla yapılan melezleme çalışmaları gelmektedir. Son yıllarda keçi sütü
çeşitli özelliklerinden dolayı (insan sağlığına faydaları, peynir ve dondurma üretimi gibi)
inek sütüne göre daha değerli bir alternatif olarak karşımıza çıkmaktadır. Keçi sütü ve
ürünlerinin piyasa değerinin yüksek olması ve Orta Anadolu Bölgesinde süt ve süt ürünlerini
işlemeye yönelik modern yatırımların artışına paralel olarak süt keçisi yetiştiriciliğine ilgi
gün geçtikçe artmaktadır. Bu sebeple 2009 yılında Bahri Dağdaş Uluslararası Tarımsal
Araştırma Enstitüsü (BDUTAE) Müdürlüğü tarafından “Farklı Şartlarda Yarı-Entansif
Koşullarda Yetiştirilen Kıl Keçisi Melezlerin Verim Performanslarının Karşılaştırılması”
adlı bir proje yetiştirici koşullarında hayata geçirilmiştir. Bu projenin amacı Saanen ve Alpin
tekeleriyle kıl keçilerinin melezlenmesi yoluyla dağlık ve ormanlık bölgelerde bulunan 3
köyde yöre halkına, hem orman yasağına karşı yeni bir alternatif sunmak, hem de süt ve döl
verimlerini arttırarak gelir seviyesini yükseltmekti. Yürütülen projenin 3. ve 4. yılında Kıl,
SaanenxKıl (F1) ve AlpinxKıl (F1) keçilerinin ekstansif şartlarda 1. ve 2. laktasyon süt
verimlerine bakılmıştır. Yapılan bu çalışma ile Saanen x Kıl (F1) ve Alpin x Kıl (F1)
keçilerinin ekstansif koşullarda süt verimlerinde Kıl keçilerine nazaran %40-50 oranında bir
artış tespit edilmiştir (1). Yürütülen bu proje kapsamında saf ve melez keçilerin Orta
Anadolu Bölgesi koşullarında yarı entansif koşullarda verimleri, yetiştirici alt yapısındaki
sıkıntılar nedeniyle tespit etme imkânı bulunamamıştır. 2009 yılında başlatılan proje şu an
itibarıyla yazım aşaması sürecine girmesine karşın, hem yetiştiricilerin isteği doğrultusunda
hem de süt keçiciliğinin bölgede geleceği açısından verim kayıtlarının tutulmasına devam
edilmesi düşünülmektedir.
Bu projenin amacı, Kıl, Saanen x Kıl (F1) ve Alpin x Kıl (F1) keçilerinin yarı
entansif şartlarda, aynı bakım ve besleme uygulamalarına tabii tutularak, döl verimi, süt
verimi ve sütün bazı bileşenleri ile saf ve melez oğlaklarında büyüme özellikleri ile yaşama
gücü özelliklerine ait fenotipik parametrelerin yetiştirici koşullarında belirlenerek
karşılaştırılmasıdır. Proje kapsamında elde edilecek bilimsel veriler sayesinde, Kıl,
SaanenxKıl (F1) ve AlpinxKıl (F1) keçilerinin Orta Anadolu Bölgesinde daha iyi tanınması
ve yararlanılması hakkında somut fikirlerin ortaya çıkması ile yetiştiricilere yarı entansif
şartlara yönelik pratik ve yönlendirici bilgiler elde edilmesi beklenmektedir. Ayrıca bu proje
ile ileride yapılacak olan ıslah çalışmalarına da ışık tutulmuş olunacaktır.
Proje ile Elde Edilmek İstenilen Çıktılar ve Kullanım Alanlarını Açıklanmalıdır.
Bu projenin gerçekleşmesi halinde, Kıl, Saanen x Kıl (F1) ve Alpin x Kıl (F1) damızlık
keçilerinin Orta Anadolu bölgesinde hangi genotipin yarı entansif koşullarda daha efektif
olarak yetiştirilebileceği üzerinde önemli bazı ipuçları elde edilecektir. Ekonomik yönden
önemli olan süt veriminin artırılmasına yönelik bazı veriler elde edilebilecektir. Bölgede
dondurma tüketimi alışkanlığının giderek yaygınlaşması, süt fabrikalarının keçi sütüne olan
talebinin artması ve bölgenin büyük tüketim merkezlerine yakın olması keçicilik işletmeleri
için iyi bir alıcı sektör oluşmaktadır. Ayrıca keçi sütü için, inek sütünün iki- üç katı fiyata
satılabileceği pazar koşulları da giderek oluşmaktadır. Çalışma sonucunda elde edilecek
bilimsel veriler bölgede, hali hazırda öncelikli olarak et verimi yönü için yetiştirilmekte olan
Kıl keçilerinden döl ve süt verimlerinin ıslahında Saanen ve Alpin ırklardan yararlanılarak
yüksek verimli genotiplere dönüşümünün sağlanıp sağlanamayacağı hakkında önemli
ipuçları sunacaktır. Kayıt tutma sistemi ile damızlıkçı işletme modelinin temelleri atılarak
Orta Anadolu Bölgesinin üstün verimli damızlık teke ihtiyacı zamanla karşılanabilecektir.
Araştırmanın yürütüleceği işletmelerde elde edilecek yüksek verim bölge yetiştiricilerine
92
örnek teşkil ederek, süt keçiciliğinin yaygınlaşmasına katkı sağlayacaktır. Yapılacak olan bu
çalışmada elde edilen bilimsel veriler, ileride yapılacak olan ıslah çalışmalarına ışık
tutacaktır.
LİTERATÜR ÖZETİ:
Küçükbaş hayvan yetiştiriciliği Türkiye ekonomisinde geleneksel olarak özel bir yere
sahiptir. Türkiye keçi mevcudunun (8.4 milyon baş) yaklaşık olarak % 98’ini Kıl keçileri
oluşturmaktadır. Konya İli 1.475.300 baş koyun ve 149.398 baş keçi mevcudu ile önemli bir
küçükbaş hayvan potansiyeline sahiptir (2). Süt keçisi yetiştiriciliği son dönemlerde gündemde
olan ve ekonomik yönden de önem kazanan hayvansal üretim dallarından birisidir. Süt keçisi
yetiştiriciliğine yönelik bilimsel çalışmalar daha çok Ege, Akdeniz ve Marmara Bölgesinde
yoğunluk kazanmıştır (3).
Kıl keçileri Türkiye’nin her tarafına yayılmış olmakla beraber sayıları Orta
Anadolu’nun kuru step meralarında daha az iken, sahil şeritleri üzerinde ve özellikle ormanlık
ve çalılık bölgelerde yoğunlaşmıştır. Çünkü Kıl keçi geniş ölçüde çalı formundaki bitkilerin
yaprak, dalları ile orman içi mer’alardan faydalanmakla birlikte, bitkisel üretime ve diğer
hayvan türlerinin yetiştirilmesine uygun olmayan araziler ile sarp alanlarda yapılmaktadır.
Yaklaşık 500.000 işletmede yapılan keçi yetiştiriciliği, üç milyon civarındaki insanın geçimine
katkıda bulunmaktadır. Kıl verimleri keçilerde 400-500 g, tekelerde ise 900-1000 g kadardır.
Ortalama süt verimi oğlağın emdiği hariç 50-60 kg kadar olup, iyi bir bakım besleme şartları
altında 140-150 kg’a kadar çıkabilmekte laktasyon süreleri 7-8 ay olabilmektedir. Sütlerinde %
5-5,5 kadar yağ bulunmaktadır. Etleri genellikle yetiştirildikleri bölgedeki halk tarafından
sevilerek tüketilmektedir. Canlı ağırlıkları 35-55 kg arasında değişmekte, randıman ise kesim
kondisyonuna bağlı olmak üzere % 51,5’a kadar çıkabilmektedir (, 4, 5, 6, 7, 8, 9, 10, 11 ve12).
Saanen keçisi sağlam konstitüsyonlu ve adaptasyon yeteneğinin iyi oluşu nedeniyle
dünyanın çeşitli bölgelerinde başarıyla yetiştirilmektedir. Süt ve döl verimi yüksektir. Ortalama
laktasyon süresi 280 gün, laktasyon süt verimi ise 750 kg olup, bu değer elit sürülerde 1700 kg’a
kadar çıkabilmektedir. Ancak yüksek verim yeteneğini iyi bakım ve besleme koşullarında
gösterebilmektedir. Saanen ırkında gelişme hızlıdır. Bu nedenle cinsel olgunluğa erken ulaşır
(13, 14 ve 15). Alpin keçisi kemik yapısı sağlam bir ırk olup, yemden yararlanma iyi ve döl
verimi yüksektir. Saanen keçisine göre geç gelişen bir ırktır. Dağlık ve kötü iklim şartlarına çok
iyi uyum sağlayan bir ırktır. Boynuzlu ve boynuzsuz iki tipi vardır. Ortalama laktasyon süt
verimleri boynuzsuz tip Alpin keçilerinde 680 kg, boynuzlu tip Alpin keçilerinde 570 kg
civarında olup, laktasyon süreleri ise her iki tipte de 270 gün’dür (15).
Türkiye’de Kıl keçilerinin ıslahında melez sütçü keçi yetiştiriciliğine dönüşümün
gerekliliği ve bu dönüşümde Alpin ve Saanen gibi ırklardan yararlanmanın olası olduğu genel
kabul gören görüşlerdir (16 ve 17).
Kıl keçisinin ıslahına yönelik stratejinin esasını üreticinin gelirini artırmak ve keçinin
ormana verdiği zararı azaltmak oluşturmalıdır. Bunun için bir yandan üretim ve pazarlama
sisteminde bazı değişiklikler yapılmaya çalışılırken, diğer yandan da bu değişikliklere olumlu
reaksiyon verecek genotiplerin elde edilmesi hedeflenmeli ve Kıl keçilerinin ıslahında
melezlemeye öncelik verilmelidir (18). Bununla beraber bu süreçte genotipin ıslahı konusunda
çok önemli çalışmalar yapılmıştır. Bir kısmı hâlâ devam etmekte olan bu çalışmalarda, Akkeçi,
Çukurova süt keçisi, Toros süt keçisi, Bornova keçisi gibi melez genotipler elde edilmiş ve
imkânlar ölçüsünde çevreye de dağıtılmıştır (19 20 ve 21). Bununla birlikte Türkiye’de süt
keçisi ıslah çalışmalarının artarak devam etmesi gerekmektedir. Bu çalışmalar ile hem
yetiştiricinin keçiden elde ettiği gelir artırılarak ulusal ekonomiye katkı sağlayacak hem de Kıl
keçinin ormana verdiği zararın azaltılması mümkün olabilecektir.
Türkiye’de kıl keçilerinin verimlerini arttırmak amacıyla yapılan melezleme
çalışmaları yapılmıştır. Yapılan bu çalışmaların bir kısmı Çizelge 1’de özetlemiştir.
93
Çizelge 1: Türkiye’de Kıl Keçisi Kanı Taşıyan Genotiplerine ait Laktasyon Performansları
Genotip
Laktasyon Süt Verimi (kg)
Alpin x Kıl (F1)
Saanen x Kıl (F1)
AAA* x Kıl Keçi
Bornova
Çukurova
Hatay
Toros
Türk Saanen
*AAA; Alman Alaca Asil
112.9 - 182
122.2 - 201.1
293.60
353.23
341 - 376
95.7 - 215.5
352 - 380
237.65 - 465.1
Laktasyon Süresi (gün)
Araştırıcı
235.0 - 242.9
201.5 - 233.1
239.9
232.8
231.3
155.0 - 210.7
230.4
190.6 - 281.9
(22, 23)
(22, 23,24)
(25)
(8)
(20, 26)
(27, 25)
(20, 26)
(2 , 29)
Keçilerde sütün kompozisyonu ırka bağlı olarak büyük farklılıklar göstermektedir (30).
Keçi sütünde yağ miktarı % 1,5’den % 9’a kadar değişkenlik göstermekte olup ortalama değeri
% 3.72’dir, protein miktarının ortalama değeri ise % 2,84 olup % 1’ den % 8’e kadar
değişkenlik göstermektedir (31).
Keçilerde süt kompozisyonu üzerine yapılan bir kısım çalışmalara ait yağ, protein,
laktoz ve kuru madde oranlarına ait ortalamaları Çizelge 2’de verilmiştir.
Çizelge 2: Bazı Keçi Genotiplerinin Süt Kompozisyonlarına ait Veriler
Genotip
Yağ (%)
Kıl
4.57 - 5.08
Saanen
*2.55 -4.50
Alpin
*3.40 - 3.92
Türk Saanen
4,07
Alpin x Kıl (F1)
4.65 - 4,10
AAA x Kıl (G1)
4.10
Saanen x Kıl (F1)
4.65
SY
4.70
Protein (%)
*3,71
*3.25-3.84
*3.08 - 3.33
3,24
3.71 - 3.40
3.40
3.64
4.00
Laktoz (%)
4.19 -5.29
*4.56
*4.37
5.36 - 4.12
4,20
5.24
3.40
Kuru Madde (%)
13,70 - 14,96
*11.06 – 11.40
*11.10 – 11.55
12,50
14.46 - 12.40
12.40
14.48
12.80
Araştırıcı
(*1, 32)
(*33, 34)
(*33, 34)
(28)
(1, 35)
(36)
(1)
(25)
*AAA; Alman Alaca Asil, SY, Saanen melezi x Yerli keçi
Türkiye hayvancılığına genel olarak bakıldığında, sığırlardan sağlanan verim artışında,
toplam sığır varlığındaki kültür ırkı ve melez genotiplerin oranındaki artışın önemli bir payı
olduğu görülmektedir. Buna karşılık koyun ve keçi yetiştiriciliğinde genotipik iyileştirmeye
yönelik çalışmalar oldukça sınırlı kalmıştır. Bu nedenle gerek koyun gerek keçide verimliliğin
artırılmasına yönelik projelerin gündeme getirilmesi büyük önem taşımaktadır. Verimliliği
artıracak çalışmaların yönlendirilebilmesi için de mevcut durumun sağlıklı olarak saptanmasına
mutlak gereksinim vardır. (37)
MATERYAL ve METOT:
Araştırma Konya ili Selçuklu ilçesi Sızma kasabası kırsalında bulunan iki keçi
işletmesinde yürütülecektir. Sızma Kasabası Batı Toros dağlarının uzantısı olan Bozdağ,
Karadağ ve Malas dağların arasına yerleşmiş bir vadi üzerine kurulmuştur. Birinci işletme il
merkezinin kuzey doğusunda (38˚ 04´ K, 32˚ 23´ D), rakımı 1404 m dolaylarındadır. İkinci
işletmenin yeri il merkezinin kuzey doğusunda (38˚ 06´ K, 32˚ 27´ D) rakımı 1527 m
dolaylarında olan dağlık bölge üzerine yerleşmiştir. Sızma kasabasında bulunan her işletmenin
kullanımı kendine ait yaylası ve mera alanı bulunmakta olup, her iki yerin de yıllık ortalama
94
yağış miktarı 318.1 mm’dir.
Hayvan Materyali: Projenin hayvan materyalini Sızma kasabasında bulunan birinci işletmede
42 baş Kıl keçisi, 51 baş Saanen x Kıl (F1) ve 55 baş Alpin x Kıl (F1) keçisi ile ikinci işletmede
40 baş Kıl keçisi, 42 baş Saanen x Kıl (F1) ve 49 baş Alpin x Kıl (F1) keçisi, olmak üzere
toplamda 279 baş keçi oluşturacaktır.
Çiftleştirme Modeli: İşletmelerde teke katımı ekim ve kasım aylarında yapılacaktır. Sürülerde
bulunan Saanen x Kıl F1 dişileri Saanen x Kıl G1 tekelerine, Alpin x Kıl F1 dişileri ise Alpin x
Kıl G1 tekelerine verilecektir. Bu çiftleştirmelerden her genotip grubundan elde edilecek döller
kendi aralarında elde aşım uygulanarak çiftleştirilecek ve sürü kapatılacaktır. Çizelge 3 ‘te
işletmelerde uygulanacak olan çiftleştirme modeli verilmiştir.
Çizelge 3: İşletmelerde uygulanacak çiftleştirme modeli
Çiftleştirilecek Genotipler ve Sayıları
Genotipler
Erkek
Kıl♂ x Kıl♀
4
Saanen x Kıl (G1)♂ x Saanen x Kıl (F1)♀
5
Alpin x Kıl (G1)♂ x Alpin x Kıl (F1)♀
6
Dişi
82
93
104
Elde Edilecek Genotipler
Kıl
(F1 X SG1): %62.5 Saanen+%37.5 Kıl
(F1 X AG1 ): %62.5 Alpin+%37.5 Kıl
Yem materyali ve Besleme: Projede kapsamında yer alan her iki işletmede, gebelik dönemi
keçilerin ve doğacak oğlaklar için ihtiyaç duyulan kaba ve kesif yemin tamamı yetiştiriciler
tarafından karşılanacaktır. Laktasyon döneminde sağmal keçilerin kesif yemin bir kısmı
BDUTAE Müdürlüğü tarafından, diğer kısmı da yetiştiriciler tarafından karşılanacaktır.
Çalışmada kullanılacak yemlere ait kuru madde, ham protein, ham kül, ham selüloz, ham yağ,
analizleri BDUTAE Müdürlüğü laboratuarlarında yaptırılacaktır.
Gebelik dönemi keçilerin beslenmesi: Gebe keçilerde gebeliğin son bir buçuk ayı oğlağın ana
karnında en hızlı büyüdüğü ve memenin giderek geliştiği döneme rastlar. Gebeliğin ilerleyen
dönemlerinde kesif yem 200 g’dan başlayarak ananın kondisyonuna göre 500 - 600 g'a kadar
tedricen yükseltilecektir. Kaliteli kuru yonca otu adlibitum olarak verilecektir.
Laktasyon dönemi keçilerin beslenmesi: Keçiler laktasyon boyu verecekleri sütün %50-70’ini
laktasyonun ilk üç ayında üretmektedirler. Bu nedenle sağmal keçilere laktasyon süresince
meraya ilave olarak,%18 Ham proteinli 2700 kcal/kg ME’ye sahip keçi süt yemi laktasyonun
pik döneminde (40-60. günler arası) günlük 700 g'a çıkarılacak şekilde iki öğün yemleme
uygulanacak, laktasyonun ilerleyen aylarında bu miktar yavaşça azaltılarak, hayvanlar kuruya
çıktıkları dönemde 250 g’a kadar düşürülecek ve teke katımına kadar yemleme bu şekilde
devam edecektir. Laktasyon süresi boyunca keçilerin her gün en az 6-8 saat/gün meraya
çıkartılmaları sağlanacaktır.
Oğlak beslenmesi:, Doğumların başlaması ile oğlaklara, doğumu müteakip kurutulduktan sonra
ağız sütü almaları sağlanacaktır. Oğlakların süt emme dönemi 12 hafta sürecektir. Bu dönemde
2. haftadan başlayarak, oğlaklara emişmenin yanı sıra, kuru yonca otu ile oğlak büyütme yemi
(%16 ham protein 2500 kcal/kg ME) tedricen arttırılarak ad libitum olarak verilecek ve
önlerinde sürekli olarak temiz su bulundurulacaktır. Oğlaklar ortalama 8 haftalık yaşa
ulaştıklarında, sürüden ayrı yetiştirici koşullarında köy merasına dayalı olarak tedricen
arttırılarak günde 6-8 saat otlatılmaları sağlanacaktır.
İncelenecek Verimler:
Döl Verimi Özellikleri: Proje dâhilinde Kıl, Saanen x Kıl (F1) ve Alpin x Kıl (F1) keçilerine ait
gebelik oranı, kısırlık oranı, yavru atma oranı, oğlaklama oranı, teke altı keçi başına doğan
oğlak sayısı (TKDO), doğuran keçi başına düşen oğlak sayısı (DKDO) ve büyütme sonuçlarına
göre teke altı keçi başına sütten kesimde yaşayan oğlak sayısı (TKSO), doğuran keçi başına
sütten kesimde yaşayan oğlak sayısı (DKSO) ve yaşama gücü aşağıdaki gibi tespit edilecektir (
95
38, 39).
Gebelik Oranı ve Kısırlık Oranı
Gebelik oranı(%)= (Gebe keçi sayısı x 100) / Teke altı keçi sayısı
Kısırlık Oranı = (Kısır keçi sayısı x 100) / Teke altı keçi sayısı
Yavru Atma ve Oğlaklama Oranı
Yavru Atma =(Yavru Atan Keçi Sayısı x100 ) /Gebe Keçi Sayısı
Oğlaklama Oranı= (Doğuran keçi sayısı x 100) /Teke altı keçi sayısı
Doğan Oğlak Sayıları
Teke Altı Keçi Başına=(Doğan Oğlak sayısı x 100) /Teke Altı Keçi Sayısı
Doğuran Keçi Başına= (Doğan Oğlak sayısı x 100 /Doğuran Keçi Sayısı
Sütten Kesilen Oğlak Sayıları
Teke Altı Keçi Başına=(Sütten kesilen Oğlak sayısı x 100) /Teke Altı Keçi Sayısı
Doğuran Keçi Başına= (Sütten kesilen Oğlak sayısı x 100 /Doğuran Keçi Sayısı
Yaşama Gücü Özellikleri
Yaşama Gücü (sütten kesimde oğlak sayısı x 100)/Doğan oğlak sayısı
Büyüme Özellikleri: Doğacak olan saf ve melez oğlakların doğumdan sonra 6 saat içinde
tartılacak, ağız sütü almaları sağlanacak ve plastik küpe ile numaralandırılarak kendilerine ait
doğum tarihi, doğum saati, cinsiyeti ve ana numaraları bilgileri kayıt edilecektir. Doğumdan
itibaren oğlakların büyüme performansını ortaya koymak amacı ile bütün oğlakların doğum, 3.
Ay ve 6. ay canlı ağırlıkları 50 g’a hassas terazide sabah aç karna tartılacaktır.
Süt Verim Özellikleri: Proje kapsamında yer alan iki adet işletmede doğurması ve süt vermesi
beklenen 2-6 yaşlı saf ve melez keçilerinin süt verimlerine ait parametrelere bakılacaktır.
Doğumların başlangıcından 25 gün sonra başlanacak süt kontrolleri laktasyonun sonuna kadar
ayda bir sabah ve akşam olmak üzere sütölçerli sağım makineleri ile yapılacaktır. Süt kontrol
verilerinden Fleischmann Metodu (ICAR, Type A) kullanılarak laktasyon süt verimleri
hesaplanacaktır (40). Bu süre zarfında laktasyon süt verimi, laktasyon süresi, günlük ortalama
süt verimi ve günlük maksimum süt verimleri de belirlenecektir. İncelenen süt verimi
özelliklerine yaşın ve doğum tipinin etkisi de araştırılacaktır. Ayrıca süt kompozisyonu için
ayda bir kez sabah ve akşam alınacak homojen süt örnekleri ile yağsız kuru madde, yağ, ham
protein, laktoz, yoğunluk ve iletkenlik düzeyleri süt analiz cihazı ile pH ise masa tipi pH metre
ölçer ile belirlenecektir.
Sağlık Koruma Uygulamaları: Projede etkin bir sürü sağlığı kontrol programı uygulanacaktır.
Koyun ve Keçi yetiştiriciliğinde hastalıkların tedavisinden ziyade koruyucu hekimlik
uygulamaları üzerinde durulmaktadır. Bunun nedeni koruyucu hekimlik uygulamalarının,
tedaviye göre daha etkili, uygulaması kolay ve ucuz oluşudur. Ağıllar kış girişi ve ilkbaharda
olmak üzere yılda iki kez baştan sona temizlenerek dezenfekte edilecek ve dış parazit ilaçlaması
uygulanacaktır.
Doğumdan sonra oğlakların göbek kordonu bağlantı noktasının dört parmak
aşağısından kesilerek bağlanacak tentürdiyotla dezenfekte edilecektir. Doğumların
başlamasından sonra bütün oğlaklara selenyum ve vitamin E uygulaması ile Ektima aşısı
yapılacaktır. Mevsimlere geçişte, yem değişikliklerine başlamadan önce yılda iki defa
Enterotoksemi aşısı, uygulanacaktır. İlkbaharın sonu mayıs ayında Şap ve Agalaksi aşısı
yapılacaktır. Ekim ayı içerisinde de Keçi Ciğer Ağrısı aşısı yapılacaktır.
İç parazitlere karşı yılda 2 kez ilkbahar ve sonbahar başlangıcında ilaçlama
yapılacaktır. Dış parazitlere karşı kırkım sonu ve kışa giriş olmak üzere yılda iki kez ilaçlama
yapılacaktır.
İstatistik analizler: Araştırmada, keçi ve oğlaklara ait döl verimi özellikleri ve yaşama gücüne
ait değerlerin analizi Khi-Kare metodu ile yapılacaktır. Keçilerde süt verimi ve kompozisyonu
özelliklerine yaşın ve genotipin, oğlaklarda incelenen özelliklere genotip, cinsiyet, doğum tipi
96
ve ana yaşı gibi çevre faktörlerinin etkileri En Küçük Kareler Yöntemi ile tespit edilecektir. Alt
grup ortalamaları arası farklılığın önem kontrolü Duncan testi ile yapılacaktır (41). İstatistik
analizlerde Minitab 14 paket programı kullanılacaktır. Verim özelliklerinin çevre faktörlerine
göre standartlaştırılması ve tekrarlanma derecesi tahmininde Harvey, (1987) paket programı
kullanılacaktır.
ÇALIŞMA TAKVİMİ
Yapılacak
Faaliyetler
Aylar
1
2
3 4 5 6
7
8
9
10 11 12 13 14 15
16
17
18
Teke Katım Dönemi
Ekim -Kasım 20142015
İlk Ay: Ekim
Doğum kayıtlarının
alınması,
numaralandırma ve
döl verimlerinin
tespiti, Mart Nisan
2015-2016
Süt verimlerinin
tespiti ve analizleri
yapılması NisanEkim 2015-2016
Oğlakların canlı
ağırlık tartımları
Aşılama ve İlaçlama
YÖNETİM DÜZENİ
Adı Soyadı
Hakan ERDURAN
Proje Yürütücülerinin Projeye Katkıları
Yapılacak Faaliyetlerdeki Sorumlulukları
Çalışma Takvimi
Teke Katım Dönemi
Ekim –Kasım 2014-2015
Hakan ERDURAN
Doğum kayıtlarının alınması, numaralandırma
ve döl verimlerinin tespiti
Süt verimlerinin tespiti ve analizleri yapılması
Mart-Ekim/2015-2016
Hakan ERDURAN
Oğlakların canlı ağırlık tartımları
Mart-Haziran/2015-2016
Hakan ERDURAN
Hakan ERDURAN
Bayram YAMAN*
Hakan ERDURAN
Birol DAĞ
Aşılama ve İlaçlama
*Bayram YAMAN Vet Sağ. Teknikeri olup,
sürülerin aşılanması ve ağılların ilaçlanmasında
çalışacaktır.
Verilerin Değerlendirilmesi, istatistik
analizlerin yapılması, sonuç raporunun
yazılması
Mart-Nisan/2015-2016
Mart-Ekim/2015-2016
Nisan/2015- Mart/2017
Proje Sonuçları Uygulama Aktarımı
Konya Bölgesinde Yarı-Entansif Koşullarda Kıl, Saanen x Kıl ve Alpin x
Proje Adı
Kıl Melezi Keçilerinin (F1, G1 ve F1 x G1) Bazı Verim Özellikleri
97
PROJENİN AMACI: Bu çalışma sayesinde yarı entansif şartlarda aynı bakım ve besleme
koşulları dikkate alınarak üç genotipin verim düzeyleri ortaya konularak, Orta Anadolu
Bölgesi ekolojik koşullarında hangi genotipin daha verimli olabileceği bu çalışmanın önemli
sonuçlarından olacaktır.
Ayrıca bu proje sonrası elde edilecek bulgular hem literatüre katkı sağlayacak, hem de ARGE çalışmalarına ışık tutarak süt keçisi yetiştiriciliği konusunda bir takım somut veriler
elde edilmesini sağlayacaktır. Diğer yandan proje kapsamındaki yetiştiricilere keçicilik
işletmelerinde yarı entansif şartlarda yetiştirme, sürü idaresi konularında ve makineli
sağım prensipleri ve hijyen hususlarında gereken eğitim verilerek, kaliteli süt üretimine
yönelik pazar koşullarının en doğru biçimde ortaya konulması sağlanacaktır.
ÇIKTILARIN UYGULAMAYA AKTARILMASI VE YAYGINLAŞTIRILMASI
Sıra Proje Çıktıları
Çıktıların Uygulamaya Aktarılma
Mekanizmaları
1
Proje Sonuç Raporu Sonuç raporu kitapçığı yayınlanacaktır.
2
Bildiriler
Elde edilen bulgular bilimsel makaleye dönüştürülerek bilimsel bir
dergide yayınlanacaktır. Bununla birlikte ulusal ve uluslararası
kongrelerde bildiri olarak sunulacaktır.
3
Yayınlar (Makale) Yurtiçi veya yurtdışı hakemli dergilerde yayınlanması düşünülmektedir.
4
Yetiştirici yönelik
Proje süresince düzenli olarak tutulacak olan verim kayıtları sayesinde,
toplantılar
yetiştiricilere kayıt tutma ve değerlendirme işi öğretilerek gelecekte
damızlıkçı sütçü keçi işletmelerinin temelleri atılmış olunacaktır.
5
Web Sitesi
Proje çıktıları ve yayınları Enstitü’nün web sitesine konulacaktır.
TALEP EDİLEN BÜTÇE
I. Yatırım Tutarı
06 SERMAYE GİDERLERİ
06.1- Mamul Mal Alımları
06.2- Menkul Sermaye Üretim Giderleri
06.3- Gayri Maddi Hak Alımları
06.4- Gayrimenkul Alımları ve Kamulaştırılması
06.5- Gayrimenkul Sermaye Üretim Giderleri
06.6- Menkul Malların Büyük Onarım Giderleri
06.7- Gayrimenkul Büyük Onarım Giderleri
06.8- Stok Alımları
06.9- Diğer Sermaye Giderleri
Toplam
Genel Toplam
1.Yıl
2.000
12.000
5.000
YILLARA GÖRE DAĞILIM
2.Yıl 3 Yıl 4.Yıl
5 Yıl
2.000
12.000
5.000
4.000 4.000
23.000 23.000
46.000
II. Bütçe Gerekçesi ve Yatırım Tutarının Dağılımı
06. SERMAYE GİDERLERİ
6 1
MAMUL MAL ALIMLARI
6 1 2 2 Bilgisayar Alımları
6 1 2 4 Laboratuvar Cihazı Alımları (Yağ analiz cihazı alımı)
Laboratuvar Gereçleri Alımları (Pens, bistüri, pipet, ilaçlama
6 1 3 4 gereçleri vs.)
6 2
MENKUL SERMAYE ÜRETİM GİDERLERİ
Diğer Alımlar (canlı hayvan alımı, yem alımı, sağlık koruma,
6 2 9 1 analiz ücretleri)
6 5
6 6
MENKUL MALLARIN BÜYÜK ONARIM GİDERLERİ
6 6 4 2 Akaryakıt ve Yağ Alımları
2014
YILLARA GÖRE DAĞILIM
2015
2016
2017 2018
2.000
2.000
12.000
12.000
5.000
5.000
98
6 6 4 3 Elektrik Alımları
6 6 5 2 Taşıt Kiralama Giderleri
6 9
DİĞER SERMAYE GİDERLERİ
6 9 2 1 Yurtiçi Geçici Görev Yollukları
TOPLAM
GENEL TOPLAM
4.000
4.000
23.000 23.000
46.000
TEKLİF ONAYI
Proje /Alt Proje Lideri
Öneren Kuruluş Müdürü
Adı Soyadı
Hakan ERDURAN
Fatih ÖZDEMİR
Tarih
İmza
99
KÜÇÜKBAŞ HAYVANCILIK ARAŞTIRMALARI
GELİŞME RAPORLARI
Proje Gelişme Raporu Formu
Kıl Keçisi ve Honamlı Tipi Kıl Keçisi Oğlak ve Çebiçlerinin
Ekstansif Şartlardaki Büyüme Performansı, Vücut Ölçüleri,
Kesim ve Karkas Özellikleri
TAGEM/HAYSÜD/13/A-07/P-01/05
PROJE BAŞLIĞI
PROJE NUMARASI
PROJE LİDERİ
Dr. Ahmet Hamdi AKTAŞ
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
RAPORUN İLGİLİ OLDUĞU
DÖNEM
01/01/2013-31/12/2013
Proje Özeti: Bu çalışmada, Halk elinde yetiştirilen Kıl Keçisi ve Honamlı Tipi Kıl Keçisi
oğlak ve çebiçlerinin ekstansif şartlardaki büyüme performansı, vücut ölçüleri ile kesim ve
karkas özellikleri karşılaştırılmalı olarak incelenecektir.
Bu araştırma ile Honamlı ile Kıl Keçisi arasındaki büyüme özellikleri yönünden
Honamlı lehindeki muhtemel farkı ortaya koymak ve çevre x genotip interaksiyonu olup
olmadığını tespit etmek mümkün olabilecektir. Bu amaçla iki genotipten 3’er işletmeden, 3-5
yaş arasındaki analardan doğan ve 75-80 günlük yaşta sütten kesilmiş toplam 60 baş tekiz
erkek oğlak ile 15 aylık yaşta ve yaklaşık aynı canlı ağırlıkta toplam 60 baş tekiz erkek çebiç
diğer işletmelere transfer edilerek Mayıs ayından Kasım ayına kadar ekstansif şartlarda (mera,
orman içi, meşelik alanlar) otlatılacaklardır. Bu dönemde oğlak ve çebiçlerin canlı ağırlıkları
ve vücut ölçüleri tespit edilecektir. Mera sezonu sonunda her işletmedeki her genotipten 3’er
baş oğlak ve 3’er baş çebiç kesilerek kesim ve karkas özellikleri belirlenecektir.
Anahtar Kelimeler: Kıl ve Honamlı Keçisi, büyüme performansı, bazı kesim ve karkas
özellikleri
Başlıca Faaliyetlerin Gerçekleşme Durumu: Dönem Bulguları:
Bu dönemde planlanan faaliyetlerden oğlak denemesi ile ilgili çalışmaların tamamı
gerçekleştirilmiştir. Mayıs ayı içerisinde yetiştirici ve hayvan seçimi yapılmış, her iki
genotipten 3’er işletmeden, 3-5 yaş arasındaki analardan doğan ve 75-80 günlük yaşta sütten
kesilmiş toplam 60 baş tekiz erkek oğlak diğer işletmelere transfer edilmiştir. Oğlaklar 25
Mayıs tarihinden 21 Kasım tarihine kadar ekstansif şartlarda (mera, orman içi, meşelik
alanlar) otlatılmıştır. Daha sonra oğlaklar Enstitü’ ye getirilerek karkas çalışması
tamamlanmıştır. Oğlak çalışmasından elde edilen bulgular aşağıdaki tablolarda verilmiştir.
Tablo 1. Denemenin Farklı Dönemlerinde Oğlakların Canlı Ağırlıkları
Dönemler
n
Bölge
Beyşehir
Taşkent
P
Irk
Honamlı
Kıl Keçisi
P
Bölge x Irk
B-Honamlı
B-Kıl Keçisi
25 Mayıs
Ort.
SH
n
24 Temmuz
Ort.
SH
n
22 Eylül
Ort.
SH
21 Kasım
n Ort.
SH
TCAA
Ort.
SH
30
30
19.8
19.8
0.20
0.20
0.992
29
29
24.9
25.3
0.41
0.42
0.426
29
29
29.3
29.6
0.49
0.50
0.631
29 28.9
27 28.8
0.47
0.49
0.925
9.1
9.0
0.43
0.44
0.917
30
30
19.8
19.7
0.20
0.20
0.854
30
28
25.2
25.0
0.41
0.41
0.713
30
28
29.6
29.3
0.50
0.50
0.692
28 29.0
28 28.7
0.48
0.48
0.647
9.2
9.0
0.43
0.43
0.670
15
15
19.8
19.9
0.27
0.28
15
14
25.2
24.5
0.57
0.58
15
14
30.0
28.5
0.68
0.70
15 29.6
14 28.2
0.65
0.67
9.8
8.4
0.59
0.61
100
T-Honamlı
T-Kıl Keçisi
P
15
15
19.8
19.6
0.29
0.28
0.265
15
14
25.2
25.5
0.61
0.58
0.368
15
14
29.1
30.1
0.73
0.70
0.092
13 28.4
14 29.2
0.70
0.67
0.126
8.6
9.6
0.64
0.61
0.068
Ort. :Ortalama, SH: standart hata P>0.05
Tablo 2. Denemenin Farklı Dönemlerinde Oğlakların Günlük Canlı Ağırlık Artışları
Dönemler
25 Mayıs24
Temmuz
Ort. ± SH
25 Temmuz22
Eylül
Ort. ± SH
Bölge
Beyşehir
85 ± 5.6
Taşkent
93 ± 5.9
P
0.343
Irk
Honamlı
90 ± 5.8
Kıl Keçisi
88 ± 5.7
P
0.746
Bölge x Irk
B-Honamlı
93 ± 7.8
B-Kıl Keçisi
77 ± 8.1
T-Honamlı
87 ± 8.4
T-Kıl Keçisi
99 ± 8.1
P
0.084
Ort. :Ortalama, SH: standart hata, P>0.05
23-Eylül21 Kasım
Ort. ± SH
Tüm Mera Dönemi
Ort. ± SH
73 ± 5.1
71 ± 5.2
0.761
-6 ± 2.6
-13 ± 2.7
0.089
51 ± 2.4
50 ± 2.5
0.915
73 ± 5.2
71 ± 5.1
0.883
-9 ± 2.7
-10 ± 2.7
0.892
51 ± 2.4
50 ± 2.4
0.677
79
67
66
76
-7
-6
-12
-14
54
47
48
53
±
±
±
±
7.0
7.3
7.5
7.3
0.148
±
±
±
±
3.7
3.8
3.9
3.8
0.582
±
±
±
±
3.3
3.4
3.5
3.4
0.065
Farklı Dönemlerde Canlı Ağırlık Değişimi
Canlı Ağırlık
31
29
27
25
Honamlı
23
Kıl Keçisi
21
19
17
25 Mayıs
24 Temmuz
22 Eylül
21 Kasım
Dönemler
Şekil 1. Merada Otlatmanın Farklı Dönemlerinde Oğlakların Canlı Ağırlık Değişimleri
101
Tablo 3. Vücut Ölçüleri, cm
Bölge
Özellikler
Beyşehir
Ort. ± SH
P
Honamlı
Ort. ± SH
Irk
Kıl Keçisi
Ort. ± SH
± 0.37
± 0.37
0.829
0.731
55.2 ± 0.52
66.1 ± 0.37
54.2
65.2
± 0.52
± 0.36
0.072
0.083
± 0.39
± 0.38
0.674
0.577
55.7 ± 0.39
66.6 ± 0.38
54.9
65.9
± 0.39
± 0.38
0.155
0.178
± 0.55
± 0.56
0.927
0.711
60.6 ± 0.55
72.5 ± 0.56
59.7
71.8
± 0.55
± 0.55
0.256
0.377
± 0.09
± 0.09
0.775
0.726
13.7 ± 0.09
14.3 ± 0.09
13.5
14.1
± 0.09
± 0.09
0.102
0.101
± 0.10
± 0.10
0.651
0.534
14.5 ± 0.10
15.1 ± 0.10
14.3
14.9
± 0.10
± 0.10
0.136
0.165
± 0.20
± 0.19
0.624
0.709
22.5 ± 0.20
27.5 ± 0.19
22.2
27.2
± 0.20
± 0.19
0.234
0.272
± 0.39
± 0.39
0.975
0.844
58.1 ± 0.39
63.1 ± 0.39
57.0
62.0
± 0.39
± 0.38
0.054
0.067
± 0.45
± 0.44
0.788
0.769
63.4 ± 0.46
68.3 ± 0.44
62.4
67.3
± 0.45
± 0.43
0.125
0.119
Taşkent
Ort. ± SH
Cidago Yüksekliği
Mera Başı
54.8 ± 0.37
54.6
Mera Sonu
65.8 ± 0.36
65.6
Sağrı Yüksekliği
Mera Başı
55.4 ± 0.39
55.1
Mera Sonu
66.4 ± 0.38
66.1
Göğüs Çevresi
Mera Başı
60.2 ± 0.55
60.1
Mera Sonu
72.3 ± 0.55
72.0
Göğüs Genişliği
Mera Başı
13.7 ± 0.09
13.6
Mera Sonu
14.3 ± 0.09
14.2
Sağrı Genişliği
Mera Başı
14.4 ± 0.10
14.4
Mera Sonu
15.1 ± 0.10
15.0
Göğüs Derinliği
Mera Başı
22.3 ± 0.20
22.4
Mera Sonu
27.3 ± 0.19
27.4
Beden Uzunluğu
Mera Başı
57.6 ± 0.39
57.6
Mera Sonu
62.6 ± 0.38
62.5
Vücut uzunluğu
Mera Başı
63.0 ± 0.45
62.8
Mera Sonu
67.9 ± 0.43
67.7
Ort. :Ortalama, SH: standart hata, P>0.05
P
Tablo 4. Kesim Özellikleri
Özellikler
Kesim Ağırlığı, kg
Sıcak karkas ağırlığı, kg
Sıcak karkas oranı, %
İç Yağ ağırlığı, g
İç Yağ oranı, %
Deri ağırlığı, kg
Deri oranı, %
Ayak ağırlığı
Ayak oranı, %
Baş ağırlığı
Bölge
Beyşehir Taşkent
Ort.
Ort.
27.3
26.7
11.7
11.2
42.6
42.0
166
134
0.59
0.50
2.62
2.54
9.65
9.51
0.87
0.86
3.20
3.22
1.81
1.76
SH
0.56
0.31
0.33
14.0
0.035
0.042
0.093
0.020
0.049
0.040
P
0.496
0.346
0.213
0.075
0.060
0.187
0.322
0.618
0.855
0.463
Irk
Honamlı Kıl Keçisi
Ort.
Ort.
27.3
26.7
11.6
11.3
42.4
42.1
154
145
0.56
0.54
2.58
2.52
9.48
9.43
0.88
0.85
3.24
3.18
1.81
1.78
SH
0.56
0.31
0.33
12.3
0.035
0.042
0.093
0.020
0.049
0.036
P
0.479
0.461
0.525
0.607
0.668
0.956
0.121
0.141
0.343
0.697
102
Baş oranı,%
6.66
6.65
Takım ağırlığı, kg
1.10
1.05
Takım oranı, %
4.04
3.91
Ort. :Ortalama, SH: standart hata, P>0.05
0.086
0.026
0.083
0.928
0.179
0.275
6.63
1.05
3.86
6.69
1.09
4.09
0.086
0.026
0.083
0.649
0.351
0.063
Irk
Kıl Keçisi
Ort.
63.8
26.5
12.6
68.3
14.6
36.9
40.5
31.4
SH
0.46
0.19
0.13
0.56
0.10
0.46
0.34
0.32
P
0.577
0.168
0.503
0.169
0.671
0.310
0.096
0.093
Tablo 4. Karkas Ölçüleri, cm
Özellikler
Göğüs Çevresi
Göğüs Derinliği
Göğüs Genişliği
Karkas Uzunluğu
Sağrı Genişliği
But Çevresi
Dış But Uzunluğu
İç But Uzunluğu
Beyşehir
Ort.
63.9
26.7
12.7
68.8
14.7
37.2
40.6
31.7
Bölge
Taşkent
Ort.
64.1
26.7
12.6
68.9
14.6
37.3
41.2
31.9
SH
0.46
0.19
0.13
0.56
0.10
0.46
0.34
0.32
Honamlı
Ort.
64.2
26.9
12.7
69.4
14.7
37.6
41.3
32.2
P
0.697
0.824
0.583
0.911
0.359
0.966
0.262
0.746
Ort. :Ortalama, SH: standart hata, P>0.05
Tablo 5. Karkas Özellikleri
Bölge
Irk
Beyşehir Taşkent
Ort.
Ort.
11.1
10.7
Özellikler
Soğuk Karkas ağırlığı, kg
SH
0.33
P
0.389
Honamlı
Ort.
11.1
Kıl Keçisi
Ort.
10.7
SH
0.33
P
0.420
Soğuk Karkas Oranı, %
Böbrek-Leğen Yağı ağırlığı, g
40.6
122
40.1
105
0.44
8.5
0.404
0.168
40.6
121
40.1
107
0.44
8.5
0.362
0.257
Böbrek-Leğen Yağı oranı, %
Böbrek ağırlığı, g
1.09
106
0.97
105
0.06
2.8
0.165
0.910
1.07
104
0.99
108
0.06
2.8
0.321
0.301
Böbrek oranı, %
Testis ağırlığı, g
0.96
122
0.99
116
0.030
8.0
0.629
0.418
0.94
124
1.01
114
0.030
8.0
0.104
0.099
Testis oranı, %
Kuyruk ağırlığı, g
1.10
49
1.08
43
0.048
0.9
0.712
0.830
1.12
48
1.06
44
0.048
0.9
0.072
0.830
0.40
0.012
0.578
0.43
0.41
0.012
0.578
Kuyruk oranı, %
0.44
Ort. :Ortalama, SH: standart hata, P>0.05
Tablo 6. Sol Yarım Karkasta Parçaların Ağırlıkları ve Oranları
Özellikler
Yarım karkas, g
Kol ağırlığı, g
Kol oranı, %
Etek ağırlığı, g
Etek oranı, %
But ağırlığı, g
But oranı, %
Beyşehir
Ort.
5546
1321
23.8
493
8.98
1790
32.3
Bölge
Taşkent
Ort.
SH
5324
150.3
1238
40.8
23.3
0.33
477
22.3
8.97
0.400
1778
54.5
33.4
0.45
P
0.304
0.162
0.262
0.616
0.997
0.877
0.097
Honamlı
Ort.
5556
1284
23.1
496
8.97
1808
32.6
Irk
Kıl Keçisi
Ort.
5314
1275
24.0
475
8.98
1760
33.1
SH
150.3
40.8
0.33
22.3
0.400
54.5
0.45
P
0.262
0.875
0.093
0.515
0.992
0.537
0.410
103
Boyun ağırlığı, g
475
433
Boyun oranı, %
8.57
8.17
Omuz başı ağırlığı, g
480
472
Omuz başı oranı, %
8.57
8.83
Sırt-bel ağırlığı, g
988
926
Sırt-bel oranı, %
17.8
17.4
Ort. :Ortalama, SH: standart hata, P>0.05
20.1
0.337
27.8
0.394
38.5
0.456
0.151
0.407
0.848
0.640
0.262
0.537
466
8.39
506
9.09
996
17.8
441
8.35
446
8.31
917
17.3
20.1
0.337
27.8
0.394
38.5
0.456
0.378
0.926
0.133
0.176
0.158
0.418
Pirzolada (Bel) Doku Ağırlıkları ve Oranları:
Veriler alındı, fakat henüz analizler tamamlanmadı.
2. Yapılması Düşünülen Ara Yayınlar: Oğlakların büyüme performansı, vücut ölçüleri,
kesim ve karkas özellikleri ile ilgili yayın yapılması (bildiri/makale) düşünülmektedir.
3. Darboğazlar: Konya İlinde 2012 yılında aşırı kar yağışı ve soğuk hava nedeni ile kış
şartları çok zor geçtiğinden dolayı hayvan materyalinin temin edildiği sürülerde de (Ülkesel
Küçükbaş Islah Projesi’nin yürütüldüğü sürüler) doğum döneminde oğlak kayıp oranları çok
yüksek olmuştur. Bu nedenle 2013 yılında proje şartlarına uygun erkek çebiç temin
edilememiştir.
4. Proje Faaliyet Takvimi: Çebiçlerle ilgili deneme (projede istenilen özellikte erkek çebiç
bulunabildiği takdirde) 2014 yılında yapılacaktır.
Adı Soyadı
Tarih
Kuruluş Amiri
Fatih ÖZDEMİR
Proje Lideri
Dr. Ahmet Hamdi AKTAŞ
İmza
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Bazı Koyun Irklarında Çiftleşme, Doğum, Ana ve
Kuzu Davranışlarının Belirlenmesi
PROJE NUMARASI
TAGEM / HAYSÜD /
PROJE LİDERİ
Zir. Yük Müh. Tülay CANATAN
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ OLDUĞU
DÖNEM
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
/ / /
01/ 12 /2013 ile 31/ 12 /2013 arası
Proje Özeti:
Araştırmanın hayvan materyalini Bahri Dağdaş Uluslararası Tarımsal Araştırma
Enstitüsünün koyunculuk ünitesinde bulunan Merinos, Akkaraman, Hasak ve Hasmer
genotipi koç ve koyunlar ile bunlardan elde edilen kuzular oluşturacaktır. Her ırktan (2, 3 ve 4
yaşlarında) 9 baş olmak üzere toplam 36 baş koç, yine her ırktan değişik yaşlarda 36 baş
olmak üzere toplam 144 baş koyun kullanılacaktır. Projenin amacı; adı geçen genotiplerde
çiftleşme, doğum, ana ve kuzu davranışlarının tanımlanması, söz konusu özellikler üzerine
genotip ve sistematik çevre etmenlerinin etkilerinin belirlenmesidir.
Araştırma kapsamında koç katımı, 2014 ve 2015 Ağustos-Eylül ayların da yapılacaktır.
Koyunlarda kızgınlıklar olağan çiftleşme mevsimi içinde intravaginal sünger uygulaması ve
104
ardından PMSG enjeksiyonu ile senkronize edilecektir. Senkronizasyon sonrası 3 koyunla
birlikte bölmelere alınan koçlarda; aşım davranışları belirlenecektir. Doğum zamanı ise;
koyunlarda analık davranışları ile doğumdan hemen sonraki dönemde kuzuların davranış
özellikleri incelenecektir. Aşımlar 30 dakika süreyle hem doğrudan (gözlemcinin saniye
duyarlığında dijital kronometre ile) hem de kamera ile izlenecektir. Doğrudan ve kamera ile
yapılacak gözlemler ile biniş sayısı, biniş süresi, ejekulasyon sayısı, ejekulasyon süresi,
çiftleşme etkinliği ve kur davranışları kaydedilecektir. Doğumlar ise; hem sabit kameralarla
görüntülecek hem de gözlemcinin elindeki kronometri ile önceden hazırlanmış olan formlar
üzerine işlenerek kayıt altına alınacaktır. Doğum zamanında koyunların; doğumun uzunluğu
(İlk huzursuzluk ve kasılmadan doğuma kadarki süre), doğumda yatma kalkma sayısı, ananın
kuzuyu kabul veya reddetmesi, plesantanın atım süresi, yalama süresi, kuzunun doğumdan ilk
ayağa kalkmasına kadar geçen süre, doğumdan ilk emmeye kadar geçen süre ile koyun ve
kuzunun doğumdaki ağırlıkları belirlenecektir.
Gözlem sırasında koyunların kolayca tanınması ve eksiksiz görüntü elde edilmesi amacıyla
sırtına iki taraflı olmak üzere hayvanların numaraları yazılacaktır.
Proje mevcut genotiplerde çeşitli davranış özelliklerinin incelenerek ırk içi ve arası
farklılıklarının ortaya konması, bu genotiplerden daha iyi faydalanabilmemiz açısından
önemlidir. Projede ayrıca; doğum sonrasında ana ve kuzu arasındaki ilişki düzeyinin tespiti,
özelliklede kuzu ölümlerinin azaltılabilmesi yönünde alınacak önlemler bakımından yol
gösterici bilgilerin elde edilmesi amaçlanmaktadır. Bunun yanında bu çalışma bu ırklar
hakkında literatüre bilimsel katkı sağlayacaktır.
Anahtar Kelimeler: Koyun, üreme davranışları, ana ve kuzu davranışları
Proje Hedeflerinin Gerçekleşme Durumu:
Proje 2013 yılı Proje Değerlendirme Toplantısında sunuldu ve 2014 yılında başlamak üzere
kabul edildi. Proje bütçesinin 2014 Mart ayında gelmesi beklenmektedir
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Proje 2014 Mayıs ayında başlayacağı için elde edilen bulgular yoktur.
Yapılması Düşünülen Ara Yayınlar:
Proje başladıktan sonra elde edilen verileri değerlendirilerek ara yayın yapılması
düşünülmektedir.
Bütçe Harcamaları Özeti:
Proje Mayıs 2014 yılında başlayacağı için herhangi bir harcama yapılmamıştır.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Ülkesel/Entegre Proje
Koordinatörü
Tarih
İmza
Fatih ÖZDEMİR
Zir. Yük. Müh. Tülay CANATAN
Dr. İrfan DAŞKIRAN
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Metabolik
Profil
Testinin
Koyunculuk
İşletmelerinde Uygulana Biriliğinin Araştırılması
(Doktora Tezi)
PROJE NUMARASI
TAGEM / HAYSÜD
PROJE LİDERİ
Necdet İlker İÇİL
105
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ OLDUĞU
DÖNEM
Hayvancılık Merkez Araştırma Enstitüsü MüdürlüğüANKARA
01/ 01 /2013 ile 31/ 12 /2013 arası
Proje Özeti: Planlanan bu çalışma ile; Koyunların verim hayatındaki kritik dönemlerin ve
bu dönemlerdeki kan kimyası profilinin belirlenerek verim özellikleri ve peripartal dönem
hastalıklarla olan ilişkisinin araştırılması, Profil belirleme işleminin daha pratik ve maliyeti
düşük uygulamalarla mümkün olup olmadığının belirlenerek, MPT’ nin ülkemiz koşullarında
sahada uygulanabilirliğinin araştırılması ve Ölçümü yapılan metabolitler için yaş ve fizyolojik
dönemler arası farklarla ilgili verilerin elde edilmesi, amaçlanmaktadır.
Aynı fizyolojik dönem içinde olan hayvanlardan alınan kan örneklerinin birleştirilip
tek örnek haline getirilmesi esasına dayanan ‘pooledsample’ yöntemi metabolikprofil testinin
maliyetini düşürmek için ortaya atılmış bir yöntemdir. Profil belirleme işleminin maliyeti
düşük uygulamalarla mümkün olup olmadığının araştırılması için; elde edilen metabolitler bu
yöntem kullanılarak birleştirilecek ve söz konusu yöntemin metabolitlerin bireysel aritmetik
ortalamasını metabolit bazında ne oranda yansıttığı belirlenecektir.
Proje Hedeflerinin Gerçekleşme Durumu:
Proje 2013 yılı Proje Değerlendirme Toplantısında sunuldu ve 2014 yılında başlamak üzere
kabul edildi. Proje bütçesinin 2014 Mart ayında gelmesi beklenmektedir
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Proje 2013 Mayıs ayında başlayacağı için elde edilen bulgular yoktur.
Darboğaz: Proje Lideri Bornova Veteriner Kontrol Enstitüsü Müdürlüğüne Tayin olmuştur.
Burda alınacak karar doğrultusunda Doktora Çalışması olan bu Projenin bundan sonra
Bornova Veteriner Kontrol Enstitüsüne Müdürlüğü bünyesinde yürütülmesi talep
edilmektedir.
Yapılması Düşünülen Ara Yayınlar:
Proje başladıktan sonra elde edilen verileri değerlendirilerek ara yayın yapılması
düşünülmektedir.
Bütçe Harcamaları Özeti:
Proje Mayıs 2014 yılında başlayacağı için herhangi bir harcama yapılmamıştır.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Tarih
İmza
Muharrem SATILMIŞ
Necdet İlker İÇİL
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Koyunlarda Östrus Siklusunda Ve Gebeliğin Erken Döneminde
Uterustan Elde Edilen Ultrason Görüntülerinin İşlenmesi
PROJE NUMARASI
TAGEM / HAYSÜD
PROJE LİDERİ
PROJE
YÜRÜTÜCÜSÜ
N.Kürşat AKBULUT
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
106
RAPORUN İLGİLİ
OLDUĞU DÖNEM
01/01/2013-31/12/2013
Proje Özeti: Bu çalışmanın amacı bir seksüel siklus boyunca ve gebeliğin erken
günlerinde günlük ultrason görüntülerinden alınan uterus kesit görüntülerinin, görüntü analiz
programında işlenerek piksellerin ortalama gri değeri (Mean gray value of pixels)’nin
belirlenmesi ve bu değerin siklusun günlerine ve gebelik dönemine göre nasıl bir değişiklik
gösterdiğinin tespit edilmesidir. Aynı zamanda siklus boyunca ve gebeliğin ilk günlerinde
günlük alınan kanların progesteron analizleri yapılacaktır.
Bu amaçla Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü Müdürlüğü’nde
yetiştirilen östrusları senkronize edilmiş 2-3 yaşlı 100 baş Merinos ırkı koyun kullanılacaktır.
Senkronizasyon sonrası kızgınlık gösteren koyunlardan yarısı tohumlanmayıp östrus siklusu
boyunca, diğer koyunlara ise koç katılıp 20 gün boyunca folliküler dönemde günlük luteal
dönemde ise 2 günde bir ultrason görüntüleri elde edilecektir. Her iki gruptaki koyunların
ultrason muayenelerinde elde edilen görüntüler daha sonra değerlendirilmek üzere bir veri
depolama aygıtında depolanacaktır.
Sonuç olarak elde edilen değerler koyunun seksüel siklusun hangi döneminde olduğunun
tespit edilmesi ve erken gebelik teşhisi açısından önemli katkılar sağlayacaktır
Anahtar Kelimeler: Seksüel siklus, görüntü analizi, piksellerin ortalama gri değeri,
Progesteron
Başlıca Faaliyetlerin Gerçekleşme Durumu: Proje faaliyet takvimi beklenmektedir.
Yapılması Düşünülen Ara Yayınlar: Yok
Darboğazlar: Yok
Projede Önerilen Değişiklikler: Projenin proje lideri N.Kürşat AKBULUT tarafından
doktora tez projesi olarak sunulması önerilmektedir.
Adı Soyadı
Kuruluş Amiri
Fatih ÖZDEMİR
Proje Lideri
N.Kürşat AKBULUT
Tarih
İmza
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Bandırma Koyununda Üreme, Büyüme
Özelliklerinin Islahı ve Tip Sabitleştirme
PROJE NUMARASI
TAGEM/HAYSÜD/12/A-07/P-01/
PROJE LİDERİ
Tamer SEZENLER
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Koyunculuk Araştırma İstasyonu Müdürlüğü
ve
Karkas
01/01/2013 ile 01/01/2014 arası
Proje Özeti:
Proje 2014 yılı doğum dönemi ile başlayacaktır.
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Dönem bulgusu yoktur.
107
Yapılması Düşünülen Ara Yayınlar: Ara yayın planlanmamıştır.
Darboğazlar: Darboğaz yoktur.
Projede Önerilen Değişiklikler:
Materyal ve Yöntem: Değişiklik önerisi yoktur.
Proje Faaliyet Takvimi:
Personel: Kurumumuz araştırıcılarından İsmail ERDOĞAN ve Dr. Mesut YILDIRIR tayin
sebebiyle projeden ayrılmıştır.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Tarih
İmza
Müstakim BAYRAM
Tamer SEZENLER
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Kıvırcık ve Karacabey Merinosu Koyun Irklarında Kur
ve Aşım Davranışlarının Elde Sıfat Yöntemiyle
Belirlenmesi
PROJE NUMARASI
TAGEM/HAYSÜD/12/A-07/P-01/
PROJE LİDERİ
Tamer SEZENLER
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Koyunculuk Araştırma İstasyonu Müdürlüğü
01/01/2013 ile 01/01/2014 arası
Proje Özeti: Proje takvimi gereği 2013 yılı koç katımı ile başlatılması planlanan çalışmalar
gerekli çiftleştirme alanı ve ortamı oluşturulamadığı için 2014 yılı koç katımı döneminde
başlatılmak üzere ertelenmiştir.
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Dönem bulgusu yoktur.
Yapılması Düşünülen Ara Yayınlar: Ara yayın planlanmamıştır.
Darboğazlar: Darboğaz yoktur.
Projede Önerilen Değişiklikler:
Materyal ve Yöntem: Değişiklik önerisi yoktur.
Proje Faaliyet Takvimi:
Personel: Kurumumuz araştırıcılarından İsmail ERDOĞAN ve Dr. Mesut YILDIRIR tayin
sebebiyle projeden ayrılmıştır.
Bütçe:
Bütçe Harcamaları Özeti: Harcama Yapılmamıştır.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Tarih
İmza
Müstakim BAYRAM
Tamer SEZENLER
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Ülkesel Merinos Geliştirme Projesi
108
PROJE NUMARASI
TAGEM/HAYSÜD/12/A-07/P-01
PROJE LİDERİ
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Tamer SEZENLER
Koyunculuk Araştırma İstasyonu Müdürlüğü
01/01/2013 ile 01/01/2014 arası
Başlıca Faaliyetlerin Gerçekleşme Durumu: Sürü Kompozisyonu:
Çizelge 1. Karacabey Merinosu Koyunların Sürü Kompozisyonu
Elit
Islah
Toplam
Koç
Koyun
65
4
69
598
400
998
Erkek
Toklu
129
1
130
Dişi Toklu
Erkek
Kuzu
Dişi Kuzu
174
98
272
TOPLAM
966
503
1469
Koç Katımı: Elit ve Islah sürülerinde 2013 yılı Ağustos ayında yapılmıştır. Doğumlar devam
etmektedir.
Canlı Ağırlıklar: 2013 yılı Elit ve ıslah sürülerinde doğum 45. gün, 90. gün, 180. Gün canlı
ağırlı tartımları alınmıştır. Bir yaş tartımları Ocak ayında gerçekleştirilecektir. Bunun yanında
2012 yılında alınarak analiz yapılmak üzere Lalahan Hayvancılık Merkez Araştırma
Enstitüsü’ne gönderilen yapağı numune sonuçları aşağıda verilmiştir. Damızlık Seçimi:2012
yılında doğan dişi ve erkek kuzular 2014 yılında damızlıkta kullanılmak üzere belirlenmiştir.
Dönem Bulguları: Üreme Özellikleri: Çizelge 2. Döl verimi özelliklerine ilişkin değerler
Döl Verimi ve Yaşama Gücü
Koçaltı Koyun
Kızgınlık Gösteren koyun
Kızgınlık Göstermeyen koyun
Doğuran Koyun
Doğum Yapmayan Koyun
Doğan Kuzu
Tek Doğan Kuzu
İkiz Doğan Kuzu
Üçüz Doğan Kuzu
Yaşama Gücü (90 gün)
Aşım Oranı,% (KAK)
Doğum Oranı,% (KAK)
Koçaltı Koyuna Göre Kuzu Verimi
Doğuran Koyuna Göre Kuzu
Verimi
Çoğuz Doğum Oranı,%
Islah Sürü
Elit Sürü
2012
621
569
52
434
187
519
351
162
6
90,5
91,6
69,8
0,83
1,19
19,1
2013
606
570
36
94,0
2012
430
365
65
266
164
299
233
66
0
88,3
84,8
61,8
2013
408
377
31
92,4
0,69
1,12
12,4
109
Çizelge 3. Elit ve Islah sürülerinde kuzuların çeşitli dönemlerdeki canlı ağırlıklarının bazı çevre faktörleri bakımından en küçük kareler
ortalamaları
Özellikler
Genel
CA_0
CA_45
CA_90
CA180
CA365
n
X ± SX
n
X ± SX
n
X ± SX
n
X ± SX
n
X ± SX
1968
4.76±0.019
1631
15.34±0.080
1549
28.90±0.149
1275
38.51±0.189
578
52.73±0.290
1152
4.59±0.053a
954
29.12±0.423
899
37.10±0.500a
578
53.15±0.744
b
---
---
Yıl
2012
2013
Sürü
Elit
942
14.51±0.232a
816
4.30±0.055
b
689
15.35±0.245
b
595
29.30±0.454
376
41.32±0.597
1150
4.52±0.052a
971
14.71±0.232a
870
31.88±0.244
851
38.48±0.497a
389
53.42±0.725
b
660
15.16±0.244
b
679
31.05±0.323
424
39.94±0.603
b
189
52.87±0.916
944
16.11±0.127a
883
29.90±0.186a
668
40.07±0.292a
264
53.55±0.521
671
14.55±0.199
b
650
28.50±0.231
b
589
39.05±0.340b
303
53.11±0.477
16
14.14±0.199
b
16
29.24±1.211
b
11
52.78±2.026
Islah
818
4.37±0.056
Doğum
Tipi
Tekiz
1112
5.13±0.024a
İkiz
832
4.30±0.028
b
c
Üçüz
24
3.90±0.147
Cinsiyet
Erkek
985
4.58±0.054a
811
15.24±0.236a
770
983
4.30±0.053b
820
14.63±0.238b
398
4.04±0.062a
300
14.02±0.281a
434
b
360
15.09±0.261
b
b
Dişi
Ana yaşı
2
3
4.45±0.058
c
245
15.43±0.270
132
15.32±0.316b
b
4
281
4.65±0.064
5
152
4.68±0.076c
6
272
4.45±0.061
b
220
14.99±0.260
7
302
4.39±0.065b
266
14.76±0.275ab
**
b
18
38.52±1.410
30.52±0.435a
639
41.26±0.535a
193
55.82±0.885a
779
27.91±0.436b
636
37.17±0.539b
385
50.47±0.737b
398
27.98±0.521a
231
37.60±0.652a
96
53.00±0.988
337
29.65±0.482
b
248
40.11±0.611b
126
54.23±0.895
214
29.75±0.511
b
62
52.22±1.074
126
29.75±0.582b
50
53.54±1.180
233
29.26±0.465
b
216
39.16±0.569
121
52.56±0.796
244
28.89±0.509ab
218
38.89±0.631ab
79
53.32±1.022
**
ab
169
38.82±0.637
86
40.71±0.811b
--1.64±0.097
2.65±0.184
2.06±0.249
βCA_0
a,b,c,d
Aynı sütun ve faktör içinde farklı üssel harfi taşıyan ortalamalar birbirinden farklıdır (P<0.05)
CA_0: doğum ağırlığı, CA_45: 45. Gün ağırlığı, CA_90: 90. Gün ağırlığı, CA_180: 180. Gün ağırlığı
βCA_0: ilgili yaş canlı ağırlığın doğum ağırlığı üzerine olan kısmi regresyon katsayısı ( **P<0.01)
ab
**
1.03±0.411*
110
Yapağı Özellikleri:
Çizelge 4. Karacabey Merinosu koyunlarında bazı yapağı özelliklerine ait açıklayıcı istatistikler
Değişken
CAĞR (kg)
K.Y.Ağr. (kg)
Uzunluk_H (mm)
Uzunluk_B (mm)
İncelik (mikron)
Elastikiyet (%)
Mukavemet (Cn/Tex)
Randıman (%)
N
X ± Sx
En Az
En Çok
Varyasyon Katsayısı (%)
153
153
153
153
153
153
153
153
57.35 ± 0.967
4.03 ± 0.057
25.30 ± 0.321
34.33 ± 0.571
25.18 ± 0.250
23.55 ± 0.478
12.62 ± 0.326
54.31 ± 0.989
29.80
1.90
16.00
19.20
19.87
10.78
6.65
25.10
100.40
5.80
36.50
56.50
36.69
36.86
29.01
95.30
20.87
17.51
15.70
20.58
12.28
25.10
31.98
22.52
CAĞR: canlı ağırlık. K.Y.Ağr.: kirli yapağı ağırlığı
Çizelge 5. Karacabey Merinosu koyunlarında bazı yapağı özellikleri arasındaki korelasyonlar
K.Y.Ağr.
Uzunluk_H
Uzunluk_B
İncelik
Elastikiyet
Mukavemet
Randıman
katsayıları
CAĞR (kg)
K.Y.Ağr. (kg)
Uzunluk_H (mm)
Uzunluk_B (mm)
İncelik (mikron)
Elastikiyet (%)
Mukavemet (Cn/Tex)
(kg)
0.395**
(mm)
0.291**
-0.030
(mm)
0.343**
-0.015
0.919**
(mikr.)
0.350**
0.093
0.549**
0.574**
(%)
0.188*
0.030
0.255**
0.358**
0.176*
(%)
0.154
-0.153
0.285**
0.271**
0.307**
0.013
0.193*
(Cn/Tex)
0.216**
0.077
0.476**
0.522**
0.802**
0.416**
**
P<0.01. *P<0.05. CAĞR: canlı ağırlık. K.Y.Ağr.: kirli yapağı ağırlığı
Çizelge 6. Karacabey Merinosu koyunlarında canlı ağırlık ve bazı yapağı özelliklerinim cinsiyet ve
yaşa göre ortalamaları ve standart hataları
CAĞR
(kg)
Cinsiyet
Erke
k
Dişi
Yaş
K.Y.Ağr.
(kg)
Uzunluk_H
(mm)
Uzunluk_B
(mm)
İncelik
(mikron)
Elastikiye
t
(%)
X ± Sx X ± Sx
X ± Sx
X ± Sx
X ± Sx
X ± Sx X ± Sx X ± Sx
46
77.0±1.28a
4.3±0.13a
26.9±0.72
37.8±1.28a
26.7±0.57a
25.6±1.11
13.9±0.77
55.5±2.32
b
b
25.6±0.37
b
25.0±0.30
b
23.9±0.58
12.3±0.40
55.4±1.20
a
4.0±0.01
23.9±0.49
a
a
24.6±0.38
22.1±0.74
12.6±0.51
51.8±1.55
4.2±0.14
26.4±0.79ab
37.1±1.39b
26.2±0.62
24.2±1.21
12.9±0.83
55.9±2.51
b
26.7±0.73
23.9±1.42
13.7±0.98
56.9±2.95
25.3±0.82
25.7±1.60
12.3±1.10
60.6±3.32
37.9±1.82
b
26.8±0.81
26.8±1.58
14.4±1.09
54.1±3.28
35.9±1.77
a
25.7±0.79
25.7±1.54
12.8±1.06
53.3±3.20
107
55.7±0.66
4.0±0.07
34.6±0.66
62
50.1±0.86
2
25
67.2±1.39b
3
18
72.0±1.63
b
4.4±0.17
27.9±0.92
4
15
71.0±1.83b
4.1±0.19
25.5±1.04ab
16
67.5±1.81
b
4.1±0.19
b
17
b
6
Randıma
n (%)
N
1
5
Mukaveme
t (Cn/Tex)
0.4±1.77
4.0±0.18
b
27.5±1.03
26.0±1.00
ab
31.8±0.86
38.8±1.63
35.6±1.84ab
a.b.c
Aynı sütunda aynı faktör seviyelerinde farklı harfleri taşıyan ortalamalar birbirinden farklıdır P<0.05)
CAĞR: canlı ağırlık. K.Y.Ağr.: kirli yapağı ağırlığı
Yapılması Düşünülen Ara Yayınlar: Ara yayın planlanmamıştır.
Darboğazlar:
Projede Önerilen Değişiklikler:
Materyal ve Yöntem: Değişiklik önerisi yoktur.
Proje Faaliyet Takvimi: Proje planlandığı gibi devam etmektedir.
Personel: Tayin sebebiyle İsmail ERDOĞAN ve Dr. Mesut YILDIRIR projeden ayrılmıştır
Bütçe Harcamaları Özeti:
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Tarih
İmza
Müstakim BAYRAM
Tamer SEZENLER
56
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Bandırma Koyunculuk Araştırma İstasyonu Bünyesinde
Yetiştirilen
Damızlık
Koçların
Spermatolojik
Özelliklerinin ve Dondurulabilirliğinin Belirlenmesi
PROJE NUMARASI
PROJE LİDERİ
Dr. Yalçın YAMAN
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Bandırma Koyunculuk Araştırma İstasyonu Müdürlüğü
01.01.2013 ile 01.01.2014 arası
Proje Özeti:
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Projenin teklif edildiği 2012 yılında henüz proje bütçesi gelmemişken,
kurum imkanları ile bazı ön çalışmalar yapılmıştır. Bu kapsamda yapılan faaliyetler şunlardır:
Koçların Sun-i Vajene alıştırılması:
Spermanın değerlendirilmesi
Spermanın sulandırılması
Spermanın Dondurulması
Çözdürme sonrası Spermanın Motilite muayenesi
Laparoskopik sun-i tohumlama
2013 yılı içerisinde projede kullanılmak üzere kimyasal madde ve sarf malzemesi temini
yapılmış, son olarak payet yazma makinesi için sipariş verilmiş olup cihazın gelmesi
beklenmektedir.
Yapılması Düşünülen Ara Yayınlar: Ara yayın düşünülmüyor.
Darboğazlar: Darboğaz yoktur
Projede Önerilen Değişiklikler: Varsa proje ile ilgili önerilen değişiklik önerileri
yazılmalıdır.
Materyal ve Yöntem: değişiklik öngörülmemektedir.
Personel: Değişiklik öngörülmemektedir
Bütçe: Kimyasal, sarf ve laboratuar cihaz alımları “Bandırma Biyoteknoloji Merkezinin
Kurulması” isimli Kalkınma Bakanlığı projesi bütçesinden gerçekleştirilmiştir.
Bütçe Harcamaları Özeti:
Proje başlangıcından itibaren dönemler üzerinden proje için harcanan ödeneklerin ana
kalemler bazında dökümü yapılacaktır.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Müstakim BAYRAM
Dr. Yalçın YAMAN
Tarih
İmza
27.12.2013
27.12.2013
57
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Erkek ve Kastre Ankara Keçisi Oğlaklarında Farklı
Kesim Ağırlıklarında Besi Performansı, Kesim, Karkas
ve Bazı Et Kalite Özellikleri (Tez projesi)
PROJE NUMARASI
TAGEM/HAYSÜD/13/A-07/P-01/04
PROJE LİDERİ
Halil EROL
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Hayvancılık Merkez Araştırma Enstitüsü
Lalahan/ANKARA
01/01/2013 - 30/01/2014
Proje Özeti: Bu araştırmanın amacı, erkek ve kastre edilmiş Ankara keçisi oğlaklarında
farklı kesim ağırlıklarında besi performansı, kesim, karkas ve bazı et kalite özelliklerinin
araştırılmasıdır.
Projenin hayvan materyalini, besi başlangıç ağırlığı 15.0 kg düzeyinde olan 50 baş
erkek ve 50 baş kastre olmak üzere toplam 100 baş Ankara keçisi oğlak oluşturacaktır.
Besi dönemi süresince kesif yem (yaklaşık %16.5 HP ve 2650 kcal/kg düzeyinde)
adlibitum olarak, kaba yem kaynağı yonca kuru otu+arpa sapı samanı ise 200g/gün düzeyinde
verilecektir.
Beside hayvan başına günlük ve 1 kg canlı ağırlık artışı için gerekli kesif ve kaba yem
tüketimi besi süresince, büyümeleri ise 2 haftada bir kez sabah aç karnına yapılan tartımlar ile
belirlenecektir.
Kesim ağırlıkları gruplarda ortalama 20.0, 25.0 ve 30.0 kg düzeyinde olacaktır.
Belirlenen canlı ağırlıklarda grup ortalamasına yakın 8’er hayvan kesilerek kesim, karkas ve
bazı et kalite özellikleri değerlendirilecektir.
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Proje; 2013 yılı için bildirilen takvimde olduğu gibi yürütülmüştür.
Raporun hazırlandığı tarih itibariyle proje oğlaklarının seçimi ve rastgele seçilen 50 oğlağın
kastrasyonu yapılmış, satın alınan hayvanların nakil işlemlerinden sonra gruplara (erkek ve
kastre) ayrılarak besi denemesi başlatılmıştır. Gruplarda yem tüketimleri belirlenmiş 15’er
günde bir sabah aç karnına canlı ağırlık tartımları yapılmıştır. Erkek ve kastre grupta 20, 25 ve
30. kg kesimleri tamamlanmıştır. Kesilen hayvanlarda kesim ve karkas özellikleri ile yarım
karkasta doku analizi yapılmış, ayrıca taze numunelerde bazı et kalite özellikleri (pH, renk, su
tutma kapasitesi, pişirme kaybı) belirlenmiştir. Diğer et kalite özellikleri (Gevreklik, protein,
homojenize olmuş yağ ile kuru madde ve kül tayini) için yeterli miktarda numuneler alınarak
– 20C0’ de saklanmıştır.
Yapılması Düşünülen Ara Yayınlar: Ara yayın yapılmamıştır.
Darboğazlar: Projede herhangi bir darboğaz bulunmamaktadır.
Projede Önerilen Değişiklikler: Herhangi bir değişiklik önerisi yoktur.
Proje Faaliyet Takvimi: Mayıs-Temmuz 2014 itibariyle et kalite analizlerinden gevreklik,
kolesterol ve yağ asitleri ile kuru madde, ham kül, protein ve homojenize olmuş yağ miktarı
analizlerinin tamamlanması, toplanan verilerin düzenlenerek istatistiksel analizlerinin
yapılması ve Mart-2015 itibariyle sonuç raporunun sunulması şeklindedir.
Bütçe: Projenin toplam bütçesi 59.000 TL dir. 2013 yılı içinde; bütçe harcamaları özetinde
belirtilen kalemlerden alımlar yapılmıştır.
Bütçe Harcamaları Özeti: Proje başlangıcından itibaren dönemler üzerinden proje için
harcanan ödeneklerin ana kalemler bazında dökümü yapılacaktır.
58
06
06
02
02
MENKUL SERMAYE ÜRETİM GİDERLERİ
Diğer Özel Alımlar (Yem alımı, canlı hayvan alımı (60 baş), derin dondurucu
alımı.)
06 02 07 01 Kimyevi Madde Alımları (Teknik NAOH, Sülfürik Asid saf, Petroleum Benzene,
Gerthard Tablet)
06 09 02
YOLLUKLAR
06 09 02 01 Yurt İçi Geçici Görev Yollukları
06 06
MENKUL MALLARIN BÜYÜK ONARIM GİDERLERİ
06 07 04 02 Akaryakıt ve Yağ Alımları
2013 yılı Genel Toplam
09
01
Adı Soyadı
Tarih
Kuruluş Amiri
Muharrem SATILMIŞ
30.01.2014
Proje Lideri
Halil EROL
30.01.2014
21800
20500
1300
500
500
500
500
22800
İmza
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Farklı Koyun Irk Ve Genotiplerinin Sütten Kesilmiş
Kuzularının Yapay Meradaki Büyüme Performanslarının
Belirlenmesi
PROJE NUMARASI
TAGEM/HAYSUD/12/07/01/04
PROJE LİDERİ
Şaban IŞIK
PROJE
YÜRÜTÜCÜSÜ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
01/01/2013-31/12/2013
Proje Özeti: Bu araştırma, Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
Müdürlüğünde tesis edilen mera arazisinde yürütülmektedir. Araştırmada, enstitümüzde
bulunan 4 farklı koyun ırkının (Akkaraman, Konya Merinosu, Hasmer, Hasak) sütten kesilmiş
kuzularının (2-2,5aylık) meradaki besi performansları ve otlatmanın meranın verim ve botanik
kompozisyonlarına olan etkilerinin incelenmesi, otlatma denemesi boyunca hayvanların canlı
ağırlık değişimi, meranın ot verimi, meranın besin madde içeriği ve botanik kompozisyonu
gibi veriler ölçülecektir.
Anahtar Kelimeler: koyun ırkı, seçim, yapay mera, otlatma, ot verimi, botanik kompozisyon
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Tesadüf parselleri deneme deseninde 3 tekerrürlü olarak tesis edilen yapay
meralara sütten kesilmiş kuzular meraların kapasitesine göre rastgele olarak 2013 yılı otlatma
döneminde (Nisan-Eylül) deneme alanlarına alınmıştır. Karışımların her tartım dönemlerinde
(üç haftada bir) dekara yaş ot ve kuru ot verimleri, karışıma giren bitkilerin ağırlıkça botanik
kompozisyonları, karışımların besin madde miktarları, araştırmada kullanılan 4 farklı koyun
ırkının (Akkaraman, Konya Merinosu, Hasmer, Hasak) sütten kesilmiş kuzularının (22,5aylık) meradaki büyüme performansları, otlatmanın meranın verim ve botanik
kompozisyonlarına olan etkileri ve canlı ağırlık değişimleri incelenmiştir. Meraların ortalama
yaş ot verimleri 39000 kg/ha kuru ot verimleri ise 9406 kg/ha olarak ölçülmüştür. Farklı
ırkların meraların verimine ve genelde botanik kompozisyonuna etkisi olmamıştır. Denemenin
ilk yıl bulguları sonucunda; toplam otlatma periyodunda kuzuların ortalama canlı ağırlık
artışları 11,4-15,9 kg/baş arasında değişmiştir. Konya şartlarında oluşturulmuş sulanan
59
meralarda Akkaraman kuzularının, Hasmer, Hasak ve Konya Merinosu kuzulara göre
özellikle sıcaklık şartlarının daha yüksek olduğu ve meraların verimlerinin düştüğü yaz ayları
döneminde daha iyi gelişme gösterdiği tespit edilmiş ve ortalama verimleri daha yüksek
bulunmuştur. Hasmer, Hasak ve Konya Merinos kuzularının ise mera şartlarında büyüme
performanslarının benzerlik gösterdiği tespit edilmiştir.
Yapılması Düşünülen Ara Yayınlar: Kongre, Dergi, Sempozyum vs.
Materyal ve Yöntem: Materyalde 2012 yılında Korunga bitkisi üstten tohumlama ile ilave
edilmişti ancak 2012 yılı sonbaharında ekilen Korungalar iyi bir çıkış yapmış olmasına
rağmen 2013 yılı ilkbaharda karışımlara rekabet edemediğinden dolayı korungalar
gözükmemektedir. Dolayısı ile korunganın tekrar denemeden çıkarılması.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
İmza
Tarih
Fatih ÖZDEMİR
Şaban IŞIK
Proje Gelişme Raporu Formu
Halk Elinde Yetiştirilen Hemşin ve Morkaraman Koyunlarının
Yapağı Özelliklerinin ve Lanolin Miktarının Belirlenmesi
/ 11 / 08 / 01 / 05
PROJE BAŞLIĞI
PROJE NUMARASI
PROJE LİDERİ
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Erdoğan SEZGİN
Doğu Anadolu Tarımsal Araştırma Enstitüsü
18/01/2013 ile 18/12/2013 arası
Dönem Bulguları:
Hemşin koyunu yapağı konusunda yeterince bilgi mevcut değildir. Ayrıca Hemşin ve
Morkaraman koyununda da Lanolin miktarlarında bugüne kadar çalışma yapılmamıştır. Bu
nedenle, bu ırklara ait yapağı özelliklerinin ve Lanolin miktarının belirlenmesi, dokuma
sanayi açısından değerlendirilmesi ve diğer yerli ırk yapağılar içerinde ki durumunun
belirlenmesi gerekir. Analiz için Lalahan Merkez hayvancılık Araştırma Enstitüsün YapağıTiftik laboratuarında incelik, uzunluk, elastikiyet mukavemet elyaf özellikleri şuan
yapılmaktadır. Lanolin miktarının belirlenmesi için Selçuk Üniversitesi Veteriner Fakültesine
gönderilecektir.
Tablo 1. Proje Materyali İle Yetiştirici Sayısına Göre Dağılımı
Irkı
Renk
Hemşin
Hemşin
Morkaraman
GENEL
Siyah
Beyaz
Koyun
Koç
Koyun
Koç
Koyun
Koç
Koyun
(1 Yaş) (1 Yaş) (2 Yaş) (2 Yaş) (3 Yaş) (3 Yaş) (4 Yaş)
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
10
30
30
30
30
30
30
30
Koç
(4 Yaş)
10
10
10
30
Toplam
80
80
80
240
Tablo 1. Hemşin Koyununa ait Sürü Genelinde Çeşitli Dönemlere Ait Yapağı Veriler
Sürü Tipi
Faktörler
GENEL
Genel
Cinsiyet
Erkek
Dişi
N
Kirli yapağı
verimi (gr)
N
H uzunluk
mm
N
B H uzunluk
mm
288
2,63±0,035
288
55,12±0,992
288
93,18±1,666
75
213
3,02±0,060
2,24±0,033
75
213
53,87±1,679
56,37±0,927
75
213
91,08±2,818
95,28±1,556
60
Yaşı
1
2
3
4
Renk
Beyaz
Siyah
93
39
81
75
**
2,18±0,051b
2,82±0,079a
2,69±0,055 a
2,82±0,058 a
93
39
81
75
**
50,93±1,41 b
55,92±2,21 a
55,15±1,55 b
58,48±1,63 a
93
39
81
75
**
82,63±2,379b
95,90±3,720 a
96,55±2,607 a
97,63±2,744 a
108
180
2,70±0,053
2,56±0,038
108
180
54,83±1,487
55, 41±1,061
108
180
90,67±2,495
95,69±1,782
Numune Alınan Bölge
Omuz
Kaburga
But
96
96
96
2,63±0,053
2,63±0,053
2,63±0,053
96
96
96
53, 36±1,475
53,81±1,475
58,19±1,475
96
96
96
90,17±2,477
92,44±2,477
96,92±2,477
Tablo 2. Hemşin Koyununa ait Sürü Genelinde Çeşitli Dönemlere Ait Yapağı Veriler
Sürü Tipi
GENEL
Faktörler
N
Genel
Cinsiyet
Erkek
Dişi
Yaşı
1
2
3
4
Renk
Beyaz
Siyah
288
41,78±0,465
288
36,67±0,347
288
28,05±0,474
75
213
75
213
93
39
81
75
36,07±0,587
37,26±0,324
**
35,84±0,495 b
37,30±0,775 a
36,76±0,543 b
36,77±0,571 a
75
213
93
39
81
75
42,27±0,787
41,29±0,435
**
40,44±0,665b
41,41±1,039b
41,65±0,728 a
43,63±0,766 a
93
39
81
75
28,22±0,802
27,87±0,443
**
24,14±0,677b
28,66±1,059a
29,15±0,742 a
30,23±0,781 a
108
180
41,88±0,697
42,38±0,498
108
180
35,55±0,520
37,78±0,371
108
180
27,11±0,710
28,98±0,507
96
96
96
41,15±0,692
40,60±0,692
43,60±0,092
96
96
96
37,27±0,516 a
37,41±0,516 a
35,32±0,516b
96
96
96
27,18±0,705
28,33±0,705
28,62±0,705
Numune Alınan Bölge
Omuz
Kaburga
But
İncelik (mikron)
N
Elastikiyet %
N
Mukavemet
Yapağıda lüle uzunluğu, elastikiyet ve mukavemet tayini Textechno Fafegraph HR+ME adlı
cihaz ile yapılmıştır. Bu cihazın standardı, DIN 53 816, ASM D 76, D 76, D 2101, ISO 5079.
Analizlerde, hassas kontrollü dijital iklimlendirici olarak HIROSS 6 LOA kullanılacaktır.
Laboratuarda iklimlendirme koşulları sıcaklık 200C ± 2 ve nispi nem %65 ± 2 dır.
Tablo 3. Hemşin Koyununa ait Sürü Genelinde Çeşitli Dönemlere Ait Yapağı Veriler
Faktörler
Sürü
Tipi
GENEL
N
Genel
Cinsiyet
Erkek
Dişi
Yaşı
288
1
2
3
4
Renk
Beyaz
Siyah
Numune Alınan Bölge
Omuz
Kaburga
But
93
39
81
75
Darboğazlar: Morkaraman koyunların ait yapağıların
yetişmediğinden projeyi 1 yıl uzatılmasını talep ediyorum.
75
213
Randıman %
70,05±0,623
**
72,63±1,053a
67,47±0,582b
**
69,42±0,889 ab
72,34±1,390a
70,23±0,974ab
68,22±1,025bb
**
70,54±0,932a
69,57±0,666b
**
70,38±0,925a
68,80±0,925b
70,98±0,925b
108
180
96
96
96
analizi
gelişme
raporuna
61
Materyal ve Yöntem:
Herhangi bir değişiklik olmamıştır. 2014 yılında grup toplantısı tarafından bir değişiklik
öngördüğü takdirde materyal ve metotta değişikliğe gidilebilir.
Bütçe Harcamaları Özeti: Laboratuar hizmetleri: 5.010 TL ödenmiştir.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Şerafettin ÇAKAL
Erdoğan SEZGİN
Tarih
İmza
30.12.2013
30.12.2013
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Farklı Şartlarda Yarı-Entansif Koşullarda Yetiştirilen Kıl
Keçisi Melezlerin Verim Performanslarının Karşılaştırılması
PROJE NUMARASI
TAGEM/HAYSÜD/10/08/04/01
PROJE LİDERİ
Hakan ERDURAN
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
01/01/2013-31/12/2013
Proje Özeti:
Orta Anadolu Bölgesinde keçi yetiştiriciliği, geçmişte dağ ve ova köylerinde,
yapılmakta iken bilinçsiz yönlendirmeler sonucu ova köylerinde, yerini hemen hemen sığır ve
koyun yetiştiriciliğine bırakmış durumdadır. Dağ köylerinde keçi yetiştiriciliği ise tamamen
orman içi ve kenarı alanlarda meraya dayalı olarak kısmen devam etmektedir. Fakat Orman
ve Su Bakanlığı, ormanlardaki yıkımın ana nedeninin keçi olduğu görüşündedir. Bu yönde
uygulamalar ve yaptırımlar sonucunda, keçi yetiştiricileri ağır para cezaları karşısında
ekonomik sıkıntılar nedeniyle sürülerini ya küçültmek ya da elden çıkartmak zorunda
kalmışlardır. Bu sebeple ülke genelinde olduğu gibi bölgede de keçi sayısı hızla
azaltmaktadır.
Bölgemizde yüzyıllardır orman içi ve kenarı alanlarda meraya dayalı ekstansif
şartlarda ilkel olarak yetiştirilen keçilerin yem ihtiyacının, rasyonel bakım ve besleme
koşullarından uzak keçicilik işletmelerince entansif karşılanması, hem ekonomik açıdan, hem
de yetiştirme alışkanlıkları dolayısıyla mümkün gözükmemektedir. Kıl Keçisi yetiştiricilerinin
bölgemizde hâlihazırda ekonomik olarak bu üretim kolundaki faaliyetlerine devam
edebilmeleri, ancak daha az sayıdaki hayvandan daha yüksek verim elde etmelerine bağlı
kalmıştır. Bu sorunun bu gün için geçerlilikte olan en iyi çözüm yolu keçicilik işletmelerinin
yetiştirme ve sürü idaresi anlamında bilinçlendirilmesi ve yörenin yetiştirme alt yapısı dikkate
alınarak mevcut popülâsyonun belirli bir plan dâhilinde daha sakin huylu, döl ve süt verimi
daha yüksek genotiplere dönüşümünün sağlanması gerekmektedir. Ancak Kıl keçilerine göre
daha yüksek verimli olacak melez sütçü tiplerin başarı ile yetiştirilebilmeleri mera
alanlarından faydalanma yanında yarı entansif koşullarda yeterli bakım ve besleme şartlarının
sağlanması ile mümkündür.
Konya Bölgesi ovalık arazilerinde geçmişte koyun yetiştiriciliğine ilaveten gerek
karışık gerekse ayrı sürüler halinde önemli sayıda Tiftik ve Kıl keçisi yetiştirilmiştir. Bu
alanlarda mera vejetasyonu keçi yetiştiriciliği için oldukça elverişli olmasına karşın, keçi
sayısı yok denecek kadar azalmıştır. Mevcut kaynakların daha verimli kullanılması
62
bakımından keçinin yeniden ova bölgesine kazandırılması gerekmektedir. Bu amaçla projenin
ilk basamağının yürütüleceği dağ köylerindeki sürülerden Saanen x Kıl ve Alpin x Kıl
melezlerinden elde edilecek dişi döllerin yarısı ile ova köyünde örnek bir işletme
oluşturulacaktır. Her iki yöre halkının gelir seviyesini ve hayvansal üretim miktarını
yükseltmek ve Konya bölgesi keçi yetiştiricilerine örnek teşkil etmek bu projenin ana amacı
olacaktır.
Bölgenin ekolojik şartları gereği yüzyıllardır yetiştirilmekte olan kıl keçisinin, yarı
entansif koşullarda süt ve döl verimi bakımından daha yüksek olan Saanen ve Alpin
keçileriyle melezlemelerinin yapılarak yöre halkının gelir seviyesini ve hayvansal üretim
miktarını yükseltmek bu projenin ana amacıdır.
Bu çalışmada Konya bölgesi ovalık ve dağlık arazilerinde halk elinde yarı entansif
işletme koşullarında, elde edilecek Saanen x Kıl (F1) ve Alpin x Kıl keçi (F1) melezi
keçilerde döl verimi, büyüme yaşama gücü, besi performansları, karkas özellikleri ile süt
verim özelliklerine ait fenotipik parametreler yetiştirici şartlarında belirlenecektir. Proje
kapsamında elde edilecek F1 ve döllerinin verimleri,, bölgede bulunan Kıl keçilerinin
ıslahında Saanen ve Alpin ırklarından yararlanılması hakkında fikir verecektir.
Dönem Bulguları
Proje kapsamında Saanen x Kıl F1 (SxK), Alpinx Kıl F1 (AxK) ve Kıl keçilerine ait laktasyon
süreleri (LS), günlük süt verimi (GSV) ve laktasyon süt verimi (LSV) ait değerler, Tablo 1 ve
Tablo 1 Saanen x Kıl F1 (SxK), Alpin x Kıl F1 (AxK) ve Kıl Keçilerine ait Süt Verimi Değerleri ve Standart Hataları
(x±Sx)
n
LSV (kg)
Sx
GSV (gr)
Sx
LS (gün)
Sx
Genotip
SxK
107
163,7
±
4,94
0,77
±
0,02
212,0
±
1,44
AxK
115
151,1
±
3,93
0,73
±
0,02
206,7
±
1,26
Kıl
80
106,8
±
4,12
0,55
±
0,02
192,5
±
2,14
İşletme
1
72
179,7
±
6,87
0,84
±
0,03
211,1
±
1,79
2
68
142,3
±
5,08
0,70
±
0,02
202,7
±
1,87
3
53
106,8
±
4,32
0,53
±
0,02
200,7
±
2,19
4
109
139,0
±
3,76
0,68
±
0,02
204,0
±
1,89
Laktasyon Sırası
1
139
129,2
±
3,39
0,63
±
0,01
201,9
±
1,40
2
163
156,3
±
4,21
0,75
±
0,02
207,3
±
1,40
2’de sunulmuştur.
Tablo 2: Kıl Keçilerine ait Süt Verimi Değerleri ve Standart Hataları ( x ± S x )
İşletme
1
2
3
4
Ana yaşı
2
3
4
5
6
7
n
LSV (kg)
61
41
56
138
141,00
113,50
99,40
111,21
33
47
45
51
77
43
96,60
113,88
119,24
129,93
116,07
109,27
Sx
GSV (gr)
±
±
±
±
5,9
5,3
4,1
3,2
0,69
0,57
0,50
0,57
±
4,2
6,2
5,6
6,5
4,7
5,4
0,51
0,58
0,59
0,64
0,59
0,56
±
±
±
±
Sx
LS (gün)
±
±
±
±
0,02
0,02
0,02
0,01
200,7
195,8
196,5
191,1
±
±
±
±
2,44
2,71
2,43
1,75
±
0,02
0,03
0,02
0,03
0,02
0,02
189,5
194,7
197,4
200,4
193,3
192,1
±
3,46
2,70
2,94
2,67
2,34
2,88
±
±
±
±
Sx
±
±
±
±
Materyal ve Yöntem: Yetiştirici koşullarında yürütülen bu proje kapsamında yarı entansif
şartlar oluşturulamamıştır. Projede aynı yaştaki (2-3 yaşlı) saf ve melez keçilerin süt ve süt
kompozisyonlarının karşılaştırılmasının yanında aynı sürülerde bulunan 2-7 yaşlı Kıl
keçilerde kendi aralarında (ana yaşı ve işletme) incelenmiştir. Proje kapsamında ayrıca hem
süt keçiciliğine destek olmak hem de verim özelliklerinin tespiti için projenin son iki yılında
63
bir Saanen Keçisi işletmesi eklenmiştir. Bu nedenlerle proje isminin değiştirilmesi
gerekmektedir. Bu sebeple projenin isminin “Farklı Keçi Genotiplerinin Konya Bölgesi
Koşullarında Performanslarının İncelenmesi” olarak değiştirilmesi önerilmektedir.
Proje Faaliyet Takvimi: Proje başlangıcında oğlakların doğum, 1., 2., 3., 4., 5. ve 6.
aylarında canlı ağırlık ve ölçümleri yapılacaktı.Projenin 1. yılında bu şekilde yapıldı. Fakat
projenin 2. yılında oğlakların canlı ağırlık ve ölçümleri, doğum, 3., 6., 9. ve 12. ay yaşları
olarak Proje Gelişme Raporunda değiştirilmesi hem kurumun bilim kurulunda, hem de grup
toplantısında önerilmiş ve kabul edilmiştir. Oğlakların 12. ay yaşları Mart 2014’e denk
gelmektedir. Bu nedenle projenin 1 yıl daha uzatılması hususunda;
Personel: Varsa görev alan araştırmacılar ile ilgili değişiklik önerileri yazılmalıdır. Projeye
personel eklenmesi veya çıkarılması PDG’de onaylandıktan sonra devam eden yıl itibariyle
gerçekleştirilebilir.
Bütçe Harcamaları Özeti: 2012 yılında proje için yapılan harcamalar Bahri Dağdaş
Uluslararası Tarımsal Araştırma Enstitüsünün Genel bütçe imkânlarından karşılanmıştır.
Kuruluş Amiri
Proje Lideri
Adı Soyadı
Fatih ÖZDEMİR
Hakan ERDURAN
Tarih
…./01/2014
…./01/2014
İmza
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
PROJE NUMARASI
Kangal Tipi Akkaraman Koyunların Süt Verimi Ve Meme
Özelliklerinin Belirlenmesi
TAGEM /01/08/01/03
Dr. Şükrü DURSUN
PROJE LİDERİ
PROJE
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
YÜRÜTÜCÜSÜ
RAPORUN İLGİLİ
01/01/2013-31/12/2013
OLDUĞU DÖNEM
Proje Özeti: Bu projede; Kangal Akkaraman koyununun laktasyon süresi, laktasyon süt
verimi, meme yapısı ve süt verimi ile meme yapısı arasındaki ilişkiler belirlenmeye
çalışılacaktır. İki ayrı işletmede 40’ar baş tekiz 20’şer baş ikiz doğum yapan koyunlar
üzerinde doğumu takiben 60. gün yaşa kadar 14 gün ara ile kuzular sabah ve akşam olmak
üzere emiştirmeden önce ve sonra tartılacaktır. Emiştirme sonunda memeler kontrol edilecek,
süt varsa sağılarak kuzu tartımlarına eklenerek koyunun o günkü süt verimi belirlenecektir.
Kuzular ortalama iki aylık (60. gün) yaşa ulaştıktan sonra koyunlarda makineli sağım
yapılacaktır. Sağımlar 15 günde bir defa kuzular annelerinden 12 saat önceden ayrılmak
suretiyle bir gün sabah ertesi gün akşam olacak şekilde (almaşıklı sağım yöntemi kullanılarak)
yapılacaktır. Bu sağımlar günlük süt miktarı 50 ml kalana kadar devam edecektir. 50 ml ve
altında süt veren koyunlar kuruya çıkmış kabul edilecektir. Böylece Halk elinde Kangal
İlçesinde yetiştirilen Kangal Akkaraman koyunlarda laktasyon süresi ve süt verimi
belirlenmeye çalışılacaktır. Meme ölçüleri en az bir sefer olacak şekilde (Mayıs ayı içerisinde
laktasyonun 90. gününde) alınacaktır. Laktasyon süresi, süt verimi ve bazı meme özellikleri
bakımından bulgular elde edilecek ve süt verimi ile incelenecek bazı meme özellikleri
arasında çeşitli korelasyonlar belirlenecektir.
Anahtar Kelimeler: Kangal Akkaraman, Koyun, Süt verimi, Meme Ölçüleri
Başlıca Faaliyetlerin Gerçekleşme Durumu: Dönem Bulguları:
İki İşletmede sağım ünitesi tamamlanmış olup bir işletmede sağımla ilgili veriler sağlıklı bir
şekilde alınmaya çalışılmıştır. İkinci işletmede sağım hanenin yapımının ve elektrikle ilgili
64
işlemler ve sağım ünitesi tamamlandı ancak yetiştirici başlarda zorlandığı için sağım ünitesini
kullanmayı terk etmesi nedeniyle makineli sağım yapılamamıştır. Makineli sağım yapılan
işletmeye götürülerek sağım gösterildi ve hayvanların girişlerinin ve sağımın alıştıktan sonra
ne kadar kolay olduğunun görmesi sağlandı. Bu sene yani 2014 yılı sağım sezonunda
koyunların otomatik sağıma alıştırılmasının ve sağım yapılmasının ardından gerekli veriler
alınacaktır. Bu döneminde her hangi bir aksaklık olmadan laktasyon süresi, süt verimi ve
meme yapısı ile ilgili veriler her iki işletmede de yapılabileceğini ümit ediyoruz. Makineli
sağım işletmede koyunların otomatik sağım sistemi ile ilgili olarak her hangi bir sorun
yaşanmamıştır. Tart emzir tart yöntemi ile kuzular tartılmış olup, tartma işleminde 10 gr'a
hassas terazi kullanılmıştır. İşletme II de sağım sistemi kullanılmadığı için meme ölçümleri ve
devam eden sağım ile ilgili veriler elle sağım sonucuna göre alınmıştır. Eşit muamele
yapıladığı için karşılaştırma yapılamamıştır. Ölçümlerin yapıldığı işletmelerde sırası ile I. ve
II. işletmelerde tart emzir tart yönteminde tek ve ikiz doğum tipine göre günlük süt verimleri
Tablo1 de özetlenmiştir.
Tablo1: Tart Emzir Tart Yönteminde elde edilen emzirmede ve günlük ortalama süt verimler.
İşletme
No
I. İşletme
II. İşletme
Tarih
Doğum Tipi
16.04.2013
16.04.2013
16.04.2013
16.04.2013
14.05.2013
14.05.2013
14.05.2013
14.05.2013
18.04.2013
18.04.2013
18.04.2013
18.04.2013
16.05.2013
16.05.2013
16.05.2013
16.05.2013
Tek
Tek
İkiz
İkiz
Tek
Tek
İkiz
İkiz
Tek
Tek
İkiz
İkiz
Tek
Tek
İkiz
İkiz
Sağım (Emzirme)
zamanı
Sabah
Akşam
Sabah
Akşam
Sabah
Akşam
Sabah
Akşam
Sabah
Akşam
Sabah
Akşam
Sabah
Akşam
Sabah
Akşam
Ortalama Süt verimi (ml)
Emzirmede
Günlük
540
990
450
880
1640
760
580
980
400
380
700
320
484
793
309
461
739
278
394
767
373
330
594
264
Sağım sistemini kullanan işletmede Temmuz 2013 tarihinde makinalı sağım yapılmış
olup Tek ve ikiz doğum yapmış olan koyunlardan tek sağımda en düşük, en yüksek ve
ortalama süt verimleri sırası ile 100ml, 975ml ve 482ml; 200ml, 1100ml ve 545ml olarak
tespit edilmiştir. İşletme II' de makinalı sağım yapılamadı ancak elle sağım yapıldıktan sonra
meme ölçüleri ve elle sağım süt miktarları belirlenmiştir.
Temmuz 2013 tarihinde yapılan makineli sağım sonrası işletme I’deki Meme ve meme
başına ilişkin alınan veriler Tablo2’de, işletme II’ye ait aynı özellikler Tablo 3’de verilmiştir.
Tablo2: İşletme I’e ait Meme, Meme Başı ölçülerinin ve makineli sağıma ait ort. en düşük ve
en yüksek değerleri.
Doğum
Tipi
Tek
İkiz
Özellik
Ortalama
En düşük
En Yüksek
Ortalama
En Düşük
En Yüksek
Derinlik
Genişlik
15
12
19
16.1
13
19.5
13.9
10
17
14.1
11
19
Meme
Yükseklik
Ön Arka
17.5
13
21
18.4
14
23
Çevre
Uzunluğu
43.5
35
54
46.6
40
55
19.2
8
24
20.3
16
26
Meme Başi
Uzunlığu Genişliği
Sağ Sol Sağ sol
3.1 3.1
2
2
2
2
1.5 1.5
5
4.5 2.5 2.5
2.9 2.9
2
1.9
2
2
1.5 1.5
5
4
3.5 2.5
Sisterna
Genişliği
Süt
Verimi
1.5
0.5
3.5
1.1
0.5
1.5
482
100
975
545
200
1.100
65
Tablo3: İşletme II’ye ait Meme, Meme Başı ölçülerinin ve elle sağıma ait ortalama, en düşük
ve en yüksek değerleri.
Doğum
Tipi
Tek
İkiz
Özellik
Derinlik
Genişlik
11,01
7,5
15
12,22
5,5
17
12,12
7
16
2,21
6
15
Ortalama
En düşük
En Yüksek
Ortalama
En Düşük
En Yüksek
Meme
Yükseklik
Ön Arka
13,9
8
20
14,8
13
20
Çevre
Uzunluğu
40,1
30
51
43,9
25
55
20,8
13
30
23,4
15
34
Meme Başi
Uzunlığu Genişliği
Sağ Sol Sağ sol
2,7 2,6 1,9 1,9
2
2
1,3 1,5
4
4
2
2,5
2,6 2,3 1,9 1,8
2
1,5 1,5 1,5
4
4
2,5 2,5
Sisterna
Genişliği
Süt
Verimi
1,3
,5
3
1,5
0,5
2,5
372
50
640
596
160
1080
Yapılması Düşünülen Ara Yayınlar: Mevcut veriler değerlendirilerek bilimsel kongrelerde
yayımlanması düşünülmektedir.
Darboğazlar: Koyunlarda otomatik sağım sistemi ilgili gelişmiş bir modelin bulunmaması.
Bölgede sağım sistemleri konusunda yetişmiş teknik elemanın olmaması, ihtiyaç duyulması
halinde teknik servise erişmenin güçlüğü. İşletme sahiplerinin sağımı özelliklede makineli
sağımı kabul etmemeleri.
Projede Önerilen Değişiklikler:
Materyal ve Yöntem: Yok
Proje Faaliyet Takvimi: İkinci işletmedeki sıkıntılar sebebi ile proje takvimi planlandığı gibi
gerçekleşmemesi nedeniyle bir yıl ek süre talep ediyoruz.
Personel:
Projede yer alan Veteriner Hekim Hakan BEKÇİ'nin projede katkı
sağlayamayacağı düşüncesinde olduğunu belirtmektedir. Bu nedenle projeden çıkarılmasını.
Bütçe:Varsa bütçe ile ilgili değişiklikler yazılmalıdır.
Bütçe Harcamaları Özeti:
2013 yılında proje için yapılan harcamalar;
-Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü Genel Bütçesi’nden karşılanmıştır.
Adı Soyadı
Tarih
İmza
KuruluşAmiri
Fatih ÖZDEMİR
03.01.2013
ProjeLideri
Dr. Şükrü DURSUN
03.01.2013
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
İvesi Koyunlarının Seleksiyona Dayalı Olarak Süt
Verimlerinin Artırılması
PROJE NUMARASI
TAGEM/11/08/01/01
PROJE LİDERİ
İrfan GÜNGÖR
PROJE
YÜRÜTÜCÜSÜ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Gap Tarımsal Araştırma Enstitüsü
Müdürlüğü/ŞANLIURFA
01.01.2013 ile 31.12.2013
ProjeÖzeti: 2010 yılında sürüde tespit edilen Visna-Maedi hastalığı nedeniyle, Genel
Müdürlüğün kararı doğrultusunda, materyal değişimi için sürünün tamamı kesim şartıyla
satılmıştır. 2012 yılı içinde koyun ağılı içinde dezenfeksiyon ve tadilat işlemleri yapılmıştır.
2012 yılı döner sermaye bütçesinden ayrılan ödenekle 101 baş İvesi ırkı koyun alınmıştır.
66
Halk elinden alınan koyunlarla oluşturulan yeni sürü 2012 Yılının Aralık ayının sonunda Tek
Tek Araştırma İstasyonuna gelmiştir. Doğumlar 22.12.2012 - 26.04.2013 tarihleri arasında
gerçekleşmiştir. 2012-2013 doğum sezonunda, 77 baş koyun kuzulamış, bunlardan sütten
kesimde 73 baş kuzu (36 erkek- 37 dişi) elde edilmiştir. Sürüde 20 gün ara ile 6 kez süt
kontrolü yapılmıştır. 2013 Yılı Koç katımı için gerekli olan damızlık koçlar Tigem
Ceylanpınar Tarım İşletmesi’nden temin edilmiştir. Alınan değerler damızlık değeri
hesaplamasına esas değildir. Başlangıç değerleridir ve bilgi amaçlıdır. Halk elinden alınan
sürüde koç altı koyun sayısı bilinmediğinden döl verimi hesaplanamamıştır.
Dönem Bulguları:Kuzuların değişik dönem yaşlardaki (doğum, 30., 60., 90. ve 120. gün)
ortalama canlı ağırlıklarısırasıyla, 4.35±0.090, 12.42±0.235, 20.62±0.373, 28.02±0.658 ve
35.54±1.134 kg olarak tespit edilmiştir (Tablo 1).
Tablo 1.Enstitü elinde bulunan İvesi koyunlarına ait açıklayıcı istatistikler
Özellik
N
Ort±SH
En Küçük
En Büyük
VK(%)
AGR0
73
4.35 ± 0.090
2.35
5.80
18
AGR30
73
12.42 ± 0.235
4.45
17.24
16
AGR60
69
20.62 ± 0.373
8.82
26.28
15
AGR90
55
28.02 ± 0.658
14.41
36.79
17
AGR120
30
35.54 ± 1.134
18.72
44.26
17
AGR0: doğum ağırlığı, AGR30: 30-gün yaşa ğırlığı, AGR60: 60-gün yaş ağırlığı, AGR90: 90-gün yaş ağırlığı, AGR120:
120-gün yaş ağırlığı
Değişik dönemlerdeki kuzu canlı ağırlıklarının doğum sezonu ve cinsiyet faktörlerine
göre ortalamaları Tablo 2’de verilmektedir. Doğum ağırlığı dışındaki canlı ağırlıkların
analizinde, doğum ağırlığı modele ko-değişken olarak dâhil edilmiştir. Buna göre, erkek ve
dişi kuzuların doğum ve 30. gün ağırlıkları farklı bulunmazken, daha sonraki dönemlerde
erkeklerin dişilere göre daha hızlı geliştiği ve daha yüksek canlı ağırlığa sahip oldukları tespit
edilmiştir (P<0.05). Doğum sezonları dikkate alındığında, ortalamalar arasındaki farklılıkların
60 ve 90-günlük yaş dönemlerinde (P<0.05) görüldüğünü ancak 120-günlük yaş canlı ağırlık
ortalamaları bakımından sezonlar arasında bir fark olmadığı gözlenmiştir.
Tablo 2.Enstitü elinde bulunan İvesi koyunlarına ait çeşitli dönem canlı ağırlıklarının cinsiyet ve doğum
sezonlarına göre ortalamaları ve standart hataları
Faktör
AGR0
AGR30
AGR60
AGR90
AGR120
Cinsiyet
Erkek
Dişi
4.37 ± 0.134
n=36
4.34 ± 0.123
n=37
12.84 ± 0.340
n=36
12.00 ± 0.316
n=37
21.59 ± 0.512a
n=33
19.72 ± 0.501b
n=36
30.01 ± 0.810a
n=28
25.95 ± 0.896b
n=27
39.34 ± 0.883a
n=15
31.74 ± 1.578b
n=15
4.28 ± 0.362
n=10
12.23 ± 0.936
n=10
20.65 ± 1.433ab
n=10
29.30 ± 1.872a
n=10
35.48 ± 2.137
n=10
4.47 ± 0.123
n=33
4.26 ± 0.128
n=30
13.08 ± 0.304
n=33
11.75 ± 0.315
n=30
21.61 ± 0.460a
n=33
19.35 ± 0.513b
n=26
28.69 ± 0.733a
n=33
25.08 ± 1.428b
n=12
35.57 ± 1.366
n=20
Sezon
1
2
3
----
a,b
Aynı sütun ve aynı factor seviyelerinde farklı üssel harfleri taşıyan ortalamalar birbirinden farklıdır (P<0.05),
Sezon 1: Aralık-Ocak, Sezon 2: Şubat, Sezon 3: Mart ve daha sonrası
Laktasyon süresi ve laktasyon süt verimi Fleishmann metoduna göre hesaplanmıştır.
Laktasyon süt verimi, laktasyon süresi, günlük ortalama süt verimi ve 180-gün laktasyon
67
uzunluğuna göre standardize edilmiş süt verimi özelliklerine ait açıklayıcı istatistikler Tablo
3’de, bu özelliklerin sezona göre ortalamalarının karşılaştırılması ise Tablo 4’te verilmektedir.
Laktasyon süt verimi (LSV) ve günlük ortalama süt verimi (GOSV) analizinde laktasyon
süresi (LSUR) modele ko-değişken olarak dâhil edilmiştir. Sürüde laktasyon süresi
115.8±3.18 gün ve laktasyon süt verimi 85.6±4.67 kg ve günlük ortalama süt verimi 727.6 ±
30.86 g olarak tespit edilmiştir.
Tablo 3.Enstitü elinde bulunan İvesi koyunlarının süt verimlerine ait açıklayıcı istatistikler
Özellik
N
Ort±SH
En Küçük
En Büyük
VK(%)
LSUR
74
115.8 ± 3.18
49
178
24
LSV
74
85.6 ± 4.67
26.9
205.7
47
GOSV
74
727.6 ± 30.86
320
1563
36
LSV180
74
131.0 ± 5.56
57.6
281.3
36
LSUR: laktasyon süresi, LSV:laktasyon süt verimi, GOSV: günlük ortalama süt verimi, LSV180: 180-gün
laktasyon süresine göre standardize edilmiş sütverimi, VK(%): varyasyon katsayısı
Laktasyon süresi en uzun olan koyunlar Sezon 1’de kuzulayan koyunlar olup bunu
sırasıyla Sezon 2 ve Sezon 3’deki koyunlar izlemiştir (P<0.05) (Tablo 4). Ancak laktasyon süt
verimi bakımından ilk iki sezon arasında fark bulunmazken son sezonda laktasyon süt
veriminin diğerlerine göre daha az olduğu tespit edilmiştir (P<0.05). Günlük ortalama süt
verimi ve 180-gün laktasyon uzunluğuna göre standardize edilmiş süt verimi bakımından
sezonlar arasında herhangi bir fark tespit edilememiştir.
Tablo 4. Enstitü elinde bulunan İvesi koyunlarının laktasyon süresi, laktasyon süt verimi, günlük ortalama süt
verimi ve 180-gün laktasyon süresine göre standardize edilmiş süt verimlerinin doğum sezonuna göre ortalama
ve standart hataları
Özellik
N
LSUR
LSV
GOSV
LSV180
Sezon 1
10
154.4 ± 4.56a
101.4 ± 17.64a
639.6 ± 97.59
115.1 ± 17.57 a
Sezon 2
33
127.8 ± 1.87b
100.7 ± 5.97a
783.3 ± 44.62
141.0 ± 8.03 a
Sezon 3
31
90.6 ± 3.22c
64.5 ± 5.51b
696.6 ± 46.10
125.4 ± 8.30 a
a,b,c
Aynı sütunda farklı üssel harfleri taşıyan ortalamalar birbirinden farklıdır (P<0.05), LSUR: laktasyon süresi
(gün), LSV:laktasyon sütverimi (kg), GOSV: günlük ortalama süt verimi (g), LSV180: 180-gün laktasyon
süresine göre standardize edilmiş süt verimi (kg), Sezon 1: Aralık-Ocak, Sezon 2: Şubat, Sezon 3: Mart ve
sonrası
18 koyun, 9 dişi kuzu ve 36 erkek kuzu reforme edilmiştir. 1 koyun hastalık sebebiyle
ölmüştür. Mevcut sürü kompozisyonu: 6 koç, 82 koyun ve 28 dişi toklu olup sürüde toplam
116 baş hayvan bulunmaktadır. Koç katımı öncesi sürünün senkronizasyonu için prit
uygulaması yapılmıştır. Sürünün bir kısmına elde aşım, bir kısmına da suni tohumlama
uygulanmıştır.
Bakım, besleme çalışmaları ile tadilat çalışmaları devam etmektedir. 2013-2014
doğum sezonu için doğumlar beklenmektedir.
Projede Önerilen Değişiklikler:
Materyal: Süt kalitesinin (sütteki kuru madde, protein, yağ, laktoz, mikroorganizma)
belirlenmesi için kullanılmak üzere iki adet ölçüm cihazı alınması önerilmektedir. 30.000 TL
ek bütçe talep etmekteyiz.
Personel:Kurumumuza yeni atanan Ziraat Mühendisi Esma PAYDAŞ’ın projeye dahil
edilmesi.
Adı Soyadı
Tarih
İmza
KuruluşAmiri
İ. Halil ÇETİNER
ProjeLideri
İrfan GÜNGÖR
68
Proje Gelişme Raporu
PROJE BAŞLIĞI
Süt Karma Yemlerinde In Vivo ve In Vitro Olarak
Saptanan Enerji ve Protein Değerlerinin
Karşılaştırılması
PROJE NUMARASI
TAGEM/GY/06/11/07/113
PROJE LİDERİ
Dr. Hülya HANOĞLU
PROJE YÜRÜTÜCÜSÜ
Bandırma Koyunculuk Araştırma İstasyonu
KURULUŞ
RAPORUN İLGİLİ OLDUĞU
01//01/2013 ile 01/01/2014 arası
DÖNEM
Proje Özeti:
Bu çalışma ile ülkemizde üretilen süt karma yemlerinin metabolik enerji (ME) ve metabolik
protein (MP) değerlerinin belirlenmesinde standart ve güvenilir olarak kabul edilen in vivo
yöntemlerin ekonomik ve pratik alternatifleri olarak önerilen çeşitli in vitro yöntemlerin
kullanım olanaklarının araştırılması ve ülkemizde rutin laboratuvarlarda kullanılması
bakımından en kolay ve en güvenilir yöntemin belirlenmesi amaçlanmıştır. Bu amaçla çeşitli
yem fabrikalarında üretilen süt karma yemlerinden alınan örneklerin öncelikle besin
maddeleri içerikleri saptanacaktır. Daha sonra besin maddeleri içerikleri saptanmış olan yem
örneklerinin parçalanabilirlik ve sindirilebilirlik değerleri in vivo ve in vitro yöntemler
kullanılarak saptanacaktır. In vivo yöntem olarak klasik sindirim denemesi, naylon kese
tekniği, in vitro yöntem olarak ise enzim yöntemi ve gaz üretim tekniği kullanılacaktır.
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Çalışmanın in vivo denemeleri başlatılmış, dönem raporu içerisinde 50
adet süt karma yeminin klasik sindirim denemeleri tamamlanmıştır. In vivo klasik sindirim
denemelerinde her bir yem için 3 tekerrür olmak üzere 18 baş ergin koç kullanılmıştır. Klasik
sindirim denemeleri, hayvanların deneme yemine alışmasını ve sindirim kanalının önceki
yemlerden arındırılmasını sağlayan ön dönem ile gübrenin toplandığı esas dönem olmak üzere
iki bölümde yürütülmüştür. Gübrenin toplanmadığı ön dönemde sindirim koçlarına günlük
yaşama payının 1.5 katı kadar deneme yemi verilerek esas dönemdeki günlük
tüketebilecekleri miktar belirlenmiştir. Esas dönemde hayvanlara gübre toplama torbaları
takılarak, belirlenen günlük yem miktarı iki öğünde verilmiştir. Esas dönem boyunca toplanan
gübrelerin yaklaşık %10’u örnek olarak ayrılmış ve her defasında 3-5 ml kloroform ilave
edilip buzdolabında muhafaza edilmiştir. Deneme sonunda gübreler kurutularak (Bratzler ve
Swift, 1959) analiz için hazır hale getirilmiştir. Yemlerin besin madde sindirilme
derecelerinin hesaplanmasında farklılığın saptanması ile sindirilme derecesinin belirlenmesi
yöntemi kullanılmış ve kaba yem olarak fiğ kuru otu (%12.5 HP ve 1502,5 kkal/kg ME)
kullanılmıştır.
Rapor dönemi içerisinde 50 adet süt karma yeminin besin maddeleri analizleri tamamlanmış,
gübrelerin besin maddeleri analizleri ise devam etmektedir.
Darboğazlar: Deneme materyali hayvan talebinin projede belirlenen Merinos ırkı ile
karşılanamaması ve denemeye tahsis edilen Bandırma tipi koçların sindirim kafesi, koşum ve
deneme yemlemesine uyumunda yaşanan zorluklardan dolayı klasik sindirim denemelerinde
ön deneme süresi beklenenden daha uzun sürmüştür.
Materyal ve Yöntem: Projede yem materyali 50 adet süt karma yemi olarak belirlenmiştir.
Yem fabrikalarından sağlanan süt karma yemlerinin protein ve enerji içeriklerinde görülen
geniş varyasyona bağlı olarak çalışma sonucunda elde edilecek regresyon denklemlerinin
güvenilir olması açısından örnek sayısı 74'e çıkarılmıştır.
69
Proje Faaliyet Takvimi: Projede yer alan in situ ve in vitro çalışmalar 2014 yılı içerisinde
başlatılacaktır.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Müstakim BAYRAM
Dr. Hülya HANOĞLU
Tarih
İmza
03.01.2014
03.01.2014
Proje Gelişme Raporu Formu
Bazı Yerli Koyun Irklarında İnhibin βB Geninin Yavru
Verimine Etkisi
PROJE BAŞLIĞI
PROJE NUMARASI
PROJE LİDERİ
İlke ÜNLÜSOY
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
Hayvancılık Merkez Araştırma Enstitüsü
RAPORUN İLGİLİ
OLDUĞU DÖNEM
01/01/2013 ile 31/12/2013 arası
Proje Özeti:
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları: Panfi Tarım Hayvancılık ve Gıda San. Tic. Ltd. Şti.’nde Bafra koyun
ırkına ait 50 baş dişiden kan alınmış ancak sonrasında bu dişilere ait yavru verimi kayıtlarına
ulaşılamamasından dolayı Tarımsal İşletmeler Genel Müdürlüğünden izin alınarak Gökhöyük
TİGEM işletmesine ait 50 baş Bafra koyunundan kan alınmıştır ve çalışmalar bunlar
üzerinden yürütülmektedir. İNHBB gen bölgesi için 3 çift primer dizaynı yapılmış bunlardan
2 çiftinin çalışmamasından dolayı tekrar primer tasarlanmıştır ve bu yeni primerlerle
denemeler yapılmaktadır.
Darboğazlar: Panfi Tarım Hayvancılık ve Gıda San. Tic. Ltd. Şti.’nde Bafra koyunlarının
yavru verimi kayıtlarına ulaşılamaması sonucunda tekrar Bafra koyunu arayışına girilmesi ve
tasarlanan 2 çift primerin çalışmamasından dolayı proje analiz süreci uzamaktadır.
Proje Faaliyet Takvimi: Proje takvimindeki aksama nedeniuyle 1 yıl uzatma talep
edilmektedir.
Adı Soyadı
Kuruluş Amiri
Proje Lideri
Muharrem SATILMIŞ
İlke ÜNLÜSOY
Tarih
İmza
27.12.2013
27.12.2013
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Süt Emme Dönemindeki Akkaraman Kuzularının Süzek
Yemleme (Creep Feeding) Sistemi ile Büyütülmesi
PROJE NUMARASI
TAGEM/HAYSÜD/13/A-07/P-03/01
PROJE LİDERİ
PROJEYÜRÜTÜCÜ
SÜ KURULUŞ
RAPORUN
İLGİLİ
OLDUĞU DÖNEM
Zir. Yük. Müh. İbrahim HALICI
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
01/01/2013-31/12/2013
70
Proje Özeti: Bu çalışma Gıda, Tarım ve Hayvancılık Bakanlığı’nca Sivas ve Aksaray
illerinde uygulanmakta olan Halk Elinde Ülkesel Küçükbaş Hayvan Islahı projesi
kapsamında, üzerinde ıslah çalışması yürütülen halk elindeki Akkaraman koyun sürülerinde
yapılacaktır. Araştırmada süt emme dönemindeki kuzularda 100 günlük besi periyodu
boyunca “ Süzek yemlemesi ” (Creep Feeding)’ adı verilen ilave besleme programı
uygulanacaktır. Bu amaçla Sivas ve Aksaray illerindeki sürülerden 8 yetiştirici tespit edilerek,
her bir yetiştiriciden farklı doğum tipi ve cinsiyette 32 baş deneme grubu, 32 baş kontrol
grubu olmak üzere toplam 64 kuzu araştırmaya katılacaktır. Kontrol grubundaki kuzulara
herhangi bir ilave yemleme yapılmayacak, geleneksel besleme düzenine bırakılacaktır.
Araştırma süresince belli aralıklarla yem tüketimi, günlük canlı ağırlık artışı gibi veriler
alınacak, araştırmanın sonunda deneme ve kontrol grupları karşılaştırmalı olarak
incelenecektir. Sonuç olarak doğumla başlayıp 100.gün sonunda biten besi periyodunda, süt
emme dönemindeki kuzularda süt ile birlikte ilave yoğunlaştırılmış yem vermenin, hızlı
büyümeyi ne ölçüde etkinleştirdiği araştırılarak yetiştiricilere çeşitli önerilerde bulunulacaktır.
Anahtar Kelimeler: Süzek yemlemesi, besi periyodu, yoğunlaştırılmış yem
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları:
Aksaray ilinde üç Sivas ilinde ise beş olmak üzere toplam sekiz işletmede proje metodunda
belirtildiği gibi uygulama gerçekleştirildi. Ancak Proje Liderinin askere gitmesi nedeniyle
gerekli analizler yapılamamıştır.
Yapılması Düşünülen Ara Yayınlar: Mevcut veriler değerlendirilerek bilimsel kongrelerde
yayımlanması düşünülmektedir.
Proje Faaliyet Takvimi:
Proje Liderinin askere gitmesi nedeniyle verilerin değerlendirilip sonuç raporunun yazılması
için projenin bir yıl ek süre verilmesi.
Bütçe Harcamaları Özeti:2013 yılında proje için yapılan harcamalar;
-Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü Genel Bütçesi’nden karşılanmıştır.
KuruluşAmiri
Adı Soyadı
Fatih ÖZDEMİR
Tarih
03.01.2013
Proje Lideri
İbrahim HALICI
03.01.2013
İmza
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
Bazı Yerli Koyun Irklarımızın Yapağı Verim
Özelliklerinin Belirlenmesi ve Lanolin Miktarlarının
Araştırılması
PROJE NUMARASI
TAGEM/HAYSÜD/10/08/01/03
PROJE LİDERİ
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Ali ATİK
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
01/01/2013-31/12/2013
Proje Özeti: TAGEM tarafından desteklenmeye alınan Halk Elinde Ülkesel Küçükbaş
Hayvan Islahı projesi kapsamında, yerli 6 adet (Kangal Akkaraman, İvesi, Akkaraman,
Anadolu Merinosu, Karayaka, Karacabey Merinosu) koyun ırklarımız ile Dağlıç koyun
ırklarının yapağı verim özellikleri incelenecektir. Yapağılarındaki yağıltı (lanolin) miktarı
71
tespit edilmeye çalışılacaktır. Bugüne kadar yerli ırklarımızın yapağısındaki lanolin miktarı
üzerine herhangi bir çalışma yapılmadığından ilerideki çalışmalar için bir durum tespiti
çalışması yapılmış olacaktır.
Başlıca Faaliyetlerin Gerçekleşme Durumu: Projede hedeflenen ırkların hepsinden yapağı
numunesi alınmıştır. Alınan yapağı numuneleri iki parçaya bölünmüş, bir kısmı Lalahan
Hayvancılık Merkez Araştırma Enstitüsüne analizler için gönderilmiş, bir kısmı ise Selçuk
Üniversitesi Veteriner Fakültesi laboratuvarlarında lanolin analizi için muamelelere tabii
tutulmuştur. Bu bağlamda Projenin gerçekleşme durumu % 85 seviyesindedir.
Dönem Bulguları: Numunelerin toplanmasından sonra elde edilen ham veriler ışığında elde
edilen veriler Minitab 16 bilgisayar programında Tukey testine tabi tutulmuş olup, sonuçlar
aşağıdaki Tablo1’de verilmiştir. Genotiplerde Kırkım Sonu Canlı Ağırlık ile Kirli Yapağı
Verimi ile Canlı Ağırlık arasındaki korelasyon ve variyasyon katsayıları ise Tablo -2 de
verilmiş olup, Genel korelasyon 0,391 (P<0,001) olarak bulunmuştur.
Proje Faaliyet Takvimi: Yapağı numunelerinin sonuçları henüz elimize ulaşmadığından
dolayı projenin bir yıl uzatılarak önümüzdeki yıl sonuç raporunun sunulması teklif
edilmektedir.
Bütçe Harcamaları Özeti: Şu ana kadar yapılan tüm harcamalar Enstitünün Genel
Bütçesinden karşılanmıştır.
Tablo 1: Kırkım Kirli Yapağı Ağırlıkları ile Kırkım Canlı Ağırlığının, Genotip, Cinsiyet ve
Yaş Bakımından Sonuçları ve Aralarındaki İnteraksiyonlar (Alfabetik Sıra ile)
n
Genotip
Akkaraman
Anadolu Merinosu
Dağlıç
İvesi
Kangal Akkaraman
Karacabey Merinosu
Karayaka
Cinsiyet
Dişi
Erkek
Yaş
1
2
3
4
5
GenotipxCinsiyet
Akkaraman-Dişi
Akkaraman-Erkek
A. Merinosu-Dişi
A.Merinosu-Erkek
Dağlıç-Dişi
Dağlıç-Erkek
İvesi-Dişi
İvesi-Erkek
Kangal Akkaraman -Dişi
Kangal Akkaraman -Erkek
Karacabey Merinosu - Dişi
Karacabey Merinosu - Erkek
Karayaka-Dişi
Karayaka-Erkek
Kirli Yapağı Ağırlığı
X
Xs
P<0,05
n
Kırkım Canlı Ağırlığı
X
Xs
P<0,05
88
78
59
81
80
78
73
2,67
3,78
2,39
2,66
2,44
4,25
2,47
0,089
0,094
0,106
0,088
0,092
0,090
0,093
C
B
C
C
C
A
C
88
78
59
81
80
78
73
65,0
69,2
51,7
70,0
67,0
68,6
45,6
0,79
0,86
0,95
0,82
0,82
0,88
0,87
B
A
C
A
AB
A
D
324
213
2,83
3,07
0,047
0,062
B
A
324
213
53,4
71,5
0,42
0,57
B
A
135
133
132
106
31
2,51
3,15
3,00
3,05
3,04
0,067
0,068
0,068
0,077
0,149
B
A
A
A
A
135
133
132
106
31
50,3
61,2
66,3
68,3
66,1
0,60
0,60
0,61
0,70
1,37
C
B
A
A
A
48
40
48
30
32
27
53
28
40
40
55
23
48
25
2,34
3,02
3,56
4,06
2,34
2,43
2,46
2,94
2,54
2,32
4,03
4,60
2,63
2,03
0,113
0,123
0,113
0,142
0,136
0,148
0,103
0,145
0,123
0,123
0,101
0,161
0,108
0,155
F
CD
BC
AB
EF
DEF
EF
DE
DEF
EF
AB
A
DEF
F
48
40
48
30
32
27
53
28
40
40
55
23
48
25
54,5
75,6
55,7
82,8
43,6
59,8
58,2
81,9
58,6
75,4
55,7
81,4
47,6
43,6
1,04
1,13
1,04
1,31
1,26
1,36
0,95
1,34
1,13
1,13
0,93
1,49
1,00
1,43
C
B
C
A
D
C
C
A
C
B
C
AB
D
D
72
Tablo 2: Genotiplerde Kırkım Sonu Canlı Ağırlık ile Kirli Yapağı Verimi Arasındaki
Korelasyonlar ve Varyasyon Katsayıları
Genotip
Akkaraman
Anadolu Merinosu
Dağlıç
Kangal Akkaraman
Karacabey Merinosu
Karayaka
GENEL
Kuruluş Amiri
Proje Lideri
Korelasyon
0.529
0.568
0.497
- 0.034
0.292
0.633
0.391
P
0.001
0.001
0.001
0.768
0.010
0.001
0.001
VK% Yapağı
31.19
30.45
8.07
38.14
16.69
23.40
Adı Soyadı
Fatih ÖZDEMİR
Ali ATİK
Tarih
VK% Canlı Ağırlık
24.91
25.93
22.53
14.98
24.79
14.87
İmza
15.01.2014
Proje Gelişme Raporu Formu
PROJE BAŞLIĞI
PROJE NUMARASI
PROJE LİDERİ
PROJE
YÜRÜTÜCÜSÜ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Süzek Yemleme Sistemi İle Meraya Ek Olarak Baklagil Yem
Bitkileri Veya Kesif Yem İle Beslemenin Kuzuların Büyüme
Performansına Ve Meraya Olan Etkisi
TAGEM/HAYSÜD/12/07/04/01
Uğur DEMİRCİ
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü
01/01/2013-31/12/2013
Proje Özeti:
Bu çalışmada, ilkbaharda yapay merada anaları ile beraber otlayan kuzuların ilave baklagil yem
bitkileri veya kesif yem ile süzek yemleme sistemi uygulanarak beslenmesinin
performanslarına ve meraya olan etkilerine bakılacaktır. Çalışmada Orta Anadolu merinosu
koyunları ile onların yaklaşık 1 haftalık yaştaki tekiz kuzularının yapay merada sürekli otlatma
ile 7 Nisan-30 Haziran tarihleri arasında besiye alınması amaçlanmaktadır. Kuzular yaklaşık 6
haftalık yaşa ulaştıkları Mayıs ayının ilk haftasında süzek yemleme sistemi ile mera
parsellerine bitişik olarak kurulmuş olan saf yonca ve gazal boynuzu parsellerini rotasyonlu
olarak otlayacaklardır. Denemede ayrıca bir kuzu grubuna meraya ek olarak kesif yem
verilirken kontrol grubu kuzular ise herhangi bir ek yem olmaksızın sadece mera üzerinde
anaları ile beraber besleneceklerdir. Koyun ve kuzuların canlı ağırlık değişimleri her 3 haftada
bir ölçülecek, meranın ot verimine ve besin madde muhtevası değişimi gibi bazı unsurlara
bakılacaktır. Deneme tesadüf blokları deneme desenine göre 3 tekerrürlü olarak kurulacaktır.
Otlatma denemesi, her biri 0,18 ha büyüklüğünde 15 adet parselden oluşacaktır. Otlatma
grupları 3 blokta 4’er parsel üzerinde 5 adet tekiz kuzulu koyunlar ile hektara 27,7 koyun/ha
otlatma yoğunluğunda oluşturulacaktır ve her iki yıl ilkbahar döneminde 84 gün olarak
yapılacaktır.
Anahtar Kelimeler: Kuzu besisi, yonca, gazal boynuzu, ek yemleme, karma yem, otlatma.
Dönem Bulguları: Meradan alınması gerekli örnekler alınmış besin madde içerikleri ve
miktarlarına ilişkin çalışma devam etmektedir. Planlanan dönemde koyunlar ve kuzular
merada denemeye alınmış olup bu döneme ait hayvan denemesine ilişkin veriler aşağıdaki
tablolarda özetlenmiştir.
73
Tablo 1. Koyun ve kuzuların canlı ağırlık artışları
Canlı ağırlık artışı, g/günn
Muameleler
Koyun
Kontrol
Gazal boynuzu
Karma yem
Yonca
PEk
PD
PEkxD
SH†
Kuzu
1. Dönem (18.0408.05)
229
222
258
207
2. Dönem (08-29.05)
-107
-68
-82
-63
3. Dönem (29.05-19.06)
37
25
51
-21
4. dönem (19.0610.07)
-42
-94
-11
-60
274
285
273
304
263
236
259
250
157
214
209
226
51
147
149
177
0.11
0.01
0.71
29.9
Kontrol
Gazal boynuzu
Karma yem
Yonca
PEk
0.01
PD
0.01
PEkxD
0.01
SH†
11.7
†: Muamele grupları ve dönemler arası ikili interaksiyon
Ek: ek yemle grupları; D: canlı ağırlık ölçüm dönemleri
Tablo 2. Koyun ve kuzuların et üretimi (kg/ha/gün)
1. Dönem (18-08.05)
6.4
6.2
7.1
5.4
Kontrol
Gazal boynuzu
Karma yem
Yonca
Koyun
PEk
PD
4. dönem (19-10.06)
-1.2
-2.6
-0.3
-1.8
0.11
0.01
0.71
0.83
PEkxD
SH†
Kontrol
Gazal boynuzu
Karma yem
Yonca
Kuzu
Et üretimi, (kg/ha/gün)
2. Dönem (08-29.05)
3. Dönem (29-19.06)
-3.0
1.0
-1.9
0.7
-2.4
1.5
-1.8
-0.5
PEk
PD
PEkxD
SH†
7.6
7.9
7.6
8.4
7.3
6.6
7.2
6.9
4.3
4.8
5.8
5.1
1.4
3.3
4.1
4.0
0.01
0.01
0.01
0.31
†: Muamele grupları ve dönemler arası ikili interaksiyon
Ek: ek yemle grupları; D: canlı ağırlık ölçüm dönemleri
Çalışmanın ilk yılı hayvan denemesine ait veriler özetlenerek "Süzek Yemleme Sistemi ile
Meraya Ek Olarak Baklagil Yem Bitkileri veya Kesif Yem ile Beslemenin Besi Kuzularının
Performansına Etkisi" isimli poster sunumu yapılmıştır. Uğur Demirci, Serkan Ateş, Şükrü
Doğan, Gürhan Keleş 7. ULUSAL HAYVAN BESLEME KONGRESİ (26-27 Eylül 2013)
ANKARA
Darboğazlar: Proje kapsamında (hayvanların beslenmesi, bakımı, kontrolü, meraya ilişkin
çalışmalar, sulama, laboratuvar çalışmaları) yapılan işlemler çeşitli ve yoğun olduğu için işçi
sorunu yaşanmaktadır.
Bütçe Harcamaları Özeti: Şu ana kadar yapılan tüm harcamalar Enstitünün genel
bütçesinden harcanmıştır.
Kuruluş Amiri
Adı Soyadı
Fatih ÖZDEMİR
Proje Lideri
Uğur DEMİRCİ
Tarih
İmza
74
Proje Gelişme Raporu Formu
Koyunlarda Zeytin Yaprağı Ekstraktının İn Vitro Ve İn
Vivo Besin Madde Sindirilebilirliği İle Rumen
Fermentasyonu, Bazı Kan Parametreleri Ve Antioksidan
Kapasite Üzerine Etkisi
TAGEM/HAYSÜD/
Pınar ÖZDEMİR
PROJE BAŞLIĞI
PROJE NUMARASI
PROJE LİDERİ
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
Hayvancılık Merkez Araştırma Enstitüsü Lalahan/ANKARA
01/01/2013 ile 31/12/2013
Başlıca Faaliyetlerin Gerçekleşme Durumu: Proje başlama tarihi Haziran 2014 olduğu için
herhangi bir çalışma henüz yapılmamıştır.
Adı Soyadı
Tarih
Muharrem SATILMIŞ
27.12.2013
Pınar ÖZDEMİR
27.12.2013
Proje Gelişme Raporu Formu
Kuruluş Amiri
Proje Lideri
PROJE BAŞLIĞI
Halk Elinde Küçükbaş Hayvan Islahı Projesi
PROJE NUMARASI
PROJE LİDERİ
PROJE YÜRÜTÜCÜSÜ
KURULUŞ
RAPORUN İLGİLİ
OLDUĞU DÖNEM
TAGEM/HAYSÜD /13 /02 /01 /04
Dr. Bekir ANKARALI
İmza
TAGEM
01/01/2013 ile 31/12/2013
Proje Özeti: Bu proje ile hayvancılığın desteklenmesi tebliği kapsamında halk elinde
yetiştirilmekte olan küçükbaş hayvanların çeşitli verim özellikleri bakımından ıslahı
amaçlanmıştır.
Amaç, küçükbaş hayvanları geliştirerek korumak, kuzu/oğlaklarının erken gelişme,
kaliteli ekonomik verim özelliklerini artırmak, küçükbaş yetiştiren çiftçilerin üstün verimli
damızlık koç ihtiyaçlarını karşılamak, halk elinde kayıtlı saf küçükbaş sürüleri oluşturmak ve
bu ırka özgü yetiştirme birliklerinin kurulmasını teşvik etmektir. Ayrıca, yetiştiricilerin her
küçükbaştan elde edecekleri kazancın artırılması da amaçlanmaktadır.
Başlıca Faaliyetlerin Gerçekleşme Durumu:
Dönem Bulguları:
Halk Elinde Küçükbaş Hayvan Islahı Ülkesel Projesi (2005-2013)
YILI
İl Sayısı
Irk/Tip Sayısı
Proje Sayısı
2005
2006
2007
2008
2
12
12
12
2
11
11
11
2
12
12
12
Materyal
Sayısı
8.300
69.668
68.724
71.414
Yetiştirici
Sayısı
20
461
461
466
Destekleme
Tutarı (TL)
166.000
1.811.368
2.105.660
2.497.670
75
2009
2010
2011
2012
2013
12
13
42
54
58
11
12
23
27
28
12
13
81
139
148
71.672
75.824
478.529
679.423
870.571
438
472
3.027
4.688
5.821
2.559.987
2.936.640
16.409.061
31.716.482
39.044.874
99.247.742
Toplam
2013 Yılı Gerçekleşen:
Projede
Kayıtlı
Anaç
Proje Adı
Hayvan
Sayısı
(Baş)
Destekleme
Yapılan Anaç
Sayısı
Elit
Sürü
Taban
Sürü
Anaç Hayvan
Destekleme Tutarı
(TL)
Elit Sürü
Ödeme
Taban
Sürü
Ödeme
Destekleme
Yapılan Yavru
Sayısı (Baş)
Elit
Sürü
Taban
Sürü
Yavru Destekleme
Tutarı (TL)
Elit Sürü
Ödeme
Taban
Sürü
Ödeme
Halk
Elinde
Küçükbaş 870.571 44.744 694.298 1.568.700 24.620.084 42.001 550.522 1.961.267 10.894.823
Hayvan
Islahı
Toplam
739.042
26.188.784
592.523
12.856.090
Ödeme
Genel
Toplam
(TL)
39.044.874
2013 Yılı Destekleme Miktarı
Ø Proje 2013 yılı itibariyle 66 il ve 163 alt proje, 23 koyun, 6 keçi Irk/Genotip ile
programa alınmış olup 58 il, 148 alt projede 22 koyun, 6 keçi Irk/Genotip ile
yürütülmektedir.
Ø Halk Elinde Ülkesel Hayvan Islahı Projesi 24 Üniversite, 7 Araştırma Enstitüsü, 83
Proje Lideri ve 148 Alt Proje Teknik Elemanı ile devam etmektedir.
Proje Paydaşları
Üniversiteler
TOPLAM
28
Öğretim Üyeleri (Proje Lideri)
49
Enstitü/İstasyon Proje Lideri
48
Proje Teknik Eleman Sayısı (Küçükbaş)
140
Proje Uygulanan Damızlık Koyun Keçi Yetiştiricileri Birliği Sayısı
61
Dönem Başarı Durumu:
• Bazı yetiştiricilerin üretimden vazgeçmesi engellenmiş, kırsal alanda istihdam
yaratılmıştır.
• Projeli yetiştiriciler damızlıkçı işletme özelliklerine kavuşmuş ve damızlık erkek
Toklularına kasaplık değerinin iki katını aşan fiyatlarda alıcı bulmuşlardır.
• Doğan her bir yavru için damızlık değer tahminleri yapılarak damızlığa ayrılmıştır.
• Birim hayvandan üzerinde durulan verim artışı sağlanmış, yetiştiricilerin geliri
artırılmıştır.
Ayrıca TAGEM Islah Bilgi Sistemi kurulmuş olup her alt projeye ait dönemsel veriler bu
sisteme yüklenmektedir. Sisteme yüklenen verilerden önemli raporlamalar yapılabilmekte ve
projenin gidişi ile ilgili somut bilgiler elde edilebilmektedir.
Darboğazlar:
· Projede yer alan Anaç Koyun/Keçi ve Kuzu/Oğlakların küpelerinin düşmesi bir
kimliklendirme sorununu da beraberinde getirmektedir.
76
·
Damızlık Seçimi Öncesi Kasaplık kuzuların ulusal küpelendirilmesi yapılmadan elden
çıkarılması sonucu projeye kayıtlı yetiştiriciler, daha az destekleme ödemesi almaktadır.
· Elit sürülerin, koç depolarının tüzel kişiliğe ait olmamasından yetiştirici şartlarında,
verilerin takibi ve sürdürülebilirliği konusunda problemler oluşmaktadır.
· Türk-Vet ve KKKS sistemleri sağlıklı çalışmamakta ve verilerin (ölüm, doğum, satış,
satın alma vb. ) güncellenmesi, zamanında yapılamamaktadır.
· Damızlık seçilen hayvanların küpelerinin düşmesi büyük risk oluşturmaktadır.
· Irkları iyi temsil eden kaliteli damızlık hayvan temininde zorluklar yaşanmaktadır.
· Proje materyali sürüler uzun soluklu bir ıslah çalışmasının materyali olduklarından
sağlıklarının takibinde bir öncelik hakkına sahip değildirler.
· Yapağı verimlerinin incelenmesinde verilerin sağlanmasında laboratuvar desteği yetersiz
kalmaktadır.
· En kısa sürede Ulusal Küçükbaş Hayvan Islahı takip programının oluşturulması
gerekmektedir.
· Geçen yıllar içerisinde elde edilen verilerin etkin değerlendirilmesine ihtiyaç vardır.
· Yürütülen Projelerde görsel bilgiler elde etmeye yönelik çalışmalar yapılmasına ihtiyaç
vardır.
· Bazı Damızlık Yetiştirici Birliklerinin proje hakkında halen bilgi yetersizliği
bulunmaktadır.
· Taban sürülerden elit sürülere hayvan aktarımında özellikle yetiştiricilerin hayvanlarını
erken dönemde pazara sevk edişlerinden dolayı sorunlar yaşanmaktadır.
Personel: Alt projelerde Proje Liderleri tarafından gelen talepler doğrultusunda personel
değişikliklerinin teklifine
77
KÜÇÜKBAŞ HAYVANCILIK ARAŞTIRMALARI
SONUÇ RAPORLARI
T.C.
GIDA, TARIM VE HAYVANCILIK BAKANLIĞI
Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü
PROJE SONUÇ RAPORU
Marmara Bölgesi Şartlarına Uygun Bandırma Koyun Tipi Geliştirme Çalışmaları
TAGEM/HAYSÜD/08/08/01/01
Tamer SEZENLER
İsmail ERDOĞAN
Dr. Mesut YILDIRIR
M. Akif YÜKSEL
Dr. Deniz SOYSAL
Cihan ÖMÜR
Orhan KARADAĞ
Dr. Mustafa KÜÇÜKKEBAPÇI
Koyunculuk Araştırma İstasyonu Müdürlüğü
Ocak- 2014
BANDIRMA
78
ÇİZELGELER DİZİNİ
Çizelge 1. Bandırma koyunlarında değişik dönemlerdeki canlı ağırlık ortalamaları ve
kuzuların sütten kesime kadarki yaşama gücü
Çizelge 2. Bandırma koyunlarında değişik dönemlerdeki günlük canlı ağırlık artışı
bakımından ortalamalar ve standart hataları
Çizelge 3. Bandırma koyunlarında bazı döl verimi ölçütlerinin yıllara göre dağılımı
Çizelge 4. Bandırma Koyunlarının Laktasyon Süresi (LS), Günlük Ortalama Süt Verimi
(GOSV), Laktasyon Süt Verimi (LSV) ve 150 Güne Standardize edilmiş Laktasyon Süt
Verimlerine (LSV_150) ait Ortalamalar.
Çizelge 5. Bandırma Koyunların Süt Bileşenlerine Ait En Küçük Kareler Ortalamaları ve
standart hataları (%)
Çizelge 6. Bandırma Tipi Kuzuların Besi Gücü ve Günlük Canlı Ağırlık Artışları(kg)
Çizelge 7. Bandırma Tipi Kuzuların Günlük Kesif Yem Tüketimi(g) ve Yem Değerlendirme
oranları
Çizelge 8. Bandırma Tipi Kuzularda Kesim ve Karkas Özellikleri
Çizelge 9. Bandırma Tipi Kuzularda Çeşitli İç Organ Ağırlıkları(kg)
Çizelge 10. Bandırma Tipi Kuzularda Karkas Ölçüleri(cm)
Çizelge 11. Bandırma erkek kuzularının değişik yaş dönemlerinde canlı ağırlık (CAĞR) ve
bazı testis ölçülerinin ortalama (±SH), en az ve en çok değerleri
Çizelge 12. Bandırma koçlarında canlı ağırlık (kg) (CAĞR) ve bazı testis ölçülerinin (cm,
cm3) doğum tipine göre en küçük kareler ortalamaları
Çizelge 13. Bandırma koçlarında testis özellikleri ve canlı ağırlık arasındaki korelasyon
katsayıları
Çizelge 14. Bandırma koyunlarında koç katım öncesi canlı ağırlık, vücut kondisyon puanı ve
bazı vücut ölçüleri arasındaki korelasyon katsayıları
Çizelge 15. Bandırma koyunlarında 2012 yılı koç katım öncesi vücut kondisyon puanları ve
vücut ölçülerinin yaşa göre ortalama ve standart hataları
Çizelge 16. Bandırma koyunlarında bazı yapağı özelliklerine ait tanımlayıcı istatistikler
Çizelge 17. Bandırma koyunlarında bazı yapağı özellikleri arasındaki korelasyon katsayıları
Çizelge 18. Bandırma koyunlarında canlı ağırlık ve bazı yapağı özelliklerine ait ortalamalar
ve standart hatalar
ŞEKİLLER DİZİNİ
Şekil 1. Bandırma Koyunu oluşum şeması
ÖZET
Bu araştırma 2008 – 2012 yılları arasında Bandırma Koyunculuk Araştırma İstasyonu
Müdürlüğü’nde yürütülmüştür. Araştırmanın hayvan materyalini toplam 50 baş koç, 985 baş
koyun ve doğan kuzuları oluşturmuştur.
Bandırma koyunu sürüsü kuzularında ortalama doğum ağırlığı, sütten kesim ağırlığı,
altıncı ay ve bir yaş canlı ağırlığı sırasıyla 4.10, 28.49, 35.86 ve 43.30 kg olarak bulunmuştur.
Kuzuların bütün dönem canlı ağırlıklarına doğum yılı, doğum tipi, cinsiyet, ana yaşı ve
doğum sezonu (ay’ı)’nun etkisi önemli bulunmuştur (P<0.05).
2008-2011 yılları arasında sırasıyla, koç altı koyun başına doğan kuzu sayısı
(KKBKS) sırasıyla 0.657, 0.680, 1.224 ve 1.352 olarak, doğuran koyun başına doğan kuzu
sayısı (DKBKS) 1.168, 1.231, 1.512 ve 1.561 olarak bulunmuştur. İkizlik oranı %16.8,
%23.1, %50.2 ve %53.3 olarak, üçüzlük oranı ise %0.0, %0.0, %0.55 ve %1.4 olarak tespit
edilmiştir.
79
Sütten kesime kadar günlük canlı ağırlık artışı sırasıyla 0.270 kg olmuş ve doğum tipi,
cinsiyet, ana yaşı, doğum yılı ve doğum sezonu’nun etkisinin önemli olduğu tespit edilmiştir
(P<0.05). Sütten kesime kadar yaşama gücü %91 olarak tespit edilmiştir. Yaşama gücü
üzerine ana yaşı, doğum yılı ve doğum sezonunun etkisi önemli bulunmuştur (P<0.05).
Bandırma koyunlarında elli altı günlük besi süresi sonunda erkek ve dişi grupların
sırasıyla besi sonu ağırlıkları 36.70 ve 33.03 kg, günlük ortalama canlı ağırlık artışı 334 ve
268 g olarak gerçekleşmiştir (P<0.01). Kesim sonucunda soğuk karkas ağırlığı sırasıyla 17.81
ve 16.53 kg, MLD kesit alanı 15.55 cm2 ve 12.50 cm2 olarak bulunmuştur (P<0.01).
Bandırma koyunlarında laktasyon süt verimi 73.29 kg, laktasyon süresi 142.02 gün,
günlük süt verimi 488.19 g olarak bulunmuştur. Süt bileşenlerinden süt yağ, protein ve laktoz,
kuru madde ve yağsız kuru madde oranları sırasıyla %5.26, %6.11 ve %3.29, %15.49 ve
%10.23 olarak tespit edilmiştir.
Testis özellikleri ortalama 2.5 ve 13.5 aylık yaşlar arasında incelenmiştir. Doğum
tipine göre incelenen sol testis çapı, sağ testis çapı, sağ testis uzunluğu, sol testis uzunluğu,
sıkrotum çevresi,sıkrotum uzunluğu ve sıkrutum hacmi 2.5 aylık tekiz erkeklerde sırasıyla
2.99, 3.04, 4.63, 4.8, 14.95, 10.11 cm ve 130.14 cm3 olarak gerçekleşirken, 13.5 aylık yaşta
tekiz erkeklerde ise sırasıyla 5.64, 5.54, 10.35, 10.85, 31.88, 18.90 cm ve 760.07 cm3 olarak
tespit edilmiştir.
Bandırma koyunlarında ortalama canlı ağırlık, vücut kondisyon puanı, vücut
ölçülerinden sağrı yüksekliği, cidago yüksekliği, vücut uzunluğu, göğüs genişliği, göğüs
derinliği ve göğüs çevresi sırasıyla, 49.12 kg, 2.24, 68.43 cm, 68.56 cm, 68.20 cm, 23.07 cm,
29.74 cm ve 89.93 cm olarak tespit edilmiştir. İncelenen tüm özellikler üzerine yaşın etkisi
önemli bulunmuştur (P<0.05).
Yapağı özelliklerinden, elyaf sayısına göre belirlenen uzunluk-H, ve elyaf hacim ve
ağırlığına göre belirlenen uzunluk-B değerleri sırasıyla ortalama 32.55 ve 45.70 mm olarak
tespit edilirken, incelik, elastikiyet, mukavemet ve randıman için elde edilen değerler sırasıyla
30.42 μ, %25.77, 16.67 g ve %58.96 olarak tespit edilmiştir.
Anahtar Kelimeler: Bandırma koyunu, büyüme özellikleri, döl verimi, süt verimi, testis
özellikleri, vücut ölçüsü, yapağı özellikleri.
GİRİŞ
Koyun yetiştiriciliğinde verimliliği artırmanın iki ana yolu vardır. Birincisi, koyunlara
daha iyi çevre koşulları sağlamak, ikincisi de koyunların genetik değerini yükseltmektir. Bu
iki ana yoldan genotipin ıslahı, kalıcı ve sürekli olması niteliğiyle önem kazanır. Türkiye’de
koyun varlığının genetik ıslahı çalışmalarının Cumhuriyet’in kuruluşu ile başladığı
söylenebilir. Erken Cumhuriyet yıllarında, yünlü dokuma endüstrisinin nitelikli yapağı
gereksinimini karşılamak amacıyla, ilk koyun ıslahı çalışmaları, Merinoslaştırma etkinlikleri
ile başlatılmıştır. Daha sonraları ise yerli koyun ırklarımızın kuzu, et ve süt verim yönünde de
ıslahı çalışmaları devreye sokulmuştur. Anılan ıslah etkinlikleri ise genelde melezleme
programları şeklinde devlet eliyle yürütüldüğü de gözlemlenmektedir. (Kaymakçı, 2009)
Islah çalışmalarında, bir yandan melezleme programları gerçekleştirilirken, bir yandan
da bu melezlemelerde temel genetik materyal olarak kullanılan yerli koyun ırklarının
verimlerinin saf yetiştirme ve seleksiyon çalışmalarıyla ortaya konulduğu görülmektedir.
(Kaymakçı, 2006)
Türkiye’de gerek yerli ırkların et verimi yönünde ıslahı, gerekse ikili ya da üçlü
kullanma melezlemesi ve uygun genotiplerin saptanması amacıyla birçok araştırma
yapılmıştır. Bu maksatla Tarım ve Köyişleri Bakanlığı 1986 yılında “Border Leicester, Dorset
Down, Ile de France, Hampshire Down, Lincoln ve Alman Siyah Başlı Etçi Koyunu”
ırklarından ithal ederek hem saf olarak yetiştirilmiş hem de melezleme ile yerli ırklarımızın
etçilik özelliklerinin arttırılması çalışmalarına başlanmıştır. Bu çalışmalar TİGEM’ e bağlı
80
Tarım İşletmelerinde yürütülmüş, daha sonra da TAGEM’ e bağlı Araştırma Enstitülerinde de
devam etmiştir. Böylece Bandırma Koyunculuk Araştırma İstasyonun’da gelen bu ırklar ile
çalışılmaya başlanmıştır.
Bir yandan saf yetiştirmeye devam edilir iken diğer yandan Enstitünün asıl koyun
materyalini oluşturan Karacabey Merinosu ve Kıvırcık ırkları ile çeşitli melezleme çalışmaları
yürütülmüştür. Ancak dönem içinde bu ırkların safları şartlara ayak uyduramayarak yok
olmuş, yalnızca çeşitli genotipik düzeylerde Hampshire Down x Karacabey Merinosu, ASB x
Karacabey Merinosu ve ASB x Kıvırcık melezleri yetiştirilmeye devam edilmektedir.
MATERYAL VE METOD
Hayvan Materyalinin Tanımı
Bu çalışma Bandırma Koyunculuk Araştırma İstasyonu Müdürlüğü Küçükbaş Hayvan
Yetiştirme ünitesinde yürütülmüştür. Araştırmanın hayvan materyalini 1986 yılında
Almanya’dan ithal edilen Alman Siyah Başlı koçlar ile Kıvırcık koyunların 1998 yılından
itibaren çiftleştirilmesiyle elde edilen ve Bandırma Koyunu olarak adlandırılan 985 baş
koyun ve doğan kuzuları oluşturmuştur.
1998 yılında bölge şartlarına uygun etçi bir koyun geliştirilmesi amacıyla ASB x
Kıvırcık (F1), ASB x Kıvırcık (G1) ve ASB x Kıvırcık (G1 x F1) genotipleri elde edilmiştir.
Dönem içerisinde Bandırma-I (ASB x Kıvırcık (G1)) ve Bandırma-II (ASB x Kıvırcık (G1 x
F1)) tipleri üzerinde durulmuş ancak her iki tipin çeşitli verim özellikleri bakımından farklı
olmadığı sonucuna varılmıştır. Daha sonra 2008 yılında sürü kapatılmış ve iki tip ayrım
yapılmadan Bandırma adı verilerek yetiştirilmeye devam edilmiştir. Genotipik olarak
ortalama % 68 ASB ve % 32 Kıvırcık olan tipte seleksiyon çalışmaları devam etmektedir.
♂SBA x ♀K
♀F1
♂SBA x ♀F1
♂♀ SBAG1
♂SBAG1 x ♀SBAG1
Bandırma-I
♂SBAG1 x ♀F1
♂♀SBAG1F1
♂SBAG1F1 x ♀SBAG1F1
Bandırma-II
Bandırma Koyunu : %68 SBA + %32 K
SBA x K= F1 :%50 SBA+ %50 K
SBA x F1= SBAG1: %75 SBA+ %25 K
SBA x K= F1 :%50 SBA + %50 K
SBAG1 x F1= SBAG1 F1: %62.5 SBA+ %37.5 K
Bandırma Koyunu : %68 SBA + %32 K
Şekil 1. Bandırma Koyunu oluşum şeması.
Bakım ve Besleme
Koyun ve kuzuların beslenmesinde fiğ, yonca ve saman kuru otu ile istasyonda
hazırlanan konsantre yemler kullanılmıştır. Koyunlar, koç katım mevsiminde merada ve
buğday anızında otlatılmıştır. Mera ve anızların yetersiz olduğu ve koyunların koç katımı
öncesi kondisyonlarının düşük olduğu yıllarda koç katımından bir ay önce başlanarak hayvan
81
başına 400-600 g konsantre yem verilmiş, koç katım döneminin bitmesiyle bu ek yemlemeye
son verilmiştir. Doğumların başlaması ile koyunlara tekrar ortalama 500 g konsantre yem ve
fiğ kuru otu verilmiştir. Bu yemlemede kuzulardan ayrılana kadar devam ettirilmiştir.
Kuzularından ayrılan koyunlarda verilen kesif yem miktarı azaltılarak Mart-Nisan ayından
itibaren konsantre yem kesilerek, sadece meradan yararlandırılmışlardır. Koyunlar her yıl 15
Haziran, 15 Eylül tarihleri arasında gece meralandırılmış, diğer dönemlerde ise iklim şartları
müsait oldukça gündüz meraya çıkartılmışlardır.
Kuzular doğumdan sonra 1 gün anaları ile birlikte doğum bölmelerinde tutulmuşlar ve
sonra anaları ile beraber kendileri için hazırlanmış bölümlere alınmışlardır. Bu bölmelerde 1520 gün kadar anaları ile beraber kapalı olarak barınakta tutulmuşlardır. Bu dönemde kuzuların
yeme alışmasını sağlamak için anaların giremediği ve sadece yavruların girebildiği kısımlar
oluşturulmuş, bu kısımlarda kaliteli yonca kuru otu, konsantre yem ve temiz su sürekli hazır
bulunmuştur. Daha sonra iklim koşulları müsait oldukça 09:00-12:00 ile 13:00-16:00 saatleri
arasında koyunlar meraya çıkartılmış ve kalan sürelerde kuzular ve analar birlikte
barındırılmıştır.
Kuzular sütten kesilinceye kadar (Yaklaşık 90 gün) bakımları bu şekilde devam
ettirilmiştir. Sütten kesilen kuzular dişi ve erkek olarak ayrılarak, büyümelerine devam
edecekleri bölümlere ayrılmışlardır. Bu dönemden sonra kesif yem, fiğ kuru otu ile
beslenmişler ve şartlar elverdiğince meradan istifade etmeleri sağlanmıştır.
Büyüme, Canlı Ağırlık Kazancı ve Yaşama Gücü
Kuzuların doğum ağırlığı ilk 12 saat içinde 100 g’ a duyarlı terazi ile tartılmış ve
plastik kulak küpesi ile numaralanmıştır. Kuzuların doğum ağırlığı, doğum tipi, cinsiyeti, ana
ve baba numaraları doğum defterine kayıt edilmiştir. Doğumu takiben koyun ve kuzu doğum
bölmelerinde tutulmuştur. Proje süresince doğum, sütten kesim canlı ağırlığı, altıncı ay ve bir
yaş canlı ağırlık tartımları 100 g hassasiyetteki baskül yardımıyla alınmıştır. Kuzuların canlı
ağırlıkları 90, 180. ve 365. güne göre standardize edilmiştir. Kuzularda doğum ile sütten
kesim arasında günlük canlı ağırlık kazançları ve yaşama güçleri de hesaplanmıştır.
Döl Verimi
Bandırma sürüsünde koç katımı (çiftleştirme), 2008 ve 2009 yıllarında 15 Haziran-15
Ağustos ayları arasında, 2010 ve 2011 yıllarında 1 Eylül- 30 Ekim tarihleri arasında
gerçekleştirilmiştir. Çiftleştirme, elde aşım yöntemine göre yapılmıştır. Arama koçları ile
kızgın koyunlar her sabah saat 08.00 da belirlenmiş ve koyunlar koç katım bölmesine
alınmıştır. Daha sonra çiftleştirilen her koyuna ait aşan koç, koyun numarası ve aşım tarihi
gibi bilgiler kayıt edilmiştir. Çalışmada; döl verim özellikleri için; kızgınlık oranı, doğum
oranı, kısırlık oranı, koçaltı koyun başına düşen kuzu sayısı (KKDK), doğuran koyun başına
düşen kuzu sayısı (DKDK), çoğuz doğum oranı ve kuzularda doğum ile sütten kesim arası
(90. gün) yaşama güçleri (Kaymakçı, 2006)’nın bildirdiği yöntemlere göre hesaplanmıştır.
Besi Performansı
Araştırmanın ikinci yılında Bandırma koyunlarının besi gücünü belirlemek amacıyla
deneme yapılmıştır. Bu çalışmada hayvan materyali olarak 12 baş dişi ve 12 baş erkek olmak
üzere toplam 24 baş kuzu kullanılmıştır.
Kuzular doğumlarından itibaren ortalama 40 günlük yaşa kadar anaları ile beraber
bulundurulmuş, ayrıca 15 günlük yaştan itibaren konsantre yeme ve kuru yonca otuna
alıştırılmışlardır. Daha sonra seçilen kuzular analarından ayrılmış ve tartılarak besi
bölmelerine alınmıştır. Alıştırma dönemi 8 hafta sürmüş, 48 günlük yaşta ve 18 kg besi
başlangıç ağırlığı ile 56 günlük yoğun besiye alınmışlardır. Çalışma boyunca erkek ve dişi
kuzular ayrı bölmelerde beslenmişlerdir. Kuzulara kesif yem serbest olarak (ad-libitum)
düzeyde verilmiş, günlük ortalama 200 g/baş/gün yonca kuru otu, taze ve temiz su, mineral
madde ihtiyaçları için ise yalama taşları önlerinde bulundurulmuştur.
82
Besi çalışmasında kullanılan yem pelet formda olup, özel bir yem fabrikasından temin
edilmiştir. Yemin ham protein içeriği min %16, Metabolik Enerjisi ise min 2600 kcal/kg dir.
Çalışma başlatıldıktan sonra günlük canlı ağırlık artışları 14 günlük periyotlar la
sabahları 09.00’ da aç olarak yapılan tartımlarla tespit edilmiştir. Tartımın yapılacağı günün
bir gün öncesi saat 21.00 da otomatik yemlikler kapatılmış ve kuru ot yemlikleri
boşaltılmıştır. Tartımlarda 100 g ‘a hassas elektronik kantar kullanılmıştır. Tüketilen yem
miktarının tespiti için ise otomatik yemliklerde kalan yem tartılmıştır. 56 günlük besinin
sonunda kuzular sabah aç karnına tartılarak besi sonu canlı ağırlıkları saptanmıştır.
Kesim ve Karkas Özellikleri
Kesimden hemen sonra hayvanlar yüzülüp iç organları çıkartılmış, kuzuların deri
(post), baş, dört ayak, testis, iç yağ, ahşa takım, kalp, akciğer, karaciğer, dalak, dört mide
dolu, dört mide boş, bağırsak dolu ağırlıkları 2 g hassasiyetli elektronik tartı aletiyle
tartılmıştır. Sıcak Karkas ağırlıkları alındıktan sonra karkaslar + 4 oC’de 24 saat
dinlendirilmiştir. Dinlendirme işleminden sonra karkasların soğuk karkas ağırlıkları, böbrek
ağırlığı, böbrek leğen boşluğu yağı ağırlığı ve karkas ölçüleri (karkas uzunluğu, iç but
uzunluğu, dış but uzunluğu, but çevresi, but genişliği, göğüs derinliği, göğüs genişliği, göğüs
çevresi, sağrı genişliği, sağrı çevresi) ölçü bastonu ve şerit metre yardımıyla alındıktan sonra
Standard Method (Colomer-Rocher ve ark.1987) parçalama yöntemine göre karkaslar
parçalanmış ve sağ ve sol karkas ağırlıkları (100 g hassasiyetli terazi ile), omuz ağırlıkları,
boyun ağırlıkları, etek ağırlıkları, uzun but ağırlıkları, kaburga ağırlıkları ve kuyruk ağırlıkları
2 g hassasiyetli elektronik terazi ile tartılarak belirlenmiştir. Ayrıca her kuzunun MLD
(Musculus longissimus dorsi) kesit alanı ve kabuk yağı kalınlığı ölçülmüştür.
Süt Verimi
Bandırma koyularının süt verimi ve laktasyon süresini belirlemek amacıyla iki
laktasyon döneminde yapılmıştır. İlk laktasyon döneminde 54 baş ve ikincisinde ise 70 baş
hayvan olmak üzere toplam 124 baş Bandırma koyunu denemenin hayvan materyalini
oluşturmuştur. Araştırma materyali koyunlar Şubat ayında doğum yapmışlardır. Doğumları
takiben anne ve kuzu bir hafta süre ile doğum bölmelerinde tutulmuştur.
Kontrol sağımları 15 günde bir defa sabah ve akşam olmak üzere iki defa yapılmıştır.
Doğumdan sonraki ilk ay içerisinde ilk kontrol sağımı yapılmıştır. Kuzuların etkilenmemeleri
için ilk kontrolde kuzular analarından akşam ayrılmış sabah sağım yapılmıştır. Kuzular
anaları ile ertesi gün sabaha kadar tutulmuş sabah ayrılmış akşam sağımı yapılmıştırtır. Daha
sonraki dönemlerde kuzuların kesif ve kaba yem tüketmeye başlamalarından dolayı sabah
sağımı 07.00’da yapılmış kuzular emiştirildikten sonra analarından ayrılmış ve akşam sağımı
saat 19.00’da yapılmıştır ve kuzular emiştirilmiştir. Sağılan sütler 5 g duyarlılıkla
ölçülmüştür. Koyunların günlük süt verimi 100 g’nın altına düşünce sağıma son verilmiştir.
Koyunların sağıldıkları süre laktasyon süresi olarak alınmıştır.
Testis Ölçümleri
Bandırma koyunlarının 2011 doğum sezonunda doğan, 50 baş erkek kuzunun ortalama
75, 165, 255 ve 380 günlük yaşlardaki testis özellikleri ve canlı ağırlıkları tespit edilmiştir.
Kuzuların 21 başı tek, 29 başı ikiz doğmuştur.
Testis Ölçümleri;
-Testis çapı(cm): Her bir testisin en geniş yerinin metal kumpas ile ölçülmesiyle,
-Testis Uzunluğu (cm): Testis ucu ve epididimis arasındaki uzunluğunmetal kumpas
ile ölçülmesiyle,
-Scrotum Uzunluğu (cm): Scrotumun inguinal bölgeye birleştiği yerden, uç kısma
kadar olan uzaklığın ölçü şeridi ileölçülmesiyle,
-Scrotum Çevresi (cm): Bir çift testisin en geniş yerinden alınan çevre uzunluğunun
ölçü şeridi ile ölçülmesiyle,
83
-Scrotum Hacmi (cm3): Hacim ölçü dereceli bir kap ile kaptan taşırdığı su miktarının
belirlenmesiyle saptanmıştır. (Koyuncu ve ark. 2005)
Vücut Ölçüleri
Bandırma koyunlarının vücut ölçüleri ve canlı ağırlıkları 2012 yılı koç katımı
öncesinde tespit edilmiştir. Canlı ağırlıkların tespit edilmesi amacıyla 200 gram
hassasiyetinde elektronik kantar kullanılmıştır. Morfometrik ölçülerden göğüs çevresi ölçü
şeridi, cidago yüksekliği, sağrı yüksekliği, vücut uzunluğu, göğüs derinliği ve göğüs genişliği
ölçü bastonu kullanılarak elde edilmiştir.
Yapağı Özellikleri
Bandırma koyunlarının kırkım calı ağırlıkları, kirli yapağı ağırlıkları 2012 yılı Mayı
ayında elde edilmiştir. Canlı ağırlıklar koyunların kırkılmasını müteakip 100 g hassasiyetinde
elektronik kantar yardımıyla alınmıştır. Aynı şekilde koyunun kırkılması ile elde edilen kirli
gömlek 100 g hassaiyetinde kantar ile tartılmış ve kaydedilmiştir. Yapağı numuneleri
koyunların son kaburga bölgesinden alınmıştır.
Alınan yapağı örnekleri yapağı özelliklerinin belirlenmesi amacıyla Lalahan
Hayvancılık Merkez Araştırma Enstitüsü Yapağı-Tiftik ve Hayvansal Elyaf Analiz
Laboratuarı tarafından analiz edilmiştir. Lüle uzunluğu ölçümü B-H) Uster AL100-FL100
isimli cihazla, İncelik veya elyaf çapı OFDA 100 isimli cihazla, Elastikiyet ve Mukavemet
ölçümleri Fafegraph ME (Fibre Tensile Tester FAFEGRAPH) cihazı ile yapılmıştır.
Randıman Tayini (Düzgüneş ve Pekel, 1983).
İstatistik Analizler
Büyüme özellikleri
Doğum, sütten kesim (90 gün), altıncı ay (180 gün) ve bir yaş (365 gün) canlı
ağırlıkları ile doğum-sütten kesim (GCAA1), sütten kesim-altıncı ay (GCAA2) ve altıncı aybir yaş (GCAA3) arası günlük canlı ağırlık artışı özelliklerini analiz etmek için kullanılan
analiz modeli, doğum yılı (2008-2011), doğum sezonu (sezon 1: Kasım-Aralık, sezon 2:
Ocak-Şubat, sezon 3: Mart-Nisan), doğum tipi (tekiz, çoğuz), cinsiyet (erkek, dişi) ve ana yaşı
(2, 3, 4, 5, 6≤) faktörlerini içermiştir. Doğum ağırlığı dışında diğer büyüme özelliklerinin
analizinde doğum ağırlığı modele ko-değişken olarak dâhil edilmiştir. İncelenen büyüme
özellikleri üzerinde çevre faktörlerin etkilerini araştırmak ve alt grup ortalamalarının
karşılaştırılmasında Proc Glm / Tukey-Kremar çoklu karşılaştırma yöntemi kullanılmıştır
(SAS, 2000).
Döl Verimi Özellikleri
Kızgınlık oranı (KO%), gebelik oranı (GO%), doğum oranı (DO%), … gibi özellikler
2008-2011 yılları itibariyle incelenmiştir. Aynı sürüde yıllar arasında ve aynı yılda sürüler
arasında karşılaştırılmasında t-testi (Sümbüloğlu ve Sümbüloğlu, 2002) kullanılmıştır.
Besi Performansı
Günlük canlı ağırlık artışı, kesim ve karkas özellikleri ve kimi iç organların analizinde
kullanılan model cinsiyet (erkek-dişi) faktörünü içermiştir. Alt grup ortalamalarının
karşılaştırılmasında varyans analizi kullanılmıştır (SAS, 2000).
Canlı Ağırlık ve Testis Ölçümleri
Canlı ağırlık ve testis özelliklerinin analizinde kullanılan model doğum tipi (tekiz,
ikiz) faktörünü içermiştir. İncelenen özellikler üzerinde çevre faktörlerin etkilerini araştırmak
ve alt grup ortalamalarının karşılaştırılmasında Proc Glm / Tukey-Kremar, canlı ağırlık ile
testis özellikleri arasındaki korelasyonları elde etmek için Proc Corr ve açıklayıcı
istatistiklerin hesaplanmasında Proc Means yöntemi kullanılmıştır (SAS, 2000).
Canlı Ağırlık ve Vücut Ölçüleri
Koyunlarda koç katım öncesi canlı ağırlık, vücut kondisyon puanı ve kimi vücut
ölçümlerinin analizinde kullanılan model yaş (1.5-7.5) faktörünü içermiştir. İncelenen
özellikler üzerinde çevre faktörlerin etkilerini araştırmak ve alt grup ortalamalarının
84
karşılaştırılmasında Proc Glm / Tukey-Kremar, canlı ağırlık ile vücut ölçüleri arasındaki
korelasyonları elde etmek için Proc Corr ve açıklayıcı istatistiklerin hesaplanmasında Proc
Means yöntemi kullanılmıştır (SAS, 2000).
Canlı Ağırlık ve Yapağı Özellikleri
Canlı ağırlık ve yapağı özelliklerinin analizinde kullanılan model yaş (1-6) ve cinsiyet
faktörlerini içermiştir. İncelenen özellikler üzerinde çevre faktörlerin etkilerini araştırmak ve
alt grup ortalamalarının karşılaştırılmasında Proc Glm / Tukey-Kremar, canlı ağırlık ile testis
özellikleri arasındaki korelasyonları elde etmek için Proc Corr ve açıklayıcı istatistiklerin
hesaplanmasında Proc Means yöntemi kullanılmıştır (SAS, 2000).
Süt Verimi
Laktasyon süresi ve laktasyon süt verimi Fleishmann (Barillet ve ark., 1992) metodu
ile hesaplanmıştır. Laktasyon süt verimi (LSV), laktasyon süresi (LS), günlük ortalama süt
verimi (GOSV) ve 150 gün laktasyon süresine göre standardize edilmiş süt verimi (LSV-150)
ile kimi süt içerikleri (protein, yağ, laktoz, kuru madde ve yağsız kuru madde) özellikleri
analiz edilmiştir. Analiz modeli yıl (2011-2012), laktasyon sırası (1-5) ve doğum tipi (tekiz,
ikiz) faktörlerini içermiştir. İncelenen özellikler üzerinde çevre faktörlerin etkilerini
araştırmak ve alt grup ortalamalarının karşılaştırılmasında Proc Glm / Tukey-Kremar yöntemi
kullanılmıştır (SAS, 2000).
BULGULAR
Büyüme Özellikleri
Kuzularına çeşitli dönemlerdeki canlı ağırlıklar ve sütten kesime kadarki yaşama gücü
Çizelge 1’de verilmiştir. Kuzuların doğum ve sütten kesim ağırlıkları üzerine modeldeki
bütün faktörlerin etkisi önemli bulunmuştur (P<0.05). Yaşama gücüne ait değerler
incelendiğinde, doğum yılı, doğum sezonu (ay’ı) ve ana yaşının etkisinin önemli (P<0.05)
olduğu görülmektedir. Üç, dört ve beş yaşlı analardan doğan kuzular yaşama gücü
bakımından %91-93 gibi bir yüksek değere sahip olmuştur. Diğer yaşlı analardan doğan
kuzular yaşama gücü bakımından benzer değerlere sahip olmuşlardır.
Çizelge 2’de kuzuların doğum ile sütten kesim arası günlük canlı ağırlık artışına ilişkin
değerler verilmiştir. Kuzuların GCAA üzerine modeldeki bütün faktörlerin etkilerinin önemli
olduğu gözlenmiştir (P<0.05). Te kiz doğanlar çoğuz doğanlardan ve erkek kuzuların dişi
kuzulardan sütten kesime kadar (GCAA1) daha fazla ağırlık artışı sağladığı (P<0.05) halde,
sütten kesimden altıncı aylık yaşa (GCAA2) aynı zamanda altıncı aydan bir yıllık yaşa
(GCAA3) kadarki dönemde ise ikiz doğanların tekiz doğanlara oranla daha fazla günlük canlı
ağırlık artışı sağladığı gözlenmiştir (P<0.05).
85
Çizelge 1. Bandırma koyunlarında değişik dönemlerdeki canlı ağırlık ortalamaları ve kuzuların sütten kesime
kadarki yaşama gücü
N
Doğ. Ağr. YG% N
CA.90 Gün
N CA.180 Gün N
CA.365 Gün
a
ab
a
a
2008 153 3.68±0.085 0.90
137 26.26±0.628 110 32.42±0.570 108 37.52±0.688a
Yıl
b
a
2009 176 4.37±0.060
0.94 166 30.64±0.419b 131 38.86±0.557b 113 47.65±0.686b
2010 322 4.05±0.047c 0.92ab 295 30.23±0.323b 237 35.29±0.366c 113 41.98±0.578c
2011 334 4.20±0.045bc 0.89b 296 26.57±0.310a 184 36.50±0.509c 182 44.86±0.643d
Sezon
D.Tipi
Cinsiyet
303
608
74
4.06±0.056a
4.10±0.035a
4.34±0.095b
Tekiz 421
Çoğuz 564
4.38±0.048a
3.90±0.032b
Erkek
Dişi
4.19±0.041a
4.01±0.039b
1
2
3
495
490
0.94a
0.90ab
0.89b
0.90
0.92
0.91
0.90
0.87a
0.93b
0.91ab
0.93b
0.89ab
0.91
278
549
66
27.91±0.375a
29.14±0.247b
25.48±0.830c
218
413
31
36.41±0.475a
37.79±0.302a
32.82±1.280b
200
289
30
43.33±0.616a
43.55±0.469a
40.62±1.680b
377
516
30.65±0.326a
26.91±0.237b
305
357
37.37±0.409a
34.56±0.297b
248
271
44.06±0.572a
42.60±0.464b
450
443
30.02±0.291a
26.93±0.265b
284
378
38.86±0.387a
33.60±0.284b
158
361
47.64±0.749a
41.40±0.371b
2
151 3.90±0.069a
132 27.09±0.551a 92 34.47±0.682a 73 41.26±0.994a
3
212 4.04±0.056a
197 29.05±0.445b 160 36.07±0.440ab 128 44.29±0.606b
ab
4
227 4.08±0.061
207 28.61±0.421b 158 35.39±0.510ab 124 42.53±0.743ab
5
189 4.24±0.066b
176 29.01±0.435b 132 36.68±0.580b 103 43.87±0.852b
b
6≤
204 4.22±0.066
181 28.23±0.444ab 120 36.34±0.680b 91 43.92±1.007b
-985 4.10±0.028
894 28.49±0.204 662 35.86±0.253 519 43.30±0.366
Genel
----- 2.90±0.188** -- 2.76±0.242** -- 2.94±0.363**
βBW0
a,b
Aynı sütün ve aynı faktör seviyelerinde farklı üssel harfleri taşıyan ortalamalar birbirinden farklıdır (P<0.05),
**
P<0.01
βBW0: İlgili yaş canlı ağırlığının doğum ağırlığı üzerine olan regresyon katsayısı, YG%: kuzuların sütten kesime
Ana
Yaşı
86
Çizelge 2. Bandırma koyunlarında değişik dönemlerdeki günlük canlı ağırlık artışı bakımından ortalamalar ve
standart hataları
N
GCAA1
N
GCAA2
N
GCAA3
2008
137
250±6.6a
153
50±6.9a
108
29±2.3a
Yıl
2009
166
292±4.3b
131
75±4.3b
113
47±2.3b
b
a
2010
295
291±3.3
237
49±3.3
113
41±1.7b
b
c
2011
296
248±3.2
184
104±2.4
182
46±1.5b
Sezon
1
2
3
278
550
66
265±3.8a
278±2.6a
234±8.8b
218
413
31
78±2.9
66±3.0
67±12.8
200
287
29
38±1.7
43±1.2
44±3.2
D.Tipi
Tekiz
İkiz
377
517
291±3.4a
255±2.5b
305
357
63±3.6a
75±2.6b
247
269
37±1.5a
45±1.3b
Cinsiyet
Erkek
Dişi
451
443
286±3.0a
254±2.7b
284
378
74±3.7a
66±2.6b
157
359
41±2.1
41±1.1
Ana Yaşı
Genel
2
3
4
5
6≤
--
133
197
207
176
181
894
257±5.7a
277±4.7b
273±4.3b
275±4.6b
266±4.6ab
270±2.1
92
160
158
132
120
662
70±5.2
68±5.0
63±4.9
74±4.0
75±4.9
70±2.2
73
128
123
101
91
516
39±2.5
44±2.0
40±2.0
41±2.2
40±2.6
41±1.0
βBW0
--
--
21±2.1**
-0.1±2.1
--
1.0±1.2
a,b
Aynı sütün ve aynı faktör seviyelerinde farklı üssel harfleri taşıyan ortalamalar birbirinden farklıdır (P<0.05),
P<0.01, βBW0: İlgili dönem günlük canlı ağırlık artışlarının doğum ağırlığı üzerine olan regresyon katsayısı,
GCCA1: doğum ile 90-günlük yaşa kadarki günlük canlı ağırlık artışı, GCAA2: 90-günlük yaş ile 180-günlük
yaşa kadarki günlük canlı ağırlık artışı, GCAA3: 180-günlük yaş ile 365-günlük yaşa kadarki günlük canlı
ağırlık artışı, Sezon: doğum sezonu (1=Kasım-Aralık; 2=Ocak-Şubat; 3=Mart-Nisan)
**
Döl Verimi Özellikleri
Bakım, besleme ve diğer çevre koşullarını iyileştirmek, koçaltı ve doğuran koyun
başına doğan kuzu sayısını artırmak, koyun yetiştiriciliğinde karlılığı artırmak için yetiştirme
hedefleri arasında olmalıdır. Proje süresince sürü, döl verimi özellikleri bakımından takip
edilmişlerdir. Kızgınlık (östrus) oranı, doğum oranı, kısırlık oranı, tek ve çoğuz doğum
oranları, doğuran koyun başına kuzu sayısı (DKBKS) ve koç altı koyun başına doğan kuzu
sayısı (KKBKS) sayıları yıllar itibariyle Çizelge 3’te verilmiştir.
Kızgınlık oranı (KO) bakımından, genel olarak yıllar itibariyle artış meydana gelmiş
olup en düşük KO (%71.4) 2009 yılında en yüksek KO (%99.6) ise 2011 yılında gözlenmiştir.
2008 ve 2009 yıllarındaki KO, ve 2010 ve 2011yıllarındaki KO’ları benzer bulunmuştur.
2010 ve 2011yıllarındaki KO’ları önceki yıllara göre yüksek ve istatistiksel olarak önemli
bulunmuştur (P<0.05). Doğum oranı (DO) bakımından, genel olarak yıllar itibariyle artış
meydana gelmiş olup en düşük DO (%55.2) 2009 yılında en yüksek DO (%86.6) ise 2011
yılında gözlenmiştir. 2008 ve 2009 yıllarındaki DO benzer bulunurken 2009 yılından sonra
meydana gelen artışlar istatistiksel olarak önemli bulunmuştur (P<0.05).
Çoğuz doğum oranı (ÇO) araştırmanın başladığı yıldan itibaren artış göstermiş olup,
ÇO araştırmanın son yılında ilk yılına kıyasla hemen hemen üç katına çıkmıştır (P<0.05).
Doğuran koyun başına doğan kuzu sayısı (DKBKS) bakımından 2008 ile 2009 yıllarında, aynı
şekilde 2010 ile 2011 yıllarında benzer bulunurken, 2010 ve 2011 yıllarında daha yüksek
olarak tespit edilmiştir (P<0.05). DKBKS en düşük 2008 yılında (1.168) ve en yüksek olarak
ise 2011 yılında (1.561) olarak tespit edilmiştir.
87
Çizelge 3. Bandırma koyunlarında bazı döl verimi ölçütlerinin yıllara göre dağılımı
Koç
Kızgınlık
Doğum
Kısırlık
Tekizlik
İkizlik
Üçüzlük
Altı
YIL Koyun Oranı(%) Oranı(%) Oranı(%) DKBKS KKBKS Oranı(%) Oranı(%) Oranı(%)
2008
2009
2010
2011
233
259
263
247
76.8a
71.4a
98.1b
99.6b
56.2a
55.2a
81.0b
86.6c
43.8a
44.8a
19.0b
13.4c
1.168a
1.231a
1.512b
1.561b
0.657a
0.680a
1.224b
1.352c
83.2a
76.9a
49.3b
45.3b
16.8a
23.1a
50.2b
53.3b
0.0
0.0
0.5
1.4
Gen.
1002
86.6
70.0
30.0
1.405
0.983
60.1
39.4
0.6
Aynı sütunda farklı harfleri taşıyan rakamlar istatiksel olarak farklıdır (P<0.05)
Genel olarak, çoğuz doğum oranı 2008 yılından 2011 yılına kadar geçen zaman içinde
hemen hemen üç katına çıkmıştır. Bu artışın sebebini yıldan yıla meydana getirilen çevre
faktörlerindeki iyileştirmenin yanı sıra sürü yönetiminde (özellikle koç katımı zamanında)
yapılan değişikliklere de bağlamak mümkündür. Aynı şekilde, KKBKS’ında da paralel olarak
artış meydana geldiği tespit edilmiştir.
Süt Verim Özellikleri
Bandırma koyunlarında laktasyon süresi, süt verimi ve günlük ortalama süt verimleri
Çizelge 4’de sunulmuştur. Ortalama laktasyon süresi, laktasyon süt verimi ve günlük ortalama
süt verimleri sırasıyla 142.02 gün, 488.19 g/gün ve 73.29 kg olarak belirlenmiştir. Bandırma
koyunlarının laktasyon süresi üzerine yıl etkisi önemli (P<0.01) ancak doğum tipi ve
laktasyon sırası önemsiz (P>0.05) bulunmuştur. Laktasyon süt verimi üzerine doğum tipinin
etkisi önemsiz (P>0.05), yıl ve laktasyon sırasının etkisi ise önemli olmuştur (P<0.01,
P<0.05). Günlük ortalama süt verimi yıl ve laktasyon sırasından etkilenirken doğum tipinden
etkilenmemiştir. Laktasyon sırası arttıkça günlük ortalama süt verimi ve laktasyon süt
veriminin de arttığı saptanmıştır. Birinci laktasyondaki koyunların ortalama süt verimleri
59.41 kg olurken beşinci laktasyondaki koyunlar 83.31 kg a ulaşmıştır. Tek ve ikiz doğuran
koyunların laktasyon süt verimleri ile yıllara göre süt verimleri benzer bulunmuştur.
Çizelge 4. Bandırma Koyunlarının Laktasyon Süresi (LS), Günlük Ortalama Süt Verimi (GOSV), Laktasyon Süt
Verimi (LSV) ve 150 Güne Standardize edilmiş Laktasyon Süt Verimlerine (LSV_150) ait Ortalamalar.
LS (gün)
GOSV (g)
LSV (kg)
LSV_150 (kg)
n
X ± Sx
X ± Sx
X ± Sx
X ± Sx
**
**
**
**
2011
54
149.82±1.446a
557.17±17.414a
83.63±2.757b
83.57±2.612a
2012
70
135.00±1.211b
414.39±14.576b
56.28±2.308a
62.16±2.186b
NS
NS
NS
NS
Faktör
Yıl
Doğum Tipi
Tekiz
80
141.79±1.123
575.06±17.483
70.40±2.140
73.33±2.028
İkiz
44
143.03±1.561
591.17±24.260
69.51±2.976
72.41±2.819
NS
*
*
*
Laktasyon Sırası
1
22
138.44±2.177
396.05±26.217
a
ab
a
59.41±3.933a
ab
71.47±3.598ab
55.45±4.151
2
27
141.68±1.992
476.43±23.985
68.12±3.797
3
23
146.07±2.169
486.11±26.115ab
71.28±4.134ab
72.92±3.917ab
b
b
4
26
144.14±1.982
514.94±23.864
75.42±3.778
77.24±3.580b
5
26
141.71±1.934
555.38±23.284b
79.51±3.686b
83.31±3.493b
Genel
124
142.02±2.043
488.19±24.516
70.31±3.790
a, b: Aynı sütunda farklı harf taşıyan ortalamalar arası farklılıklar önemlidir. *:P<0.05, **:P<0.01,
*:P<0.05, **:P<0.01, NS: P>0.05.
73.29±3.747
ÖD: P>0.05.
Süt bileşenlerinden yağ, protein, laktoz, kuru madde, yağsız kurumadde oranlarına ait
değerler Çizelge 5’te verilmiştir. Bandırma koyunlarında yağ %5.26, protein %6.11, laktoz
88
%3.29, kuru madde %15.49 ve yasız kurumadde oranı da %10.23 olarak belirlenmiştir. Yıl
incelenen süt bileşenlerinin tamamı üzerine etkili olurken, laktasyon sırası ve doğum tipinin
etkili olmadığı tespit edilmiştir (P>0.05).
Çizelge 5. Bandırma Koyunların Süt Bileşenlerine Ait En Küçük Kareler Ortalamaları ve standart hataları
Faktör
n
Yıl
Yağ(%)
Protein(%)
Lactoz(%)
KM(%)
YZKM(%)
X ± Sx
X ± Sx
X ± Sx
X ± Sx
X ± Sx
**
**
a
**
a
**
a
NS
10.26±0.052
2011
54
5.77±0.123
6.40±0.097
3.63±0.031
2012
Laktasyon Sırası
1
70
22
4.80±0.103b
NS
5.32±0.186
5.93±0.081b
NS
6.20±0.147
2.95±0.026b
NS
3.29±0.047
15.00±0.131b
NS
15.54±0.236
10.22±0.043
NS
10.14±0.078
2
26
5.08±0.170
6.26±0.134
3.27±0.043
15.43±0.216
10.37±0.071
3
23
5.32±0.185
6.22±0.146
3.22±0.047
15.60±0.235
10.29±0.078
26
27
80
5.35±0.169
5.37±0.165
NS
5.41±0.096
6.07±0.133
6.09±0.130
NS
6.07±0.076
3.34±0.043
3.32±0.042
NS
3.30±0.024
15.62±0.215
15.39±0.210
NS
15.66±0.122
10.30±0.071
10.11±0.069
NS
10.22±0.040
44
5.16±0.133
6.26±0.105
3.27±0.034
15.37±0.169
10.27±0.056
124
5.26±0.088
6.11±0.063
3.29±0.036
15.49±0.107
10.23±0.033
4
5
Doğum Tipi
Tekiz
İkiz
Genel
16.03±0.157
a
a, b: Aynı sütunda farklı harf taşıyan ortalamalar arası farklılıklar önemlidir. *:P<0.05, **:P<0.01,
*:P<0.05, **:P<0.01, NS: P>0.05
ÖD: P>0.05.
Besi Özellikleri
Bandırma tipi erkek ve dişi kuzulara ait besi gücü ve günlük canlı ağırlık artışlarına
ilişkin tanımlayıcı değerler Çizelge 6’de sunulmuştur. Çizelge incelendiğinde erkek ve dişi
kuzular arasında besi gücü bakımından 14. ve 28. gün canlı ağırlıkları farklı
olmamıştır(P>0.05). Ancak 42. gün ve besi sonu canlı ağırlığı bakımından önemli düzeyde
fark tespit edilmiştir(P<0.01). Bunun yanında erkek ve dişi kuzular için besi süresince elde
edilen ortalama günlük canlı ağırlık artışı erkek kuzular lehine önemli düzeydedir(P<0.01).
Araştırmada günlük ortalama canlı ağırlık artışı adına elde edilen değerler, Kaymakçı
ve ark., (1996), Özder ve ark., (1996), Akmaz ve ark. (2000a)’ nın bulduğu değerlerden
düşük, Cengiz ve ark., (1989), Ertuğrul ve ark., (1989a), Köycü ve Özder., (1994), Torun ve
ark., (1998), Oğan (2001), Kaymakçı ve ark., (2002), Özbey ve Akcan (2003), Köycü ve
Özder (2004), Altın ve ark., (2005), Tekin ve ark., (2005), Ceyhan ve ark., (2008)’ nın
bildirişlerinden yüksek, Akmaz ve ark., (1999)’ nın bulduğu değerler ile paralellik
göstermektedir.
Çizelge 6: Bandırma Tipi Kuzuların Besi Gücü ve Günlük Canlı Ağırlık Artışları(kg)
Erkek
Dişi
Özellikler
n
n
x ± Sx
x ± Sx
Doğum Ağ.(kg)
Besi Başı Ağ.(kg)
14.Gün Ağ.(kg)
28.Gün Ağ.(kg)
42.Gün Ağ.(kg)
Besi Sonu.Ağ.(kg)
Gün.Ort.C.A.A (kg)
12
12
12
12
12
12
12
4.82± 0.107
17.98±0.335
22.65±0.553
26.80±0.684
31.68±0.873a
36.70±0.877a
0.334±0.013a
12
12
12
12
12
12
12
4.48± 0.131
18.00±0.176
22.20±0.310
25.63±0.348
28.93±0.425b**
33.03±0.456b**
0.268±0.006**
**
P<0,01 Aynı satırda farklı harflerle gösterilen değerler arasındaki fark istatistiki olarak önemlidir.
Deneme grubu kuzuların besi süresi boyunca tükettikleri günlük kesif yem miktarı ve
yem değerlendirme oranları Çizelge 7’ de verilmiştir. Besi başı, 14. gün arası dönem dışındaki
diğer dönemlerde, erkek kuzular dişilere oranla daha fazla günlük kesif yem tüketmişlerdir.
89
Ayrıca 1 kg canlı ağırlık artışı için tüketilen kesif yem miktarı incelendiğinde erkek kuzuların
dişi kuzulara oranla daha düşük yem tüketimi ile canlı ağırlık artışı sağladığı görülmektedir.
Yem değerlendirme oranları incelendiğinde, Cengiz ve ark., (1989), Ertuğrul ve ark.,
(1989a), Köycü ve Özder., (1994), Kaymakçı ve ark., (1996), Özder ve ark., (1996), Torun ve
ark., (1998)., Akmaz ve ark., (1999, 2000a), Kaymakçı ve ark., (2002), Oğan (2001), Özbey
ve Akcan (2003), Köycü ve Özder (2004), Altın ve ark., (2005), Tekin ve ark., (2005),
Ceyhan ve ark., (2008)’ nın bildirmiş oldukları değerlerden yüksektir.
Çizelge 7: Bandırma Tipi Kuzuların Günlük Kesif Yem Tüketimi(g) ve Yem Değerlendirme
oranları
Besi Özellikleri
Yem Tüketimi(kg/gün)
Besi Başı-14 gün
14-28 nci gün
28-42 nci gün
42-56 ncı gün
Besi Başı-56 ncı gün
Yem Değerlendirme
Besi Başı-14 gün
14-28 nci gün
28-42 nci gün
42-56 ncı gün
Besi Başı-56 ncı gün
Erkek
n=12
Dişi
n=12
0,814
1,090
1,263
1,502
1,167
0,864
1,073
1,179
1,301
1,104
2,441*
3,678*
3,623*
4,189*
3,482*
2,880*
4,382*
5,005*
4,443*
4,177*
*Bir kg canlı ağırlık kazancı için ortalama tüketilen kesif yem miktarı
Kesim ve Karkas Özellikleri
Besi sonunda kesilen 12 baş kuzudan elde edilen kesim ve karkas özelliklerine ilişkin
bulgular Çizelge 8’ de verilmiştir. Erkek ve dişi kuzularda sırasıyla kesim ağırlığı 37.80 ve
33.57 kg, sıcak karkas ağırlığı 18.57 ve 17.11 kg, soğuk karkas ağırlığı 17.81 ve 16.63 kg, baş
ağırlığı 2.04 ve 1.57 kg, 4 ayak ağırlığı 0.94 ve 0.80 kg, sağ karkas ağırlığı 8.59 ve 7.90 kg,
sol karkas ağırlığı 8.71 ve 8.02 kg, omuz ağırlığı 1.77 ve 1.56 kg ve uzun but ağırlığı 3.02 ve
2.79 kg olarak gerçekleşmiş ve önemli bulunmuştur (P<0.01). Soğuk kaybı ise erkek
kuzularda % 4.12, dişi kuzularda % 3.42 olmuş ve önemli bulunmuştur (P<0.05). Karkas
randımanı açısından her iki grup arasında istatistiki açıdan fark gözlenmemiştir (P>0.05).
Karkas randımanı değerleri incelendiğinde, Macit ve Aksoy (1996), Yaprak ve ark.,
(1998), Oğan (2001), Altın ve ark., (2005) ve Ceyhan ve ark., (2008)’ nın bildirdiği
değerlerden düşük, Macit ve ark., (1997), Özbey ve Akcan (2003)’ ın bildirişleriyle benzer,
Bayındır ve ark., (1986), Cengiz ve ark., (1989), Ertuğrul ve ark., (1989a,b), Köycü ve Özder
(1994), Kaymakçı ve ark., (1996) ve Köycü ve Özder (2004)’ in bildirdikleri değerlerden
yüksek bulunmuştur.
90
Çizelge 8: Bandırma Tipi Kuzularda Kesim ve Karkas Özellikleri
Erkek
Özellikler
n
x ± Sx
Kesim. Ağ (kg)
6
37.80±0.403a
Sıc. Kar. Ağ (kg)
6
18.57±0.206a
Soğ. Kar. Ağ. (kg)
6
17.81±0.171a
Sıc. Kar. Ran. %
6
49.15±0.498
Soğ. Kar. Ran. %
6
47.13±0.475
Soğuk. Kaybı %
6
4.12±0.221a
Deri Ağ. (kg)
6
3.42±0.145
Baş Ağ. (kg)
6
2.04±0.079a
4 Ayak Ağ. (kg)
6
0.94±0.030a
Sağ Kar. Ağ. (kg)
6
8.59±0.114a
Sol Kar. Ağ. (kg)
6
8.71±0.074a
Omuz Ağ. (kg)
6
1.77±0.031a
Etek Ağ. (kg)
6
1.07±0.028
Uzun But Ağ. (kg)
6
3.02±0.022a
Boyun Ağ. (kg)
6
0.54±0.030
Kaburga Ağ. (kg)
6
2.29±0.68
Kuyruk Ağ. (kg)
6
0.10±0.006
*
Dişi
n
6
6
6
6
6
6
6
6
6
6
6
6
6
6
6
6
6
x ± Sx
33.57±0.204b**
17.11±0.272b**
16.53±0.287b**
50.76±0.754
49.08±0.808
3.42±0.165b*
3.30±0.127
1.57±0.039b**
0.80±0.021b**
7.90±0.092b**
8.02±0.173b**
1.56±0.041b**
1.03±0.035
2.79±0.062b**
0.54±0.021
2.08±0.080
0.11±0.009
P<0,05, **P<0,01 Aynı satırda farklı harflerle gösterilen değerler arasındaki fark istatistiki olarak önemlidir.
Bandırma tipi erkek ve dişi kuzuların çeşitli iç organlarına ait ağırlıklar Çizelge 9’da
sunulmuştur. Sırasıyla erkek ve dişi kuzularda ahşa takım ağırlığı 1.95 ve 1.62 kg, bağırsak
dolu ağırlığı 2.96 ve 2.51 kg, karaciğer ağırlığı 0.97 ve 0.82 kg, böbrek ağırlığı 0.14 ve 0.12
kg olarak bulunmuş (P<0.01), iç yağ ağırlığı 0.31 ve 0.43 kg, akciğer ağırlığı 0.75 ve 0.61 kg
olmuştur (P<0.05). İç yağ ağırlığı yönünden dişilerin erkeklere göre üstün olması cinsiyet
faktöründen ileri gelebilir.
İç yağ ağırlığı bakımından elde edilen veriler, Bayındır ve ark., (1986), Cengiz ve ark.,
(1989), Ertuğrul ve ark., (1989b), Köycü ve Özder., (1994), Oğan (2001), Özbey ve Akcan
(2003) ve Ceyhan ve ark., (2008)’ ın bulmuş olduklarından düşük, Ertuğrul ve ark., (1989a)
ve Macit ve ark., (1997)’ nın sonuçlarıyla benzerdir.
Çizelge 9: Bandırma Tipi Kuzularda Çeşitli İç Organ Ağırlıkları(kg)
Erkek
Dişi
n
n
x ± Sx
x ± Sx
Ahşa Tak. Ağ
6
1.95±0.023a
6
1.62±0.058b**
4MideDol.Ağ.
6
4.76±0.240
6
4.25±0.180
Bağ. Dolu Ağ.
6
2.96±0.079a
6
2.51±0.086b**
b
İç yağ Ağ.
6
0.31±0.025
6
0.43±0.034a*
Dalak Ağ.
6
0.08±0.005
6
0.07±0.005
Karaciğer Ağ
6
0.97±0.028a
6
0.82±0.034b**
Kalp Ağ.
6
0.19±0.009
6
0.17±0.003
Akciğer Ağ.
6
0.75±0.047a
6
0.61±0.025b*
a
Böbrek Ağ.
6
0.14±0.004
6
0.12±0.003b**
Bö.Leğ.Y.Ağ.
6
0.19±0.034
6
0.30±0.040
*
P<0,05, **P<0,01 Aynı satırda farklı harflerle gösterilen değerler arasındaki fark istatistiki olarak önemlidir.
İç Organlar
Bandırma tipi kuzularda karkas ölçülerine ilişkin değerler Çizelge 10’da verilmiştir.
Erkek ve dişi kuzularda sırasıyla sağrı genişliği 20.17 ve 19.33 cm, MLD(musculus
longisimus dorsi) 15.55 ve 12.50 cm olmuş(P<0.01) ve but genişliği 12.17 ve 11.00 cm,
göğüs derinliği 24.83 ve 23.83 cm olarak bulunmuştur (P<0.05).
MLD (Musculus Longissimus Dorsi) kesit alanı için elde edilen değerler Cengiz ve
ark., (1989), Macit ve Aksoy (1996), Macit ve ark., (1997), Esen ve Özbey (2001), Akmaz ve
ark., (2000ab), Esen ve Yıldız (2000), Oğan (2001) ve Özbey ve Akcan (2003)’ ın elde etmiş
oldukları değerlerden yüksek, Ertuğrul ve ark., (1989a), Akmaz ve ark., (1999)’ nın
değerleriyle örtüşmekte ve Kaymakçı ve ark., (1996) ve Ceyhan ve ark. (2008)’nın elde etmiş
oldukları değerlerden ise düşüktür.
91
Çizelge 10: Bandırma Tipi Kuzularda Karkas Ölçüleri(cm)
Erkek
Dişi
n
n
x ± Sx
x ± Sx
Karkas Uz.
6
71.33±0.919
6
69.00±0.730
Dış But Uz.
6
46.33±0.760
6
46.83±0.477
İç But Uz.
6
23.00±0.577
6
24.00±0.365
But Çevresi
6
37.67±0.494
6
35.83±0.749
But Genişliği
6
12.17±0.307a
6
11.00±0.258b*
Göğüs Gen.
6
18.50±0.342
6
17.67±0.422
Sağrı Gen.
6
20.17±0.167a
6
19.33±0.211b**
a
Göğ.Derinliği
6
24.83±0.307
6
23.83±0.307b*
Göğ.Çevresi
6
74.00±0.816
6
72.17±0.654
Sağrı Çevresi
6
63.33±0.667
6
62.00±0.577
MLD Kesit Alanı cm2
6
15.55±0.417a
6
12.50±0.483b**
Sırt Yağ Kal.
6
0.31±0.029
6
0.44±0.064
*
P<0,05, **P<0,01 Aynı satırda farklı harflerle gösterilen değerler arasındaki fark istatistiki olarak önemlidir.
Karkas Ölçüleri
Testis Özellikleri
Bandırma tipi erkek kuzularında canlı ağırlık ve bazı testis özelliklerinin yaklaşık 2.5
aylık yaştan başlamak üzere yaklaşık 13.5 aylık yaşa kadar ölçüleri alınmış ve değişik
yaşlardaki açıklayıcı istatistikler Çizelge 11’de verilmiştir. Testis özellikleri olarak sol testis
çapı, sağ testis çapı, sol testis uzunluğu, sağ testis uzunluğu, sıkrotum çevresi, sıkrotum
uzunluğu ve sıkrotum çapı ile canlı ağırlık 2.5 ve 13.5 aylık yaşlarda sırasıyla, 2.74-5.58 cm,
2.80-5.59 cm, 4.48-10.48 cm, 4.83-11.16 cm, 14.47-31.51 cm, 10.46-18.74 cm 109.59-749.56
cm3 ve 27.19-65.53 kg olarak bulunmuştur.
Çizelge 11. Bandırma erkek kuzularının değişik yaş dönemlerinde canlı ağırlık (CAĞR)
ve bazı testis ölçülerinin ortalama (±SH), en az ve en çok değerleri
CAĞR
Yaş (ay)
2.5
5.5
8.5
13.5
N
49
50
50
45
En Çok
48.40
64.60
70.80
85.80
En
Az
8.00
16.00
23.00
26.00
En Çok
22.00
59.50
35.50
40.50
En
Az
7.50
11.00
12.00
13.00
En Çok
15.00
17.50
21.00
23.00
X ± SX
En
Az
En Çok
X ± SX
27.19 ± 0.853
43.64 ± 0.971
51.59 ± 1.048
65.53 ± 1.227
Scrtm.Çev
X ± SX
2.5
5.5
8.5
13.5
49
49
50
45
14.47 ± 0.388
27.60 ± 0.816
30.17 ± 0.447
31.51 ± 0.471
Scrtm.Uz
X ± SX
2.5
5.5
8.5
13.5
49
49
50
45
Sol.T.Çapı
En
Az
18.40
30.40
38.40
44.80
10.46 ± 0.208
13.91 ± 0.222
15.63 ± 0.252
18.74 ± 0.292
Scrtm.Hac
En Az
1.60
2.50
3.90
4.40
En
Çok
4.30
6.40
7.30
7.40
En Az
1.60
2.90
4.10
4.00
En
Çok
4.30
7.00
7.50
6.80
En Az
3.30
5.00
8.20
7.00
En
Çok
5.90
12.70
14.50
14.10
X ± SX
En Az
En
Çok
X ± SX
2.74 ± 0.086
4.81 ± 0.114
5.96 ± 0.114
5.58 ± 0.091
Sağ.T.Çapı
X ± SX
2.80 ± 0.085
5.13 ± 0.118
6.04 ± 0.117
5.59 ± 0.093
Sol.T.Uz
X ± SX
4.68 ± 0.075
9.22 ± 0.226
11.02 ± 0.221
10.48 ± 0.173
Sağ.T.Uz
2.5
49
109.59 ± 6.708
35.00
250.00
4.83 ± 0.078
3.30
6.00
5.5
49
446.82 ± 20.374
34.00
770.00
9.71 ± 0.243
5.50
13.90
8.5
50
615.10 ± 17.700
380.00
870.00
12.01 ± 0.242
8.30
15.50
13.5
45
749.56 ± 24.229
470.00 1070.00
11.16 ±0 .200
7.00 15.10
Sağ.T.Çapı: Sağ testis çapı, Sol.T.Çapı: sol testis çapı, Sağ.T.Uz: Sağ testis uzunluğu, Sol.T.Uz: sol testis
uzunluğu, Scrtm.Çev: scrotum çevresi, Scrtm.Hac: scrotum hacmi, CAĞR: canlı ağırlık
92
Testis özelliklerinin değişik yaşlarda doğum tipine göre karşılaştırmaları Çizelge
12’de verilmektedir. Genel, testis ölçüleri yaşın ilerlemesiyle birlikte beklendiği gibi artış
göstermiştir, bütün yaş dönemlerinde tekiz doğanlar ikiz doğanlara göre daha yüksek
değerlere sahip olmuşlardır. Ancak, sol testis çapı, sağ testis çapı ve sıkrotum hacmi
özellikleri bakımından tekizler ile ikizler arasındaki farklılık yalnızca 2.5 aylık yaşta önemli
bulunmuştur (P<0.05). Daha ileri yaşlarda testis özellikleri bakımından tekiz doğanlar ile ikiz
doğanlar arasında önemli bir farklılık tespit edilememiştir.
Bu araştırmada elde edilen testis çapı (sağ-sol, tekiz-ikiz) ölçüleri ortalama 5.5 aylık
yaşta 4.73 ile 5.23 cm arasında değişmektedir. Bu değerler, daha önceden Acıpayam,
Kıvırcık, Karakaş ve Konya Merinosu kuzuları için bildirilen (Kaymakçı ve ark., 1988;
Aygün ve Karaca, 1995; Öztürk ve ark., 1995; Taşkın ve Kaymakçı, 1996; Koyuncu ve ark.,
2005) değerlerden yüksek bulunmuştur.
Elde edilen testis uzunluğu (sağ-sol, tekiz-ikiz) ölçüleri ortalama 5.5 aylık yaşta 9.16
ile 9.76 cm arasında değişmektedir. Bu değerler, daha önceden Acıpayam, Karakaş, Konya
Merinosu, Morkaraman, Dağlıç ve Kıvırcık için bildirilen değerlerden (Kaymakçı ve ark.,
1988; Aygün ve Karaca, 1995; Öztürk ve ark., 1995; Odabaşoğlu ve ark., 1992; Taşkın ve
Kaymakçı, 1996; Koyuncu ve ark., 2005) oldukça yüksek bulunmuştur.
Bu araştırmada elde edilen sıkrotum çevresi (tekiz-ikiz) ölçüleri sırasıyla ortalama 5.5
aylık yaşta 26.86 ve 26.81 cm arasında değişmektedir. Bu değerler, daha önceden Acıpayam,
Romney Marsh, Karakaş ve Kıvırcık kuzularında bulunan değerlerden yüksektir (Kaymakçı
ve ark., 1988; Moraes ve ark., 1992; Aygün ve Karaca, 1995; Taşkın ve Kaymakçı, 1996;
Koyuncu ve ark., 2005).
Bu araştırmada elde edilen sıkrotum uzunluğu (tekiz-ikiz) ölçüleri sırasıyla ortalama
5.5 aylık yaşta 13.75 ve 14.02 cm arasında değişmektedir. Bu değerler, daha önceden
Acıpayam, Karakaş, Morkaraman ve Kıvırcık tokluları için bulunan değerlerden yüksek
bulunmuştur (Kaymakçı ve ark., 1988; Aygün ve Karaca, 1995; Odabaşoğlu ve ark., 1992;
Koyuncu ve ark., 2005).
Bu araştırmada elde edilen sıkrotum hacmi (ikiz-tekiz) ölçüleri sırasıyla ortalama 5.5
aylık yaşta 440.51 ve 455.96 cm3 arasında değişmektedir. Bu değerler, daha önceden Konya
Merinosu, Karayaka ve Kıvırcık için bildirilen değerlerden (Öztürk ve ark., 1995; Koyuncu ve
ark., 2000; Taşkın ve Kaymakçı, 1996; Koyuncu ve ark., 2005) yüksek bulunmuştur.
Bandırma genotipi kuzularda canlı ağırlık ile testis ölçüleri ve testis ölçülerinin kendi
aralarındaki korelasyon katsayılarının tamamı önemli (P<0.01) ve Morkaraman, Konya
Merinosu, Akkaraman ve Kıvırcık için bildirilen değerler ile (Odabaşoğlu ve ark., 1992;
Öztürk ve ark., 1995; Öztürk ve ark. 1996; Koyuncu ve ark., 2005) benzerlik göstermektedir.
93
Çizelge 12. Bandırma koçlarında canlı ağırlık (kg) (CAĞR) ve bazı testis ölçülerinin (cm, cm3) doğum tipine göre en küçük kareler
ortalamaları
Yaş Doğum
Sol.T.Çapı Sağ.T.Çapı Sol.T.Uz
Sağ.T.Uz
Scrtm.Çev Scrtm.Uz
Scrtm.Hac
CAĞR
X ± SX
X ± SX
X ± SX
X ± SX
X ± SX
X ± SX
X ± SX
X ± SX
(ay) Tipi N
a
a
a
2.5 Tekiz 21 2.99±0.075 3.04±0.075 4.63±0.106 4.80±0.114 14.95±0.531 10.11±0.317 130.14±9.489 32.00±0.891a
23.87±0.739b
95.42±7.389b
5.5 Tekiz 21 4.73±0.167 4.98±0.172 9.16±0.288 9.64±0.318 26.86±1.345 13.75±0.311 455.96±27.888 46.90±1.359a
İkiz 29 4.87±0.135 5.23±0.139 9.26±0.234 9.76±0.257 28.11±1.088 14.02±0.251 440.51±22.556 41.29±1.156b
8.5 Tekiz 21 6.00±0.159 6.15±0.161 11.12±0.293 12.26±0.318 30.71±0.653 15.78±0.379 638.00±25.296 54.75±1.510a
İkiz 29 5.94±0.134 5.95±0.136 10.94±0.246 11.83±0.267 29.78±0.549 15.52±0.319 598.52±21.267 49.30±1.285b
13.5 Tekiz 20 5.64±0.169 5.54±0.135 10.35±0.325 10.85±0.265 31.88±0.678 18.90±0.425 760.07±32.786 67.49±1.821
İkiz 25 5.54±0.091 5.62±0.120 10.58±0.178 11.42±0.236 31.21±0.605 18.62±0.379 741.15±29.235 63.97±1.628
a,b
P<0.05, Sağ.T.Çapı: Sağ testis çapı, Sol.T.Çapı: sol testis çapı, Sağ.T.Uz: Sağ testis uzunluğu, Sol.T.Uz: sol testis uzunluğu,
Scrtm.Çev: scrotum çevresi, Scrtm.Hac: scrotum hacmi, CAĞR: canlı ağırlık
İkiz
29 2.57±0.059b 2.63±0.058b 4.71±0.082
4.85±0.089 14.13±0.413 10.70±0.247
94
Çizelge 13. Bandırma koçlarında testis özellikleri ve canlı ağırlık arasındaki korelasyon katsayıları
Sağ.T.Çapı
Sol.T.Uz
Sağ.T.Uz
Scrtm.Çev
Scrtm.Uz
Scrtm.Hac
CAĞR
Sol.T.Çapı
0.967
0.938
0.932
0.889
0.802
0.886
0.809
Sağ.T.Çapı
0.929
0.930
0.894
0.773
0.878
0.786
Sol.T.Uz
0.982
0.881
0.804
0.890
0.823
Sağ.T.Uz
0.865
0.791
0.879
0.814
Scrtm.Çev
0.814
0.881
0.805
Scrtm.Uz
0.896
0.881
Scrtm.Hac
0.886
*
Bütün katsayılar 0.01 seviyesinde sıfırdan farklıdır
Sağ.T.Çapı: Sağ testis çapı, Sol.T.Çapı: sol testis çapı, Sağ.T.Uz: Sağ testis uzunluğu, Sol.T.Uz: sol testis uzunluğu,
Scrtm.Çev: scrotum çevresi, Scrtm.Hac: scrotum hacmi, CAĞR: canlı ağırlık
Testis özellikleri ile canlı ağırlık arasındaki korelasyon katsayıları Çizelge 13’de
verilmiştir. Testis ölçülerinin birbirleri ile ve canlı ağırlık arasındaki tüm korelasyon
katsayıları önemli bulunmuştur (P<0.01). Canlı ağırlık ile en yüksek korelasyona sıkrotum
hacmi sahip olurken bunu sırasıyla sıkrotum uzunluğu, sol testis uzunluğu, sağ testis
uzunluğu, sol testis çapı, sağ testis çapı ve sıkrotum çevresi izlemiştir.
Vücut Ölçüleri
Sürüdeki koyunlar, koç katım öncesi yukarıda belirtilen özelliklere ek olarak vücut
kondisyon puanları bakımından da değerlendirilmiş ve özellikler arasındaki korelasyon
katsayıları Çizelge 14’de verilmiştir. Buna göre canlı ağırlık ile en yüksek korelasyon göğüs
çevresi arasında bulunmuş (0.843) olup, bunu sırasıyla vücut uzunluğu (0.663), göğüs
derinliği (0.584), sağrı yüksekliği (0.558) ve göğüs genişliği (0.557) izlemiştir. Vücut
kondisyon puanı ile diğer özellikler (sağrı yüksekliği ve cidago yüksekliği hariç) arasındaki
korelasyonlar istatistiksel olarak önemli olsa da nispeten küçük olarak belirlenmiştir.
Çizelge 14. Bandırma koyunlarında koç katım öncesi canlı ağırlık, vücut kondisyon puanı ve
bazı vücut ölçüleri arasındaki korelasyon katsayıları
VKP
SAĞ_YÜK CİD_YÜK VÜC_UZ GÖĞ_GEN GÖĞ_DER GÖĞ_ÇEV
Genel
CAĞR
0.410**
0.558**
0.247**
0.663**
0.557**
0.584**
0.843**
**
**
**
VKP
0.100
-0.006
0.227
0.261
0.162
0.371**
SAĞ_YÜK
0.566**
0.411**
0.227**
0.386**
0.446**
**
**
CİD_YÜK
0.269
0.094
0.180
0.171**
VÜC_UZ
0.304**
0.387**
0.537**
**
GÖĞ_GEN
0.287
0.552**
GÖĞ_DER
0.500**
*
P<0.05, **P<0.01,
CAĞR: canlı ağırlık, VKP: vücut kondisyon puanı, SAĞ_YÜK: sağrı yüksekliği, CİD_YÜK: cidago yüksekliği,
VÜC_UZ: vücut uzunluğı, GÖĞ_GEN: göğüs genişliği, GÖĞ_DER: göğüs derinliği, GÖĞ_ÇEV: göğüs çevresi
Bandırma koyunlarında koç katım öncesi tespit edilen cidago yüksekliği, Akkaraman
(Yıldız ve Denk, 2006; Esen ve Yıldız, 2000), İvesi (Şeker ve Kul, 2000), Zom (Koncagül ve
ark., 2012), Morkaraman ve İvesi (Kaymakçı ve Sönmez, 1992), Karagül (Erol ve Akçadağ,
2009), Gıcık (Çimen ve ark., 2003), Acıpayam Koyunu (Özbaşer ve Akçapınar, 2011),
Dağlıç, Karayaka, Gökçeada, Kıvırcık (Kaymakçı ve Sönmez, 1992) için bildirilen
değerlerden yüksek bulunmuştur. Diğer taraftan, Alman Et Merinosu, Karacabey Merinosu
(Gürcan ve Akçapınar, 2006), Norduz (Bingöl, 1998) ve Sakız (Kaymakçı ve Sönmez, 1992)
için bildirilen değerlere benzer bulunmuştur.
Bu araştırmada tespit edilen vücut uzunluğu, Akkaraman (Esen ve Yıldız, 2000, Yıldız
ve Denk, 2006), Morkaraman (Ulusan ve Aksoy, 1996), Karakaş (Gökdal ve ark., 2000), İvesi
(Şeker ve Kul, 2000) ve Zom (Koncagül ve ark., 2012) için bildirilen değerlerden yüksek
bulunmuştur. Sağrı yüksekliği bakımından elde edilen değerler Akkaraman (Esen ve Yıldız,
2000; Yıldız ve Denk, 2006; Özbaşer ve Akçapınar, 2011) için bildirilen değerlerden yüksek
bulunmuştur.
95
Göğüs genişliği özelliği için elde edilen bu değerler Akkaraman koyunlarında daha
önceden bildirilen kimi araştırmalarda (Şireli, 1996; Esen ve Yıldız, 2000), İvesi (Şeker ve
Kul, 2000), Gıcık (Çimen ve ark, 2003) ve Zom (Koncagül ve ark., 2012) için bildirilen
değerlerden yüksek bulunmuştur. Göğüs çevresi özelliği bakımından elde edilen değerler
Akkaraman (Esen ve Yıldız, 2000; Yıldız ve Denk, 2006), Morkaraman (Ulusan ve Aksoy,
1996), İvesi (Şeker ve Kul, 2000) ve Karakaş (Gökdal ve ark., 2000) koyunu için bildirilen
değerlere benzer bulunmuştur. Göğüs derinliği özelliği bakımından elde edilen değerler
Acıpayam (Özbaşer ve Akçapınar, 2011) koyunundan yüksek, Akkaraman (Pekel, 1968) ve
Zom (Koncagül ve ark., 2012) koyunu için bildirilen değerlere benzer bulunurken, Gıcık
(Çimen ve ark., 2003), Karagül (Erol ve Akçadağ, 2009), Alman Et Merinosu ve Karacabey
Merinosu (Gürcan ve Akçapınar, 2006) ve Norduz (Bingöl, 1998) için bildirilen değerlerden
düşük bulunmuştur.
Sağrı yüksekliği daha önceden yapılan araştırmalarda Karagül (Erol ve Akçadağ,
2009), Acıpayam (Özbaşer ve Akçapınar, 2011) ve Gıcık (Çimen ve arkç, 2003) koyunları
için bildirilen değerlerden yüksek bulunurken, Zom (Koncagül ve ark, 2012) koyunu ile
benzer değerlere sahip olmuştur.
Özelliklerin koç katım öncesi farklı yaşlar bakımından karşılaştırmaları Çizelge 15’de
verilmektedir. Buna göre, genel olarak canlı ağırlık, vücut kondisyon puanı, sağrı yüksekliği,
cidago yüksekliği, vücut uzunluğu, göğüs genişliği, göğüs derinliği ve göğüs çevresi sırasıyla,
49.12 kg, 2.24, 68.43 cm, 68.56 cm, 68.20 cm, 23.07 cm, 29.74 cm ve 89.93 cm olarak tespit
edilmiştir. İncelenen tüm özellikler üzerine yaşın etkisi önemli bulunmuştur (P<0.05).
96
Çizelge 15. Bandırma koyunlarında 2012 yılı koç katım öncesi vücut kondisyon puanları ve vücut ölçülerinin yaşa göre ortalama ve standart
hataları
CAĞR
VKP
SAĞ_YÜK
CİD_YÜK
VÜC_UZ
GÖĞ_GEN
GÖĞ_DER
GÖĞ_ÇEV
Yaş
N
X ± SX
X ± SX
a
X ± SX
ab
X ± SX
a
X ± SX
a
X ± SX
a
X ± SX
a
X ± SX
a
1.5
109
43.73±0.470
2.21±0.045
67.47±0.282
67.65±0.278
66.20±0.327
22.37±0.136
28.32±0.138
86.55±0.394a
2.5
75
48.53±0.624b
2.35±0.081ab
68.43±0.310ab
68.65±0.330ab
68.29±0.361b
22.79±0.330a
29.64±0.144b
89.88±0.557b
3.5
29
54.43±1.084c
2.48±0.158a
69.07±0.460ab
69.07±0.457ab
69.86±0.619bc
24.24±0.256b
29.97±1.062bc
94.21±1.031cd
4.5
19
54.44±1.741c
2.34±0.158ab
69.11±0.772ab
69.68±0.927ab
69.79±0.778bc
24.26±0.323b
31.00±0.315bc
93.26±1.279cd
5.5
25
53.82±1.241c
2.24±0.136ab
68.88±0.494ab
67.40±2.566ab
68.40±0.666bc
23.48±0.342ab
31.40±0.216c
92.48±0.926cd
6.5
35
54.42±1.089c
2.04±0.111ab
69.74±0.356b
70.37±0.389b
70.51±0.438c
23.97±0.300b
31.37±0.217c
92.83±0.881cd
7.5
21
52.70±1.342c
1.90±0.149b
69.29±0.493ab
69.52±0.546ab
70.38±0.745bc
23.10±0.384ab
31.33±0.311c
90.86±1.219b
Genel 313
49.12±0.407
2.24±0.037
68.43±0.158
68.56±0.259
68.20±0.204
23.07±0.116
29.74±0.139
89.93±0.312
a,b,c,d,e
Aynı sütunda farklı üstsel harfleri taşıyan ortalamalar birbirinden farklıdır (P<0.05)
CAĞR: canlı ağırlık, VKP: vücut kondisyon puanı, SAĞ_YÜK: sağrı yüksekliği, CİD_YÜK: cidago yüksekliği, VÜC_UZ: vücut uzunluğı,
GÖĞ_GEN: göğüs genişliği, GÖĞ_DER: göğüs derinliği, GÖĞ_ÇEV: göğüs çevresi
97
Yapağı Özellikleri
Bandırma koyunlarının kırkım canlı ağırlığı ve bazı yapağı özelliklerine ilişkin
tanımlayıcı istatistikler Çizelge 16’ da verilmiştir.
Çizelge 16. Bandırma koyunlarında bazı yapağı özelliklerine ait tanımlayıcı istatistikler
Değişken
N
X±S
x
En Az
En Çok
31.20
1.45
20.80
22.80
20.66
10.71
6.71
32.00
95.00
6.00
52.00
79.00
39.00
41.31
32.96
73.20
CAĞR (kg)
117
53.22 ± 1.046
K.Y.Ağr. (kg)
117
3.71 ± 0.081
Uzunluk_H (mm)
117
32.55 ± 0.503
Uzunluk_B (mm)
117
45.70 ± 0.888
İncelik (mikron)
117
30.42 ± 0.329
Elastikiyet (%)
117
25.77 ± 0.586
Mukavemet (Cn/Tex)
117
16.67 ± 0.500
Randıman (%)
117
58.96 ± 0.681
CAĞR: canlı ağırlık, K.Y.Ağr.: kirli yapağı ağırlığı
Varyasyon
Katsayısı (%)
21.26
23.57
16.70
21.01
11.69
24.60
32.45
12.49
Çizelge incelendiğinde kırkım canlı ağırlığı ortalama 53.22 kg, kirli yapağı veriminin
ise ortalama 3.71 kg olmuştur. Yapağı özelliklerinden, elyaf sayısına göre belirlenen uzunlukH ve elyaf hacim ve ağırlığına göre belirlenen uzunluk-B değerleri sırasıyla ortalama 32.55 ve
45.70 mm olarak tespit edilirken, incelik, elastikiyet, mukavemet ve randıman için elde edilen
değerler sırasıyla 30.42 μ, %25.77, 16.67 Cn/Tex ve %58.96 olarak tespit edilmiştir.
Elde edilen bu değerlerden yapağının morfolojik özelliklerinden en önemlisi olan
incelik Bandırma koyunlarının 30.42 mikron incelik ile Karayaka, Karagül, Gökçeada ve
Sakız, Norduz ve Acıpayam koyunlarına göre daha ince(Koyuncu ve ark.(1999), Erol ve
Akçadağ (2009), Çörekçi ve Evrim(2000), Yılmaz ve Denk(2004), Yüceer ve ve ark. (2010)),
Örkiz M(1975), Oğan M(1988) ve Başpınar ve ark.(1993) Karacabey ve Anadolu Merinosları
için bildirmiş oldukları sonuçlardan yüksek bulunmuştur.
Çizelge 17. Bandırma koyunlarında bazı yapağı özellikleri arasındaki korelasyon katsayıları
K.Y.Ağr.
(kg)
0.326**
Uzunluk_H
(mm)
0.085
0.325**
Uzunluk_B
(mm)
0.022
0.344**
0.913**
İncelik
(mikr.)
0.058
0.100
0.548**
0.540**
CAĞR (kg)
K.Y.Ağr. (kg)
Uzunluk_H (mm)
Uzunluk_B (mm)
İncelik (mikron)
Elastikiyet (%)
Mukavemet
(Cn/Tex)
**
P<0.01. *P<0.05. CAĞR: canlı ağırlık. K.Y.Ağr.: kirli yapağı ağırlığı
Elastikiyet
(%)
0.133
-0.043
0.376**
0.471**
0.311**
Mukavemet
(Cn/Tex)
-0.081
0.063
0.593**
0.628**
0.811**
0.585**
Randıman
(%)
-0.103
0.049
0.227*
0.328**
0.307**
0.200*
0.245**
Bandırma koyunlarının canlı ağırlık ve yapağı özellikleri arasındaki korelasyonların
incelendiği Çizelge 17 değerlendirildiğinde, canlı ağırlık ile sadece kirli yapağı ağırlığı
arasında ilişki önemli düzeyde bulunmuştur. Yapağı randımanı ile canlı ağırlık ve kirli yapağı
ağırlığı dışındaki tüm özellikler arasında pozitif ve önemli bir ilişki saptanmıştır. Yapağının
morfolojik özelliklerinden en önemlisi incelik ile canlı ağırlık ve kirliyapağı verimi hariç
diğer tüm özellikler arasındaki ilişki pozitif yönde ve önemlidir.
98
Çizelge 18. Bandırma koyunlarında canlı ağırlık ve bazı yapağı özelliklerine ait ortalamalar ve standart hatalar
CAĞR
K.Y.Ağr. Uzunluk_H Uzunluk_B İncelik
Elastikiyet Mukavemet Randıman
(kg)
(kg)
(mm)
(mm)
(mikron)
(%)
(Cn/Tex)
(%)
X ± Sx
X ± Sx
X ± Sx
X ± Sx
X ± Sx
X ± Sx
X ± Sx
X ± Sx
N
4.2±0.17a
33.1±1.11 45.9±1.75 29.7±0.56 24.1±1.14 14.8±0.82a 58.0±1.35
Cinsiyet Erkek 33 63.8±2.05a
b
b
Dişi 84 49.1±0.87
3.5±0.08
32.3±0.55 45.6±1.03 30.7±0.40 26.4±0.67 17.4±0.60b 59.3±0.79
1
42 53.7±2.06
4.2±0.15a 33.6±0.90 47.8±1.64 29.4±0.41a 23.7±0.98a 15.3±0.81 58.4±0.98
Yaş
2
15 48.9±2.53 3.3±0.14bc
31.1±1.66 44.6±2.64 30.8±1.08ab 25.6±1.50ab 17.1±1.77 62.8±2.02
b
3
19 55.9±3.28
3.6±0.16
31.4±1.14 43.4±1.87 31.2±0.86ab 26.4±1.46ab 17.1±1.12 61.0±1.65
4
16 51.9±1.74 3.9±0.13ab
35.0±1.26 49.0±2.38 32.3±0.96b 27.3±1.50ab 19.2±1.29 56.4±2.36
c
5
13 52.7±2.48
3.1±0.20
31.1±1.11 42.4±2.20 31.4±0.88ab 26.5±1.94ab 18.1±1.48 57.2±1.34
6
12 55.2±1.56
3.1±0.21c
30.5±1.10 42.4±1.99 28.8±1.15ab 29.8±1.36b 15.6±1.29 58.1±2.37
a,b,c
Aynı sütunda aynı faktör seviyelerinde farklı harfleri taşıyan ortalamalar birbirinden farklıdır P<0.05)
CAĞR: canlı ağırlık. K.Y.Ağr.: kirli yapağı ağırlığı
99
Çizelge 18’de canlı ağırlık, kirli yapağı verimi ve yapağı özelliklerinin cinsiyet ve yaşa
göre ortalamaları verilmiştir. İncelenen özelliklerinden canlı ağırlık, kirli yapağı ağırlığı ve
mukavemetin cinsiyet ile birlikte önemli(P<0.05) oranda farklılaştığı, diğer özelliklerin
önemli oranda değişmediği tespit edilmiştir (P>0.05). Yaş faktörünün etkisi incelendiğinde;
kirli yapağı verimi, incelik ve elastikiyet önemli oranda etkilenirken (P<0.05), diğer özellikler
yaş ile birlikte önemli oranda değişim göstermemiştir (P>0.05).
SONUÇ
Sonuçlandırılan bu proje ile Bandırma koyunlarının büyüme, döl verimi, süt verimi,
besi performansı, kesim ve karkas özellikleri, testis özellikleri, vücut ölçüleri ve yapağı
özellikleri incelenerek ortaya koyulmuştur.
İncelenen tüm bu özellikler açısından Bandırma Koyununun yeterli görüldüğü,
Marmara Bölgesi şartlarında rahatlıkla yetiştirilebileceği kanaatine varılmıştır. Elde edilen
sonuçlardan, Bandırma koyununun geliştirilmesinde ki asıl hedefi oluşturan alternatif etçi bir
koyun geliştirme çalışmalarının doğru yolda olduğunu söylemek mümkündür. Ayrıca elde
edilen bu tüm bu veriler ışığında, devam eden çalışmalarda daha isabetli bir seleksiyon
yapılabilmesi mümkün olacaktır.
100
T.C.
GIDA, TARIM VE HAYVANCILIK BAKANLIĞI
Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü
PROJE SONUÇ RAPORU
PROJE ADI
KIL KEÇİSİ VE HONAMLI TİPİ KIL KEÇİSİ OĞLAKLARININ BESİ PERFORMANSI,
KESİM VE KARKAS ÖZELLİKLERİ
PROJE NO
PROJE YÜRÜTÜCÜLERİ
Bekir GÖK
Dr. Ahmet Hamdi AKTAŞ
Prof. Dr. Mehmet Emin TEKİN
İbrahim HALICI
Hüseyin BAŞ
Hakan ERDURAN
Dr. Şükrü DURSUN
Uğur DEMİRCİ
YÜRÜTÜCÜ KURULUŞ
Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü Müdürlüğü
AY/YIL
Aralık 2013
İL
KONYA
101
Kısaltma Tanımları:
CA: Canlı Ağırlık, TCAA: Toplam Canlı Ağırlık Artışı, GCCA: Günlük Canlı Ağırlık Artışı,
GYT: Günlük Yem Tüketimi, KMT: Kuru Madde Tüketimi, YYD: Yemden Yararlanma
Değeri
Özet:
Bu araştırma, ıslah çalışması yürütülen sürülerdeki Kıl Keçisi ve Honamlı tipi Kıl
Keçisi oğlaklarının besi performansları ve bazı kesim ve karkas özelliklerinin karşılaştırmalı
olarak araştırılması amacıyla yapılmıştır.
Projenin hayvan materyali “Halk Elinde Ülkesel Küçükbaş Hayvan Islahı Projesi”
kapsamında Konya İlinde yürütülen alt projelerdeki Kıl Keçisi ve Honamlı Keçisi
sürülerinden temin edilmiştir. Bu amaçla, her iki genotipten 3-5 yaşlı analardan birbirine
yakın tarihlerde doğan 30’ar baş tekiz erkek oğlak sütten kesildikten sonra (75±5 günlük yaş)
yetiştiriciden satın alınarak Bahri Dağdaş Uluslararası Tarımsal Araştırma Enstitüsü’ne
getirilmiştir. Enstitü’ ye getirilen iki genotipe ait oğlaklar, her grupta 10 baş olacak şekilde
şansa bağlı olarak üç gruba ayrılmış ve üç farklı besi süresince (60, 80 ve 100 gün)
beslenmiştir. Besi süreleri sonunda her iki genotipteki oğlaklardan grup ortalamasına en yakın
olan 6’şar başı kesilerek kesim ve karkas özellikleri incelenmiştir.
Oğlaklar on beş günlük alıştırma periyodu sonrası 3 farklı besi süresi (60, 80 ve 100
gün) boyunca %15,1 ham protein ve 2640 kkal metabolik enerji içeren besi rasyonu ve kuru
yonca otu ile gruplar halinde beslenmiştir. Oğlaklara hem kesif hem de kuru yonca otu ad
libitum olarak verilmiştir. Denemede besi başı, 20, 40 ve 60, 80 ve 100. gün canlı ağırlıkları
(CA) ve günlük canlı ağırlık artışları (GCAA) Honamlı oğlaklarında sırasıyla 17.5, 20.8, 24.7,
28.6, 33.5, 39.2 kg ve 167, 193, 197, 185, 242, 288 g; Kıl Keçisi oğlaklarında ise 13.4, 16.8,
21.2, 26.0, 30.8, 36.1 kg ve 168, 223, 237, 209, 244, 266 g olarak bulunmuştur. Besinin farklı
dönemlerinde günlük canlı ağırlık artışları bakımından genotipler arasındaki farklar önemsiz
olmuştur.
Honamlı ve Kıl Keçisi oğlaklarının kesim ağırlığı, sıcak ve soğuk karkas oranları ile iç
yağı ve böbrek-leğen yağı oranları 60. Günde sırasıyla 25.9 kg, %44.3, %43.2, %0.9, %1.03;
25.0 kg, %45.5, %44.4, %0.9, %1.16 olarak, 80. Günde 33.6 kg, %47.0, %45.9, %1.0, %1.46;
29.4, %47.4, %46.4, %0.9, %1.48 olarak, 100. Günde ise 38.8 kg, %49.6, %48.2, %1.8,
%2.13; 34.6 kg, %48.6, 47.2, %2.1, %2.35 olarak tespit edilmiştir. İncelenen kesim ve karkas
özelliklerinden 60. günde sadece ayak ağırlıkları ve oranları ile testis oranları arasındaki
farklar önemli bulunmuştur (P<0.05). 80. günde kesim, sıcak karkas ve ayak ağırlıkları, göğüs
derinliği, karkas, dış ve iç but uzunlukları, soğuk karkas, testis, yarım karkas, but ve boyun
ağırlıkları arasındaki farklar önemli bulunmuştur (P<0.05). Yüzüncü günde ise kesim ve sıcak
karkas ağırlıkları, baş oranı, karkas uzunluğu, but çevresi, soğuk karkas ve testis ağırlıkları,
testis oranları, yarım karkas, kol ve etek ağırlıkları arasındaki farklar önemli bulunmuştur
(P<0.05). Her 3 kesim zamanında da incelenen diğer kesim ve karkas özellikleri arasındaki
farklar ise önemsiz olmuştur.
Sonuç olarak, Honamlı Keçisi ve Kıl Keçisi oğlaklarının entansif besi ile kesim ve
karkas özelliklerine ait veriler incelendiğinde her iki genotipte birçok özellik bakımından
birbirine benzer sonuçların elde edildiğini söylemek mümkündür. Diğer bir ifade ile bu iki
genotipin büyüme, entansif besi kabiliyetleri, kesim ve karkas özellikleri bakımından benzer
özelliklere sahip oldukları söylenebilir.
Anahtar kelimeler: Honamlı, Kıl Keçisi, besi, kesim ve karkas özellikleri
102
Giriş:
Farklı ülkeler ekonomik, kültürel ve doğal şartların farklı olması nedeniyle hayvansal
protein gereksinimlerini değişik kaynaklardan karşılamaktadırlar. Türkiye’de ise bu
kaynakların başında koyun, sığır, keçi ve tavuk gelmektedir. Türkiye genelinde keçi
popülasyonunda azalmalar olup, 1976 yılında 14 973 000 baş olan keçi sayısı 2012 yılı
itibariyle 8 357 286 milyon başa (TÜİK, 2012) düşmüş olmasına karşın hayvancılık
ekonomisi içerisinde önem ve değerini sürdürmektedir . Topraklarının azlığı nedeniyle orman
kenarı köylerimizde keçi yetiştiriciliği temel gelir kaynaklarından birisidir (Akbağ ve
Baytekin 2010, Tolunay ve ark. 2010). Türkiye’deki keçi varlığının %96.5’ini Kıl keçilerinin
oluşturduğu ve toplam kırmızı et üretiminde, Kıl keçisi etinin payının % 2.93 ve oğlak-çebiç
(3-12 ay) karkas ağırlığı ortalamasının 13.8 kg olduğu bildirilmektedir (TÜİK 2009).
Hayvansal protein açığımızın kapatılmasında mevcut türlerimizden en üst düzeyde
yararlanmamız gerekmektedir (Düzgüneş ve Eliçin 1986). Bunu gerçekleştirirken insanların
keçi (oğlak) eti hakkındaki önyargılarını ortadan kaldırarak, olumlu yönlerini göstermek
kadar, oğlaklardan et kaynağı olarak yararlanma düşüncesinin de geliştirilmesi ve bu yönde
planlamalar yapılması gerekir (Güney 1997, Morand-Fehr ve ark. 2004).
Ülkemizde Kıl Keçisi ile ilgili bilimsel çalışmalar daha çok döl veriminin ve süt
üretiminin arttırılmasına yönelik melezleme çalışmaları biçiminde olmuştur (Şengonca ve ark.
1998). Bu melezleme çalışmalarında elde edilen melezlerin besi ve karkas özellikleri ile ilgili
çalışmalar az sayıda olduğu gibi, Kıl Keçi oğlaklarına yönelik çalışmalar da sınırlıdır.
Dünyada keçi karkas ortalamasının 12 kg’ı geçmediği düşünülürse (Güney 1997), Türkiye’de
de kaliteli keçi eti üretimi için oğlak eti üretiminin arttırılması gerekmektedir. Türkiye’de
yetiştiricilerin oğlakları erken sütten kesme ya da yapay büyütme gibi bir uygulamaların
olmadığından oğlak eti üretimi, doğal büyütme sonunda, analarıyla meralanan oğlakların
yaklaşık 6-7 aylıkken pazarlanmasıyla gerçekleşir. Bu şekilde yetiştirilen oğlak karkaslarının
ağırlığı ortalama 6-8 kg’dır (Kaymakçı ve Taşkın 2001).
Türkiye’de entansif oğlak besisinin teşvik edilmesi, böylece erken kesim önlenerek
ürün kaybı, geç kesim önlenerek de mera, yem, ilaç, ağıl, iş gücü vb. kaynak kayıplarının
önlenmesi gerektiği bildirilmektedir (Anonim 1996).
Erken yaşta sütten kesilen Kıl Keçisi oğlaklarının entansif koşullardaki besi
performansı ve karkas özelliklerine ilişkin çalışmalar yanında bunların et kalitelerinin
belirlenmesine yönelik çalışmalar da sınırlı sayıdadır. Honamlı Keçisi oğlaklarının besi
performansı ve karkas özellikleri ile ilgili bir çalışma ise bulunmamaktadır. Ülkemizin
Akdeniz ve İç Anadolu’nun Toros Dağları eteklerinde keçicilik ile geçinen halk arasında
Honamlı Keçisinin varlığı bilinmekte ve birçok özellik bakımından da Kıl Keçisinden daha
üstün olduğu düşünülmektedir. Fakat bu ırkın bilimsel olarak entansif şartlardaki besi
performansı ile kesim ve karkas özellikleri tam olarak ortaya konmamış ve Kıl Keçileri ile
aynı şartlarda karşılaştırılmamıştır. Bu çalışma ile Honamlı Keçisi oğlakları ile ilgili önemli
bilgiler edinilmiş olup bu ırkın hak değeri kazanmasına yardımcı olacağı düşünülmektedir.
Bu araştırma, ıslah çalışması yürütülen sürülerdeki Kıl Keçisi ve Honamlı tipi Kıl
Keçisi oğlaklarının besi performansları ve bazı kesim ve karkas özelliklerinin karşılaştırmalı
olarak araştırılması amacıyla yapılmıştır.
Materyal ve Metot:
Projenin hayvan materyali “Halk Elinde Ülkesel Küçükbaş Hayvan Islahı Projesi”
kapsamında alt proje olarak Konya İlinde yürütülen Kıl Keçisi (Taşkent İlçesi) ve Honamlı
Keçisi (Beyşehir ve Derebucak ilçeleri) Projelerinden sağlanmıştır. Projede, Kıl Keçisi ve
Honamlı tipi Kıl Keçisi oğlakları kullanılmıştır. Bu amaçla her genotipten 3-5 yaşlı analardan
doğan 30 baş tekiz erkek oğlak, sütten kesildikten sonra (75 günlük yaş) Bahri Dağdaş
Uluslararası Tarımsal Araştırma Enstitüsü’ne getirilmiştir. Enstitü’ ye getirilen iki genotipe ait
oğlaklar, her grupta 10 baş olacak şekilde şansa bağlı olarak üç gruba ayrılmış ve üç farklı
103
besi süresince (60, 80 ve 100 gün) beslenmiştir. Belirlenen hedef besi sürelerine ulaşan
oğlaklardan grup ortalamasına en yakın 6’şar oğlak kesilerek kesim ve karkas özellikleri
incelenmiştir. Besleme grup beslemesi tarzında yapılmıştır. Oğlaklar iç ve dış parazit
mücadelesi uygulandıktan ve 15 günlük alıştırma döneminden sonra besiye alınmıştır. Besi
başında tüm oğlaklar 2 gün üst üste sabahları aynı saatte aç karnına tartılarak besi başlangıç
ağırlıkları belirlenmiştir.
Hesaplanmış besin madde miktarları Tablo 1’de verilen oğlak besi yemi ve kuru yonca
otu ad libitum olarak verilmiştir. Ayrıca, yemliklerde kaya tuzu, mineral yalama taşları ve
suluklarda temiz içme suyu sürekli olarak bulundurulmuştur. Yemlikte kalan yemler ve otlar
her üç günde bir toplanıp tartılmıştır. Yirmi günde bir aç karına yapılan tartımlarla CA,
GYT’leri ve YYD’leri belirlenmiştir. Her gruptan hedef besi süresine ulaşan ve grup
ortalamasına en yakın olan 6 baş oğlak kesime tabi tutulmuşlardır.
Kesimden önce hayvanların kesim ağırlıkları ile vücut ölçüleri belirlenmiş, kesimden
sonra ise sıcak karkas, baş, deri, dört ayak, yürek+ciğerler (takım) ile iç yağı ağırlıkları tespit
edilmiştir. Elde edilen karkaslar +4 °C’de 24 saat süre ile dinlendirildikten sonra soğuk karkas
ağırlığı, böbrek, böbrek ve leğen yağları ile testis ağırlıkları belirlenmiş ve karkas ölçüleri
alınmıştır. Daha sonra karkaslar, Colomer-Rocher ve ark. (1987)’nin bildirdiği esaslara göre
parçalanarak karkas parçalarının ağırlıkları tespit edilmiş ve sol yarım karkasın 6-12.
kaburgaları arasından alınan pirzola örneğinde et, kemik, kabuk yağı, kasarası yağı, toplam
yağ ve atılan kısımların miktarları belirlenerek oranları hesaplanmıştır. Elde edile değerlerden
karkas randımanı, soğutma firesi, karkas parçaları ile çeşitli yan ürünlerin oranları
belirlenmiştir.
Araştırmadan elde edilen veriler tek yönlü varyans analizi metodu ile analiz edilmiştir.
Farklı besi sürelerine ait veriler birbirinden bağımsız olarak analize tabi tutulmuştur. Kıl
Keçisi ve Honamlı Keçisi oğlaklarının besi başı CA’ları arasındaki (genotip ya da çevreden
kaynaklandığı düşünülen) farklılıklar önemli bulunduğu için kovaryans analizi de yapılmıştır.
Farklı ortalamaların karşılaştırılması ise Tukey Testi ile yapılmıştır.
Tablo 1. Beside oğlaklara verilen yem maddeleri ve hesaplanmış besin maddeleri
Yem Hammaddeleri*
Miktarı, %
Hesaplanmış Besin Maddeleri, %
Arpa
20.00
Kuru Madde
89.00
Buğday
15.00
Ham Protein
15.10
Mısır
16.00
Metabolik Enerji, kkal/kg
2640
Razmol
13.50
Kalsiyum
1.04
Fosfor
0.51
Ham Selüloz
4.91
Bonkalite
Pamuk Tohumu Küspesi
Soya Küspesi
DDGS
Melas
Mermer Tozu
Tuz
Vit.-Min. Karması*
Toplam
5.00
7.00
5.00
10.00
5.00
2.60
0.80
0.10
* Vitamin Mineral Karmasının 1 kg’ ı: 15 000
000 IU vitamin A; 3 000 000 IU vitamin D3; 30
000 mg vitamin E; 50 000 mg Mn; 50 000 mg Fe;
50 000 mg Zn; 10 000 mg Cu; 150 mg Co; 800
mg I ve 150 mg Se içerir.
100.0
*:Besi yemi pelet olarak özel bir yem fabrikasına hazırlatılmıştır.
Bulgular: Araştırmadan elde edilen bulgulardan, besinin farklı dönemlerinde oğlakların canlı
ağırlıkları Tablo 2 ve 3’de, günlük ortalama canlı ağırlık artışları Tablo 4’de, günlük yem
tüketimleri ve yemden yararlanma değerleri Tablo 5’de, kesim özellikleri Tablo 6’da, karkas
104
ölçüleri Tablo 7’de, karkas özellikleri Tablo 8’de, sol yarım karkasta parçaların ağırlıkları ve
oranları Tablo 9’da, pirzolada (bel) doku ağırlıkları ve oranları ise Tablo 10’da verilmiştir.
Kıl Keçisi ve Honamlı Keçisi oğlaklarının besi başı, 20 ve 40. Günlerdeki CA’ları
arasında genotipten kaynaklanan önemli seviyede (P<0.05-0.01) farklılıklar bulunmuş, fakat
besi başı CA’ları kovaryans olarak modele dahil edildiğinde genotipler arasındaki farklılıklar
önemsiz olmuştur (Tablo 2 ve 3). GCAA’ları incelendiğinde, istatistiki olarak önemli olmasa
da 60. Güne kadar Kıl Keçisi oğlaklarının daha hızlı büyüdüğü görülmektedir. Besinin son 20
gününde ise istatistiki olarak önemli olmasa da Honamlı oğlakları daha hızlı büyümüşlerdir
(Tablo 4). Besinin genelinde Kıl Keçisi oğlakların günlük yem tüketimleri Honamlı
oğlaklarından biraz düşük olmasına rağmen, besinin son dönemi hariç, yemden yararlanmaları
daha iyi olmuştur (Tablo 5).
Kesim özellikleri incelendiğinde 60. Günde sadece ayak ağırlığı ve oranı Honamlı
oğlaklarında önemli seviyede yüksek bulunmuş, 80 ve 100. Gündeki kesim ve sıcak karkas
ağırlıkları ile 80. Gündeki ayak ağırlığı Honamlı oğlaklarında önemli seviyede daha yüksek
bulunmuştur. Kıl Keçisi oğlaklarının 100. Gündeki baş ağırlığı ile takım oranları Honamlı
oğlaklarından önemli seviyede daha yüksek tespit edilmiştir. Denemenin genelinde, oranlar
arasında (ayak, baş ve takım oranları hariç) genotipler arasında önemli bir farklılık tespit
edilmemiştir (Tablo 6).
Karkas ölçüleri incelendiğinde 60. Günde genotipler arasındaki farkılıkların önemsiz
olduğu, 80. Günde ise göğüs derinliği, karkas uzunluğu ve but uzunluklarının Honamlı
oğlaklarında önemli seviyede daha yüksek olduğu, 100. Günde ise karkas uzunluğu ve but
çevresinin Honamlı oğlaklarda daha fazla olduğu görülmektedir (Tablo 7).
Karkas özellikleri bakımından 60. Günde sadece testis oranında Honamlı lehine
önemli seviyede bir farklılık tespit edilirken, 80. Günde soğuk karkas ağırlıkları ve testis
ağırlıkları Honamlı oğlaklarda önemli seviyede yüksek bulunmuştur. 100. Günde ise yine
soğuk karkas ağırlıkları ve testis ağırlıkları ve oranları Honamlı oğlaklarında önemli seviyede
yüksek olmuştur (Tablo 8).
Sol yarım karkas parçalarının ağırlıkları ve oranları incelendiğinde 60. Günde
genotipler arasında önemli seviyede bir farklılık tespit edilmemiştir. 80. Günde yarım karkas,
but ve boyun ağırlıkları Honamlı oğlaklarda önemli seviyede yüksek olmuştur. 100. Günde
ise yarım karkas, kol, but ve etek ağırlıkları arasındaki farklar Honamlı oğlaklarda önemli
seviyede yüksek bulunmuştur (Tablo 9).
Pirzoladaki (bel) doku ağırlıkları ve oranları bakımından her 3 kesim döneminde de
genotipler arasında önemli seviyede bir farklılık tespit edilememiştir (Tablo 10).
Tablo 2. Besinin farklı dönemlerinde oğlakların canlı ağırlıkları, kg
Özellikler
n
BBCA
20. Gün
40. Gün
60. Gün
Ort. ± SH
Ort. ± SH
Ort. ± SH
Ort. ± SH
n
80. Gün
Ort. ± SH
100. Gün
n
Ort. ± SH
Honamlı
30 17.5 ± 0.62
20.8 ± 0.71
24.7 ± 0.96
28.6 ± 1.08
20
33.5 ± 1.27
10 39.2 ± 1.40
Kıl Keçisi
30 13.4 ± 0.62
16.8 ± 0.71
21.2 ± 0.96
26.0 ± 1.08
20
30.8 ± 1.27
10 36.1 ± 1.40
0.019
0.097
P
0.001
0.001
0.161
0.137
BBCA =Besi başı canlı ağırlık, Ort. :Ortalama, SH: standart hata
Tablo 3. Besinin farklı dönemlerinde oğlakların canlı ağırlıkları, kg
Özellikler
20. Gün
Ort. ± SH
Honamlı
18.6 ± 0.30
Kıl Keçisi
19.0 ± 0.30
P
0.519
BBCA için kovaryans: 15.5±0.22 kg
40. Gün
Ort. ± SH
22.0 ± 0.65
23.9 ± 0.65
0.095
60. Gün
Ort. ± SH
25.8 ± 0.86
28.8 ± 0.86
0.054
80. Gün
Ort. ± SH
30.5 ± 1.17
33.8 ± 1.17
0.107
100. Gün
Ort. ± SH
36.3 ± 1.41
39.0 ± 1.41
0.262
105
Tablo 4. Besinin farklı dönemlerinde oğlakların günlük ortalama canlı ağırlık artışları, g
Özellikler
0-20. Gün
Ort. ± SH
Honamlı
167 ± 11.7
Kıl Keçisi
168 ± 11.7
P
0.964
Ort. :Ortalama, SH: standart hata
20-40. Gün
Ort. ± SH
193 ± 20.0
223 ± 20.0
0.294
40-60.Gün
Ort. ± SH
197 ± 18.7
237 ± 18.7
0.148
0-60.Gün
Ort. ± SH
185 ± 11.7
209 ± 11.7
0.168
60-80. Gün
Ort. ± SH
242 ± 18.2
244 ± 18.2
0.924
80-100. Gün
Ort. ± SH
288 ± 15.7
266 ± 15.7
0.323
Tablo 5. Besinin farklı dönemlerinde oğlakların günlük yem tüketimleri ve yemden yararlanma değerleri
0-60. Gün
Honamlı
Kıl Keçisi
30
30
0.336
0.352
0.605
0.538
0.941
0.890
64.3
60.4
0.837
0.792
3.64
3.96
5.09
4.26
Özellikler
Oğlak Sayısı
Günlük Kesif Yem Tüketimi, kg
Günlük Kaba Yem Tüketimi, kg
Günlük Yem Tüketimi, kg
Kaba Yem Tüketim Oranı, %
Günlük Kuru Madde Tüketimi, kg
Canlı Ağırlığın %'si olarak KMT
Yemden Yararlanma Değeri
KMT: Kuru madde tüketimi
60-80. Gün
Honamlı
Kıl Keçisi
20
20
0.943
0.805
0.442
0.463
1.385
1.268
31.9
36.5
1.233
1.129
3.98
4.03
5.72
5.20
80-100. Gün
Honamlı
Kıl Keçisi
10
10
1.106
1.079
0.569
0.475
1.675
1.554
34.0
30.6
1.490
1.383
4.14
4.19
5.81
5.86
Tablo 6. Kesim Özellikleri*
Kesim Zamanı
Özellikler
60. Gün
80. Gün
Honamlı Kıl Keçisi
Honamlı Kıl Keçisi
Ort.
Ort.
SH
P
Ort.
Ort.
SH
P
Kesim Ağırlığı, kg
25.9
25.0
0.73 0.381
33.6
29.4
1.01 0.016
Sıcak karkas ağırlığı, kg
11.5
11.4
0.28 0.803
15.8
13.9
0.47 0.020
Sıcak karkas oranı, %
44.3
45.5
1.52 0.139
47.0
47.4
0.52 0.634
İç Yağ ağırlığı, g
237
228
16.9 0.703
350
282
68.4 0.496
İç Yağ oranı, %
0.9
0.9
0.05 0.996
1.0
0.9
0.19 0.758
Deri ağırlığı, kg
2.24
2.06
0.07 0.105
2.98
2.75
0.094 0.105
Deri oranı, %
8.7
8.3
0.39 0.475
8.9
9.4
0.32 0.335
Ayak ağırlığı
0.80
0.63
0.03 0.001
1.07
0.84
0.035 0.001
Ayak oranı, %
3.1
2.5
0.16 0.031
3.2
2.9
0.11 0.054
Baş ağırlığı
1.39
1.29
0.06 0.221
1.86
1.71
0.078 0.221
Baş oranı,%
5.4
5.2
0.31 0.570
5.5
5.8
0.27 0.432
Takım ağırlığı, kg
1.12
1.03
0.032 0.074
1.49
1.37
0.043 0.074
Takım oranı, %
4.3
4.1
0.22 0.505
4.4
4.7
0.13 0.259
Ort. :Ortalama, SH: standart hata
*:Kesim zamanları birbirinden bağımsız olarak analiz edilmiştir.
100. Gün
Honamlı Kıl Keçisi
Ort.
Ort.
SH
38.8
34.6
1.08
19.2
16.8
0.62
49.6
48.6
0.60
705
703
76.5
1.8
2.1
0.23
3.64
3.32
0.213
9.4
9.6
0.38
1.11
1.00
0.04
2.9
2.9
0.07
2.23
2.15
0.080
5.8
6.2
0.13
1.66
1.62
0.057
4.3
4.7
0.13
P
0.021
0.019
0.271
0.988
0.469
0.318
0.664
0.061
0.783
0.464
0.031
0.600
0.046
Tablo 7. Karkas Ölçüleri, cm*
Kesim Zamanı
Özellikler
Göğüs Çevresi
Göğüs Derinliği
Göğüs Genişliği
Karkas Uzunluğu
Sağrı Genişliği
But Çevresi
Dış But Uzunluğu
İç But Uzunluğu
60. Gün
80. Gün
Honamlı Kıl Keçisi
Ort.
63.5
22.4
14.1
67.0
15.7
37.7
39.4
32.9
Ort.
63.9
22.5
13.9
67.4
15.9
36.8
38.6
31.5
Ort. :Ortalama, SH: standart hata
100. Gün
Honamlı Kıl Keçisi
SH
0.89
0.35
0.37
0.64
0.34
0.51
0.48
0.67
P
0.708
0.793
0.736
0.722
0.683
0.250
0.279
0.173
Ort.
66.8
25.6
13.9
73.1
13.7
44.8
42.4
32.8
Ort.
65.3
24.8
13.7
70.8
13.6
43.2
39.9
30.1
Honamlı Kıl Keçisi
SH
0.70
0.26
0.31
0.57
0.35
0.73
0.48
0.50
P
0.161
0.048
0.627
0.015
0.767
0.169
0.005
0.003
Ort.
71.1
27.3
15.7
75.8
16.2
46.9
42.9
32.6
Ort.
68.7
26.1
15.2
71.7
16.1
44.6
41.2
31.5
SH
0.95
0.41
0.24
1.07
0.20
0.59
0.72
0.50
P
0.105
0.067
0.183
0.022
0.598
0.018
0.123
0.148
*:Kesim zamanları birbirinden bağımsız olarak analiz edilmiştir.
Tablo 8. Karkas Özellikleri*
Kesim Zamanı
Özellikler
Hon.
Ort.
11.2
43.2
Soğuk Karkas ağırlığı, kg
Soğuk Karkas Oranı, %
Böbrek-Leğen Yağı
115
ağırlığı, g
Böbrek-Leğen Yağı oranı,
1.03
%
Böbrek ağırlığı, g
129
Böbrek oranı, %
1.15
Testis ağırlığı, g
121
Testis oranı, %
1.08
Kuyruk ağırlığı, g
46
Kuyruk oranı, %
0.40
Ort. :Ortalama, SH: standart hata,
60. Gün
Kıl
Ort.
SH
11.1
0.28
44.4
0.53
P
0.823
0.136
Hon.
Ort.
15.4
45.9
80. Gün
Kıl
Ort.
SH
13.7
0.50
46.4
0.50
P
0.033
0.465
Hon.
Ort.
18.7
48.2
100. Gün
Kıl
Ort.
SH
16.3
0.60
47.2
0.60
P
0.020
0.277
132
9.6
0.246
229
207
36.7
0.690
397
375
50.9
0.770
1.16
0.077
0.257
1.46
1.48
0.209
0.944
2.13
2.35
0.310
0.623
125
4.3
0.508
151
141
4.9
0.208
1.10
0.038 0.356
0.97
1.04
0.039 0.278
102
7.8
0.102
208
137
21.2
0.038
0.89
0.058 0.045
1.35
0.98
0.130 0.072
46
3.4
0.973
58
50
2.6
0.054
0.40
0.027 0.992
0.37
0.36
0.017 0.569
*:Kesim zamanları birbirinden bağımsız olarak analiz edilmiştir.
138
0.75
255
1.37
65
0.35
135
0.84
187
1.15
58
0.36
6.10
0.042
16.3
0.068
3.2
0.022
0.707
0.175
0.014
0.049
0.177
0.708
106
Tablo 9. Sol Yarım Karkasta Parçaların Ağırlıkları ve Oranları*
Kesim Zamanı
Özellikler
Hon.
Ort.
5.61
1.21
21.5
0.52
9.2
1.91
34.0
0.48
8.6
0.41
60. Gün
Kıl
Ort.
SH
5.70
0.153
1.21
0.028
21.3
0.27
0.53
0.033
9.2
0.41
1.94
0.050
34.0
0.32
0.47
0.025
8.3
0.50
0.44
0.034
0.47
Yarım karkas
Kol ağırlığı
Kol oranı, %
Etek ağırlığı
Etek oranı, %
But ağırlığı
But oranı, %
Boyun ağırlığı
Boyun oranı, %
Omuz başı ağırlığı
Omuz başı oranı,
7.3
7.6
%
Sırt-bel ağırlığı
1.09
1.12
Sırt-bel oranı, %
19.4
19.6
Ort. :Ortalama, SH: standart hata
80. Gün
100. Gün
Kıl
Ort.
SH
8.07
0.288
1.76
0.059
21.8
0.33
0.89
0.037
11.1
0.41
2.52
0.089
31.2
0.59
0.77
0.049
9.5
0.38
0.58
0.048
P
0.013
0.019
0.394
0.013
0.713
0.017
0.806
0.086
0.840
0.129
7.4
7.2
0.40
0.664
1.80
19.3
1.56
19.2
0.082
0.51
0.066
0.951
P
0.712
0.39
0.688
0.860
0.961
0.677
0.871
0.719
0.653
0.611
Hon.
Ort.
7.73
1.65
21.4
0.72
9.3
2.59
33.5
0.73
9.4
0.55
Kıl
Ort.
6.86
1.50
21.8
0.70
10.2
2.25
32.9
0.62
9.0
0.49
SH
0.232
0.057
0.39
0.042
0.54
0.076
0.54
0.028
0.28
0.024
P
0.024
0.081
0.477
0.701
0.287
0.010
0.419
0.023
0.350
0.110
Hon.
Ort.
9.31
1.99
21.4
1.05
11.3
2.88
31.0
0.90
9.6
0.69
0.693
7.1
7.1
0.19
0.938
0.033 0.628
1.50
1.31
0.061
0.055
0.39
0.770
19.3
19.1
0.33
0.593
*:Kesim zamanları birbirinden bağımsız olarak analiz edilmiştir.
Tablo 10. Pirzolada (Bel) Doku Ağırlıkları ve Oranları*
Kesim Zamanı
60. Gün
Özellikler
Hon.
Kıl
Pirzola ağırlığı, g
Kas ağırlığı, g
Kas oranı, %
Kemik ağırlığı, g
Kemik oranı, %
Kabuk yağı ağırlığı, g
Kabuk yağı oranı, %
Kasarası yağ ağırlığı, g
Kasarası yağ oranı, %
Toplam yağ ağırlığı, g
Toplam yağ oranı, %
Atılan ağırlığı
Atılan oranı, %
Kas/Kemik oranı
Kas/Yağ oranı
Ort.
574
315
55.2
197
34.0
18
3.1
33
5.8
51
8.8
11
1.9
1.7
6.3
Ort.
600
324
53.7
207
34.9
20
3.2
37
6.1
57
9.3
12
2.0
1.6
5.9
80. Gün
SH
37.2
21.6
1.32
14.4
1.44
1.7
0.16
3.3
0.35
4.9
0.48
0.8
0.04
0.11
0.36
P
0.637
0.771
0.445
0.642
0.667
0.465
0.485
0.432
0.517
0.434
0.482
0.304
0.138
0.551
0.393
Hon.
Kıl
Ort.
729
413
56.7
218
29.7
29
4.0
56
7.7
85
11.7
14
1.9
1.9
4.9
Ort.
642
360
56.0
203
31.9
24
3.6
44
6.7
68
10.4
12
1.8
1.8
5.5
100. Gün
SH
36.3
21.7
1.09
12.7
1.17
2.4
0.25
4.2
0.39
6.5
0.63
0.9
0.06
0.11
0.33
P
0.121
0.114
0.630
0.435
0.211
0.140
0.273
0.073
0.115
0.089
0.155
0.162
0.385
0.288
0.252
Hon.
Kıl
Ort.
785
453
57.9
221
28.0
33
4.2
63
8.1
97
12.4
15
1.9
2.1
4.7
Ort.
709
401
56.8
210
29.6
28
3.9
57
7.9
85
11.8
13
1.8
1.9
4.9
SH
37.2
17.9
1.00
14.6
0.97
3.2
0.26
5.4
0.48
8.3
0.68
0.6
0.08
0.10
0.32
P
0.637
0.071
0.465
0.599
0.282
0.315
0.533
0.411
0.821
0.320
0.602
0.062
0.440
0.296
0.617
*:Kesim zamanları birbirinden bağımsız olarak analiz edilmiştir.
Tartışma ve Sonuç:
Canlı Ağırlıklar:
Bu çalışmada Honamlı Keçisi ve Kıl Keçisi oğlaklarının besi başı, 60, 80 ve 100. Gün
CA’ları sırasıyla 17.5, 28.6, 33.5, 39.2 kg; 13.4, 26.0, 30.8, 36.1 kg olarak bulunmuştur. Besi
süresince TCAA’ları ise Honamlı ve Kıl Keçisi oğlaklarında 60, 80 ve 100. Günlerde sırasıyla
11.1, 16.0, 21.7 kg; 12.6, 17.4, 22.7 kg olarak bulunmuştur. Kıl Keçisi ve Honamlı Keçisi
oğlaklarının BBCA’ları arasında (genotip ya da temin edildiği işletmelerden kaynaklanan
nedenlerle) önemli seviyede (P<0.05-0.01) farklılıklar bulunmuştur. Fakat besi başı CA’ları
kovaryans olarak modele dahil edildiğinde 20, 40 ve 60. Gün CA’ları bakımından genotipler
arasındaki farklılıklar önemsiz olmuştur (Tablo 2 ve 3). Diğer bir ifade ile TCAA’ları
bakımından genotipler arasındaki farklılıklar önemsiz bulunmuştur.
Bu çalışmada tespit edilen besi sonu ve besideki TCAA değerleri Atay ve ark. (2007),
Kıl Keçisi erkek oğlaklarının besi gücünü tespit etmek amacıyla yaptıkları 60 günlük
çalışmada elde ettikleri değerlerden (BSCA ve TCAA’ları sırasıyla 19.7, 4.9 kg) daha yüksek
bulunmuştur. Yine mevcut araştırmada 100. günde elde edilen değerler Öztürk ve Deniz’in
(2000), Kıl Keçisi oğlaklarının 98 günlük entansif besisinde buldukları değerlerden (BSCA ve
TCAA’ları sırasıyla 32.3-35.8 ve 10.9-12.8 kg) daha yüksek olmuştur. Şimşek ve
Bayraktar’ın (2007) Kıl Keçisi ve Saanen X Kıl Keçisi (F1) melezlerinde entansif besi
performansını inceledikleri 98 günlük bir çalışmada Kıl Keçisi oğlaklarının BSCA ve
TCAA’ları sırasıyla 32.8 ve 10.8 kg olarak bulunmuştur. Yine mevcut çalışmanın 100.
107
Günündeki değerler bu çalışmanın değerlerinden daha yüksek bulunmuştur. Gökdal ve ark.
(2013) yarı entansif şartlarda 70 gün süren çalışmada Kıl Keçisi oğlaklarında besi sonu CA ve
besi süresince elde edilen toplam CAA sırasıyla 28.9 ve 6.7 kg bulmuşlardır. Araştırıcıların
beside elde ettikleri toplam CAA mevcut çalışmada 60. Günde bulunan değerlerden daha
düşük olmuştur.
Günlük Canlı Ağırlık Artışları:
Bu çalışmada Honamlı Keçisi ve Kıl Keçisi oğlaklarının 0-60, 60-80 ve 80-100.
Günler arasındaki GCAA’ları sırasıyla sırasıyla 185, 242, 288 g; 209, 244, 266 g olarak tespit
edilmiştir. GCAA’ları incelendiğinde, 60. Güne kadar Kıl Keçisi oğlaklarının Honamlı
oğlaklarından daha hızlı büyüdüğü görülmektedir. Besinin son 20 gününde ise Honamlı
oğlakları daha hızlı büyümüşlerdir, fakat bu farklılıklar istatistiki olarak önemli olmamıştır
(P>0.05, Tablo 4).
Kıl keçisi oğlaklarının entansif besi kabiliyetlerinin tespit etmek amacı ile yapılan
çalışmalarda besi süresince (0-70 veya 0-100. günler arası) GCAA’ları 82-160 g arasında
tespit edilmiştir (Aydın ve Arık 1999, Öztürk ve Deniz 2000, Şimşek ve Bayraktar 2007,
Atay ve ark. 2007). Ülkemizde diğer yerli saf keçilerinin ya da farklı ırkların (Saanen, Kıl
Keçisi, Ankara Keçisi, Renkli Tiftik Keçisi) melezlemesi sonucu elde edilen melez oğlaklarla
yapılan entansif besi çalışmalarında ise GCAA’ları 83-164 g arasında bulunmuştur (Kor 1991,
Koşum ve ark. 2003, Tekeli ve Okuyan 2006, Karadağ ve Köycü 2011). Mevcut araştırmada
Honamlı ve Kıl Keçisi oğlaklarında tespit edilen GCAA değerleri hem saf Kıl Keçisi hem de
Kıl Keçisi melezi veya diğer saf ve melez oğlaklarının GCAA’larından daha yüksek
bulunmuştur. Mevcut çalışmada elde edilen GCAA değeri yine Gökdal ve ark.’nın (2013) Kıl
Keçisi oğlaklarında yarı entansif şartlarda yaptıkları çalışmada buldukları değerden (90 g)
daha yüksek bulunmuştur.
Karaca’nın (2004) tarafından Akkeçi oğlaklarında yapılan entansif besi çalışmasında
bulunan GCAA’ları (189-218 g) mevcut çalışmada 60. Günde elde edilen değerlere yakın
bulunmuştur.
Günlük Yem Tüketimleri ve Yemden Yararlanma Değerleri:
Bu çalışmada Honamlı Keçisi ve Kıl Keçisi oğlaklarının 0-60, 60-80 ve 80-100.
Günler arasındaki GYT’leri sırasıyla 941, 1385, 1675 g; 890, 1268, 1554 g olarak tespit
edilmiştir. YYD’leri ise sırasıyla 5.09, 5.72, 5.81; 4.26, 5.20, 5.86 olarak bulunmuştur (Tablo
5).
Bu çalışmada tespit edilen GYT’leri ülkemizde oğlakların entansif besisi ile ilgili
yapılan çalışmalarında bulunan GYT değerlerinden (570-951 g) daha fazla bulunmuştur
(Öztürk ve Deniz 2000, Koşum ve ark. 2003, Atay ve ark. 2007).Bu çalışmada tespit edilen
YYD’leri ülkemizde oğlakların entansif besi çalışmalarında tespit edilen YYD değerlerinden
(5.92- 10.5) genellikle daha düşük bulunmuştur (Aydın ve Arık 1999, Öztürk ve Deniz 2000,
Atay ve ark. 2007, Şimşek ve Bayraktar 2007, Karadağ ve Köycü 2011). Koşum ve ark.
(2003)’nın tespit ettikleri değerler (4.82-4.96) ise bu çalışmada bulunan değerlere yakın
olmuştur. Karaca’nın Akkeçi erkek oğlaklarında bulduğu YYD’leri (3.26-3.46) ise mevcut
çalışmada bulunan değerlerden daha düşük olmuştur.
Kesim ve Karkas Özellikleri:
Yapılan çalışmada Honamlı ve Kıl Keçisi oğlaklarının kesim ağırlığı, sıcak ve soğuk
karkas oranları ile iç yağı ve böbrek-leğen yağı oranları 60. Günde sırasıyla 25.9 kg, %44.3,
%43.2, %0.9, %1.03; 25.0 kg, %45.5, %44.4, %0.9, %1.16 olarak, 80. Günde 33.6 kg, %47,
%45.9, %1.0, %1.46; 29.4 olarak, 100. Günde ise 38.8 kg, %49.6, %48.2, %1.8, %2.13; 34.6
kg, %48.6, 47.2, %2.1, %2.35 olarak tespit edilmiştir. Atay ve ark. (2007) Kıl Kkeçisi
oğlaklarında yaptıkları 60 günlük entansif besi çalışmasında kesim ağırlığını 19.84 kg, soğuk
karkas randımanını %42.4, iç yağı oranını %1.41, böbrek-leğen yağı oranını ise %1.31 olarak
bulmuşlardır. Bu değerlerden soğuk karkas randımanı mevcut çalışmadaki 60. Güne ait
108
değerlere yakın, iç yağı ve böbrek-leğen yağı oranları ise daha yüksek bulunmuştur. Şimşek
ve Bayraktar (2007) Kıl Keçisi oğlaklarında yaptıkları 98 günlük entansif besi çalışması
sonrası kesim ağırlığı, sıcak ve soğuk karkas randımanları, iç yağı ve böbrek-leğen yağı
oranlarını sırasıyla 35.7 kg, %48.4, 47.3, 1.92, 2.55 olarak bulmuşlardır. Bu değerlerden
kesim ağırlığı mevcut çalışmanın 100. Günündeki Kıl Keçilerine ait kesim ağırlığından düşük,
sıcak ve soğuk karkas randımanları ile iç yağı ve böbrek-leğen yağı oranları ise benzer
bulunmuştur. Durmuş ve Deniz (2000) Kıl Keçisi oğlaklarında 98 gün süren entansif besi
çalışması sonrasında kesim ağırlığı, sıcak karkas ağırlığı, sıcak karkas randımanı, soğuk
karkas ağırlığını sırasıyla 33.5-36.5 kg, 15.6-17.9 kg, %46.6-49.0, 15.3-17.5 kg bulmuşlardır.
Bu değerlerden sıcak karkas oranı mevcut çalışmada 100. Günde elde edilen değerlere yakın
bulunmuş, diğer özellikler ise daha düşük bulunmuştur. Daşkıran ve ark. (2006) Norduz
Keçisi oğlaklarının entansif besisi sonrasında kesim ağırlığı, sıcak ve soğuk karkas
randımanları ile iç yağı ve böbrek-leğen yağı oranları sırasıyla 25.4 kg, %42.9, 41.4, 1.18,
2.05 olarak bulunmuştur. Bu değerlerden kesim ağırlığı mevcut çalışmada 60. Günde bulunan
değerlere benzer, sıcak ve soğuk karkas randımanları %1-1.5 daha düşük, iç yağı ve böbrekleğen yağı oranları ise daha yüksek bulunmuştur. Koşum ve ark. (2003) Saanen ve Bornova
erkek oğlaklarında 56 gün süren besi çalışması sonrasında yaptıkları karkas çalışmasında
kesim ağırlığı, Sıcak ve soğuk karkas oranları sırasıyla %29.4-29.6 kg, %52.2, 50.8 olarak
bulunmuştur. Bu değerler mevcut çalışmadaki değerlerden daha yüksek bulunmuştur. Gökdal
ve ark. (2013) Kıl Keçisi oğlaklarında entansif şartlarda 70 gün süren çalışma sonrası soğuk
karkas ağırlığı ve randımanı 11.1 kg ve %38.5 kg olarak tespit etmişlerdir. Bu değerler
mevcut çalışmanın 60. Günlük değerleri ile kıyaslandığında soğuk karkas ağırlığı benzer
bulunurken, soğuk karkas oranı ise % 4 daha düşük bulunmuştur.
Karkas Parçalarının Oranları:
Mevcut çalışmada değerli karkas parçalarından but, kol ve sırt-bel oranları Honamlı ve
Kıl Keçisi oğlaklarında sırasıyla 60. Günde %34.0, 21.5, 19.4; %34.0, 21.3, 16.6 olarak, 80.
Günde %33.5, 21.4, 19.3; %32.9, 21.8, 19.1 olarak, 100. Günde ise %31.0, 21.4, 19.3; %31.2,
21.8, 19.2 olarak bulunmuştur. Atay ve ark. (2007) 60 günlük entansif besi çalışması sonunda
but, kol ve sırt oranlarını sırasıyla %32.9, 23.9 ve 15.9 olarak bulmuşlardır. Bu değerlerden
but ve kol oranları mevcut çalışmadaki değerlere yakın bulunmuş (yaklaşık %1-1.5 daha
düşük), sırt oranı ise yaklaşık %3 daha düşük bulunmuştur. Şimşek ve ark. (2007) entansif
besi çalışması sonrası but oranını %29.2 olarak bulmuşlardır. Bu oran mevcut çalışmada elde
edilen orandan yaklaşık % 2 daha düşük bulunmuştur. Daşkıran ve ark. (2006) Norduz Keçisi
oğlaklarının karkas özelliklerini tespit amacıyla yaptıkları çalışmada but, kol ve sırt-bel
oranlarını sırasıyla %31.0, 19.8 ve 23.5 olarak tespit etmişlerdir. Bu oranlardan but ve kol
oranları mevcut çalışmadaki değerlerden yaklaşık %2-3 daha düşük, sırt-bel oranı ise % 4
daha yüksek bulunmuştur. Koşum ve ark. (2003) Saanen ve Bornova erkek oğlaklarında but,
kol ve sırt-bel oranlarını sırasıyla %29.0, 19.6 ve 24.3 olarak bulunmuştur. Bu oranlardan but
ve kol oranları mevcut çalışmadaki değerlerden yaklaşık %2-3 daha düşük, sırt-bel oranı ise
% 4 daha yüksek bulunmuştur. Yalçıntan ve ark. (2012) Kıl Keçisi oğlaklarında yaptıkları
çalışmada but, kol ve sırt-bel oranlarını sırasıyla %32.0, 23.0 ve 24.2 olarak bulmuşlardır. Bu
değerlerden but ve kol oranları mevcut çalışmadaki değerlere yakın (but oranı %2 düşük, kol
oranı %1.5 yüksek), sırt-bel oranı ise daha yüksek bulunmuştur.
Karkas Ölçüleri:
Bu çalışmada Honamlı ve Kıl Keçisi oğlaklarının karkas ölçülerinden göğüs çevresi,
göğüs derinliği, göğüs genişliği, karkas uzunluğu, sağrı genişliği, but çevresi, dış but
uzunluğu ve iç but uzunluğu 60, Günde yapılan kesimlerde sırasıyla 63.5, 22.4, 14.1, 67.0,
15.7, 37.7 39.4, 32.4 cm; 63.9, 22.5, 13.9, 67.4, 15.9, 36.8, 38.6, 31.5 cm; 80. Günde 66.8,
25.6, 13.9, 73.1, 13.7, 44.8, 42.4, 32.8cm; 65.3, 24.8, 13.7, 70.8, 13.6, 43.2, 39.9, 30.1 cm;
100 günde ise 71.1, 27.3, 15.7, 75.8, 16.2, 46.9, 42.9, 32.6 cm; 68.7, 26.1, 15.2, 71.7, 16.1,
109
44.6, 41.2, 31.5 cm olarak tespit edilmiştir. Koşum ve ark. (2003) Saanen ve Bornova erkek
oğlaklarında karkas uzunluğu, but uzunluğu ve but çevresini sırasıyla 60.6-61.6, 37.4-39.7,
38.2-38.4 cm olarak bulmuşlardır. Bu değerlerden vücut uzunluğu ve but çevresi mevcut
çalışmada bulunan değerlerden düşük, iç ve dış but uzunlukları ise benzer bulunmuştur.
Şimşek ve ark. (2007) Kıl Keçisi oğlaklarında 98 günlük entansif besi çalışması sonrası
yaptıkları karkas çalışmasında tespit ettikleri karkas ölçülerinden çoğunluğu mevcut
çalışmada bulunan değerlere benzer olmuş ya da çok az düşük veya yüksek bulunmuştur.
Fakat o çalışmada but çevresi çok düşük tespit edilmiştir.
Pirzoladaki doku oranları:
Mevcut çalışmada Honamlı ve Kıl Keçisi oğlaklarının pirzola kısmında yapılan
analizlerde kas, kemik ve yağ oranları sırasıyla 60. Günde %55.2, 34.0, 8.8; %53.7, 34.9,
9.3; 80. Günde %56.7, 29.7, 11.7; %56.0, 31.9, 10.4; 100. Günde ise %57.9, 28.0, 12.4;
%56.8, 29.6, 11.8 olarak tespit edilmiştir. Daşkıran ve ark. (2006) Norduz Keçisi oğlaklarının
entansif şartlardaki yaptıkları çalışmada pirzola kısmında kas, kemik ve yağ oranlarını
sırasıyla %46.6, 38.8 ve 10.0 olarak bulmuşlardır. Mevcut çalışma ile karşılaştırıldığında
araştırıcıların bulduğu kas oranı düşük, kemik oranı yüksek, yağ oranı ise benzer
bulunmuştur. Yalçıntan ve ark. (2012) Kıl Keçisi oğlaklarında bel bölgesinde kas, kemik ve
yağ oranlarını sırasıyla %51.8, 21.9 ve 8.2 olarak bulmuşlardır. Bu değerler mevcut
çalışmadaki değerlerden düşük bulunmuştur.
Sonuç olarak;
Konya İlinde yürütülen Ülkesel Küçükbaş Islahı Projesi’ndeki Kıl Keçisi ve Honamlı
Keçisi sürülerinden temin edilen aynı yaştaki tekiz erkek oğlakların aynı şartlardaki entansif
besisinde besi kabiliyeti ve karkas özellikleri bakımından benzer sonuçlar elde edildiğini
söylemek mümkündür.
Bu çalışmada hem Honamlı hem de Kıl Keçisi oğlaklarında tespit edilen GCAA
değerleri literatürlerde Kıl Keçisi veya melezleri ile ya da diğer keçi ırklarıyla yapılan
çalışmalarda bildirilen değerlerin birçoğundan daha yüksek bulunmuştur.
Yine mevcut çalışmada bu iki genotipe ait kesim ve karkas özelliklerinden birçok
özelliğin birbirlerine benzediği ifade edilebilir. Bununla birlikte, mevcut çalışma ile farklı
literatürlerde bildirilen çalışmalardan elde edilen kesim ve karkas özelliklerine ait sonuçlar
karşılaştırıldığında bazı çalışmalarda benzer sonuçlar tespit edilirken, bazılarında ise farklı
sonuçlar bulunmuştur. Bu farklılıkların muhtemel sebepleri oğlakların farklı canlı ağırlıkta
besiye alınmaları, besi sürelerinin ve beside kullanılan rasyonların farklı olması, iklim ve
coğrafi farklılıklar yanında genetik farklılıklar gibi nedenler olabilir.
Diğer taraftan genetik materyal olarak halk elinde koruma altına alınan Honamlı
sürülerinden (Antalya, Konya, Isparta) temin edilecek oğlaklar ile benzer çalışmaların
yapılması da bu ırkın özelliklerinin belirlenmesinde faydalı olacaktır.
110
T.C.
GIDA, TARIM VE HAYVANCILIK BAKANLIĞI
Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü
ARAŞTIRMA - GELİŞTİRME DESTEKLERİ
PROJE SONUÇ RAPORU
PROJE NO
TAGEM/HAYSUD/
SAANEN, KIL KEÇİSİ VE MELEZLERİNİN BAZI KIL ÖZELLİKLERİNİN
BELİRLENMESİ
PROJE YÜRÜTÜCÜLERİ
Murat ÜNAL
Engin ÜNAY
Orhan KARADAĞ
Sedat BEHREM
YÜRÜTÜCÜ KURULUŞ
Hayvancılık Merkez Araştırma Enstitüsü Müdürlüğü – Lalahan
MART / 2013
ANKARA
111
ÖZET:
Proje Hayvancılık Merkez Araştırma Enstitüsü Yapağı ve Tiftik Laboratuarı tarafından
Bandırma Koyunculuk Araştırma İstasyonunda (BKAİ) mevcut Saanen Saf hattı ile Saanen
Teke X Kıl Keçisi Ana ile elde edilmiş, G1, G2 melezleri ile Balıkesir İli içerisinde Halk
Elinde Islah Projesi kapsamındaki 3 Kıl Keçisi sürüsünde yürütülmüştür. Proje kapsamında
BKAİ de mevcut saf saanen, G1 ve G2 tip sürülerinden 30 ar baş keçiden omuz but ve
kaburga bölgelerinden ayrı ayrı olmak üzere örnek alınmıştır. Örnekler özel kırkım makası ile
her bölgeden 20 – 25 gr. Olacajk şekilde kırkılarak toplanmıştır. Halk elindeki 3 ayrı kıl keçisi
sürülerinden her sürüden 2-3 yaşlı 10 ar baş keçiden omuz but ve kaburga bölgesinden 20 –
25 gr numune olacak şekilde kırkılarak örnekler toplanmıştır. Aynı kıl keçilerinden özel tarak
vasıtasıyla tarama yolu ile kaburga bölgesinden alt kıl örnekleri toplanmıştır. Toplanan
örnekler Enstitümüz Yapağı ve Tiftik Laboratuarında randıman, lüle uzunluğu, incelik,
elastikiyet ve mukavemet özellikleri yönünden incelenmiştir.
Anahtar Kelimeler: Saanen kıl özellikleri, kıl keçisi kıl özellikleri, Saanen x Kıl Keçisi
melezleri kıl özellikleri, üst kaba kıl, Keşmir kılı(alt kıl)
GİRİŞ: Ülkemiz keçi varlığının büyük kısmını Kıl Keçileri oluşturmaktadır. Ancak sayısı
yıllara göre giderek azalmaktadır. Sayının azalması ile paralel olarak kıl üretimi de
azalmaktadır. Yıllar itibariyle Kıl Keçisi sayıları ve Kıl üretimi Çizelge 1 de verilmiştir.
Keçi sayısının ve kıl üretiminin azalmasına karşın Türkiye’ nin kullandığı hayvansal kaynaklı
liflerin miktarı değişmemekte ve açık yurtdışından karşılanmaktadır. Cari açık kavramı
hayvansal kaynaklı liflerde de mevcut olduğu Çizelge 2. de görülmektedir.
Çizelge 2 den anlaşılacağı gibi yaklaşık 200.000 USD lik bir cari açık 1996 yılından bu yana
devam etmektedir. Cari açığın kapatılması ve iç piyasa ihtiyacının yanında dış piyasalarda da
hayvansal liflerimizin satışının arttırılabilmesi için sanayide kullanılabilecek vasıfta lif
üretmek gerekmektedir. Son yıllarda organik yaşam ve çevre duyarlılığı ve bilincinin artması
tekrar hayvansal liflerin kullanımını gündeme getirmektedir. Gerek el dokuması ürünler
gerekse sanayide hayvansal lif kullanımının arttığı gözlenmektedir. Birçok yörede el dokuma
tezgahlarının tekrar kullanılmaya başlandığı özellikle AB kaynaklı projeler ile kırsal kalkınma
amaçlı yatırımların arttığı bilinmektedir.
Keçi kılı çok uzun yıllardan beri çadır ve el dokuması çuval vb ürünlerin en önemli
hammaddesini oluşturmaktadır. Günümüzde de hala göçebe hayatı yaşayan ve hayvancılıkla
geçinen ailelerin barınma ihtiyaçlarını büyük ölçüde kıl çadırlardan sağladığı görülmektedir.
Ancak gelişen teknoloji ve doğal hammaddelerin yerini yapay hammaddelerin alması sonucu
keçi kılı da yapağı gibi tiftik gibi önemini yitirmeye başlamıştır. Özellikle sanayide kullanım
alanı bulamayan kıl keçisi kılları tamamen yöresel el dokumacılığı ile sınırlı kalmıştır.
İlk evcilleştirilen hayvanlardan birisi olan keçi insanoğluna yüzyıllardır etiyle sütüyle ve
kılıyla ürün sunmaktadır. Göçebe hayatın hakim olduğu çağlarda keçi değerli bir hayvan
olarak insanoğlunun yanında yer almaktadır. Özellikle Orta Asya bozkırlarında ve buradan
köken alan medeniyetlerin hemen hemen hepsinde keçi yetiştiriciliğinin yaygın olduğu
görülmektedir.
Bu projede ince fakat kısa kıl yapısına sahip olduğu belirtilen Saanen keçisi, Kıl Keçisi ve
melezlerinin alt kıl ve üst kıl özellikleri incelenmiş olup melezlerde Saanen keçisinin kıl
inceliği ve kıl keçisinin uzun kıl yapısının oluşup oluşmadığı araştırılmıştır. Bu anlamda saf
hat, G1 ve G2 melezlerinin bir arada incelendiği ilk çalışma olması özelliği de taşımaktadır.
MATERYAL VE METOT:
Hayvan Materyali: Proje kapsamında BKAİ de mevcut saf saanen, G1 ve G2 tip sürülerinde
30 ar baş keçi Balıkesir yöresi yetiştiricilerinden Halk Elinde Hayvan Islahı Ülkesel projesi
kapsamındaki 3 ayrı kıl keçisi sürüsünden her sürüden 2-3 yaşlı 10 ar baş keçi kullanılmıştır.
112
Araştırmada yapılan analizler:
Kıl numuneleri Nisan ayında hayvanların omuz, but ve kaburga bölgelerinden 20-25 gr. kadar
olacak şekilde mümkün olduğunca dip kısımlarından kırkım makası ile alınmıştır. Kıl keçisi
sürülerindeki hayvanlardan aynı zamanda kaburga bölgesinden Keşmir tarağı ile Keşmir
kılları tarama yöntemi ile toplanmıştır. Keşmir ve kaba kıl örneklerinde;
Randıman Tayini: Kırkım esnasında, gömlek hayvandan henüz ayrılmadan keçilerin yan
bölgelerinden alınan 10-15 gr’lık örnekler 0.01 gr’a hassas terazi ile tartılmış ve yapağı elle
didiklenerek içindeki bitkisel maddeler, pislik ve toprak parçaları ayıklanmıştır (Emsen,
1982). Ayıklanma işleminden sonra %0.2’lik deterjanlı ılık suda yıkanan örnekler önce açık
hava şartlarında ve daha sonra da sıcaklığı 105 0 C ‘ye ayarlı kurutma dolabında ağırlıkları
sabit oluncaya kadar tutulmuşlardır(Tellioğlu, 1975). Kurutma dolabının yanında bulunan
0.01 gr’a kadar duyarlı terazi ile örneklerin kuru ağırlıkları tespit edilmiştir. Tespit edilen kuru
ağırlığa normal rutubet oranı %14 eklendikten sonra (Sönmez, 1978) elde edilen değer ilk
tartılan yapağının yüzdesi olarak aşağıdaki formüle göre tespit edilmiştir (Düzgüneş ve Pekel,
1983).
% Randıman = Numunenin Kuru Ağırlığı+Kuru Ağırlığının %14’ü / Numunenin
İlk Ağırlığı
Lif Uzunluk Analizi: Lif uzunluk analizleri USTER FL100 ve USTER AL100 cihazları ile
yapılacaktır. Lifler uçları aynı hizaya getirilip tarandıktan sonra USTER AL100 CİHAZI ile
otomatik olarak ölçümü yapılacaktır. USTER AL100 lif uzunluğu ölçüm ünitesine yerleştirilen
lif örneğini 1200 noktada ölçen bir kondansatör içeren kapasitif ölçüm metodunu
kullanmaktadır. Cihaz lif sayılarını esas alarak ortalama lif uzunluğu ‘HAUTER’ ve ağırlık
esaslı ortalama lif uzunluğu ‘BARBE’ değerlerini milimetre olarak ölçülmüştür.
Lif Çapı(İncelik) Analizi: Lif çapı, diğer bir deyişle incelik analizleri USTER OFDA
100(Optik Fibre Diameter Analyzer) cihazı ile yapılacaktır. Optik esaslarla ölçüm yapan bu
alet dakikalar içinde 4000-5000 lifin ortalama çapını bizlere mikron olarak verir.
Lif Elastikiyet- Mukavemet Analizi: Analizler FAFEGRAPH ME ‘Single Fibre Tensile
Tester’ cihazı ile yapılacaktır. Kompresörün ürettiği hava basıncı ile hareket eden çenelere
tutturulan tek bir lif çektirilir. Belli bir miktar uzayan ve kopmaya mukavemet eden lif bir
noktada kopar. Koptuğu andaki % uzama miktarı bize elastikiyeti, ne kadar bir kuvvete
dayandığı ise Cn/Tex yada gr/den olarak mukavemeti ifade etmektedir.
Denemede Kullanılan İstatistik Metot: Araştırmadaki hayvan materyalinin (Saanen,
Kıl Keçisi, G1, G2) üzerinde durulan kıl özellikleri (randıman, incelik, uzunluk,
elastikiyet/mukavemet) yönünden tanıtıcı istatistik değerleri tespit edilmiş, ayrıca farklı
genotip seviyeleri arasındaki farklılığın önemli olup olmadığının Minitab 16 paket programı
yardımı ile Fishere göre Varyans analizi yapılmıştır.
BULGULAR:
Saanen keçilerinden omuz, but ve kaburga bölgelerinden alınan kıl özelliklerine ait
tanımlayıcı istatistikler Çizelge 6 da verilmiştir. G1 tipinden omuz, but ve kaburga
bölgelerinden alınan kıllara ait tanımlayıcı istatistikler çizelge 7 de verilmiştir. G2 tipinde
omuz, but ve kaburga bölgelerinden alınan kıllara ait tanımlayıcı istatistikler çizelge 8 de
verilmiştir. Kıl keçilerinde omuz, but ve kaburga bölgelerinden alınan kıllara ait tanımlayıcı
istatistikler çizelge 9 da verilmiştir. Vücut bölgelerine göre farklılıkları ortaya koyabilmek
için hazırlanan Saanen, Kıl Keçisi, G1 ve G2 tiplerine ait varyans analizi tablosu çizelge 10 da
verilmiştir. Bölge farkı gözetilmeden Saanen, Kıl Keçisi, G1 ve G2 tiplerine ait varyans
analizi çizelge 11 de verilmiştir. Saanen, Kıl keçisi, G1 ve G2 tiplerinde vücut bölgelerine
göre kıl özelliklerinin değişiklik gösterip göstermediğinin, hangi bölgeden kıl alınması
durumunda vücut genelini temsil edip etmediğinin incelenmesi amacıyla her tipin kendi
içerisinde varyans analizine tabi tutulduğu istatistik değerlendirmesi sırasıyla çizelge 12, 13,
14 ve 15 de verilmiştir.
113
Çizelge 6. Saanen Keçisine Ait Bazı Kıl Verim Özellikleri
VUCUT
BÖLGESİ
OMUZ
BUT
KABURGA
n
(Baş)
29
29
29
UZUNLUK (MM)
Ort±SEM
24,11±0,895
26,35±1,12
26,39±1,02
Min
16,8
16,5
17,3
Max
32,2
37,2
38,8
İNCELİK (µ)
Ort±SEM
57,79±3,982
67,78±4,60
61,04±4,09
Min
26,7
21,66
25,36
Max
96,2
104,34
101,33
ELASTİKİYET
(%)
Ort±SEM
Min Max
11,78±1,169 4,38 29,13
12,59±1,51
2,23 30,68
12,38±1,21
3,49 26,98
MUKAVEMET
(Cn/Tex)
Ort±SEM
Min Max
10,11±0,414 6,82 15,35
11,46±0,74
4,9
21,2
9,59±0,48
5,65 16,67
Max
105,89
104,01
102,6
ELASTİKİYET
(%)
Ort±SEM
Min Max
17,12±1,47 7,21 32,55
19,19±1,72 5,3
43,2
14,66±1,18 6,59 25,38
MUKAVEMET
(Cn/Tex)
Ort±SEM
Min Max
11,88±0,65 7,77 24,94
15,18±1,16 5,69 31,93
9,61±0,31
7,35 13,59
Max
106,74
110,8
104,18
ELASTİKİYET
(%)
Ort±SEM
Min Max
15,81±1,41 4,6
30,2
14,63±1,33 3,49 33,13
14,91±1,15 3,88 31,67
MUKAVEMET
(Cn/Tex)
Ort±SEM
Min Max
12,01±0,53 7,09 20,71
13,97±0,85 6,05 21,97
11,14±0,77 5,61 26,84
RANDIMAN (%)
Ort±SEM
87,55±0,454
85,80±0,56
88,05±0,47
Min
80,8
78,3
83,5
Max
91,1
89,5
93,8
Çizelge 7. G1 Tipine ait Bazı Kıl Verim Özellikleri
VUCUT
BÖLGESİ
OMUZ
BUT
KABURGA
n
(Baş)
27
27
27
UZUNLUK (MM)
Ort±SEM
29,40±0,94
34,40±1,89
29,57±1,00
Min
21,9
19,8
21,7
Max
39,3
62,9
43,6
İNCELİK (µ)
Ort±SEM
57,98±4,59
66,47±5,01
69,43±4,73
Min
25,65
20,70
21,3
RANDIMAN (%)
Ort±SEM
85,85±0,46
85,45±0,85
85,01±0,62
Min
80,2
72,4
75,3
Max
91,1
94,5
89,3
Çizelge 8. G2 Tipine Ait Bazı Kıl Verim Özellikleri
VUCUT
BÖLGESİ
OMUZ
BUT
KABURGA
n
(Baş)
30
30
30
UZUNLUK (MM)
Ort±SEM
26,62±1,16
32,38±2,38
27,57±1,24
Min
17
13,9
16
Max
55
63,8
44,4
İNCELİK (µ)
Ort±SEM
71,44±4,22
69,37±5,04
76,62±4,27
Min
28,04
25,4
25,27
RANDIMAN (%)
Ort±SEM
86,81±0,73
85,83±0,64
87,36±0,47
Min
69
78,9
82,8
Max
92
91,9
92,3
Çizelge 9. Kıl Keçisine Ait Bazı Kıl Verim Özellikleri
VUCUT
BÖLGESİ
OMUZ
BUT
KABURGA
ALT KIL
n
(Baş)
30
30
30
30
UZUNLUK (MM)
Ort±SEM
46,70±2,13
47,51±1,88
52,10±2,13
22,93±0,99
Min
22,8
29,9
26,5
16,2
Max
74
66,2
81
42,1
İNCELİK (µ)
Ort±SEM
73,71±2,12
80,58±2,88
78,60±2,01
15,34±0,16
Min
48
33,06
54,33
14,1
Max
93,66
102,23
101,86
18,2
ELASTİKİYET
(%)
Ort±SEM
Min
33,12±1,28
19,4
29,45±1,48
11,36
30,16±1,38
7,87
……………. ………
Max
45,2
42,13
42,15
……….
MUKAVEMET
(Cn/Tex)
Ort±SEM
Min
Max
20,26±0,83 12,77
28,79
25,94±0,97 17,54
35,82
21,52±0,81 10,06
33,99
………….. ……… ………
RANDIMAN (%)
Ort±SEM
89,99±0,46
82,25±1,06
90,45±0,37
86,04± 0,51
Min
85,3
70,3
86,1
78,6
Max
98,9
90,8
94,8
90,3
114
Çizelge 10. Irklar bazında vücut bölgeleri arasındaki farklılıklar
UZUNLUK (H) (mm)
İNCELİK (Mikron)
ELASTİKİYET (%)
n
(Baş) OMUZ BUT
KABURGA OMUZ BUT
KABURGA OMUZ BUT
KABURGA
46,693a 47,51 a
52,103 a
73,71 a 80,580 a
78,600 a
33,122 a 29,445 a
30,162 a
KIL
30
b
b
b
b
b
ab
b
b
29,404
34,4
29,574
57,98
66,470
69,430
17,125 19,186
14,658 b
G1
27
bc
b
b
a
ab
a
b
c
G2
30
26,620
32,38
27,567
71,44 69,370
76,620
15,809 14,628
14,912 b
c
c
b
b
b
b
c
c
SAANEN 29
24,110 26,35
26,393
57,79
67,780
61,040
11,778 12,587
12,385 b
Aynı sütunda birbirinden farklı harfler arasındaki fark istatistiki olarak önemli bulunmuştur (p<0.05)
IRK
MUKAVEMET (Cn/Tex)
RANDIMAN (%)
OMUZ BUT
KABURGA OMUZ BUT
KABURGA
20,262 a 25,937 a
21,517 a
89,987 a 82,250 b
90,447 a
bc
b
b
c
a
11,88
15,180
9,609
85,852 85,452
85,011 c
b
bc
b
bc
a
12,014 13,971
11,138
86,807
85,827
87,363 b
c
c
b
b
a
10,114 11,464
9,586
87,855 85,797
88,052 b
Çizelge 11. Irklar bazında Kıl Özellikleri arasındaki farklılıklar
IRK
n
(Baş)
UZUNLUK (H) (mm)
a
İNCELİK (Mikron)
ELASTİKİYET (%)
a
a
KIL
90
48,769
77,630
G1
81
31,126 b
64,630 bc
G2
90
28,857 b
72,480 ab
c
SAANEN
87
25,617
62,200 c
Aynı sütunda birbirinden farklı harfler arasındaki fark istatistiki olarak önemli bulunmuştur (p<0.05)
30,910
16,990 b
15,116 b
12,250 c
MUKAVEMET (Cn/Tex)
a
22,572
12,223 b
12,374 b
10,388 c
RANDIMAN (%)
87,561 a
85,438 b
86,666 a
87,134 a
Çizelge 12. G1 tipinde Kıl Özelliklerinin vücut bölgeleri arasındaki farklılıklar
G1
n
(Baş)
UZUNLUK (H) (mm)
İNCELİK (Mikron)
ELASTİKİYET (%)
MUKAVEMET (Cn/Tex)
RANDIMAN (%)
17,125 ab
19,186 a
14,658 b
16,990 ab
11,880 bc
15,180 a
9,609 c
12,223 b
85,852 a
85,452 a
85,011 a
85,438 a
OMUZ
27
29,404 b
57,980 a
a
BUT
27
34,400
66,470 a
b
KABURGA
27
29,574
69,430 a
GENEL
81
31,126 b
64,630 a
aynı sütunda birbirinden farklı harfler arasındaki fark istatistiki olarak önemli bulunmuştur (p<0.05)
Çizelge 13. G2 tipinde Kıl Özelliklerinin vücut bölgeleri arasındaki farklılıklar
G2
n (Baş)
UZUNLUK (H) (mm)
b
İNCELİK (Mikron)
a
ELASTİKİYET (%)
OMUZ
30
26,620
71,440
BUT
30
32,383 a
69,370 a
b
KABURGA
30
27,567
76,620 a
GENEL
90
28,857 ab
72,480 a
aynı sütunda birbirinden farklı harfler arasındaki fark istatistiki olarak önemli bulunmuştur (p<0.05)
15,809
14,628
14,912
15,116
a
a
a
a
MUKAVEMET (Cn/Tex)
ab
12,014
13,971 a
11,138 b
12,374 ab
RANDIMAN (%)
86,807 a
85,827 a
87,363 a
86,666 a
115
Çizelge 14. Kıl Keçisi Kıl Özelliklerinin vücut bölgeleri arasındaki farklılıklar
İNCELİK
ELASTİKİYET (%)
(Mikron)
OMUZ
30
46,690 a
73,710 b
33,122 a
a
a
BUT
30
47,510
80,580
29,445 a
a
ab
KABURGA 30
52,100
78,600
30,162 a
a
ab
GENEL
90
48,770
77,630
30,910 a
aynı sütunda birbirinden farklı harfler arasındaki fark istatistiki olarak önemli bulunmuştur (p<0.05)
KIL
n
(Baş)
UZUNLUK (H) (mm)
MUKAVEMET (Cn/Tex)
RANDIMAN (%)
20,262 c
25,937 a
21,517 bc
22,572 b
89,987 a
82,250 c
90,447 a
87,561 b
MUKAVEMET (Cn/Tex)
RANDIMAN (%)
10,114 ab
11,464 a
9,586 b
10,388 ab
87,555 a
85,797 b
88,052 a
87,134 a
Çizelge 15. Saanen ırkında Kıl Özelliklerinin vücut bölgeleri arasındaki farklılıklar
İNCELİK
ELASTİKİYET (%)
(Mikron)
OMUZ
29
24,110 a
57,790 a
11,778 a
BUT
29
26,348 a
67,780 a
12,587 a
a
a
KABURGA
29
26,393
61,040
12,385 a
a
a
GENEL
87
25,617
62,200
12,250 a
aynı sütunda birbirinden farklı harfler arasındaki fark istatistiki olarak önemli bulunmuştur (p<0.05)
SAANEN
n (Baş)
UZUNLUK (H) (mm)
116
TARTIŞMA VE SONUÇ:
Çizelge 6 incelendiğinde Saanen keçisi kıl uzunluğunun omuz, but ve kaburga bölgesinde
sırasıyla 24,11±0,895, 26,35±1,12 ve 26,39±1,02 mm, inceliğin sırasıyla 57,79±3,982, 67,78±4,60
ve 61,04±4,09 µ olduğu, elastikiyetin sırasıyla % 11,78±1,169, 12,59±1,51 ve 12,38±1,21 olduğu,
mukavemetin sırasıyla 10,11±0,414, 11,46±0,74 ve 9,59±0,48 Cn/Tex olduğu, randımanın ise
sırasıyla % 87,55±0,454, 85,80±0,56 ve 88,05±0,47 olduğu tespit edilmiştir. Bu sonuçlar ışığında
Saanen keçisinin Türkiye koşullarında söylendiği gibi ince bir kıl yapısı olmadığı anlaşılmıştır.
Çizelge 7 incelendiğinde G1 tipinin kıl uzunluğunun omuz, but ve kaburga bölgesinde
sırasıyla 29,40±0,94, 34,40±1,89 ve 29,57±1,00mm, inceliğin sırasıyla 57,98±4,59, 66,47±5,01 ve
69,43±4,73 µ olduğu, elastikiyetin sırasıyla % 17,12±1,47, 19,19±1,72 ve 14,66±1,18 olduğu,
mukavemetin sırasıyla 11,88±0,65, 15,18±1,16 ve 9,61±0,31 Cn/Tex olduğu, randımanın ise sırasıyla
% 85,85±0,46, 85,45±0,85 ve 85,01±0,62 olduğu tespit edilmiştir.
Çizelge 8 incelendiğinde G2 tipinin kıl uzunluğunun omuz, but ve kaburga bölgesinde
sırasıyla 26,62±1,16, 32,38±2,38 ve 27,57±1,24 mm, inceliğin sırasıyla 71,44±4,22, 69,37±5,04 ve
76,62±4,27 µ olduğu, elastikiyetin sırasıyla % 15,81±1,41, 14,63±1,33 ve 14,91±1,15 olduğu,
mukavemetin sırasıyla 12,01±0,53, 13,97±0,85 ve 11,14±0,77 Cn/Tex olduğu, randımanın ise
sırasıyla % 86,81±0,73, 85,83±0,64 ve 87,36±0,47 olduğu tespit edilmiştir.
Çizelge 9 incelendiğinde Kıl Keçisinin kıl uzunluğunun omuz, but ve kaburga bölgesinde
sırasıyla 46,70±2,13, 47,51±1,88 ve 52,10±2,13 mm, inceliğin sırasıyla 73,71±2,12, 80,58±2,88 ve
78,60±2,01 µ olduğu, elastikiyetin sırasıyla % 33,12±1,28, 29,45±1,48 ve 30,16±1,38 olduğu,
mukavemetin sırasıyla 20,26±0,83, 25,94±0,97 ve 21,52±0,81 Cn/Tex olduğu, randımanın ise
sırasıyla % 89,99±0,46, 82,25±1,06 ve 90,45±0,37 olduğu tespit edilmiştir.
Vücut bölgeleri arasındaki farkın ırklar arasındaki karşılaştırılmasının verildiği çizelge 10
incelenecek olursa, omuz bölgesinde en uzun kılın 46,693 mm ile Kıl Keçisinde olduğu, en kısa kılın
ise 24,110 mm ile Saanen Keçisinde olduğu melezleme Saanen Keçisine yaklaştıkça kısalığın arttığı
görülmüştür. But ve kaburga bölgeleri içinde benzer sonuç çıktığı ancak but bölgesindeki kılların G1
ve G2 arasındaki farkın önemsiz, kaburga bölgesinde ise G1, G2 ve Saanen arasındaki farkın önemsiz
olduğu tespit edilmiştir. İncelik yönünden Kıl keçisinin en kalın kıla sahip olduğu ancak G2 nin
incelik yönünden Kıl keçisine daha yakın olduğu görülmektedir. Elastikiyet ve mukavemet yönünden
Kıl Keçisi kılının diğer tiplerden farklı olduğu görülmektedir.
G1 tipinde vücut bölgeleri arasındaki farklılığın önemli olup olmadığının incelendiği çizelge
12 incelendiğinde incelik ve randıman yönünden bölgeler arasındaki farkın önemsiz olduğu, uzunluk
yönünden but kıllarının en uzun kıl olduğu diğer bölgelerin ve vücut geneli arasındaki farkın önemsiz
olduğu, elastikiyet yönünden omuz ve vücut genel ortalaması arasındaki farkın önemsiz olduğu, but ve
kaburganın önemli derecede farklı olduğu tespit edilmiştir. Mukavemet yönünden ise tüm bölgeler
arasındaki fark önemli bulunmuştur.
G2 tipinde vücut bölgeleri arasındaki farklılığın önemli olup olmadığının incelendiği çizelge
13 incelendiğinde; incelik, elastikiyet ve randıman yönünden vücut bölgeleri ve genel ortalama
arasındaki farkların önemsiz olduğu görülmektedir. Uzunluk ve mukavemet yönünden omuz ve
kaburga arasındaki farkın önemsiz, but bölgesinin ise diğerlerinden önemli derecede farklı olduğu
tespit edilmiştir.
Kıl keçisinin vücut bölgeleri arasındaki farklılığın önemli olup olmadığının incelendiği çizelge
14 incelendiğinde; uzunluk ve elastikiyet yönünden bölgeler arasındaki farkın önemsiz olduğu, incelik
ve mukavemet yönünden bölgeler arası farkın önemli olduğu tespit edilmiştir.
Saanen keçisinin vücut bölgeleri arasındaki farklılığın önemli olup olmadığının incelendiği çizelge 15
incelendiğinde; uzunluk, elastikiyet ve incelik yönünden farkın önemsiz olduğu, randıman yönünden
but dışındaki bölgelerin arasındaki farkın önemsiz olduğu görülmektedir.
117
T.C.
GIDA, TARIM VE HAYVANCILIK BAKANLIĞI
Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü
PROJE SONUÇ RAPORU
PROJE ADI
YETİŞTİRİCİ ŞARTLARINDA SUNİ MERA VE ENTANSİF BESLENEN KUZULARIN
BESİ VE KARKAS ÖZELLİKLERİNİN KARŞILAŞTIRILMASI
PROJE NO
PROJE YÜRÜTÜCÜLERİ
Zir. Yük. Müh. Tülay CANATAN
Zir. Yük. Müh. Şükrü DOĞAN
Zir. Yük. Müh. Gazi ÖZCAN
Dr. Mustafa KAN
Vet. Hek. Kürşat AKBULUT
Dr. Vet. Hek. Bumin Emre TEKE
YÜRÜTÜCÜ KURULUŞ
BAHRİ DAĞDAŞ ULUSLARARASI TARIMSAL ARAŞTIRMA ENSTİTÜSÜ
OCAK/ 2013 KONYA
118
KISALTMA TANIMLARI
BBCA : Besi Başı Canlı Ağırlığı
CA
:
Canlı Ağırlık
g
:
Gram
CAA : Canlı Ağırlık Artışı
YT : Yem Tüketimi
YYD : Yemden Yararlanma Değeri
Kg : Kilogram
MLD : Muskulus longissimus dorsi
HS
:
Ham selüloz
HP
:
Ham protein
ADF :
Asit Deterjan Fiber (Asit deterjanda çözünmeyen lif)
NDF : Nötral Deterjan Fiber (Nötr deterjanda çözünmeyen lif)
Şekil 1. Meranın kurulması sırasındaki
çalışmalar Şekil 2. Meradan örnek alma
çalışmaları.
Şekil 3. Alınan örneklerin türlere göre ayrılması
Şekil 4. Ham protein oranının tayin edilmesi çalışması
Şekil 5. ADF ve NDF çalışması
Şekil 6. Kesimhaneden görüntüler
Şekil 7. Karkas çalışmasında vücut ölçülerinin alınması
Şekil 8. Karkas çalışmasından görüntüler
Şekil 9. Karkas parçalama yöntemi
Şekil 10.Sol yarım karkas üzerinde yapılan çalışmalar
Şekil 11. Sol yarım karkasta 6 ve 12. Kaburgalar arasından alınan örnek üzerinde doku
kompozisyonu çalışması
Grafik1.Yemleme Sistemi ve Cinsiyetlere Göre Toplam Gelir, Marjinal Gelir ve Marjinal
Masraf Eğrileri
Tablo1: Kuzu Büyütme Döneminde Kullanılan Rasyonun Hammadde Miktarları ve
Hesaplanmış Besin Madde Kompozisyonları Tablo2:Besi Döneminde Kullanılan
Rasyonun Hammadde Miktarları ve Hesaplanmış Besin Maddeleri Kompozisyonları
Tablo 3:Farklı tarihlerde biçilen mera otlarının verim özelikleri Tablo 4:Farklı
tarihlerde biçilen mera otlarının besin madde içerikleri,%
Tablo 5:Deneme Kuzularının Değişik Dönemlerdeki Canlı Ağırlık Değişimleri, kg
Tablo 6:Deneme kuzularının Değişik Dönemlerdeki CAA ve OCAA ları (g/gün)
Tablo 7:Entansif ve Mera+ süt+ yem grubundaki kuzuların değişik dönemlerdeki günlük ve
toplam yem tüketimleri, kg Tablo 8:Entansif ve Mera+ süt+ yem grubundaki kuzuların
yemden yararlanma değerleri
Tablo 9. Kesim Özellikleri
Tablo 10: Karkas Özellikleri
Tablo 11: Karkas Parçalarının Oranları
Tablo12:Deneme Kuzularında Sol Yarım Karkasın 6 ile 12.Kaburgaları Arasındaki Alınan
Pirzola Örneklerinde Doku Kompozisyonu (%)
Tablo13:Entansif Yemleme Sistemine Dayalı Besleme Sisteminde Merinos Kuzularının
Tahmin Edilen Performansları ve Marjinal Gelir-Marjinal Masraf Değerleri Tablo14:Entansif
Yemleme+Süt+Mera Sistemine Dayalı Besleme Sisteminde Merinos Kuzularının Tahmin
Edilen Performansları ve Marjinal Gelir-Marjinal Masraf Değerleri
Önsöz:
Bilimsel çalışmalar öncelikle yürütüldüğü bölgenin, daha sonrasında da geniş alanların
karşılaştığı bir sorunu çözmeye yönelik olmalıdır.
119
Ülkemizde hayvancılık sektörünün en önemli kaba yem kaynaklarından birisi olan
doğal çayır ve meralar uzun yıllardan beri yanlış ve bilinçsiz kullanımları sonucu üretim
güçlerini ve bitki örtüsünün büyük bir kısmını kaybetmiş bunun sonucu olarak da birer
erozyon sahasına dönüşmeye yüz tutmuşlardır. Meralara karşı toprak kazanmak maksadıyla
yapılan ihlaller neticesinde yüzölçümleri gittikçe küçülmekte ve hayvan sürülerini
doyurmaktan uzak bir noktaya gelmiştir.
Orta Anadolu Bölgesinde, son zamanlarda mera alanlarının azalması ve bitki örtüsünün
bozulmasından dolayı koyunculukta besin madde ihtiyacını karşılamak amacı ile tarım için
elverişli olmayan arazilere suni meraların kurulması ön plana çıkmıştır. Ürün vermeyen
arazilerde de suni meralar oluşturularak bu alanlarda bir taraftan erozyonun önüne geçilirken
diğer taraftan araziler değerlendirilerek ülke ekonomisine katkı sağlayacaktır. Yapay
meraların verimleri doğal meralara göre daha yüksektir ve kaliteli yem üretirler. Farklı
türlerin karışımlarından elde edilen yem, hayvanlar için daha dengeli ve besleyici olmaktadır.
Farklı çayır mera karışımı tohumları ile özlenen yüksek verimli zengin besleyici özelliği olan
meralar yurt sathında yüz binlerce dekar özel çayır meraların kurulması doğal meraların
yükünü de hafifletecektir. Oysaki dünyada ileri teknikler kullanılarak yapılan üretimler kar
marjını artırdığı gibi kaliteyi de yükseltmektedir. Bu yüzden yapılacak araştırmalar ve
uygulamalar hem kullanılacak olan hayvan materyalinin hayatiyetini devam ettirme
konusuna yardımcı olacak, hem de bölge arazilerinin daha verimli kullanımını sağlayacaktır.
“Yetiştirici Şartlarında Suni Mera ve Entansif Beslenen Kuzuların Besi ve Karkas
Özelliklerinin Karşılaştırılmasına yönelik yapılan bu araştırma, Konya Karapınar Tarım
İlçe Müdürlüğü’nün destekleri ile Gıda ve Hayvancılık Bakanlığı Tarımsal Araştırmalar
ve Politikalar Genel Müdürlüğü’ne bağlı Bahri Dağdaş Uluslararası Tarımsal Araştırma
Enstitüsü’nde gerçekleştirilmiştir.
ÖZET
Bu araştırmada, yetiştirici şartlarında suni mera ve entansif beslenen kuzuların besi ve
karkas özelliklerinin karşılaştırılması amaçlanmıştır. Araştırma, 2011-2012 yıllarında Konya
İli Karapınar İlçesinde yapılmış ve toplam 60 baş kuzu hayvan materyali olarak
kullanılmıştır. Kuzular 3 gruba ayrılmıştır. 1. grup mera+süt, 2. grup mera+süt+ilave yem, 3.
grup entansif besleme. Yetiştirici şartlarında 24 da mera alanı kurulmuştur. Mera 3
buğdaygil+ 3 baklagil karışımından oluşmuştur. Deneme parselleri eşit olarak 4 alt parsele
bölünmüştür. Rotasyonlu otlatma yapılmıştır. Deneme 60 gün sürmüştür. Çalışma süresince
kuzular 10 günde bir tartılmış ve 21 günde merada yer değiştirmiştir. Mera örneklemesine
paralel olarak, merada otlayan 20’şer baş erkek ve dişi kuzunun canlı ağırlıkları da
belirlenerek günlük canlı ağırlık artışları hesaplanmıştır. Meradan ot örnekleri 21 günde bir (
11.05.2012- 31.05.2012.26.06.2012-17.07.2012) alınarak yeşil ot ve kuru ot verimi, kuru
madde (KM), ham protein (HP), ham selüloz (HS), ADF, NDF özellikleri ele alınmış ve
analiz edilmiştir. Biçim tarihlerine göre suni meranın yeşil ot verimi, yukarıdaki tarih
sırasıyla; 6.640, 4.075, 3.400 ve 1.620 kg/ da, kuru ot verimi, 2.603, 1.970, 1.505 ve 625
kg/da olarak bulunmuştur. Yeşil ot verimi Mayıs ayında en yüksek iken diğer biçim
zamanlarında sıcaklıkların artmasıyla verimin düştüğü görülmüştür. Vejetasyonun
ilerlemesine bağlı olarak mera otlarının KM, NDF ve ADF düzeyleri artmış, HP düzeyi
azalmıştır (P<0,001). Mera örneklerine paralel olarak yapılan tartımlarda, besleme
gruplarındaki kuzuların CA kazancı önemli bulunmuştur (P<0,001). Besi süresince canlı
ağırlık artışı en yüksek entansif ve mera+süt+yem besi grubunda en düşük değer ise mera+süt
besisi yapılan kuzularda belirlenmiştir. Cinsiyet bazında erkek kuzuların dişilere göre daha
iyi performans gösterdiği görülmüştür. 60 günlük besi sonunda erkek kuzular dişi kuzulara 3
kg fazla canlı ağırlık kazancı sağlamıştır (P<0,001). Günlük canlı ağırlık artışı bakımından
gruplarda 0-10,10-20. günlerde (P<0,001), 20-30, 30-40. günlerde (P<0,05) önemli
bulunurken, 40-50 ve 50-60. günlerde düşüş görüldüğü için önemsiz bulunmuştur (P>0,001).
120
Entansif ve mera +süt+ yem grubundaki kuzuların günlük yem tüketimleri 10 ve
50.günde (P<0,001),20, 30 ve 60. gün de (P<0,05) yem tüketimleri önemli bulunmuştur.
Gruplarda 30-40 ve 40-50.günlerde günlük yedikleri yem bakımından birbirlerini
yakaladıkları görülmüş olup istatistiki olarak önemsizdir. Grupların yemden yararlanma
değerleri istatistiki olarak önemli çıkmıştır. Mera+ süt+yem grubunun entansif grubuna göre
daha az yem yiyerek yemi daha iyi değerlendirdiği görülmektedir (P<0,001). Cinsiyet
bakımından erkekler dişilere göre daha az yem yiyerek yemi en iyi şekilde değerlendirdikleri
tespit edilmiştir ( P<0,001).
Randıman bakımından besi gruplarında önemsiz bulunmuş, erkek ve dişi kuzuların
sıcak ve soğuk randıman değerleri sırasıyla; % 19.53- % 18.22 (P<0,001); % 48.20- % 47.15
(P<0,05) bulunmuştur. İç yağ ağırlığı bakımından en yüksek değer entansif besi grubunda ve
dişi kuzularda; en düşük değer ise mera+ süt besisi yapılan grupta ve erkek kuzularda olduğu
hesap edilmiştir (P<0.,001). Karkasın değerli parçaları olarak adlandırılan kol, but, sırt bel
ağırlıkları ve oranları önemli bulunmuştur (P<0,05). Böbrek leğen yağı ve kuyruk ağırlığı
bakımından en yüksek değer entansif beside en düşük değer mera+süt besi grubunda
bulunmuştur(P<0,001). MLD göz kası alanı mera+süt besisi grubunda en yüksek, entansif ve
mera+süt+yem besi grubunda ise birbirine çok yakın değerler olduğu görülmüştür. Sol yarım
karkasın 6 ila 12. Kaburgaları arasındaki alınan pirzola örneklerinde doku kompozisyonun
incelenmesi sonucunda kabuk yağı, kas arası yağ, toplam yağ oranları ve kabuk yağı kalınlığı
entansif besi grubunda en yüksek (P<0.001), en düşük değerler mera+süt besi grubunda
olduğu belirlenmiştir (P<0.001).
Sonuç olarak, yüksek üretim ve ot tüketimi için tahıl ekimi yapılamayan arazilerin
yapay mera alanına dönüştürülmesi akılcı bir çözümdür. Ayrıca 3 farklı besleme sistemine
dayalı olarak yapılan analizler sonucunda erkeklerin dişilere göre daha fazla ağırlık kazancı
sağladığı görülmektedir. Ekonomik analiz sonucuna göre, Merinos kuzularında entansif yani
sadece yeme dayalı besleme sisteminin daha fazla masraf gerektirdiği ve toplam gelirin
maksimum olduğu nokta için kuzuların 40 kg değerin üzerine çıkması gerektiği
görülmektedir. Entansif besleme sisteminde yem masrafının besleme sisteminde büyük bir
masraf kalemini oluşturması Merinos kuzularında sadece entansif yemleme dayalı bir
besleme sisteminin ekonomik olmadığı görülmektedir. Yemin besleme sistemine girişi aynı
zamanda karkas değerinde yağ oranında artışa neden olmakta ve ette yağlılık oranının artması
tüketici açısından da istenilen bir durum olmamaktadır. Yerel ırklarımızdan olan Merinos
koyun ırkında kuzu besisinde sadece entansif besi sistemine dayalı bir üretim modeli önerilen
bir durum değildir. Araştırmada; besi grupları içinde yer alan yapay mera üzerinde yapılan
besi çalışması sonucu merada otlayan kuzularda karkasta yağ ve kas oranı üzerinde olumlu
etki oluşturması meraların ne kadar önemli olduğunun bir göstergesi olarak ülkemizdeki mera
ıslahı çalışmalarının titizlikle sürdürülmesi ve otlatmanın mutlaka mera yönetim ilkelerine
uygun yapılması kanısına varılmıştır.
Anahtar Kelimeler: Kuzu, yapay mera, otlatma, besi performansı, karkas özellikleri
GİRİŞ
Dünya ülkelerinde ve Türkiye’de hayvansal üretim faaliyetleri içinde yer alan koyun
yetiştiriciliği çoğunlukla karlı bir üretim dalı olarak varlığını artırarak sürdürebilmekte, koyun
ve kuzu eti, koyun sütü gibi ürünleri insan beslenmesinde önemli bir yere sahiptir. Bu önem,
koyunun genelde kısa boylu bitki örtüsüne sahip ve aşırı otlatmadan verimsiz hale gelmiş
meralar ile anız ve bitkisel üretime uygun olmayan alanları değerlendirerek et, süt, yapağı ve
deri gibi hayvansal ürünlere dönüştürebilme yeteneğinden kaynaklanır ( Kaymakçı ve
ark.,2009; Sönmez ve Kaymakçı, 1986).
Hayvanların ihtiyaç duyduğu kaba yemin sağlandığı kaynakların en başında meralar
gelmektedir. Örneğin dünyada evcil hayvanların kaba yem ihtiyacının yaklaşık %70’inin
meralardan karşılandığı tahmin edilmektedir.(Brown ve Thorpe,2008).Ülkemizde ise bu
121
oranın %28.6 olduğu hesaplanmıştır (Gökkuş,1994).
Ülkemizde meralar köy orta malı oldukları için genellikle yoğun kullanıma maruz
bırakılmış, ıslah, bakım ve iyileştirmeye yönelik uygulamalar yapılamaması, kullanıcılara
belli bir yetki ve yükümlülük getirilememesi nedeniyle meraların örtüsü büyük oranda
bozulmuş ve ot verimleri azalmıştır(Gökkuş ve Koç,2001).Bunun sonucunda 1980’den sonra
genelde üretimin yapılamadığı diğer arazilerin oranı %8,6’dan %21,6’ya çıkarken, çayır mera
alanlarının oranının %28,2’den % 18,9’a inmesi (TÜİK,2010) bu durumu doğrulamaktadır.
Meralardan yeterince nitelikli yem üretilememesi ve yem bitkileri üretiminde azlığı,
hayvanlarımızın toplam tükettiği kaba yemin 2/3’ünün sap saman gibi niteliksiz yemlerden
oluşmasına sebep olmuştur.
Doğal çayır ve meraların ıslah yolu ile yem üretiminin artırılması yanında hayvanların
kaliteli yem gereksinimini karşılamak amacı ile tahıl yetiştirilemeyen tarla alanlarında da yem
üretiminin geliştirilmesi zorunlu olmaktadır. Bu bakımdan bazı buğdaygil ve baklagil yem
bitkilerinin karışık ekimlerini kapsayan entansif yapay meralar özel bir önem taşımaktadır.
Yapay mera tesisini oluşturan yem bitkilerinin karışık ekimlerinin yalın ekimlerden daha
fazla ve kaliteli yem vermesi yanında pek çok tarımsal yarar sağladığı değişik amaçlara
hizmet ettiği bilinmektedir.
Türkiye’de hayvan başına elde edilen karkas ağırlığı koyunlarda 13-17 kg iken, Dünya
genelinde ise karkas ağırlığı ortalama 15 kg olup ülkelere göre bu oldukça değişken değerler
almaktadır (Sanudo et.al., 1998a; Ekiz ve ark.,2009). Karkas ağırlığının düşük olmasının
nedenleri arasında koyunculuğun büyük miktarda(%97) verimi düşük yerli ırklardan oluşması
yanında, erken kuzu kesimlerin fazla olması ve hayvanların entansif besiye alınmadan
kalitesiz meralarda otlatılması suretiyle direk kesimhaneye gönderilmesi gibi faktörler
sayılabilir (Akçapınar, 1994; Ekiz ve ark., 2009).
Literatür Özeti
Meraların besleyebileceği bir hayvan kapasitesi vardır. Mera ıslahında seçilecek
bitkilerin toprağı kaplama alanı geniş, uzun boylu olması, rizom ve stolon meydana
getirmeleri gerektiği dikkate alınmalıdır. Mera karışımında mutlaka bir baklagil bulunmalıdır
(Abalı ve ark.1986).
Yapay çayır ve mera tesisi sulu veya kıraç şartlarda mera veya tarla arazisinde uzun
veya kısa süreler için yapay olarak kurulan yüksek verimli yem alanlarıdır. Doğal meraların
ihtiyacı karşılayamadığı veya verimlerinin düşük ve yapılarının bozuk olduğu yerlerde toprak
ıslahı amacıyla da yapay, çayır ve mera tesisi kurulur. Böylece normal bitki münavebesine
giren meralar toprak verimliliğini arttırır, yapısını düzeltir ve kendinden sonra gelecek olan
bitkilerin verimlerini de arttırırlar (Anonymous 1986).
Ülkemizde mera alanları 1940’lı yıllarda 44 milyon ha dolaylarında iken, 2000’li
yıllarda yaklaşık olarak % oranında azalarak 12,3 milyon ha’a düşmüştür. Bu süreçte, bir
büyük baş hayvan birimine düşen otlatma alanı 4,45 ha iken, günümüzde bu alan 0.45 ha’dır.
Mevcut hayvan varlığımızın yıllık kaba yem ihtiyacı ise 21.45 milyon tondur. Yem bitkileri
ile çayır meralardan 10.77 milyon ton kaliteli kaba yem elde edildiği düşünülürse, 10.68
milyon ton kaliteli kaba yem açığı söz konusudur (Anonim,2006).
Dünya üzerinde, binlerce hektarlık mera arazisi, yanlış otlatma nedeni ile bir insan ömrü
süresince ıslah edilemeyecek kadar zayıflamış ve tüketilmiştir. Bunların arzu edilen otlarla
verimli bir örtü ile kaplanması ve toprağın doğal süreçlerle ıslahı için uzun yıllara ihtiyaç
vardır. İyi planlanan ve idare edilen tohumlama programları, bu gibi arazilerin önemli bir
bölümünün 2-3 yıl gibi kısa bir süre içinde toparlanmasına olanak sağlayabilmektedir.
Toprağın iyileştirilmesi, terkedilmiş ürün arazilerinin ve bozulmuş meraların, tekrar bitki
örtüsüne kavuşturulması ile mümkün olabilmektedir (Akalan ve Doğan 1988).
Meralar sadece hayvanlara yem sağlayan kaynaklar değil, aynı zamanda erozyonu
önleyen, su toplama havzası olarak taban suyunu ve akarsuları zenginleştiren, kirli havayı
122
temizleyen, pek çok yabani hayvana yaşam ortamı olan, ormanlar, madenler ve petrol kadar
önemi olan doğal kaynaklardır. Meralarımızın toprak muhafazası ve erozyon kontrolü
bakımından önemi ise gün geçtikçe daha da artmaktadır. Çünkü ülkemizden her yıl 500
milyon ton toprak denizlere akıp gitmektedir. Toprak kaybının büyük bir kısmı aşırı otlatma
nedeniyle bitki örtüsünün zayıfladığı meralarda gerçekleşmektedir. Bu alanlarda erozyonla
mücadelenin en etkili yollarından birisi sürekli yada rotasyon yapay meraları kurulmasıdır
(Avcıoğlu ve Erekul,1996).
Yapay çayır-meraların kurulması ve geliştirilmesini gerekli kılan nedenlerden bazılarını
şu şekilde sıralamıştır: Doğal çayır-meraların verimlerinin düşük olması, doğal çayır
meraların botanik kompozisyonda değerli bitkilerin azalması, doğal çayır meraların yapısal
bozukluklarının ortaya çıkması yine soğuk iklim yem bitkilerinin kışlık olarak sonbaharda
ekileceğini, ancak kışların sert geçtiği İç Anadolu ve Doğu Anadolu Yörelerinde de bu
bitkilerin yazlık olarak ekilmesi gerekebileceğini, genel kural olaraktan kışlık ekim olanağı
bulunan bölgelerde bunun yazlık ekime yeğlenmesinin iyi olduğunu belirtmektedir. Suni
meralardan elde edilen kuru ot miktarının doğal meralara göre yaklaşık 3 katı daha fazla
olduğunu belirtmişlerdir (Avcıoğlu ,1999).
İşletmenin veya köyün mera yemi ihtiyacı da bazı hallerde bizi kültür meralarını
kurmaya zorlayabilir. Diğer ıslah yöntemleri nispeten uzun sayılabilecek bir sürenin sonunda
olumlu sonuçlar verir, verimi arttırırlar. Halbuki, kültür meraları yağışlı bölgelerde bir yıl,
kurak bölgelerde de iki en çok üç yıl sonra otlatılabilecek hale gelir ve bol yem üretimine
başlarlar. Bu bakımdan kültür meraları kurma, en kısa zamanda en çok yem üretimi sağlayan
bir yöntemdir ve kısa zamanda bol yemin karşılanması gerektiği hallerde, her durum ve
sınıftaki meralar üzerinde kurulabilirler (Bakır 1977).
Karışıma alınacak bitki türleri, bölgenin iklim ve toprak şartlarına iyice adapte oldukları
anlaşılmış bulunan tür ve varyeteler arasından seçilmelidir. Daha çok kurak ve yarı kurak
bölgelerde tercih edilen ve az sayıda bitki türlerinden oluşan karışımlara "Basit Karışımlar",
yağışlı bölgelerin çok türden oluşan karışımlarına da "Çoklu Karışımlar" adı verilmektedir.
Her karışımda en az bir buğdaygil yem bitkisi ile, bir baklagil yem bitkisi bulunmalıdır.
Kurağa ve soğuğa en çok dayanan bitkiler; adi otlak ayrığı (Agropyron cristatum), kır ayrığı
(Agropyron desertorum), adi otlak arpası(Elymus junceus), kılçıksız brom (Bromus inermiş),
kamışsı yumak (Festuca arundinacea), yonca (Medicago sativa), korunga (Onobrychis
sativa), nohut geveni (Astragalus cicer) dir (Bakır 1985).
Yıllardır süre gelen ağır ve erken otlatma sonucu özellikle İç Anadolu, Güneydoğu
Anadolu ve Geçit bölgelerinde meraların kuru ot verimleri yer yer 10-20 kg/da, bitki ile kaplı
alanları da % 10-20’ye kadar düşmüştür. Bu meraların ıslah edilerek yeniden verimli bir hale
getirilebilmesi için önce düzenli bir otlatma sisteminin uygulanması gerekmektedir
(Büyükburç., 1983).
Hayvanların beslenmesinde en önemli yem kaynağını oluşturan doğal çayır
meralarımızın yetersizliği yanında, yem bitkileri üretimimizde gerekli düzeyin çok altındadır
(Büyükburç., 1995).
Her daimi suni mera, erozyon kontrolünde temel olarak ve meranın uzun yıllar
devamını sağlamak üzere, çok yıllık ve toprak yüzeyini kaplayıp, çim kapağı meydana
getiren bir bitkiye sahip olmalıdır. Buna ilaveten her mera karışımı toprak strüktürünü gevşek
ve geçirgen tutmak ve kurak periyotlara daha iyi dayanmak için derin köklü çok yıllık
bitkileri ihtiva etmelidir. Suni meraların saf bir çeşit bitki yerine buğdaygil ve baklagilleri
içerisine alan bir karışım şeklinde tesisi öteden beri tatbik edilmekte olan bir usuldür. Ekim,
kullanılan buğdaygil ve baklagillerin isteklerine göre ilkbaharda veya sonbaharda
yapılmalıdır (Erkun ve ark.1968).
De Villiers ve ark. (2002) Süt emen kuzulara günlük ortalama 300-350 g ilave
konsantre yem verilmesiyle canlı ağırlık artışının 132 g dan 190 g a çıktığını, pazara yetişme
123
süresinin ise 119 günden 77 güne indiğini bildirmektedir. Bhatt (2008), benzer bir çalışmada
deneme sonu canlı ağırlığının ilave yem verilen kuzularda daha yüksek olduğunu (27 x 33)
kg bildirmektedir. Alcock’un (2006) çalışmasında, 98.gün sütten kesim CA ilave yem verilen
kuzularda verilmeyenlerden 7.2 kg daha ağır bulunmuştur.
Süt kuzularının beslenmelerine ilişkin olarak; Doney ve Peart (1976), süt emme
dönemindeki kuzulara, tükettikleri sütün yanısıra 10.2 MJ ME/kg enerjili yoğun yem karması
yedirmişler ve araştırma sonucunda kuzuların canlı ağırlık artışlarının 300-420 g/gün olarak
saptamışlardır.
Duarte ve Ortega (2000), creep yemlemenin kuzular üzerindeki etkisini belirlemeye
çalıştıkları araştırmalarında, günlük canlı ağırlık artışının, süte ek olarak yoğun yem tüketen
gruplarda 205-288 g, sadece süt içen kontrol grubu kuzularda 110 g olduğunu bildirmişlerdir.
Söz konusu sonuçlardan, creep yemleme uygulaması ile süt kuzuların besiye, uygun ağırlıkta
ve daha az stresle girmelerini sağlamanın mümkün olduğu söylenebilir.
Türkiye kuzu eti üretiminde, optimum kesim ağırlığındaki ve yağlılık düzeyindeki
kuzulardan sağlanan karkasların elde edilmesi amaçlanmalıdır. Türkiye’de kuzularda
ortalama karkas ağırlığı 14.75 kg/baş’dır (Kaymakçı ve ark., 2000). Bu değerin optimum
düzeyde karkaslar elde etmek için besleme şartları da göz önüne alınarak 19 kg/baş civarına
yükseltilmesi mümkündür.
Orta Anadolu kıraç koşullarında bir yapay mera karışımının tohum oranları üzerine
yapılan bir araştırmada; uyumlu bir yapay mera karışımı için dekara 600 gr mavi ayrık, 900
gr kılçıksız brom ve 100 gr yonca tohumu atılması önerilmiştir. Bu durumda 1 m ye düşen
saf çanlı tohum oranı mavi ayrıkta % 30, kılçıksız bromda % 59 ve yoncada % 11 olmuştur.
Genel ortalama kuru ot verimi 225 kg/da olarak bulunmuştur (Kurt 1982).
Orta Anadolu kıraç şartlarında bir suni mera karışımlarının belirlenmesi üzerine yaptığı
çalışmada mavi ayrık, kılçıksız brom ve yonca bitkilerinin en uygun karışım olduğunu tespit
etmiştir (Kurt ,1982).
Bir çok araştırmacı, kurağa çok ve/veya orta derecede dayanıklı şeklinde bitkileri şöyle
sıralamaktadırlar. Çok yıllık baklagiller; korunga, yonca, sarı taş yoncasını. Çok yıllık
buğdaygiller; adi otlak ayrığı, koyun yumağı, kılçıksız brom ve domuz ayrığını
göstermektedirler (Tosun 1974; Sağlamtimur ve ark.1995; Eraç ve Ekiz 1990).
Çayır-meraların; ucuz kaba yem temini ile ekonomik önemi yanında, erozyonu
önlediğini, su muhafazasını sağladığını, havayı temiz tuttuğunu, çeşitli av ve yaban hayatının
devamını sağladığını ve insanlar için piknik alanları olduğunu belirtmişlerdir. Ülkemizde son
50 yılda çayır-mera alanlarının yarıya indiğini ve bu durumunda, erozyona davetiye
çıkardığını ifade etmişlerdir. Ülkemiz arazilerinin % 20’si orta, % 36.4’ü şiddetli, % 16.0’ı
çok şiddetli erozyona maruz olduğunu, toprağın oluşumunu sağlayan, toprağı koruyan,
havayı temizleyen, insanı dinlendiren, hayvanları besleyen ve birçok yönleriyle fayda
sağlayan çayır- mera alanlarının bir kaynak olduğunu belirterek, dikkate alma zamanında
gelmiş ve hatta geçmekte olduğunu bildirmektedirler (Mülayim ve Acar 1996).
Türkiye hayvancılığının en önemli sorunu yem olup; bu sorun önemli ölçüde bitkisel
üretime, özelliklede yem bitkileri üretimine ve çayır meraların durumuna bağlıdır. Son 35 yıl
içinde çayır-mera arazisi 16 milyon hektar azalmış olduğunu bildirmişlerdir. Mevcut tahıl
vejetasyonda bulunan bitki gurupları içerisinde iyi cins yem bitkileri azalmış, bitkilerin
erken, aşırı ve düzensiz otlatılması ile de verim güçlerini çoğu yerde önemli oranda
kaybetmeye başladığını söylemişlerdir. Özellikle iklim şartlarının olumsuz olması sebebi ile
Orta Anadolu meralarının en fazla etkilenen yerler olduğunu, bu alanlardan yem sağlamak bir
yana, mera toprağını yerinde tutmak bile mümkün olmadığını belirtmişlerdir. Ülkemiz de
hayvan beslemede önemli yer tutan meraların % 701nin verimsiz olduğu hale geldiğini. %
30’dan fazlasında ise suyun ve otlatmanın düzenlenmesi gerektiğini; verimsiz hale gelmiş
olan % 70’inin yeniden ekilerek tesis ve ıslahı gerektiğini, bu gün büyük kısmi örtüsü
124
bakımından yeterli olmaktan uzak olan meralarımızın doğal tohumlama ile ıslahının
olmayacağını da ifade etmişlerdir (Mülayim ve Acar 1997).
Hızlı büyüme sonucu vücutta, vücut kompozisyonunda, organ büyüklüklerinde ve yağ
doku depolanması ve yağ asiti kompozisyonunda değişimler ortaya çıkabilmektedir (Polat
2000).
Suni mera karışımında karışıma girecek türlerin seçiminin önemli olduğuna, türlerin
bölgenin iklim ve toprak şartlarına uyum göstermiş olmaları gerektiğini, bölgede denenmemiş
bitki türlerinin kullanılmasından kaçınılmasını, her bir karışımın en az bir baklagil ve bir
buğdaygil içermesi gerektiğini, türlerin belirlenmesinden sonrada bunların hangi oran ve
miktarda olacağının tespit edilmesi gerektiğini belirtmiştir (Ünal, 2001).
Yıllık 200-350 mm yağış miktarına görede şu karışımları tavsiye etmektedir:
Karışıma Giren Bitki
% Karışım Oranı
Tohum Miktarı(kg/da)
1-Adi Otlak(veya kır)Ayrığı
% 70
2.0
Yonca____________________________ % 30 __________________ 0.5
2-Adi Otlak Ayrığı
% 60
1.0
Korunga
% 40
4.0
3-Yonca
% 30
0.5
Mavi Ayrık
% 35
1.0
Kılçıksız Brom
% 35
0.8
4-Adi Otlak Ayrığı
% 30
0.6
Çayır Düğmesi
Koyun Yumağı
% 40
% 30
2.0
0.4
İlave yemleme yapılarak sütten kesim CAA’nı artırmanın yanı sıra, kuzuların
analarından daha az stresle ayrılması ve katı yemlere de daha kolay alışması da
sağlanmaktadır (Morrical, 1990).Yüksek proteinli konsantre yemlerin (HP%21) süt emme
dönemindeki kuzuların canlı ağırlık artışını daha çok hızlandırdığını Polat (2000), Karim ve
ark (2001) bildirmektedir.
Ülkemiz meralarının çoğunluğu aşırı ve erken otlatma nedeni ile dejenere olurken,
doğal bitki örtüsünü de kaybederek çıplaklaşmış ve erozyona açık alanlar haline gelmiştir (
Andiç., 1977; Büyükburç., 1983).
Tekeli (1977), kurak bölge şartlarında suni mera kurmak için en uygun ekim
yönteminin tespiti çalışmalarında yonca, kılçıksız brom ve mavi ayrık kullanmış, tohumların
karışık veya ayrı ayrı olarak sıraya ekimlerinin elverişli ekim yöntemi olduğunu belirtmiştir.
Materyal ve Metot
Araştırma Yeri
Araştırma bölgesi olan Konya İli Karapınar ilçesi 37°, 42‘, 54 sn kuzey, 33°, 32‘, 54 sn
doğu koordinatlarında, Enlem 37,7150°, Boylam 33,5484° olup Rakım 995 m dir.
Bölgede; yarı kurak ve karasal iklim hakim dir. Yazları kurak, geceleri soğuk ve
gündüzleri sıcaktır. Bu yerde ortalama yıllık yağış toplamı yaklaşık 270-280 mm arasında
değişmekte olup, bunun % 40’ı kış yağışları şeklindedir. Büyüme sezonu boyunca düşen
yağış miktarı sadece 90-120 mm arasında olup, sulanmadan bitki yetiştirilmesi hemen hemen
imkansızdır. Ortalama yıllık sıcaklık 11 °C dir.
Karapınar bölgesinde topraklar alluviyaldir. Toprak bünyesi genellikle üst toprakta
hafif (tınlı kum), aşağılarda ağır (kil) dir. Topraklar kireç ve potasça zengin, organik madde
ve fosforca fakirdir. Rüzgarın bu sahadaki hakim yönü kuzey-doğu ile güney-batı
istikametindedir. Ortalama rüzgar hızı 2.92 - 3.50 m/sn arasındadır.
Yapay Mera Karışımı
Yapay mera karışımında Çok yıllık çim (Lolium perenne L, % 30), Kamışsı yumak (
125
Festuca arundinacea Schreb ( % 20 ) , Domuz ayrığı (Dactylis glomerata,,% 20), Korunga (
Onobrychis sativa ( % 10), Yonca ( Medicago sativa %5), ak üçgül (Trifolium repens L.
%15) türleri kullanılmıştır.
Deneme Deseni
Tesadüf blokları deneme deseninde 2 tekerrürlü olarak kurulmuştur. Otlatma
denemesi, her biri 6 da büyüklüğünde 4 adet parselden oluşmuştur.
Meranın kurulması
Denemenin yürütüldüğü mera alanı yetiştiricinin ağılına yakın ekilebilir fakat tahıl
ziraatı yapılamayan arazisine yapay mera kurulmuştur. Mera alanı 24 da dır.
Çalışmada kullanılan tohumların küçük olması, çimlenme ve çıkış zorluğu nedeniyle
tohum yatağı hazırlığı özenle yapılmıştır. Pullukla derin sürümün ardından birkaç kez diskaro
ve kazayağı-tırmık kombinasyonu çekilerek toprak iyice ufalanmıştır.
Tohum ekimi 2011 yılı Mart ayında mibzer ile yapılmıştır. Ekim derinliği 1.5 cm olarak
ayarlanmıştır.
Ekimden önce tohumların safiyet ve çimlenme güçleri belirlendikten sonra SCT (saf
canlı tohum) oranları hesaplanarak ve buna göre ekilecek tohum miktarları belirlenmiştir.
(Altın ve ark., 2005).
Kurulan meranın bakımı
Projenin yürütüldüğü araziden alınan toprak örneklerinin analizi dikkate alınarak
(Kacar, 1972) hesaplanan gübre miktarı 3 kg/da verilmiştir. Denemede azotlu gübre olarak
amonyum nitrat (%33 N) uygulanmıştır (Gökkuş ve Koç, 2001).
Denemenin için kurulan mera, sondaj kuyusundan temin edilen su ile yağmurlama
sulama yöntemiyle sulanmıştır.
Otlatma
İlk yıl meralar otlatılmamıştır. Bitkilerin büyüme ve gelişme performanslarına
bakılmıştır. İlk yıl otlatma yapılmadığı için mera biçilerek hayvanların önlerine verilerek
değerlendirilmiştir. Mera kurulduktan bir sonraki yıl Mayıs ayında hayvanlara yeşil ot
sağlayacak şekilde bitki kompozisyonu iyileştirilip otlatmaya açılmıştır. Otlatma denemesi
2012 yılında 11 Mayıs da başlamıştır.
Merada otlatılacak hayvan sayısı ve otlatılacak gün sayısını hesaplamak için
aşağıdaki formülden hesaplanmıştır (Milligan ve ark.,1987).
Otlatma öncesi kuru ot miktan (kg) + Alan(ha)
Otlatma gün sayısı = -----------------------------------------------------------Hayvan sayısı(baş) x Hayvanın KM tüketimi (kg/gün/baş)
Deneme merasının etrafı kafesli teller ile muamele parselleri ise geçici çitlerle
çevrilmiştir. 24 da lık arazide iki otlatma grubu oluşturulmuştur. 1. grup: Yapay mera + ana
sütü, 2. grup: Yapay mera + ana sütü + ek yemleme
Deneme kuzuları ile anaları parsellerde rotasyonlu otlatılmıştır. Deneme 60 gün
sürmüştür. Deneme sonunda kuzular tartılıp otlatma sonlandırılmıştır. Deneme bittikten sonra
deneme parselleri merada otun büyümesi mevsimsel şartlardan dolayı durana kadar koyun ve
toklulardan oluşan sürüler ile rotasyonlu olarak karışık otlatılmıştır.
Meralardan örnek alınması
Denemenin ikinci yılında otlatma uygulamasının başlaması ile birlikte, Mayıs2012’den2’itibaren meradan 21 günde bir örnekler alınmıştır. Örnek alımları için 1m lik
(1.0x1.0) kuadratlar kullanılmıştır (Gökkuş ve ark., 1993; Avcıoğlu, 1996). Örnek alma
zamanında, hem otlatılan kısımlardan hem de korunan kısımlardan 4’er adet örnek alınmıştır.
Böylece hem meraların üretim kapasitesi ve hem de üretilen otun ne kadarının hayvanlar
tarafından tüketildiği tespit edilmiştir.
Araştırma Süresince Merada Yapılacak Ölçüm ve Gözlemler
Yeşil ot verimi (kg/da): Otlanan ve otlanmayan alanlarda 20 günde bir yeşil ot verimi tespit
126
edilmiştir. Bu amaçla 1mx1m ebatlarında kuadratlar kullanılmıştır. Kuadrat içindeki bitkiler
toprak seviyesinden 2 cm yüksekliğinden biçildi ve tartıldı. Elde edilen değerler dekara
çevrilerek yeşil ot verimi belirlendi (yukarıdaki şekil)
Kuru ot verimi (kg/da): Yeşil ot verimi tesbiti için biçilmiş olan 150 gr’lık kuadrat örnekleri
70°C’de 72 saat kurutularak hassas terazide tartılmıştır. Bu değerlerden faydanılarak dekara
kuru ot verimleri hesaplanmıştır (Akyıldız,1984).
Botanik kompozisyon (%): Otlatmanın etkilerini belirlemek amacıyla, otlatma yapılan
alanda 21 günde bir ağırlığa göre botanik kompozisyon tespiti yapılacaktır. Her parselden 5
adet 0.4 m2’lik kuadrat biçildikten sonra alınan ot örnekleri laboratuarda türlere göre ayrılarak
kurutulup tartıldı, her türün ağırlığı toplam ağırlığa oranlanmak suretiyle bitki bileşimi
hesaplanmıştır(GökkuşveAltın,1986).
Ham protein oranı (%):Homojen şekilde öğütülen mera örneklerinin ham protein oranı
N*6,25 formülü ile çarpılarak hesaplandı ve azot tayin cihazı LECO FP 528 ile belirlenmiştir
(AOAC 1990).
Kuru Madde Oranı (%): Örnekler etüvde 105 oC’ de 4 saat kurutularak,ağırlık (su) kaybını
belirleme esasına dayanılarak nem oranı tespit edilmiştir. (Karabulut ve Canbolat 2005)
Asit Detergent Fiber(ADF) Oranı: Kuru madde verimleri belirlenen ve 1 mm’lik elekten
geçecek şekilde öğütülen otların hücre duvarı bileşenlerini oluşturan asit deterjan lif
ADF(Asit deterjanda çözünmeyen lif) analizleri ise Van Soest ve ark. (1991) tarafından
bildirilen
yöntemlere göre Gerhardt FiberAnalyzer(Germany)
cihazı
kullanılarak
belirlenmiştir.
Nötral Detergent Fiber(NDF) Oranı: Kuru madde verimleri belirlenen ve 1 mm’lik elekten
geçecek şekilde öğütülen otların hücre duvarı bileşenlerini oluşturan nötr deterjan lif
NDF(Nötr deterjanda çözünmeyen lif) analizleri ise Van Soest ve ark. (1991) tarafından
bildirilen yöntemlere göre Gerhardt FiberAnalyzer(Germany)
cihazı
kullanılarak
belirlenmiştir.
Hayvan Materyali:
Denemede yetiştirici şartlarında yetiştirilen 3-4 yaşlı Merinos ırkı koyunlardan doğan yaşları
birbirine yakın 2,5 aylık yaşta dişi ve erkek tekiz kuzular kullanılmıştır.
Koyunların Tohumlanması
Deneme ve kontrol grubu için koyunlar 15 Ağustos- 10 Eylül arasında sürüde yer alan 250
baş koyun bir örnekliliği sağlamak için kısa sürede serbest aşım olarak tohumlanmıştır.
DoğanKuzuların Bakım ve Beslenmesi
Deneme yapılan işletmede doğan kuzular kuruduktan sonra ilk 12 saat içinde 10 g a
hassas terazi ile tartılmış ve kulak numarası ile numaralandırılmıştır. Kuzuların doğum
ağırığı, genotipi, doğum tarihi, cinsiyeti, doğum tipi, ana numarası kaydedilmiştir.
Kuzular 2,5 aylık yaşa kadar anaları ile birlikte kaldılar ve protein değeri yüksek % 18
HP 2800 k/cal ME içerikli kuzu büyütme yemi ile beslendiler. (Tablo 1). Denemeye
alınmadan önce aç karnına tartılarak besi başı ağırlıkları alınarak mera denemesi başlatıldı.
Besi Performansı
Yaklaşık 2,5 aylık yaştaki tekiz dişi ve erkek kuzular deneme öncesi canlı ağırlıklarına
göre seçilip deneme gruplarına yerleştirilmişlerdir. Bu amaçla geceden su ve yem verilmeyen
kuzular canlı ağırlıkları tespit edilmiştir. Mera denemesi 11 Mayısta başlamış 17 Temmuzda
bitmiştir. Yapay meradan yararlanacak olan 1.grup, meraya ilaveten sadece anne sütünden
yararlanmıştır. Kuzular gündüzleri analarıyla beraber meraya gitmişlerdir. Ek yemleme
uygulanacak 2.grupta ise, mera+ ana sütüne ilaveten kuzulara % 16 HP, 2700 k/cal ME
(Tablo 2) içerikli yoğun yem karması 250 g ile başlayarak ad-libitum olarak verilmiştir. Bu
gruptaki kuzularda gündüzleri anaları ile birlikte meraya giden kuzular mera dönüşü ayrı
bölmeye alınmış ve karma yem ile grup halinde beslenmişlerdir. Bu amaçla özel bir yemlik
yapılmıştır. Yemlik yaklaşık 8 saat hayvanların önünde bırakılmıştır. Yem tüketimleri ise 10
127
günde bir alınmıştır. Kuzuların tükettikleri yem miktarı ise; tartı dönemleri arasında verilen
yem ile yemlikte kalan yem farkından yararlanılarak belirlenmiştir.
Kontrol grubunu entansif besi grubu oluşturmuştur. Bu gruptaki erkek kuzular 2,5 aylık
yaşta sütten kesilmişlerdir. Deneme grubundaki kuzulara % 16 HP, 2700 k/cal ME içerikli
yoğun yem karması verilmiştir. Konsantre yem karması 250 g dan başlayarak tedricen
arttırılarak ad-libitum olarak, kaba yem olarak yem tüketiminin %30’u kadar meradan biçilen
ot kurutularak verilmiştir.
Deneme ve kontrol grubundaki kuzuların canlı ağırlıkları 50 gr hassasiyetli elektronik
tartı alınmış ve kaydedilmiştir.
Besi süresi boyunca grup halinde beslenen kuzular, 10 günde bir canlı ağırlıkları tespit
edilerek besi performansları, yemden yararlanma kabiliyetleri, besi süresi boyunca aldığı
ilave yemi hangi ölçüde ve ne şekilde değerlendirebildiği gibi parametreler hesaplanmaya
çalışıp veriler tablolaştırılmıştır.
Karkas özellikleri
Yetiştirici şartlarından satın alınıp Enstitüye getirilen yaşları birbirine yakın Merinos
tekiz dişi ve erkek kuzular besi sonunda (60. gün) rastgele 6’er baş seçilerek ( her tekerrür
grubundan 6x6) toplam 36 baş kuzunun kesim ve karkas özellikleri incelenmiştir. Kuzuların
kesim ve karkas değerlendirmeleri için KONET adlı özel mezbahada yapılmıştır.
Kuzular kesim öncesi yaklaşık 18 saat aç kalmışlardır. Kuzuların kesim öncesi canlı
ağırlığı ile besi sonu vücut ölçüleri ( cidago yüksekliği, göğüs çevresi, göğüs derinliği, göğüs
genişliği, sağrı genişliği, vücut uzunluğu) alınmıştır. Kesim sonrasında kesim özellikleri
olarak sıcak karkas, deri, baş 4 ayak, takım ve iç yağı ağırlıkları alınıp kaydedilmiştir.
Karkasların 24 saat süre ile, +4°C lik soğuk depoda bekletilmesinden sonra soğuk
karkas ağırlıkları alındıktan sonra bazı karkas ölçüleri ( göğüs çevresi, göğüs genişliği, göğüs
derinliği, karkas uzunluğu, but çevresi, but genişliği, but derinliği, but uzunluğu, sağrı
genişliği) alınmıştır.
Kesim sırasında karkasın üzerinde bırakılan böbrekler, testisler, böbrek + leğen yağları,
ve kuyruk çıkarılıp ağırlıkları tespit edilmiştir.
Daha sonra karkaslar Colomer-Rocher ve ark.(1987) tarafından bildirilen standart
karkas parçalama yöntemine göre parçalara ayrılmıştır. Bu yöntemde yarım karkas üzerinde
çalışılmakta, karkas; boyun, omuz (kollar), etek, sırt- bel (kaburgalar) ve butlar olmak üzere 5
ana parçaya ayrılmaktadır.
Şekil 9. Karkas parçalama yöntemi
Daha sonra karkas omurga boyunca iki eşit parçaya bölünmüştür. Parçalama işlemi sol
yarım karkas üzerinde yapılmıştır. Karkas parçalarının ağırlıkları 10 g duyarlı terazi ile
belirlenmiştir. Ayrıca 12-13. Kaburgalar arasından aydınger kağıdına çizilen göz kası alanları
dijital planimetre ile saptanmıştır.
128
Şekil 10. Sol yarım karkas üzerinde yapılan çalışmalar
Karkasta doku kompozisyonunun belirlenmesi amacıyla sol yarım karkasta 6. ve 12.
kaburgalar arası örnek olarak alınmıştır. Alınan örnekte, keskin ve sivri uçlu bir bıçakla
kemik, kas, kabuk yağı ve diğer dokular (atılan) fiziki olarak ayrılmış ve ayrılan parçalar 10
g’a duyarlı terazi ile tartılarak bunların örnek ağırlığındaki payları bulunmuştur.
Şekil 11. Sol yarım karkasta 6 ve 12. Kaburgalar arasından alınan örnek
üzerinde doku kompozisyonu çalışması
Kesilen hayvanlar yüzülüp baş, deri, 4 bacak, testis ve iç organlarından ayrıldıktan
sonra; böbrek ve leğen yağları dahil edildikten sonra karkas ağırlığı belirlenmiştir. Karkaslar
129
soğuk hava deposunda +4 °C’de 24 saat tutulduktan sonra soğuk karkas ağırlığı
belirlenmiştir. Sıcak karkas ağırlığının kesimhane ağırlığına bölünmesiyle yüzde oranı olarak
randıman bulunmuştur. Kesimden sonra her kuzuda ayrı ayrı deri, baş ve dört bacak ve testis
ağırlıkları saptanmıştır. Soğuk havada 24 saat soğutulmuş karkasta böbrek çevresi ile leğen
boşluğundaki yağların ağırlıkları belirlenmiştir. Soğuk karkaslardan karkas ölçüleri ( göğüs
çevresi, göğüs derinliği, vücut uzunluğu, but çevresi, but genişliği) Eliçin ve ark. (1976) ve
Ertuğrul’un (1985) bildirişlerine göre ölçü bastonu ve ölçme şeridi ile alınmıştır. Karkas
parçalanmasında Colomer-Rocher ve ark. (1987)’nin bildirdiği şekilde, karkaslar askı
üzerinde omurga boyunca iki eşit parçaya ayrılarak tüm parçalama işlemleri sol yarım karkas
üzerinde yapılmıştır. Bu yönteme göre sol yarım karkas, sırt-bel, etek, ön kol, but ve boyun
olmak üzere beş parçaya ayrılmıştır. Ayrıca 12-13. kaburgalar arasından aydınger kağıdına
çizilen Musculus longissimus dorsi(göz kası) alanları dijital planimetre ile ölçülerek
kaydedilmiştir. Karkas kesim işleri özel sektöre yaptırılmıştır.
Ekonomik analiz
Bu çalışmada, Türkiye hayvancılık sektörü içerisinde önemli bir yeri olan koyunculuk
üretim faaliyetinin maliyet ve karlılık analizinin yapılması da amaçlanmıştır. Çalışmada
otlatma gruplarına göre değişken masraf (yem, veteriner sağlık, makine, pazarlama) sabit
masraf (yönetim giderleri, işçilik, amortisman, bina anapara faizi, makine amortismanı, alet
makine anapara faizi), ve üretim masrafları belirlenmiştir. Kuzular satıldıktan sonra kuzu
başına gelir bulunmuştur. Brüt kar kuzu başına gelirden değişken masrafların çıkarılmasıyla
bulunmuştur. Net kar ise kuzu başına gelirden toplam üretim masraflarının çıkarılmasıyla
bulunmuştur. Hangi otlatma grubunda karlılığın daha yüksek olduğu tespit edilecek ve
koyunculuk üretim faaliyetinin karlı bir şekilde yapılması için çeşitli önerilerde
bulunulmuştur.
İstatistik analizler
Araştırmada bitki örneklerinden elde edilen verilerin değerlendirilmesinde Tekrarlanan
Ölçümlü Deneme düzeninde varyans analizi tekniğinden yararlanılmış, besi ve karkas
özelliklerine etkisini belirlemek için ise Tesadüf Parselleri Deneme Deseninde Faktöriyel
Düzende (Besleme sistemi* Cinsiyet) analiz edilmiştir. Ortalamaların karşılaştırılmasında ise
Duncan çoklu karşılaştırma testi kullanılmıştır. Söz konusu istatistik analizlerinin
yapılmasında SPSS istatistik paket programından yararlanılmıştır (Winer ve ark., 1991).
BULGULAR ve TARTIŞMA
Farklı tarihlerde biçilen yapay meranın ot verimine yönelik bilgiler Tablo 3’de
verilmiştir. Tablo 3’den de görüleceği üzere dekar başına elde edilen yeşil ot verimi ve kuru
madde verimi biçim tarihlerine göre farklılık göstermiştir (p<0,0001). Yine Tablo 3’den
görüleceği gibi farklı biçim tarihlerine göre mera bitki örtüsünün çoğunluğunu
buğdaygillerden meydana geldiğini, ikinci sırada baklagiller son sırada ise diğer
familyalardan türler (yabancı ot) yer almıştır. Biçim tarihlerine göre buğdaygil ve baklagil
oranlarının (P<0,001) önemli diğer familyalarınki ise önemsiz bulunmuştur.
Genellikle gerek ülkemiz gerekse dünya meralarında buğdaygiller hayvanların tükettiği
yemin büyük bir kısmını oluşturmaktadır (Holeckek ve ark.,2004).Bu araştırma merasında da
aynı durum görülmüştür. Ancak burada buğdaygillerin fazla olması, meraya %70 buğdaygil
içeren yem bitkileri karışımı ekilmesinden kaynaklanmıştır. Ekilen buğdaygiller içerisinde
özellikle çok yıllık çim iyi bir çıkış ve gelişme göstermiş, bitki örtüsünün hakim türü
konumuna geçmiştir. Bu yüzden merada buğdaygil hakimiyeti beklenen bir durumdur. İlk
yılda çok yıllık çim süratle geliştiği için diğer türlere zarar vermemek için merada otlatma
yapılmamış ancak biçilerek değerlendirilmiştir. Diğer familyalardan türler ekilen bitki
grubunda yer almamakla birlikte hepsi, mevcut çevreye en iyi uyum sağlayan bitkiler olduğu
için bu türlerin bitki örtüsünde bulunması kaçınılmazdır. Zira yabani bitkiler ekilen türlere
göre çevre faktörlerinden daha iyi yararlanmaktadırlar (Altın ve ark.,2005b; Riewe ve
130
Mondart, 1985). Araştırma merasında bu yabancı familyaların oranı önemsiz bulunmuştur.
Araştırmadan elde edilen verilere göre, kuru ot verimleri arasındaki farklılıklar otlatma
zamanları arasında önemli çıkmıştır (P<0,001). Verimler ilk otlatmanın yapıldığı biçim
aralığında (11.05.2012-31.05.2012) yüksek değerine yükselmiş, daha sonraki biçim
aralıklarında ise giderek azalmıştır (Tablo 3).Botanik kompozisyonun çoğunluğunu oluşturan
türler, ekilen serin iklim yem bitkilerinden meydana gelmiştir. Serin iklim bitlileri
gelişmelerini yılın serin dönemlerinde yaptıkları (Soya ve ark., 2004) için yıl içerisinde en
yüksek üretime ilkbaharda ulaşmaktadırlar. Başlangıçta serin giden toprak ve hava Mayıs
ortasına rastlayan ilk otlatmanın sonunda iyice ısınarak serin iklim bitkilerinin gelişmesi için
uygun hale gelmiştir. Toprakta yeterince nem de bulunduğundan ilk otlatma döneminde ot
verimi en üst seviyesine ulaşmıştır. Diğer otlatma zamanları Haziran sonu ve Temmuz
ortasına rastlamaktadır. Bu aylarda havalar iyice ısınmakta ve bitkilerin gelişme hızı
yavaşlamaktadır. Bu durum mera bitkilerinin yeniden gelişmesini sınırlamaktadır. Zira serin
iklim yem bitkileri en iyi büyümelerini 20°C civarındaki sıcaklıklarda yapmaktadırlar
(Miller,1984). Günlük sıcaklıkların ( özellikle gündüz sıcaklıklarının) bu dereceye aşması
halinde serin iklim bitkilerinde enzim etkinliğinin azalması, reaksiyon oranlarında dengesizlik
ve sentez faaliyetlerinde azalma meydana geldiği için büyüme yavaşlamaktadır (McCloud ve
Bula,1985). Merada otlayan hayvanların tükettikleri yem miktarları ot verimine ve
kalitesine(besleme değeri, lezzetlilik, sindirilebilirlik) bağlıdır ( Langevelde ve ark.,2008).
Otlatma dönemleri içinde en verimli ve kaliteli ot ilk otlatma döneminde üretilmiştir. İkinci
sırada ise ikinci otlatma dönemi yer almaktadır (Tablo 3).
Hayvanların otladığı meraların KM içerikleri bitkinin olgunlaşmasına paralel olarak bir
artış göstermiştir. Bitki olgunlaştıkça KM içeriğinde meydana gelen artış (Tablo 4) daha önce
yapılmış olan bazı çalışmalarla desteklenmiştir (Muruz ve ark.,2000; Karslı ve ark.,2003;
Kaya ve ark.,2001). Biçim zamanlarında meradan alınan örneklerin KM düzeyleri arasındaki
farklılığın görülmesi (11.05.2012-17.07.2012), hayvanların merada yeşil yani KM düzeyi
düşük otları seçmesine bağlı olarak, meranın KM düzeyinin artışı şeklinde açıklanabilir.
Karslı ve Küçük,(2000), hayvanların otlama esnasında bitkinin yeşil ve besin değeri yüksek
kısımlarını seçtiğini bildirmişlerdir. Ayrıca, kuru madde değerinin % 93 olması iyi bir
kurutma dönemi geçirdikleri de belirlenmiştir. Kuru otlarda KM içeriğinin genellikle %88-92
arasında değişiklik gösterdiği bildirilmektedir (Ensminger ve ark.,1990; Pond ve ark.,1995).
Meranın HP içeriği vejetasyonun ilerlemesine bağlı olarak azalmıştır. Hayvanların
otladığı alanlardan alınan örneklerin HP değeri başlangıçta % 17.25 iken bu değer
vejetasyonun ilerlemesiyle % 16.91, % 15.73 ve % 15.51 olarak bulunmuştur (P<0,001).
Yapılan bir çalışmada (Karslı ve ark,2003) meradan aldıkları örnekler sonucunda HP
değerlerini %15.74, %12.41, % 10.63, % 8.71, % 8.16, %7.30 ve % 7.04 (P<0,001) olarak
bulmuşlardır. Yine yapılan bir çalışmada, benzer şekilde vejetasyonun ilerlemesiyle bitkinin
HP değerinin azaldığı bildirilmiştir (Horney,1996).
Meranın farklı biçim tarihlerinde alınan örneklerin NDF ve ADF içeriklerindeki
değişim Tablo 4’de sunulmuştur. Tablo 2 incelendiğinde NDF değerleri örnekleme dönemleri
sırasına göre % 53.75, % 56.94, % 55.25, ve % 57.13; ADF değerleri ise % 32.96, % 35.66,
% 36.28 ve % 34.87 olarak bulunmuştur (P<0,001). Mera otun bünyesinde NDF ve ADF gibi
lifli bileşiklerin miktarının yükselmesi otun sindirilme oranını azalttığı (Özaslan- Parlak ve
ark., 2011; Alatürk, 2012) gibi yem tüketimini de düşürmektedir (Can ve ark., 2008). Ayrıca
çevre faktörlerinin ilkbahara göre elverişsiz hale gelmesi de yem tüketimini azaltan başka bir
neden olabilir (Can ve ark., 2008).
131
Tablo 3: Farklı tarihlerde biçilen mera otlarının verim özelikleri
Biçim Tarihleri
Yeşil ot kg/da
Kuru ot kg/da
Buğdaygil %
Baklagil %
Yabancı ot %
11.05.2012
6640±400,0 a
2603±154,5a
77,20±0,6c
20,30±0,5a
2,50±0,25
31.05.2012
4075±205,6b
1970±106,0b
80,03±0,4b
16,83±0,7b
3,15±0,34
26.06.2012
3400±158,1b
1505±115,7c
81,73±0,6ab
15,93±0,4b
2,35±0,23
17.07.2012
1620±340,7c
625±173,8d
82,25±0,7a
15,45±0,5b
2,30±0,16
***
***
***
***
***
ÖNEM
***P<0,001
Tablo 4: Farklı tarihlerde biçilen mera otlarının besin madde içerikleri,%
Biçim Tarihleri
Kuru Madde
ADF
NDF
Ham Selüloz
Ham Protein
11.05.2012
93,38±0,05b
32,96±0,42c
53,75±0,41b
35,05±0,68a
17,25±0,25a
31.05.2012
93,58±0,15b
35,66±0,33ab
56,94±0,46a
32,87±0,65ab
16,91±0,36a
26.06.2012
93,65±0,07b
36,28±0,28a
55,25±0,56b
31,83±1,12b
15,73±0,19b
17.07.2012
94,28±0,10a
34,87±0,34b
57,13±0,79a
27,92±0,56c
15,51±0,54b
ÖNEM
***
***
***
***
***
***P<0,001
Mera otunun kimyasal bileşimi ile ilgili yapılan değerlendirmede genel olarak
örnekleme zamanına göre otun kimyasal yapısının değiştiği görülmüştür. HP kapsamı otlama
başında yüksek, ilerleyen otlatma zamanlarında düşük çıkmıştır. Buna karşılık NDF ve ADF
miktarlarında tersi bir durum görülmüştür (Tablo 4). Bitkiler büyümelerinin başlangıç
dönemlerinde yeşil ve körpe dokulara sahiptirler. Hızlı büyüme dönemlerinde olan böyle
bitkilerde hücre içi (protoplazma) maddeleri fazla, buna karşılık çeper maddeleri
(pektin,selüloz, hemiselüloz,lignin) düşük düzeylerdedir (Lyons ve ark.,1999). Genç
hücrelerde fizyolojik faaliyetler (hücre içi faaliyetleri) yoğun olduğu için, bu faaliyetleri
kontrol eden protein (enzim) oranı da fazladır. Bu dönemde protoplazma maddelerinin çeper
maddelerine oranı yüksektir. Hücredeki yapısal olmayan bileşikleri temsil eden hücre içi
bileşiklerin sindirimleri, lezzetlilikleri ve besleme değerleri fazladır (Moore ve
Hatfield,1994). Buna karşılık bitki büyümesi ilerledikçe protoplazma küçülerek yapısal
bileşikler (çeper maddeleri) artmaktadır. Hücre çeperini oluşturan bileşikler sindirimi zor
olan bitki kısımlarıdır. Bunların bir bölümü ancak geviş getiren hayvanların işkembesindeki
mikroflora tarafından parçalanmakta ve değerlendirilmektedir. Ayrıca bitkilerde yaprağa göre
sap oranının artması da yapısal bileşiklerin artmasına sebep olmaktadır (Nelson ve
Moser,1994). Bu durumlar meradan alınan bitki örneklerinde otlatma başlangıcında
protoplazmada yer alan HP miktarının daha yüksek, çeper maddelerinin (NDF ve ADF) ise
daha düşük çıkmasına neden olmuştur. ADF’nin sindirim düzeyi çok yavaş ve düşük
olduğundan, rasyonda da düşük miktarlarda olması istenir (Van Soest 1994).
Tablo 5: Deneme Kuzularının Değişik Dönemlerdeki Canlı Ağırlık Değişimleri, kg
Besleme grupları
Entansif
Mera+Süt
Mera+Süt+Yem
ÖNEM
Cinsiyet
n BBCA
22,84±0,79a
20,69±0,29b
21,79±0,51ab
CA 0-10
25,72±0,88a
22,75±0,34b
24,22±0,54ab
***
CA10-20
28,72±0,83a
25,14±0,36c
26,89±0,59b
***
CA20-30
32,16±0,95a
27,85±0,41c
30,00±0,78b
***
D
21,08±0,35 23,36±0,38 26,07±0,43b 28,95±0,53b
E
22,47±0,57 25,10±0,65 27,76±0,65a 31,05±0,77a
ÖNEM
**
**
**
**
Besleme grupları* cins
Entansif Dişi
22,01±0,82 24,70±0,79 27,95±0,77 31,32±0,93
Entansif Erkek
23,67±1,34 26,74±1,55 29,49±1,47 33,00±1,68
Mera+Süt Dişi
20,35±0,39 22,25±0,45 24,55±0,41 26,96±0,44
Mera+Süt Erkek
21,03±0,43 23,25±0,47 25,73±0,55 28,74±0,59
Mera+Süt+Yem
20,87±0,42 23,12±0,45 25,71±0,57 28,57±0,76
Dişi
Mera+Süt+ Yem
22,7±0,86
25,32±0,86 28,06±0,91 31,42±1,24
Erkek ***P<0,001 CA:Canlı ağırlık TCAA: Toplam canlı ağıtlık artışı
**P<0,05
CA30-40
35,33±1,02a
30,67±0,51b
33,30±0,83ab
***
CA40-50
38,61±1,07a
33,60±0,63b
36,34±0,94a
***
CA50-60
41,64±1,09a
36,59±0,68b
39,23±0,97ab
***
TCAA
18,80±0,60a
15,90±0,50b
17,45±0,57ab
***
31,90±0,57b 34,78±0,66b 37,65±0,72b 16,57±0,50
34,30±0,84a 37,59±0,88a 40,65±0,87a 18,19±0,46
***
***
**
**
34,30±0,90
36,36±1,84
29,63±0,54
31,71±0,76
31,77±0,91
34,83±1,25
37,44±1,02
39,78±1,87
32,31±0,74
34,89±0,86
34,58±1,08
38,10±1,37
40,37±1,12
42,90±1,85
35,16±0,85
38,01±0,88
37,41±1,22
41,05±1,33
18,36±0,74
19,23±0,96
14,81±0,66
16,98±0,61
16,54±0,87
18,35±0,67
132
Merinos kuzularının her 10 günlük periyotta meydana gelen canlı ağırlık kazançlarının
birbirinden istatistiki olarak farklı olup olmadıklarını belirlemek için Tekrarlanan Ölçümlü
Deneme Deseninde veriler analiz edilmiştir. Analiz sonucu besleme sistemi ve cinsiyetler
arasında istatistiki olarak anlamlı bir şekilde canlı ağırlık kazançlarında fark bulunurken
cinsiyet* besleme sistemi interaksiyonunun önemli olmadığı belirlenmiştir (Tablo 5). Tablo
3’e bakıldığında özellikle toplam canlı ağırlık kazancında entansif besleme sistemi diğer
sistemlere göre daha avantajlı olarak görülmektedir. Entansif besideki kuzuların TCAA
bakımından mera+ süt+yem grubundaki kuzulardan 1,35 kg, mera+ süt grubundaki kuzulara
göre 2,9 kg daha fazla canlı ağırlık kazanmıştır. İstatistiki olarak 0-10, 10-20, 20-30,30-40.
Günlerde (P<0,05), 40-50 ve 50-60.günlerde (P<0,001) önemli çıkmıştır. Besleme sistemi ve
cinsiyetler arasında yapılan kovaryans analizi sonucu (BBCA değeri kovaryant değer)
istatistiki olarak önemli farklılıklar bulunurken besleme sistemi* cinsiyet interaksiyonu
istatistiki olarak önemli bulunmamıştır. Yine Tablo 5’de görüldüğü gibi cinsiyet bakımından
60. Günde erkek kuzuların dişi kuzulara göre daha fazla canlı ağırlık kazancı sağladığı
belirlenmiştir (P<0,001). Fakat bu fazlalık beklenen bir sonuç olmasına rağmen bu sistemin
ekonomik olduğunun bir göstergesi değildir. Çalışmanın asıl önemli kısmını canlı ağırlık
artışının yanı sıra besleme sisteminde yem girdisinin masraf kalemine bağlı olarak artışın
ekonomik bir kazanca çevrilip çevrilemediğinin kontrol edilmesidir.
Yaralı ve Karaca.,(2011), mera, mera+yem, entansif besi gruplarından oluşmuş 0-5, 610 ve 0-10. Haftalık dönemde yaptıkları Karya kuzularının canlı ağırlıkları sırasıyla;16.84,
21.48, 19.16; 17.34, 24.17, 20.76; 18.40, 24.84, 21.62 olarak bulunan değerler, bu deneme
sonuçlarından düşük bulunmuştur.Karslı ve ark.,(2003) sezon boyu merada otlayan erkek ve
dişi toklulara ait 10.gün, 25.gün, 39.gün, 57.gün ve 70.gün canlı ağırlık değerleri srasıyla;
41.55, 43.83, 45.77, 48.94, ve 50.07; 33.76, 36.30, 39.41, 41.65, 43.88 ve 44.60 olarak
belirtilmiş, bu çalışmada erkek ve dişi kuzular için bulunan değerlerden yüksek bulunmuştur.
Tablo 6: Deneme kuzularının Değişik Dönemlerdeki CAA ve OCAA ları (g/gün)
**P<0,05***P<0,001 CAA: Canlı ağırlık artışı OCAA: Ortalama canlı ağırlık artışı
Besleme grupları
Entansif
Mera+Süt
Mera+Süt+Yem
n CAA0-10
CAA10-20
CAA20-30
CAA30-40
CAA40-50
CAA50-60
OCAA
288,0±18,4a
206,0±8,7c
243,5±9,3b
***
300,0±13,9a
239,0±9,6b
266,5±10,0b
***
344,0±17,4a
271,0±12,3b
311,0±22,4ab
**
330,5±12,0a
282,0±13,5b
317,0±20,0a
**
328,0±15,6
293,0±15,1
304,0±16,0
302,5±20,4
298,5±12,2
289,0±14,4
313,3±10,0a
264,9±8,4b
290,8±9,6a
***
228,0±9,2b
263,7±13,7a
**
265,7±9,3b
271,3±11,1a
**
288,0±12,6b
329,3±17,1a
**
295,0±12,8b
324,7±13,0a
**
287,7±13,7b
329,0±10,7a
**
287,0±13,1
306,3±12,7
**
276,2±8,4b
303,1±7,6a
**
269,0±15,5
307,0±33,2
190,0±12,3
222,0±10,5
225,0±9,2
262,0±14,4
325,0±15,5
275,0±20,9
230,0±15,2
248,0±12,0
259,0±14,0
274,0±14,5
337,0±20,7
351,0±29,1
241,0±11,6
301,0±17,4
286,0±21,4
336,0±39,0
298,0±28,0
336,0±28,8
267,0±16,9
297,0±20,9
320,0±19,0
341,0±15,1
314,0±22,9
342,0±21,5
268,0±25,2
318,0±13,9
281,0±23,3
327,0±20,4
293,0±24,5
312,0±33,6
285,0±19,2
312,0±14,9
283,0±26,0
295,0±13,8
306,0±12,4
320,5±15,9
246,8±11,0
283,0±10,2
275,7±14,6
305,8±11,1
Cinsiyet
D
E
Besleme grupları* cins
Entansif Dişi
Entansif Erkek
Mera+Süt Dişi
Mera+Süt Erkek
Mera+Süt+Yem Dişi
Mera+Süt+ Yem Erkek
Merinos kuzularının her 10 günlük periyotta meydana gelen günlük canlı ağırlık artış
kazançlarının birbirinden istatistiki olarak farklı olup olmadıklarını belirlemek için
Tekrarlanan Ölçümlü Deneme Deseninde veriler analiz edilmiştir. Analiz sonucu besleme
sistemi ve cinsiyetler arasında istatistiki olarak anlamlı bir şekilde canlı ağırlık kazançlarında
fark bulunurken cinsiyet* besleme sistemi interaksiyonunun önemli olmadığı belirlenmiştir
133
(Tablo 6). Tablo 6’ya bakıldığında özellikle ortalama canlı ağırlık artışı entansif besleme
sistemi diğer sistemlere göre daha avantajlı olarak görülmektedir. İstatistiki olarak besleme
sistemlerinde 0-10 ve 10-20. gün (P<0,001), 20-30 ve 30-40. gün (P<0,05) daha fazla canlı
ağırlık artışı sağladığı görülmüştür. Yine 40-50 ve50-60. gün CAA’nın entansif besleme ve
mera+süt+yem grubunda düşüş olduğu görülmeye başlanmış hayvanların birim yemden
yararlanma kabiliyetleri azalmaya başlamıştır. 50-60. gün arasında her 3 yemleme sisteminde
CAA birbirine yakın bir noktaya geldiği görülmüştür. Yukarıda sunulan tekrarlı ölçüm
deneme desenine göre analiz sonucunda entansif ve mera+ süt+ yemleme sistemleri arasında
istatistiki olarak önemli bir fark olmadığı görülmektedir. Buradan Merinos ırkı kuzularda
sadece kesif yeme dayalı entansif besi sistemine gerek olmadığını göstermektedir. Ortalama
canlı ağırlık artışı bakımından besleme gruplarında istatistiki olarak önemli olduğu
belirlenmiştir (P<0,001).Besleme sistemi ve cinsiyetler arasında istatistiki olarak önemli
farklılıklar bulunurken besleme sistemi* cinsiyet interaksiyonu istatistiki olarak önemli
bulunmamıştır.
Sütten kesilmiş Tuj kuzularla, 128 gün süreyle sadece merada otlatma, mera+400 g,
mera+ 600 g, mera+ 800 g ek konsantre yem verilerek yapılan bir çalışmada (Eliçin ve
ark.,1989), kuzuların günlük canlı ağırlık artışı 131.9, 188.2, 195.3 ve 190.1 g olarak tespit
edilmiştir. Bu araştırma sonuçları, çalışmamızdan bulunan değerlerden düşük bulunmuştur.
Ayrıca, Macit ve ark.,(2003) tarafından 2,5 aylık yaşta sütten kesilen İvesi, Morkaraman ve
Tuj ırkı kuzulara meraya ilave olarak günde 450 g konsantre yem verilerek 70 gün süreyle
yapılan çalışmada, belirlenen günlük canlı ağırlık artışları (155, 172 ve 148 g),
sonuçlarımızdan düşük bulunmuştur. Ayrıca sütten kesilmemiş kuzuların merada otlatılması
ile kazanılan günlük canlı ağırlık artış değerleri (Kaya ve ark.,2011; Işık ve Kaya., 2011), bu
denemede merada otlayan ve ilave konsantre yem verilen kuzulardan elde edilen veriler ile
karşılaştırıldığında düşük bulunmuştur. Karslı ve ark.,(2003), tokluların 70 günlük merada
otlatma sezonu boyunca günde ortalama 122 g canlı ağırlık kazandığını ifade ettikleri
bulgusu, denememizde merada otlayan kuzulardan elde edilen değerlerden düşük
saptanmıştır. Kaya ve ark.,(2004) sütten kesilmemiş 2 aylık Morkaraman ve Tuj ırkı erkek
kuzuların, merada otlatma ve meraya ilave konsantre yem vererek yaptıkları çalışmada,
saptanan günlük canlı ağırlık artışı, bu deneme sonuçlarından düşük bulunmuştur.
Tablo 7: Entansif ve Mera+ süt+ yem grubundaki kuzuların değişik dönemlerdeki
günlük ve toplam yem tüketimleri, kg
Besleme
grupları
n
YT 0-10
YT 10-20 YT 20-30
YT 30-40
YT 40-50 YT 50-60
YT 0-60
TYT
Entansif Yem
20
1,11±0,03a
1,17±0,03a 1,22±0,03a
1,29±0,03
1,17±0,03 1,15±0,03a
1,18±0,01a
356,20
Mera+süt+yem
20
0,93±0,04b
1,07±0,03b 1,10±0,04b
1,25±0,03
1,10±0,05 1,00±0,14b
1,07±0,03b
241,21
***
**
Önem
**
***
**
Cinsiyet
D
20
1,08±0,05a
1,12±0,04 1,18±0,03
1,28±0,02
1,14±0,04 1,10±0,04
1,14±0,03
337,83
E
20
0,96±0,03b
1,11±0,02 1,14±0,04
1,26±0,04
1,13±0,04 1,04±0,04
1,12±0,02
259,58
Önem
**
**P<0,05 ***P<0,001 YT: Yem tüketimi TYT: Toplam yem tüketimi
134
Tablo 8: Entansif ve Mera+ süt+ yem grubundaki kuzuların yemden yararlanma değerleri
Besleme
grupları
n
YYD 0-10
YYD 10-20
YYD 20-30
YYD 30-40
YYD 40-50
YYD 50-60
YYD0-60
Entansif Yem
20
4,87±0,24a
5,43±0,39a
6,14±0,49
7,12±0,55a
6,41±0,37a
5,64±0,26
5,94±0,26a
Mera+süt+yem
20
3,24±0,13b
3,45±0,15b
3,91±0,19
5,26±0,23b
4,52±0,22b
3,74±0,17
4,02±0,12b
***
***
***
***
***
***
***
Önem
Cinsiyet
D
20
4,55±0,29a
5,15±0,43a
5,90±0,53a
7,00±0,48a
6,09±0,36a
5,10±0,34a
5,63±0,31a
E
20
3,56±0,18b
3,73±0,21b
4,15±0,22b
5,39±0,39b
4,84±0,34b
4,29±0,24b
4,33±0,20b
***
***
***
***
***
***
***
Önem
**P<0,001 YYD: Yemden yararlanma değerleri
Grupların günlük yem tüketimleri ve toplam yem tüketimleri ile yemden yararlanma değerleri
Tablo 7 ve Tablo 8’da verilmiştir. Kuzular gruplar halinde yemlendikleri için varyans
analizleri yapılmamıştır. Entansif ve mera +süt+ yem grubundaki kuzuların günlük yem
tüketimleri 10 ve 50.günde (P<0,001),20, 30 ve 60. gün de (P<0,05) yem tüketimleri önemli
bulunmuştur. Gruplarda 30-40 ve 40-50. Günlerde günlük yedikleri yem bakımından
birbirlerini yakaladıkları görülmüş olup istatistiki olarak önemsizdir.
Grupların yemden yararlanma değerleri istatistiki olarak önemli çıkmıştır. Mera+
süt+yem grubunun entansif grubuna göre daha az yem yiyerek yemi daha iyi değerlendirdiği
görülmektedir (P<0,001). Cinsiyet bakımından erkekler dişilere göre daha az yem yiyerek
yemi eniyi şekilde değerlendirdikleri tespit edilmiştir ( P<0,001).
Yaralı ve Karaca.,(2011), Farklı besi sistemlerinde besiye alınan Karya kuzularında
toplam yem tüketimi ve yemden yararlanma değerleri 2008 yılı sırasıyla; 793.69 kg ve 5.45
olarak bulunurken, 2009 yılı itibari ile ise aynı değerler sırasıyla; 835.47 kg ve 5.22 dir. Bu
çalışmada bulunan değerlerden yüksek bulunmuştur. Erkek kuzularda saptanan toplam yem
tüketimi, ortalama günlük yem tüketimi ve yemden yararlanma değerleri sırasıyla 685,07 kg
ve 4.93; aynı değerler dişi hayvanlar için sırasıyla 944,09 kg ve 5.63 olarak bulunan değerler,
bu çalışmada bulunan değerlerden yüksek bulunmuştur. Yapılan benzer çalışmalarda yakın
sonuçlar göstermektedir. Kıvırcık kuzularda 1 kg canlı ağırlık artışı için yem tüketimi 5.30 ve
6.25 kg (P<0,05) (Altın ve ark. 2005); (ASB x Kıvırcık ) x Kıvırcık, (ASB x Merinos) x
Kıvırcık ve Kıvırcık kuzularda 4.63 kg, 4.76 kg ve 5.33 kg (Ekiz ve Altınel, 2005); Kıvırcık x
(Sakız x Morkaraman) F1 ve Sakız x ( Kıvırcık x Morkaraman ) F1 melezi erkek kuzularda
4.75 ve 4.98 kg (Özbey ve ark.,2000); Kıvırcıklarda 1.496 kg ve 5.453 kg (Köycü ve
Özder.,1994); Kıvırcık, Sakız x Kıvırcık, Kıvırcık x Karya melezlerinde ortalama 4.18 kg
(Altın ve ark.,2003); Akkaraman ve Sakız x Akkaraman (F1) melezi kuzularda 3.28 ve 3.77
kg (Esen ve Yıldız, 2000); Tuj kuzularda 5.01 kg (Karaoğlu ve ark.,2001); Karayaka, Sakız x
Karayaka ve Ile de France x Karayaka kuzularda sırasıyla 7.075, 7.201 ve 6.513 kg’dır
(Aydoğan, 1985). Farklı ırk, farklı dönem, farklı besi yöntemleri, farklı besi süreleri ve farklı
yem içerikleri kullanıldığı araştırmalarda ise değişik değerler ortaya çıkmaktadır. Buna göre
mera+ ilave yemleme, entansif besiye göre doğal olarak yem masraflarında azalmaya yol
açmaktadır.
135
Tablo 9.: Kesim Özellikleri
Besleme
grupları
Kesim öncesi Sıcak Karkas Sıcak karkas İç yağ
C.Ağır(kg)
Ağır. (Kg)
randımanı % Ağır. (gr)
Entansif Yem
40,09±0,57a
19,38±0,35a
48,32±0,34
0,84±0,08a 3,60±0,12
1,81±0,06 0,95±0,04
Ciğer
Takım
Ağır. (Kg)
1,74±0,06
Mera+süt
38,14±0,64b
18,14±0,35b
47,55±0,27
0,33±0,02c 3,63±0,13
1,92±0,07 0,93±0,05
1,78±0,05
Mera+süt+yem
39,68±0,41a
19,11±0,27a
48,15±0,31
0,59±0,02b 3,69±0,10
1,97±0,06 0,93±0,04
1,71±0,06
Önem
**
***
D
38,42±0,52b
18,22±0,27b
47,43±0,16b
0,71±0,08a 3,48±0,09b
1,75±0,04b 0,84±0,02b
1,61±0,03b
E
40,16±0,38a
19,53±0,24a
48,61±0,26a
0,48±0,04b 3,81±0,08a
2,04±0,05a 1,03±0,03a
1,87±0,03a
Önem
***
***
***
***
Deri Ağır.
(Kg)
Baş
Ağır(kg)
4
Ayak
Ağır(kg)
***
Cinsiyet
***
***
***
***
Besleme
gmpları*Cins
Entansif yem*dişi
39,57±0,87
18,79±0,45
47,49±0,21
1,07±0,09a 3,31±0,09c
1,68±0,06 0,90±0,03
1,64±0,07
Entansif yem*erkek
40,62±0,75
19,97±0,43
49,15±0,43
1,84±0,08
36,52±0,80
17,20±0,41
47,09±0,24
0,62±0,05b 3,88±0,16a
b
0,36±0,02c 3,26±0,11c
1,93±0,07 1,00±0,06
Mera+süt*dişi
1,71±0,04 0,79±0,02
1,66±0,05
Mera+süt*erkek
39,37±0,78
18,91±0,40
48,04±0,43
0,30±0,03c 3,98±0,10a
2,11±0,08 1,04±0,06
1,88±0,06
Mera+süt+yem*dişi
38,85±0,61
18,51±0,27
47,65±0,34
1,85±0,07 0,83±0,02
1,54±0,03
Mera+süt+yem+erkek
40,50±0,30
19,71±0,32
48,65±0,45
0,65±0,02b 3,82±0,14a
b
0,53±0,02b 3,57±0,13b
c
***
***
2,09±0,08 1,04±0,05
1,88±0,04
Önem
**P<0,05***P<0,001g: gramKg: Kilogram
Merinos koyunlarından elde edilen kuzularla Konya İli Karapınar ilçesinde alternatif besleme
sistemlerinin besi ve karkas özelliklerine etkisini belirlemek için yapılan çalışmada elde
edilen veriler Tesadüf Parselleri Deneme Deseninde Faktöriyel Düzende (Besleme sistemi*
Cinsiyet) analiz edilmiştir. Kesilen kuzuların karkas özelliklerine alternatif 3 besleme sistemi
(Mera+ süt, Mera+ süt+ yem, Entansif Yemleme) ve hayvanlarının cinsiyetlerinin (Dişi,
Erkek) etkisi incelenmiş ve sonuçlar tablolarda verilmiştir.
Kesimde ele alınan özelliklere ilişkin bulgular Tablo 9’de sunulmuştur. Kesim ağırlığı
bakımından grubun etkisi (P<0,05), cinsiyetin etkisi çok önemli (P<0,001) dir.Kesim ağırlığı
erkeklerde 40.16 kg, dişilerde 38,42 kg dır. Kuzuların besi başı ağırlıkları kesim ağırlıklarını
önemli düzeyde etkilemiştir (P<0,001). Besleme gruplarına göre kesim ağırlığı sırasıyla;
40.09, 39.68 ve 38.14 kg dır. Sıcak karkas ağırlığı besleme gruplarında ve cinsiyette çok
önemli bulunmuştur (P<0,001). Sıcak karkas ağırlığı besleme gruplarında sırasıyla; 19.38,
19.11 ve 18.14 kg; cinsiyetlere göre sırasıyla; 18.22 ve 19.53 kg dır.
Çalışmada kesim ağırlığı, sıcak karkas ağırlığı ve sıcak karkas randımanı üzerinde çok
önemli etki yaratmıştır. İç yağ ağırlığı bakımından ise besleme grupları, cinsiyet ve besleme
grupları* cinsiyet interaksiyonu çok önemli bulunmuştur (P<0,001). Tablo 9’de görüldüğü
gibi deri, baş, 4 ayak ve ciğer takım ağırlığı bakımından da cinsiyetin etkisi önemli
bulunmuştur (P<0,001). Örneğin, Karya ve Kıvırcık kuzularında kesim ağırlığı sırasıyla;
31.36 ve 28.23 kg, sıcak karkas ağırlığı 14.97 ve 14.86 kg, soğuk karkas ağırlığı 14.76 ve
14.61 kg bulunmuştur (Altın ve ark,2005). Yine bir başka çalışmada mera, mera+yem ve
entansif yem gruplarının kesim ağırlığı sırasıyla; 23.35, 26.84 ve 27.53 kg; sıcak karkas
ağırlığı sırasıyla; 11.79, 12.35 ve 12.15 kg; soğuk karkas ağırlığı ise aynı sırasıyla 11.52,
12.03 ve 11.89 kg olarak bulmuşlardır. Kesim özellikleri açısından besleme grupları arasında
dikkate değer farklılık olmasa da yukarıda sayılan özellikler bakımından yapılan
çalışmalardan daha yüksek bulunmuştur (Yaralı ve Karaca,2011).Anadolu Merinosu
kuzularında 63 günlük entansif besi sonucunda kesim, sıcak ve soğuk karkas ağırlıkları
sırasıyla; 44.28, 20.05 ve 19.64 kg; karkas randımanı % 44,36 olarak bulmuşlardır. Çalışmada
136
bulunan değerler bahsedilen çalışmanın ağırlık değerlerinden düşük randıman değerinden ise
yüksek bulunmuştur. Kıvırcık kuzularda soğuk karkas ağırlığı 13.72-16.5 kg, soğuk karkas
randımanı % 46.8-48.8 arasında bildirilirken (Özcan ve ark,2001; Yılmaz ve Altınel, 2003);
Kıvırcık koyunlarında yapılan bazı melezleme çalışmalarında soğuk karkas ağırlığı 15.6619.45 kg; soğuk karkas randımanı % 45.84-50.10 arasında bildirilmiştir (Özcan ve ark,2001;
Yılmaz ve Altınel, 2003). Çalışmada kesim özelliklerinin daha sağlıklı değerlendirilebilmesi
için kesim ağırlığının baz alınması gerektiği ortadadır. Çalışmalarda, uygulanan besi
yönteminin, besi başı ağırlığın, besi süresinin ve ırkın önemi oldukça büyüktür ve bunlar
kesim özelliklerini önemli ölçüde etkilemektedir. Sadece doğal merada beslenen hayvanlarda
yapılan çalışmalarda değerler düşük seviyede kalmaktadır. Mutlaka konsantre yem takviyesi
yapılması zorunluluktur. Bu denemede ise sadece yapay merada otlayan kuzular
ağırlıklarındaki artışın biraz düşük olması, mera + süt+yem grubundaki kuzuların ise entansif
beslenen kuzuların ağırlık artışına çok yakın olduğu görülmüştür. Bu durum araştırmada
kullanılan meranın besin madde içeriklerinin yüksek oluşuna ve konsantre yem tüketimi gibi
bir çok faktöre bağlanabilir.
137
Tablo 11: Karkas Parçalarının Oranları
Besleme
grupları
Soğuk
Soğ. karkas Böbrek
Kuyruk
Kol ağır,gr But ağır,kg Sırt
bel
karkas Ağır. Randımanı% leğen yağı ağır,gr
ağır,kg
ağır,gr
Entansif Yem (Kg)
19,22±0,34a 47,92±0,32
0,35±0,04a 0,56±0,05a 1,77±0,06ab 3,49±0,10a 2,16±0,07
Mera+süt
Etek
ağır,gr
Omuz
başı
0,99±0,06 ağır,gr
0,57±0,04ab
18,04±0,33b 47,28±0,29
0,22±0,02b 0,28±0,02b 1,66±0,05b 3,19±0,09ab 1,96±0,08
0,90±0,04 0,61±0,02a
Mera+süt+yem 18,98±0,27a 47,83±0,34
0,25±0,04b 0,46±0,04a 1,82±0,04a 3,40±0,04b 2,16±0,05
0,96±0,03 0,61±0,03b
Önem
**
**
***
**
**
**
Cinsiyet
TabloD 14: Entansif
Yemleme+Süt+Mera Sistemine Dayalı Besleme Sisteminde Merinos Kuzularının
18,13±0,23b 47,15±0,19b 0,33±0,02a 0,47±0,04a 1,68±0,05b 3,25±0,08b 2,18±0,05a 0,93±0,04 0,60±0,03
E
19,37±0,25a 48,20±0,27a
0,21±0,02b 0,40±0,04b 1,83±0,04a 3,47±0,06a 2,01±0,06b 0,98±0,04 0,60±0,02
Gelir-Marjinal
Önem
*** Masraf**Değerleri
**
**
0,66±0,07a 1,67±0,10
3,33±0,15
2,21±0,10
0,97±0,09 0,57±0,06
0,30±0,05
0,46±0,07bc 1,88±0,03
3,66±0,11
2,11±0,12
1,02±0,10 0,57±0,05
0,27±0,02
0,33±0,01cd 1,60±0,07
3,08±0,14
2,06±0,08
0,91±0,08 0,63±0,03
18,76±0,42 47,65±0,41
0,17±0,02
0,24±0,02d 1,73±0,07
3,30±0,09
1,86±0,12
0,90±0,02 0,60±0,03
18,42±0,27 47,41±0,39
0,34±0,03
0,43±0,05bc 1,77±0,04
3,35±0,07
2,26±0,08
0,90±0,05 0,59±0,05
19,55±0,35 48,25±0,53
0,16±0,03
0,50±0,05b 1,87±0,07
3,45±0,04
2,06±0,06
1,02±0,03 0,64±0,05
Bes.
Grup.*Cins
Ent. Yem Dişi 18,65±0,43 47,13±0,24
Ent.
19,79±0,45 48,71±0,40
Yem.Erkek
Mera+süt dişi 17,31+0,30 46,91±0,38
Mera+süt
erkek
Mera+süt+yem
dişi
Mera+süt+yem
***
**
0,39±0,05
erkek
Önem
**
**
*P<0,05 ***P<0,001 g: gram Kg: Kilogram
Besleme grupları
Entansif Yem
Kol Oranı Etek Oranı Boyun
Omuz
Başı Sırt Bel Oranı But Oranı % MLD göz
%
%
Oranı % Oranı %
%
kası (cm2)
9,00±0,0,16a 5,03±0,26
3,22±0,14 2,87±0,15ab
11,00±0,31
17,15±0,38
16,23±0,46b
Mera+süt
8,55±0,20b 4,89±0,21
3,53±0,15 3,34±0,12a
10,68±0,45
17,07±0,34
17,11±0,48a
Mera+süt+yem
9,15±0,14a 4,92±0,14
3,65±0,17 3,14±0,15b
11,07±0,26
16,67±0,14
16,56±0,32b
Önem
Cinsiyet
***
**
**
D
8,82±0,12b
4,94±0,18
3,33±0,12 3,18±0,13
11,67±0,22a
16,78±0,28b
15,84±0,33b
E
8,98±0,17a
4,95±0,15
3,61±0,14 3,05±0,11
10,17±0,22b
17,15±0,22a
17,42±0,26a
Önem
**
***
**
**
Besleme grupları*Cins
Entansif yem*dişi
8,59±0,37
4,99±0,39
3,02±0,05 2,89±0,25
11,46±0,42
17,19±0,40
16,05±0,28
Entansif yem*erkek
8,50±0,19
5,06±0,40
3,42±0,26 2,85±0,20
10,55±0,39
17,12±0,70
17,07±0,51
Mera+süt*dişi
9,08±0,27
5,14±0,39
3,50±0,28 3,60±0,15
11,77±0,46
17,50±0,49
16,45±0,81
Mera+süt*erkek
8,91±0,19
4,64±0,11
3,55±0,15 3,09±0,11
9,60±0,47
16,65±0,45
17,77±0,43
Mera+süt+yem*dişi
9,26±0,16
4,70±0,14
3,46±0,17 3,06±0,20
11,78±0,29
16,78±0,16
15,03±0,40
Mera+süt+yem+erkek
9,04±0,23
5,15±0,21
3,85±0,29 3,22±0,24
10,37±0,13
16,57±0,24
17,43±0,45
**P<0,05 ***P<0,001 MLD: Muskulus longissimus dorsi
138
Tahmin Edil
Tablo 12.: Deneme Kuzularında Sol Yarım Karkasın 6 ile 12.Kaburgaları Arasındaki Alınan
Pirzola Örneklerinde Doku Kompozisyonu (%)
Besleme grupları
Kabuk yağı Kas arası yağ Kas oranı
oranı %
oranı %
%
Kemik oranı Toplam
%
oranı %
yağ Atılan
kısımların
oranı %
Kabuk yağı
kalınlığı
(ml)
Entansif Yem
19,21±1,21a
13,11±1,18a
48,16±1,42b
18,66± 1,03b 32,32±1,54
0,87±0,11
5,04±0,55a
Mera+süt
10,86±1,30b
8,45±0,89b
55,57±1,20a
24,10±1,20a
19,32±1,90
0,98±0,11
2,83±0,24c
Mera+süt+yem
18,47± 1,89a 10,76±0,86b
49,33±1,52b
20,53±0,81b
29,22±2,23
0,92±0,12
3,77±0,27b
Önem
***
***
***
***
***
D
19,60±1,12a
12,86±0,69a
47,76±1,14b
18,97±0,65b
32,46± 1,43a
0,81±0,10
4,57±0,37a
E
12,76±1,39b
8,69±0,83b
54,28± 1,09a
23,22±1,00a
21,45±1,64b
1,04±0,08
3,19±0,31b
Önem
***
***
***
***
***
***
Cinsiyet
***
Besleme grupları*Cins
Entansif yem*dişi
20,82±1,93 15,69±1,11
44,52±0,74
17,94±1,25
36,51 ±1,47
1,02±0,18ab
6,00±0,73
Entansif yem*erkek
17,59±1,28 10,53±1,49
51,79±1,73
19,38±1,70
28,12±1,09
0,71±0,11b
4,08±0,66
Mera+süt*dişi
14,74±1,09 10,34±0,33
53,26±1,51
20,93±1,19
25,08±1,05
0,74±0,12ab
3,25±0,21
Mera+süt*erkek
6,99±0,52
57,89±1,40
27,28±0,93
13,55±1,19
1,23±0,12a
2,42±0,37
Mera+süt+yem*dişi
23,23±0,52 12,56±0,81
45,50±1,14
18,04±0,35
35,79±1,15
0,67±0,19b
4,45±0,19
Mera+süt+yem+erkek
13,71±2,51 8,96±1,12
53,16±1,74
23,01±0,52
22,66±1,81
1,17±0,06a
3,08±0,30
Önem
6,57±1,39
**
**P<0,05 ***P<0,001
Soğuk karkasların standart olarak parçalanması ile elde edilen parçaların ağırlık ve oransal
değerleri ile ilgili bulgular Tablo 10 ve Tablo 11’da verilmiştir. Kesim ağırlığı soğuk karkas
ağırlığı üzerinde önemli etki yaratmıştır (P<0,05). Genel olarak karkas parçaları karkas
ağırlığına bağlı olarak önemli ölçüde değişmektedir. Değişimin yönü bütün parçalarda ağırlık
için pozitif yönde olurken, oransal olarak Kol, omuz başı,sırt bel ve but oranı ile MLD göz
kası alanı önemli bulunmuştur (P<0,05, P<0,001). En fazla kuyruk ağırlığı Entansif ve mera+
süt+yem besleme grubunda, en düşük mera+ süt grubunda bulunmuştur. Tüm parçalar için,
erkek ve dişi kuzular arasında istatistiki anlamda önemli bir fark bulunmuştur. But, kol, sırt
bel ve diğerleri olarak beş parçaya ayrılan karkaslarda değerli bölge olarak nitelendirilen but
ve sırt bölgelerinin yüksek olması istenilen bir durumdur. Bu parçalar perakende olarak daha
yüksek fiyata satılırken, yağlılık anlamında da tercih edilmektedir. Bu çalışmada erkek
hayvanlarda but ve kol oranının dişilerden yüksek olduğu görülürken farklılık çok önemsiz
kalmıştır. Karkas parçaları için besleme grupları arasında önemli bir farka rastlanmaması
çalışmada ortaya çıkan bir diğer sonuçtur. Anadolu merinoslarında 63 günlük entansif besi
yapılan bir çalışmada, but, sırt-bel, omuz başı, kol, etek,kuyruk ağırlıkları ile MLD (göz kası
alanı, cm2) sırasıyla; 3.11 kg, 1.70 kg, 442.8 g,1.72 kg, 1.63 kg, 234.5 g ve 16.62 cm2 olarak
belirtmişlerdir (Şahin ve Boztepe,2011). Yapılan benzer çalışmalarda; Karya ve Kıvırcık
kuzularda genotipler için kol oranı %18.53 ve %18.43, omuz-sırt-bel oranı %22.53 ve
%21.37(P<0,0,01), but oranı % 30.59 ve % 31.23, boyun oranı %9.01 ve % 8.77, etek
oranı%13.34 ve % 13.22, kuyruk oranı % 2.58 ve % 3.68 (P<0,05) (Altın ve ark., 2005);
Kıvırcık kuzularda but oranı %30.54- 31.48, kol oranı %17.51- 18.88, sırt oranı % 6.74-7.72,
bel oranı % 8.72-10.87 ve diğerleri oranı % 29.66-31.13 arasında bildirilmiştir
139
(Akçapınar,1981; Akgündüz ve ark.,1993; Özcan ve ark., 2001; Yılmaz ve Altınel.,2003).
Karakaş erkek kuzulardaki but, kol, sırt-bel, boyun+ kaburga ve böbrek oranları sırasıyla
%27.33, % 17.08, %17.19 olarak bildirilmiş ve çalışmada uygulanan besi yöntemleri(açık adlib, açık+karma yem, kapalı ad-lib, kapalı+karma yem) karkas özellikleri üzerine önemli
olmamıştır (Karaca ve ark.,1996).
Tablo 13: Entansif Yemleme Sistemine Dayalı Besleme Sisteminde Merinos Kuzularının Tahmin
Edilen Performansları ve Marjinal GelirMarjinal Masraf Değerleri
Tüketilen
Yem
(Kg)
0
5
10
15
20
25
30
35
40
45
50
55
60
65
70
75
80
85
90
95
100
Entansif Toplam
Yem
Yem
(Dişi)
Gideri
Tahmin (TL)
Edilen
Canlı
22,07605
0
23,95305 4,6
25,75405 9,2
27,47905 13,8
29,12805 18,4
30,70105 23
32,19805 27,6
33,61905 32,2
34,96405 36,8
36,23305 41,4
37,42605 46
38,54305 50,6
39,58405 55,2
40,54905 59,8
41,43805 64,4
42,25105 69
42,98805 73,6
43,64905 78,2
44,23405 82,8
44,74305 87,4
45,17605 92
Entansif Ortalama Marjinal
Yem
Gelir (TL) Masraf
(Dişi)
(TL)
Toplam
Gelir
(10*TL) 0
24,28366
0
26,34836 5,269671 4,6
28,32946 2,832946 4,6
30,22696 2,01513 4,6
32,04086 1,602043 4,6
33,77116 1,350846 4,6
35,41786 1,180595 4,6
36,98096 1,056599 4,6
38,46046 0,961511 4,6
39,85636 0,885697 4,6
41,16866 0,823373 4,6
42,39736 0,770861 4,6
43,54246 0,725708 4,6
44,60396 0,686215 4,6
45,58186 0,651169 4,6
46,47616 0,619682 4,6
47,28686 0,591086 4,6
48,01396 0,56487 4,6
48,65746 0,540638 4,6
49,21736 0,518077 4,6
49,69366 0,496937 4,6
Marjinal Tüketilen Entansif Toplam
Gelir
Yem
Yem
Yem
(TL)
(Kg)
(Erkek) Gideri
Tahmin (TL)
Edilen
Canlı
0
0
23,75957
0
20,647 5
26,29249 4,6
19,811 10
28,68891 9,2
18,975 15
30,94883 13,8
18,139 20
33,07225 18,4
17,303 25
35,05917 23
16,467 30
36,90959 27,6
15,631 35
38,62351 32,2
14,795 40
40,20093 36,8
13,959 45
41,64185 41,4
13,123 50
42,94627 46
12,287 55
44,11419 50,6
11,451 60
45,14561 55,2
10,615 65
46,04053 59,8
9,779
70
46,79895 64,4
8,943
75
47,42087 69
8,107
80
47,90629 73,6
7,271
85
48,25521 78,2
6,435
90
48,46763 82,8
5,599
95
48,54355 87,4
4,763
100
48,48297 92
Entansif Ortalama Marjinal
Yem
Gelir (TL) Masraf
(Erkek)
(TL)
Toplam
Gelir
(10*TL) 0
26,13553
0
28,92174 5,784348 4,6
31,5578 3,15578 4,6
34,04371 2,269581 4,6
36,37948 1,818974 4,6
38,56509 1,542603 4,6
40,60055 1,353352 4,6
42,48586 1,213882 4,6
44,22102 1,105526 4,6
45,80604 1,017912 4,6
47,2409 0,944818 4,6
48,52561 0,882284 4,6
49,66017 0,82767 4,6
50,64458 0,779147 4,6
51,47885 0,735412 4,6
52,16296 0,695506 4,6
52,69692 0,658711 4,6
53,08073 0,624479 4,6
53,31439 0,592382 4,6
53,39791 0,562083 4,6
53,33127 0,533313 4,6
Marjinal
Gelir (TL)
0
27,86212
26,36062
24,85912
23,35762
21,85612
20,35462
18,85312
17,35162
15,85012
14,34862
12,84712
11,34562
9,84412
8,34262
6,84112
5,33962
3,83812
2,33662
0,83512
-0,66638
Çalışmada; mera+süt, mera+süt+yem ve entansif besleme sistemlerindeki kuzularda
belirlenen MLD kesit alanı (Tablo 11) değerleri sırasıyla; 17.11, 16.56 ve 16.23 olarak
bulunmuştur (P<0,05). Bulunan bu değerler daha önceden yapılmış çalışmalardan, Bulmuş ve
Demir(1995) ve Demir (1995)’in Kıvırcık kuzularda, 0ğan(2000)’ın Karayaka kuzularında,
Köycü ve Özder (2004)’in Türkgeldi kuzularında, Tufan ve Akmaz (2001)’ın Güney
Karaman, Kangal- Akkaraman ve Akkaraman Kuzularında, Tekin ve ark.(1993)’nın
Akkaraman, İvesi kuzularında, Akmaz ve ark.(2000)’nın Alman Siyah Başlı x İvesi (F-ı) ve
Hampshire Down x İvesi (F- ve G-ı) melezi kuzularda, Demir, (1989)’ın Dağlıç kuzularında,
Tekin (1991)’ın Anadolu Merinosları ve Lincoln x Anadolu Merinosu melezleri için bildirilen
değerlerden yüksek bulunmuştur.
Deneme kuzularında sol yarım karkasın 6 ile 12.kaburgaları arasındaki alınan pirzola
örneklerinde doku kompozisyonu değerleri istatistiki olarak çok önemli çıkmıştır (P<0,001).
Tablo 12 incelendiğinde en fazla kas oranı mera+süt besleme sisteminde olduğu
görülmektedir. Mera +süt+yem ve entansif besleme sisteminde bulunan değerler birbirine
yakın bulunmuştur. Kas arası yağ oranı en düşük değer mera+ süt besleme sisteminde
bulunmuştur. Bu çalışmada hem karkasın en kaliteli kısmı olarak nitelendirilen pirzola
kısmından elde edilen kas oranın yüksek ve yine kas arası yağlanma oranının düşük olması
merada otlatmanın ne kadar sağlıklı ve önemli olduğu sonucuna varılmıştır. Daha önce
yapılan entansif besi çalışmaları ile karşılaştırıldığında kas oranı; Şahin ve Boztepe (2011),
Yücelen ve ark. (1976), Güney ve Özcan (1983), Güney ve Biçer (1985) ve Boztepe ve
ark’nın (1997) bildirdikleri değerlerden yüksek bulunmuştur. Kemik oranları ise Şahin ve
Boztepe (2011), Boztepe ve ark’nın (1997) değerleriyle uyumludur. Kabuk yağı kalınlığı
bakımından en düşük değer mera+süt, en yüksek değer ise entansif besleme sisteminde
140
bulunmuştur (P<0,001).Çalışmalarda karkas parçalama sistemleri arasında farklılık görülse de
genel olarak but, kol sırt, bel ve diğer parçalar şeklinde yapılan bir parçalama sistemi üzerinde
durulmaktadır. Ancak but ve kol oranlarının üzerinde durulduğu veya bunlara ilaveten boyun,
omurga ve kuyruk ile ilgili parametrelerin ele alındığı çalışmaları da görmek olasıdır.
Denemede ve birçok araştırmada uygulanan besleme sistemi ve cinsiyet genel olarak karkas
parçaları üzerinde istatistiki olarak önemli bir etki yaratmamıştır. Grafik 1. Yemleme Sistemi
ve Cinsiyetlere Göre Toplam Gelir, Marjinal Gelir ve Marjinal Masraf Eğriler
Tüketil
en
Yem
(Kg)
0
5
10
15
20
25
30
35
40
45
50
Entansif Topla
Yem+Süt+M m
era
(Dişi) Yem
Tahmin
Gider
Edilen Canlı i
Ağırlık (Kg) 0(TL)
20,86504
25,41823
4,6
29,34442
9,2
32,64361
13,8
35,3158
18,4
37,36099
23
38,77918
27,6
39,57037
32,2
39,73456
36,8
39,27175
41,4
38,18194
46
Entansif Ortalam Marji
Yem+Süt+M a Gelir nal
era
(Dişi) (TL)
Masra
Toplam
f
Gelir
(TL)
(10*TL)
22,95154
0
0
27,96005
5,5920 4,6
32,27886
3,2278 4,6
35,90797
2,3938 4,6
38,84738
1,9423 4,6
41,09709
1,6438 4,6
42,6571
1,4219 4,6
43,52741
1,2436 4,6
43,70802
1,0927 4,6
43,19893
0,9599 4,6
42,00013
0,8400 4,6
03
Marjinal Tüketil
Entansif Topla
Gelir
en
Yem+Süt+M m
(TL)
Yem era (Erkek) Yem
(Kg) Tahmin
Gider
Edilen Canlı i
Ağırlık (Kg) 0(TL)
0
0
22,65083
50,085 5
28,91241
4,6
43,188 10
34,08599
9,2
36,291 15
38,17157
13,8
29,394 20
41,16915
18,4
22,497 25
43,07873
23
15,600 30
43,90031
27,6
8,7030 35
43,63389
32,2
1,8060 40
42,27947
36,8
45
39,83705
41,4
50
36,30663
46
11,987
Entansif Ortalam Marji
Yem+Süt+M a Gelir nal
era (Erkek) (TL)
Masra
Toplam
f
Gelir
(TL)
(10*TL)
24,91591
0
0
31,80365
5,7824 4,6
37,49459
3,4085 4,6
41,98873
2,5447 4,6
45,28607
2,0584 4,6
47,3866
1,7231 4,6
48,29034
1,4633 4,6
47,99728
1,2466 4,6
46,50742
1,0569 4,6
43,82076
0,8852 4,6
39,93729
0,7261 4,6
33
Marjinal
Gelir
(TL)
0
68,877
56,909
44,941
32,973
21,005
9,0373
38,834
Merinos ırkı kuzularda besi sistemleri arasında entansif ve entansif+süt+mera besi sistemi
arasında istatistiki olarak farklılık bulunmaması işin ekonomik boyutunun önem kazandığını
göstermektedir. Çalışmada verilen yem miktarlarına göre dişi ve erkek kuzularda canlı ağırlık
kazançlarının nasıl değiştiği incelenmiş ve her birim yemin hem entansif hem de
entansif+süt+mera besi sistemindeki etkinliği ortaya konulmuştur. Bu değerler üzerinden de
ekonomik analiz yapılmıştır. Hesaplanan yeni değerlerde sadece kesif yemin farklı masraf
karakterini oluşturduğu varsayımından hareketle toplam gelirin maksimum olduğu yani
marjinal gelirin marjinal masrafa eşit olduğu noktalar hesaplanmaya çalışılmıştır. Grafik 1’de
yeme dayalı olarak Merinos kuzularındaki ağırlık kazançları gösterilmiştir. Tablo 13’de
sadece entansif besi sisteminde, tablo 14’de ise entansif+süt+mera besi sistemindeki gelir
unsurları gösterilmiştir. Sadece mera+süt besleme sistemi analize dahil edilmemiştir. Her 2
tablo incelendiğinde toplam gelirde maksimuma ulaşmak için yani marjinal gelirin marjinal
masrafa eşit olduğu noktaların entansif sistemde daha fazla yem tüketimi yani daha fazla
masraf gerektirdiği, diğer sistem olan yem+süt+mera sisteminde ise toplam gelirin maksimum
olması için daha az yem tüketiminin yeterli olduğu görülmektedir
SONUÇ
Araştırmada elde edilen verilere göre, yapay meralar yüksek ot üretimine ve
dolayısıyla daha çok tüketime sahiptir. Ot üretimi en yüksek mayıs ayında gerçekleşirken,
diğer aylarda daha az üretim olmuştur. Meraya buğdaygil ve baklagil yem bitkileri karışımı
ekildiği için bitki örtüsünün büyük kısmını bu iki familya teşkil etmiştir. Ottaki NDF ve
ADF miktarı ise mayıs ayında düşük, diğer aylarda yüksek bulunmuştur. Meraların yeşil
olduğu dönemde (11 Mayıs-17 Temmuz) besi hayvanlarının besin madde ihtiyaçlarını
önemli ölçüde
Karşılayabileceği, kuzularda yeterli canlı ağırlık artışının sağlanabileceği tespit
edilmiştir. Ayrıca vejetasyon ilerledikçe meraların HP içeriğinde azalma, KM, HS
değerlerinde ise artış meydana gelmiştir.
Yüksek üretim ve ot tüketimi için tahıl ekimi yapılıp ta bitki büyümeyen tarla
arazilerine yapay mera kurulması akılcı bir çözümdür. Ancak otlatmanın mutlaka mera
yönetim ilkelerine uygun yapılması gerekmektedir. Meranın ağır otlaması ekilen türlerde ve
141
verimde kayıplara yol açarak merada daha az nitelikli türlerle daha az üretimin
gerçekleşmesine yol açacağı düşünülmektedir.
Küçükbaş hayvan yetiştiriciliği, bölgenin kalkınmasında, istihdam yaratmada, refahın
artmasında ve beslenmede önemli görevler üstlenmiştir.Kuzu besiciliği bu anlamda ekonomik
bir uğraşıdır ve karlı olduğu sürece yapılır. Karlılık da, en az yem ve kayıpla, en yüksek
ağırlığa kısa sürede ulaşan kuzular ile ucuz ve kaliteli yem kullanımına bağlıdır. Yetiştirici
koşullarında uygulanan kuzu besi yöntemlerinde genelde hayvanlar meraya bağımlı
olmaktadır. Ancak mera alanlarınınyetersizliği, kalitesizliği ve iklim koşulları, hem canlı
ağırlık artışını hem de karkas ve et kalitesini olumsuz yönde etkilemektedir.
Yapılan araştırmalarda, kuzuların ilk 3-4 aylık yaşta hızlı bir büyüme gösterdikleri ve
yapılacak yarı- entansif veya entansif besleme sistemleri ile daha fazla bir et üretimi
sağlanabileceği rapor edilmektedir.Bu araştırmada, Merinos kuzularda 10 günlük yapılan
tartımlara göre canlı ağırlıklara ilişkin, cinsiyetler arasında önemli bir farklılk olmamasına
karşılık, besi dönemi boyunca erkeklerin dişilerden daha yüksek bir canlı ağırlığa sahip
olduğu ortaya çıkmıştır. Besi boyunca günlük canlı ağırlık artışında ise, erkek hayvanların
daha iyi olduğu görülmektedir. Besleme gruplar bazında en yüksek değerin entansif besi
grubundaki kuzularda olduğu saptanmıştır. İlaveten, hayvanların meraya çıkmaları, toplam
yem tüketimini ve buna bağlı olarak yem giderlerini azaltırken, kuzu başına kazançta
artmaktadır. Kesim sonrası hesaplanan sıcak ve soğuk karkas ağırlıkları için, besleme grupları
bazında önemli bir farkın olmamasına karşılık bu anlamda en yüksek değeri entansif ve
mera+süt+yem grubundaki kuzular göstermiştir. Randıman bakımından da aynı durum söz
konusudur. Erkek hayvanlarda, dişilere göre randıman değerin daha yüksek olduğu da
görülmektedir. Araştırmada, genel olarak karkas parçaları, karkas ağırlığına bağlı olarak
önemli ölçüde değişmektedir. Değişimin yönü bütün parçalarda ağırlık için pozitif yöndedir.
Tüm parçalar bazında (but,kol,sırt, bel ve diğerleri) cinsiyet ve gruplar bazında istatistiki
anlamda önemli bir fark bulunmamıştır.
Koyunculuk ülkemiz et açığını karşılama açısından büyük öneme sahiptir. Çok sayıdaki
süt kuzusunun erken yaşlarda, genç koyunlarında besiye alınmadan kesilmesi ile binlerce ton
et kaybı meydana gelmektedir. Bu noktadan hareketle 3 farklı besleme sistemine dayalı
olarak yapılan analizler sonucunda erkeklerin dişilere göre fazla ağırlık kazancı sağladığı
görülmektedir. Merinos ırkı kuzularda besi sistemleri arasında entansif ve mera+ süt+yem
besi sistemi arasında istatistiki olarak farklılık bulunmaması işin ekonomik boyutunun önem
kazandığını göstermektedir. Ekonomik olarak incelendiğinde toplam gelirde maksimuma
ulaşmak için yani marjinal gelirin marjinal masrafa eşit olduğu noktaların entansif sistemde
daha fazla yem tüketimi yani daha fazla masraf kalemini oluşturması Merinos kuzularında
sadece entansif yemleme dayalı bir besleme sisteminin ekonomik olmadığı, diğer sistem olan
mera+ süt+yem besi sisteminde ise toplam gelirin maksimum olması için daha az yem
tüketiminin yeterli olduğu görülmektedir. Yemin besleme sistemine girişi aynı zamanda
karkas değerlerinde yağ oranında artışa neden olmakta ve ette yağlılık oranının artması
tüketici açısından da istenilen bir durum
142
T.C.
GIDA. TARIM VE HAYVANCILIK BAKANLIĞI
Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü
PROJE SONUÇ RAPORU
PROJE ADI
KARACABEY MERİNOSLARINDA LAKTASYON DÖNEMİ BESLEME KOŞULLARI
İLE FLUSHİNG ETKİNLİĞİ ARASINDAKİ İLİŞKİLER
PROJE NO
TAGEM/ HAYSÜD/10/08/03/01
PROJE YÜRÜTÜCÜLERİ
Dr. Mesut YILDIRIR
Dr. Yalçın YAMAN
Dr. Hande Işıl AKBAĞ
Zir. Müh. İsmail ERDOĞAN
Zir. Y. Müh. Tamer SEZENLER
Danışman: Prof. Dr. İ.Yaman YURTMAN
YÜRÜTÜCÜ KURULUŞ
Koyunculuk Araştırma İstasyonu Müdürlüğü - Bandırma
03/2014
143
BALIKESİR
Kısaltma Tanımları:
BKAİ: Bandırma Koyunculuk Araştırma İstasyonu
CL: Korpus luteum
KP: Kondüsyon puanı
CA: Canlı ağırlık
ME: Metabolik enerji
GLUC: Glikoz
NEFA: Esterleşmemiş yağ asitleri
TP: Total protein
BUN: Kan üre azotu
Çizelge Listesi:
Çizelge 1: Laktasyon boyunca gruplara göre koyunların ortalama günlük kaba-kesif yem ve
temel besin madde tüketim miktarları
Çizelge 2: Aşım döneminde gruplara göre koyunların günlük kaba-kesif yem ve temel besin
madde tüketim miktarları
Çizelge 3: Koyunların gruplara göre aylık KP değişimlerine ilişkin saptanan en küçük kareler
ortalama ( x ), standart hata ( Sx ) ve P değerleri
Çizelge 4: Koyunların, gruplara göre aylık CA (kg) değişimlerine ilişkin saptanan en küçük
kareler ortalama ( x ), standart hata ( Sx ) ve P değerleri
Çizelge 5: Koyunlarda gruplara göre doğum, laktasyon ve kuru dönemde kan parametrelerine
ilişkin saptanan en küçük kareler ortalama ( x ), standart hata ( Sx ) ve P değerleri
Çizelge 6: Gruplara göre flushing, aşım ve kızgınlık günü kan parametrelerine ilişkin en
küçük kareler ortalama ( x ), standart hata ( Sx ) ve P değerleri
Çizelge 7: Gruplarına göre koç katımından itibaren kızgınlıkların gözlendiği günlere ait en
küçük kareler ortalama, standart hata ( Sx ) ve P değerleri
Çizelge 8: Gruplara göre koyunların ovulasyon oranlarına ilişkin en küçük kareler ortalama (
x ), standart hata ( Sx ) ve P değerleri
Çizelge 9: Uygulama gruplarında bazı döl verim özellikleri
Özet:
Bu çalışmanın temel amacını, Karacabey Merinosu koyunlarında aşım döneminden 4-6 ay
öncesinde uygulanan besleme koşullarının ve flushing uygulamasının üreme performansı ile
ilişkilerini değerlendirmek oluşturmuştur. Aşım döneminin 6 ay öncesinden başlayarak, üç
aylık laktasyon dönemi boyunca, NRC (2007) bildirimleri doğrultusunda yeterli (%100;
Kontrol-F ve Kontrol) ve düşük (%70; Deneme-F ve Deneme) olmak üzere iki farklı seviyede
besleme uygulanmıştır. Çalışma, flushing uygulamasına etkilerin besleme geçmişi ile
etkileşimini değerlendirmek amacıyla, aşım döneminde flushing uygulanan (Kontrol-F ve
Deneme-F) ve uygulanmayan gruplar (Kontrol ve Deneme) olmak üzere toplam 4 grup
üzerinde (n=21) yürütülmüştür.
Laktasyon dönemi yeterli seviyede beslenen gruplarda (Kontrol-F;1.67±0.13 ve Kontrol;
1.62±0.13) ovulasyon oranı düşük seviyede beslenen gruplara (Deneme-F;1.45±0.13 ve
Deneme;1.37±0.14) göre daha yüksek gerçekleşmiştir (P=0.296). Aynı şekilde DKDK sayısı
Kontrol-F ve Kontrol gruplarında Deneme-F ve Deneme gruplarına kıyasla 0.15 daha fazla
gerçekleşmiştir (P=0.684). Bununla birlikte flushing uygulamasına bağlı olarak Kontrol-F
grubunda KKDK sayısı düşerken Deneme-F grubunda olumsuz bir etki gözlenmemiştir.
Kontrol-F grubunda Kontrol grubuna göre KKDK sayısının daha düşük olduğu gözlenmiştir.
144
Flushing uygulaması kızgınlıkların toplu olarak ortaya çıkışı üzerinde etkili olmuş, bu etki
sonucunda kızgınlıklar Deneme-F grubunda diğer tüm gruplardan daha kısa sürede
gerçekleşmiştir (P=0.020).
Ovulasyon oranı ve kuzu verimi bakımından gruplar arasında gözlenen farklılığın önemli
çıkmaması besleme geçmişinin üreme performansı üzerinde taşıdığı etkiler bakımından kesin
yargılara varılmasının önüne geçmektedir. Bununla birlikte koyunların aşım döneminin 6 ay
öncesinde maruz kaldıkları beslenme koşullarının ovulasyon oranını önemli oranda
etkileyebilecek potansiyele sahip olduğu söylenebilir.
Anahtar Kelimeler: Koyun, Karacabey Merinosu, Besleme, Flushing, Üreme etkinliği,
Ovulasyon oranı, Kuzu verimi, Kondüsyon Puanı, Canlı ağırlık, Metabolit
Giriş:
Koyun yetiştiriciliği geleneksel olarak ekstansif koşullarda, otlatmaya dayalı olarak
yürütülmektedir. Yem kaynaklarının kısıtlı olduğu dönemlerde koyunlar vücut rezervlerini
kullanma kabiliyetine sahiptirler. Bu nedenle koyunların sahip oldukları üreme özellikleri ile
besleme çevresi arasında da güçlü bir ilişki şekillendiği görülmektedir (Blache ve ark., 2008).
Flushing, koç katımı öncesi ve süresince besleme koşullarının iyileştirilmesine yönelik
uygulamaları tanımlar. Üreme performansını artırmak amacıyla ek yemleme birkaç hafta
süreyle uygulanabilmektedir (Kaymakçı, 2006). Ayrıca kızgınlık döngüsünün kritik
dönemlerinde uygulanan birkaç günlük ‘odak yemleme’ ile ovulasyon oranında artış
sağlanabildiği bildirilmiştir (Robinson ve ark., 2006). Bununla birlikte aşım sezonu
öncesinde, farklı fizyolojik dönemlerde koyunların maruz kaldıkları beslenme koşullarının
taşınabilir etkilerine bağlı olarak, geçmiş dönem besleme koşullarının üreme performansını
etkilediği vurgulanmaktadır (Robinson ve ark., 2002). Besleme geçmişi aynı zamanda aşım
dönemi ek yemleme uygulamalarının başarısını da etkileyebilmektedir (Nottle ve ark., 1997a).
Bu çalışmada Karacabey Merinosu koyunlarında laktasyon dönemi besleme koşulları ile
flushing uygulamalarına bağlı ilişkilerin üreme performansı üzerindeki etkileri ele alınmıştır.
Literatür Özeti:
Flushing uygulamasının üreme performansı üzerinde olumlu etkilerinin gözlendiği ilk
bulguların 1900’lü yıllarının başlarında (Heape, 1899; Marshal, 1908) elde edildiği
görülmektedir (Hulet ve ark., 1962). Flushing üzerine yürütülen bilimsel çalışmaların çoğunda
ek yemlemenin üreme performansı üzerindeki olumlu etkileri rapor edilmektedir (Forcada ve
ark., 1992; Wilkins, 1997; El-Hag ve ark., 1998; Branca ve ark., 2000; Esen ve Bozkurt,
2001; Islam ve ark., 2007; Sabra ve Hassan, 2008; Santos ve ark., 2009). Bununla birlikte
yine çok sayıda bilimsel çalışmanın sonuçları flushingin belirli koşullarda üreme
performansını etkilemediğini göstermektedir (Naqvi ve ark., 2002; Faris ve ark., 2003;
Godfrey ve ark., 2003; Demirel ve ark., 2004; Ghoreishi ve ark., 2007). Ek yemleme
uygulamasının sonuçlarında gözlenen bu varyasyonun nedeni ise birey ve çevre ile ilgili
faktörlerin varlığının flushing uygulamasının sonuçlarını etkileyebilme potansiyeline sahip
olmasıdır (Ermin ve Yurtman, 1999).
Ülkemiz koşulları altında yürütülen flushing etkinliğinin belirlenmesine yönelik çalışmalarda;
farklı enerji yoğunlukları ve flushing etkinliği (Işık, 1980; Koyuncu ve Canpolat, 2009),
genotipik farklılıklar ve flushing etkinliği (Kaymakçı ve ark., 1988), ek yemleme
uygulamasının süresi ve flushing etkinliği (Demirören ve ark., 1990), koç katımı dönemi
kondüsyon puanı (KP) ve flushing etkinliği (Özder ve ark., 1998), rumen içi mikrobiyal
yıkıma karşı korunmuş ürünlerin kullanımı ve flushing etkinliği (Ermin ve Yurtman, 1999;
Yurtman ve ark., 1999a), protein ek yemlemesi ve flushing etkinliği (Ocak ve ark., 2006)
arasındaki ilişkilerin incelendiği görülmektedir.
145
Flushing, üreme aktivitesini kan metabolitleri, gonadotropinler ve doğrudan ovaryumlarda
folliküler seviyede gerçekleştirdiği etkiler sonucunda uyarır (Landau ve Molle, 1997; Martin
ve ark., 2004; Scaramuzzi ve ark., 2006; Blache ve ark., 2008). Tüketilen yem miktarına bağlı
olarak etkilenen enerji tüketim oranı, metabolik durum ve vücut rezervlerinin miktarı
koyunların üreme aktivitelerini etkileyebilme kapasitesine sahiptirler (Zhang ve ark., 2005).
Fakat metabolik faktörler vücut rezervleri ve yem tüketimlerinin üreme fizyolojisinin kontrolü
üzerindeki etkileri tam olarak açıklanabilmiş değildir. Besleme uygulamaları sonucunda
ortaya çıkan fizyolojik tepkiler verimlilik açısından beslemenin güncel ve taşınabilir etkilerini
içerir. Güncel beslenme koşullarını içeren günler-haftalarla değerlendirilen ‘kısa’, haftalaraylara uzanan ‘orta’ ve aylar-yıllara uzanan ‘uzun’ dönem besleme uygulamalarının
koyunların üreme performansları üzerinde önemli etkilere sahip olduğu vurgulanmaktadır
(Scaramuzzi ve ark., 2006; Stubbings, 2007).
Primordial ovaryum follikülerinin follikülogenesis sürecinden geçerek ovule olmaları
koyunlarda 6 aylık bir dönemde gerçekleşir (Cahill, 1981; Robinson ve ark., 2002: Rassu ve
ark., 2004; Robinson ve ark., 2006). Folliküler gelişim süreçlerinde maruz kalınan beslenme
koşullarının metabolizmada yarattığı etkilere bağlı olarak ovulasyon oranı artabilmekte ya da
düşebilmektedir (Robinson ve ark., 2002). Söz konusu koşullar altında verimliliğin
korunmasında belli fizyolojik dönemlerin ön plana çıktığını vurgulayan Martin ve ark. (2004),
koyun yetiştiriciliğinde “fizyolojik dönem odaklı besleme” yaklaşımının üreme
performansının korunabilmesi açısından taşıdığı öneme dikkat çekmektedirler. Bir başka
anlatımla, bir üretim sezonu içerisinde, farklı fizyolojik dönemlerde maruz kalınan besleme
koşulları, beslemenin taşınabilir etkileri sonucunda koyunların üreme performansları üzerinde
önemli etkiler meydana getirmektedir (Nottle ve ark., 1997a; Robinson ve ark., 2006).
Aşım döneminde sahip oldukları kondüsyon puanı (KP) ve canlı ağırlık (CA) değerleri
koyunların besleme geçmişini ve mevcut enerji rezervlerini yansıtan önemli araçlardır.
Koyunlarda optimum aşım dönemi KP’nı farklı araştırmacılar 2,0-3,5 aralığında
bildirmektedirler (Robinson ve ark., 2002; Hinton, 2007). Fraser ve Stamp (1987), Corridalea,
Merinos ve Romney koyunlarında CA’da sağlanan 1 kg artışın ovulasyon oranında %2 artış
sağladığını bildirmişlerdir (Islam ve ark.. 2007). Attı ve ark. (2001), CA ve KP’da gözlenen
artışla birlikte kuzulama oranı ve kuzu veriminin arttığını bildirmişlerdir. Bununla birlikte
pratik anlamda KP kullanımında önemli problemlerden birisi vücut yağ miktarının ırklara
göre farklılıklar gösteriyor olmasıdır (Cannas, 2004). Farklı genotiplere ait CA ve KP
arasındaki ilişkilerin tanımlanabilmesi yani KP’da bir birimlik değişimin CA üzerinde
meydana getireceği değişim açısından genotipik farklılıkların varlığı ortaya konulmuştur
(Arık ve ark., 1997). Ayrıca kan metabolitlerinden yararlanarak hayvanların güncel beslenme
durumları hakkında çok daha etkili tespitler yapılabilmektedir. Fizyolojik olarak normal kabul
edilen hayvanlarda metabolik parametreler belirli sınırlar içerisinde değişim gösterirler.
Bununla birlikte söz konusu metabolitlerin kandaki normal düzeyleri birey ve çevreye bağlı
bir çok koşula göre değişkenlik göstermektedir (Yurtman ve ark., 2000). Bu koşullar
fizyolojik dönem, yaş ve uygulanan analiz yöntemi gibi faktörler olarak tanımlanmaktadır
(Sıdkı ve Hırst, 1998; Nazifi ve ark., 2002 ).
Materyal ve Metot:
Hayvan Materyali;
Hayvan materyalini, Bandırma Koyunculuk Araştırma İstasyonu (BKAİ), Koyun Yetiştirme
Şubesi’nde yetiştirilen 400 başlık Karacabey Merinosu sürüsü içerisinden seçilmiş, 2,0-3,5
KP'na sahip, 3-5 yaşlı, tek doğum yapmış toplam 84 baş koyun oluşturmuştur.
Yem Materyali;
Kaba yem materyalini, doğal meraya ek olarak fiğ ve yonca kuru otu oluşturmuştur. Kesif
yem işletmede bulunan yem ünitesinde hazırlanmıştır. Kesif yemde kullanılan buğday
146
koyunlarda tüm dönemlerde bütün halde tüketime sunulmuştur. Çalışmada kullanılan
yemlerin ham besin madde içerikleri Akyıldız (1984) tarafından bildirilen analiz
yöntemleriyle belirlenmiş, metabolik enerji (ME) düzeyleri ise TSE (1991) tarafından
önerilen eşitlik aracılığı ile hesaplanmıştır. Kaba yemlerde karbonhidrat sınıflarının analizleri
Van Soest ve ark. (1991) tarafından önerilen yöntemle gerçekleştirilmiştir. Laktasyon
döneminde koyunların beslenmesi için hazırlanan karma yemde buğday (% 60), buğday
kepeği (% 18), ayçiçeği tohumu küspesi (% 20), vitamin-mineral karması (% 1), tuz (% 0,4)
ve mermer tozu (% 1,5) kullanılmıştır.
TSE (1991) tarafından önerilen formül: ME, kcal/kg OM = 3260 + 0.455 (A) – 4.037 (H) +
3.517 (B) (A = Ham protein, g/kg OM; H = Ham selüloz, g/kg OM; B = Ham yağ, g/kg OM ).
Gruplarının oluşturulması, deneme düzeni ve besleme uygulamaları;
Laktasyon ve aşım dönemleri, besleme düzeylerinin gruplar arasında farklılaştığı dönemleri
oluştururken, gebelik ve kuru dönemlerde tüm gruplar benzer besleme uygulamalarına tabi
tutulmuştur. Besleme uygulamalarının sergileyeceği farklılıklar açısından NRC (2007)
tarafından tek doğum yapmış koyunlar için önerilen değerler referans alınmıştır. Temel
beslenme farklılıklarının oluşturulduğu 96 günlük laktasyon dönemi 2010 yılı Şubat, Mart ve
Nisan aylarını kapsamış ve tüm gruplar ağılda kapalı olarak yemlenmişlerdir.
Laktasyon döneminde toplam 84 baş koyun, yeterli seviyede beslenen (Kontrol; n=42) ve
düşük seviyede beslenen (Deneme; n=42) gruplar olmak üzere iki deneme grubunu
oluşturmuştur. Flushing döneminde ise bu gruplar flushing uygulanan (Kontrol-F ve DenemeF) ve uygulanmayan (Kontrol ve Deneme) dört alt gruba ayrılmışlardır. Laktasyon döneminde
yeterli seviyede beslenen gruba (Kontrol) ait koyunlar, NRC (2007) tarafından aynı fizyolojik
dönem için bildirilen besin madde tüketimi sağlanacak şekilde beslenirken, kısıtlı beslenen
grupta (Deneme) bulunan koyunlar yeterli seviyede beslenen grupların yaklaşık % 70’ i
oranında yemleme seviyesinde beslenmişlerdir (Çizelge 1).
Çizelge 1. Laktasyon boyunca gruplara göre koyunların ortalama günlük kaba-kesif yem ve temel besin madde
tüketim miktarları
Gruplar
Yemler ve besin maddeleri
Kontrol (n=42)
Deneme (n=42)
Fiğ kuru otu, kg
0.5
0.5
Kesif yem, kg
1.0
0.5
KM, kg
1.353
898
ME1, Mcal
4.155
2.722
HP1, g
199
135
1
KM: Kuru madde, ME: Metabolik enerji, HP: Ham protein.
Kuru dönemde, doğal meraya ilave olarak herhangi bir ek yemleme yapılmamıştır. Temmuz
ayında meranın kuruması ve koyunların besin madde ihtiyaçlarını karşılamakta yetersiz
olması nedeniyle flushing başlangıcına kadar geçen bir aylık sürede tüm koyunlar grup
koşullarında ortalama olarak günlük 0,9 kg/baş yonca kuru otu ve 120 g/baş kesif yemle
beslenmişlerdir. Gebelik dönemi besleme uygulamalarında ise tüm gruplar aynı seviyede
beslenmiş, bu dönemde doğal mera ve tahıl anızlarından faydalanılmıştır.
Flushing dönemin besleme uygulamaları Çizelge 2’de verilmiştir. Flushing, koç katımından
üç hafta önce Ağustos ayı ortasından itibaren başlatılmış ve koç katımı sonrasında ise ikinci
haftadan itibaren göreceli olarak düşürülmüştür. Çalışmada flushing gruplarına (Kontrol-F ve
Deneme-F) aşım döneminde aynı düzeyde ek yemleme uygulaması yapılırken, diğer gruplar
(Kontrol ve Deneme) aynı fizyolojik dönem için bildirilen değerler (NRC, 2007) seviyesinde
aynı düzeylerde beslenmişlerdir (Çizelge 2). Aşım dönemi süresince enerji kaynağı olarak
İşletme koşullarında üretilen buğday ve dışarıdan satın alınan yonca kuru otu kullanılmıştır.
Yemleme sabah ve akşam günde iki sefer yapılmıştır.
147
Çizelge 2. Aşım döneminde gruplara göre koyunların günlük kaba-kesif yem ve temel besin madde tüketim
miktarları
Gruplar
Yemler ve besin maddeleri
Kontrol-F
Kontrol
Deneme-F
Deneme
(n=21)
(n=21)
(n=21)
(n=21)
Yonca kuru otu, kg
1.0
1.0
1.0
1.0
Buğday, kg
0.6
0.2
0.6
0.2
KM1, kg
1.387
1.034
1.387
1.034
ME1, kcal
4.194
3.093
4.194
3.093
HP1, g
208
167
208
167
1
KM: Kuru madde. ME: Metabolik enerji. HP: Ham protein
Döl verimi ölçütleri ve ovulasyon oranının belirlenmesi;
Kızgınlıkları belirlemek amacıyla her gün sabah yemlemesinden hemen sonra kızgınlık
gösteren koyunlar, arama koçu kullanılarak belirlenmiştir. Kızgınlıkları tespit edilen koyunlar
ayrı bir bölmeye alınmış ve daha önceden belirlenen koçlar kullanılarak aşımlar
gerçekleştirilmiştir. Yaklaşık bir ay süren aşım döneminde tüm aşımlar elde aşım yöntemiyle
gerçekleştirilmiştir. Kızgınlığı tekrar eden koyunlar ikinci kez koça verilmiştir. Koç katım
dönemi başlangıcından itibaren koyunlar koçlarla aynı ağılda aralarında demir parmaklıklarla
ayrılmış oldukları padoklarda bakılmıştır. Aşımlarda toplam 6 baş tecrübeli koç tüm gruplarda
dengeli olarak kullanılmıştır. Döl verimi ölçütlerinden; kızgınlık oranı, kısırlık oranı,
kuzulama oranı, KKDK (Doğan kuzu/Koç altı koyun), DKDK (Doğan kuzu/Doğuran koyun),
tek kuzulama oranı, ikiz kuzulama oranı ve üçüz kuzulama oranı hesaplanmıştır (Kaymakçı,
2006).
Ovulasyon oranı kızgınlık gösteren koyunlarda kızgınlığın tespitinden sonraki 5-6. günlerde
ovaryumlar üzerinde şekillenmiş olan korpus luteum (CL)’ların sayılması yöntemi ile
belirlenmiştir (Kaymakçı, 2006). Laparoskopi seti; düz ileri görüşlü 5-10 mm çapında 00 fiber
optik ışık transmisyonu bulunan teleskop, 150 cm uzunluğunda 4,5 mm çapında fiber optik
ışık kaynağı kablosu, 150 watt halojen ampul ile çalışan ışık kaynağı, teleskop ve forseps için
iki adet trokar, 30-36 cm uzunluğunda 5 mm çapında 3600 dönebilen çift çene hareketli, düz
uçlu paslanmaz forseps ve karbondioksit gaz tüpünden oluşmuştur. Laparoskopi uygulanacak
koyunlara 24 saat öncesinden itibaren yem verilmemiş ve 12 saat susuz bırakılmışlardır.
Kızgınlık gösteren koyunlar daha sonra laparoskopi uygulaması için özel olarak hazırlanmış
sehpa üzerine yatırılarak sağ ve sol ovaryumlar üzerindeki CL sayıları ayrı ayrı belirlenerek
kaydedilmiştir (Scaramuzzi ve Downing, 1997). İkinci kez kızgınlık gösteren koyunlarda
laparoskopi uygulanmamıştır.
Kondüsyon puanı ve canlı ağırlık değişiminin takibi;
Koyunlarda KP ve CA’lar aylık olarak, toplam 13 dönemde takip edilmiştir. KP tespitleri
koyunun sağrı bölgesinde elle yapılan değerlendirme ile, 1 (çok zayıf) ve 5 ( çok yağlı)
arasında ve 0,5 puan aralıklarında yapılmıştır (Russel ve ark., 1969). Koyunların CA’ları
sabah yemlemesinden önce 100 g’a hassas elektronik terazi kullanılarak belirlenmiştir.
Kan numunelerinin alınması. serumların çıkarılması ve analiz; Kan serum biyokimyasal
parametrelerinin konsantrasyonlarının belirlenmesi için çalışma süresince doğumdan itibaren
11 ayrı dönemde (G0, G30, G60, G90, G120, G150, G180, G210-flushing başlangıcı, koç
katım dönemi başlangıcı, aşım, aşım sonrası 10. gün) gruplarda yer alan koyunlardan kan
örnekleri alınmıştır. Örnek alınma günlerinde sabah yemlemesinden yaklaşık 3 saat sonra
148
Vena Jugularisten vakumlu tüpler aracılığı ile alınan kan örnekleri, 3000 rpm 15°C de 15
dakika süre ile santrifüj edilerek eppendorflara serumlar ayrıldıktan sonra, serum örnekleri –
40 °C’ de analiz gününe kadar korunmuştur. Serum örneklerinde kan biyokimyasal
parametrelerinden; glikoz (GLUC), total protein (TP), serbest yağ asitleri (NEFA) ve kan üre
azotu (BUN) düzeyleri belirlenmiştir. Serum örneklerinde NEFA analizleri, Wako marka
NEFA-HR(2) kitleri kullanılarak gerçekleştirilmiştir. Test kiti in vitro enzimatik kalorimetrik
prensibe dayalı olarak çalışmaktadır. NEFA analizleri spektrofotometrik yöntemler
kullanılarak gerçekleştirilmiştir (UVmini–1240 Shimadzu Spectrofotometer). Analiz için 7µl
serum örneği cam deney tüplerine konularak üzerine birinci reaktif çözeltisinden (R1 ) 300 µl
eklenmiş ve 37 0C’deki su banyosunda 3 dk süre ile bekletilmiştir. Süre bitiminde deney
tüpüne 150 µl ikinci reaktif çözeltisinden (R2) eklenerek aynı sıcaklıktaki su banyosunda 4,5
dk bekletilmiştir. Bu süre sonunda örnek 546 nm dalga boyuna ayarlanmış spektrofotometre
cihazında okuma işlemi gerçekleştirilmiştir. Kalibrasyon eğrisinin oluşturulmasında kit
içerisinde yer alan standart çözeltiden yararlanılmıştır. Biyokimyasal parametrelerin tümü
(GLUC, TP, BUN) Siemens Dimention Rxl max analizörde kolorimetrik yöntemle
yapılmıştır. Kolorimetri, renk ölçülmesi esasına dayanan miktar tayin yöntemidir. Bir
çözeltide konsantrasyonu belli olmayan bir madde tarafından oluşturulan rengin aynı
maddenin bilinen konsantrasyondaki çözeltisinin rengi ile karşılaştırılması suretiyle
konsantrasyon tayinidir. GLUC, BUN 340-383 nm. TP 540-700 nm. dalga boyunda bikromatik
veya trikromatik end point teknikle ölçülmüştür.
İstatistik değerlendirme;
KP ve CA verilerine ilişkin istatistik analizlerinde grup (Kontrol-F, Kontrol, Deneme-F,
Deneme), yaş (3, 4, 5) ve dönemin (G0, G30, G60, G90, G120, G150, G180, aşım, G240,
G270, G300, G330, doğum) sabit faktörler olarak dikkate alındığı doğrusal bir model
kullanılmıştır. İkili karşılaştırmalarda TUKEY testi kullanılmıştır. Takip edilen üreme
özelliklerinin istatistik analizlerinde grup (Kontrol-F, Kontrol, Deneme-F, Deneme) ve yaşın
(3, 4, 5) sabit faktörler olarak yer aldığı kesikli modelden yararlanılmıştır. İkili
karşılaştırmalarda ki-kare testi kullanılmıştır. Tüm istatistik analizlerinde SPSS (10) paket
programı kullanılmıştır. Serum örneklerinden elde edilen biyokimyasal parametrelerin
istatistik analizlerinde grup (Kontrol-F, Kontrol, Deneme-F, Deneme), yaş (3, 4, 5) ve
dönemin (G0; G30; G60; G90; G120; G150; G180; aşım dönemi başlangıcı, kızgınlık günü)
sabit faktörler olarak dikkate alındığı ve grup yaş etkileşiminin yer aldığı doğrusal bir model
kullanılmıştır. İkili karşılaştırmalarda TUKEY testi kullanılmıştır.
Bulgular:
Kondüsyon puanı ve canlı ağırlık;
Çizelge 1’de görüldüğü gibi, gruplar arasındaki KP ve CA farkı deneme başlangıcında
önemsizken (P>0.05), laktasyonun ilk ayından itibaren, tüm laktasyon dönemleri boyunca KP
ve CA farklılığı yeterli beslenen gruplarda (Kontrol-F ve Kontrol) daha yüksek bulunmuştur
(P≤0.01). Doğal mera otlatma sürecini kapsayan ve koyunların kuruya çıktığı dönemde tüm
gruplarda KP ve CA kayıplarının gerçekleştiği gözlenmiştir, fakat gruplar arasındaki KP ve
CA farklılığı devam etmiştir (P≤0.01).
Flushing uygulaması sonucunda tüm gruplarda KP ve CA artışı gözlenmiş, gruplar arasında
gözlenen KP ve CA farklılığı devam etmiştir (P≤0.01). Gebelik döneminin genelinde gruplar
arasındaki KP farklılığı önemli bulunurken (P=0.001), gebeliğin 4. ayı (P=0.165) ve doğum
(P=0.949) dönemlerinde gruplar arasındaki KP farklılığı önemsizdir. Gebelik döneminin 1. ve
4. aylarında gruplar asındaki CA farkı ise önemlidir (P<0.05).
149
Çizelge 3. Koyunların, gruplara göre aylık KP değişimlerine ilişkin saptanan en küçük kareler ortalama ( x ),
standart hata ( Sx ) ve P değerleri
Gruplar
P
Kontrol
Deneme
Fizyolojik dönem
Grup
Yaş
Grup*Yaş
Doğum
Lakt. 1
Lakt. 2
Lakt. 3
Kuru dönem
Kuru dönem
x
Sx
x
Sx
2.64
2.06a
1.79a
2.44a
2.30a
2.25a
Kontrol-F
0.07
0.07
0.05
0.05
0.05
0.06
Kontrol
2.65
1.56b
1.59b
1.90b
1.82b
1.84b
Deneme-F
0.07
0.07
0.06
0.05
0.06
0.06
Deneme
x
Flushing
Aşım
Gebelik-1
Gebelik-2
Gebelik-3
Gebelik-4
Doğum
*
2.21a
2.69a
2.79a
2.93a
3.14a
3.14
2.86
Sx
0.06
0.06
0.07
0.09
0.09
0.08
0.09
x
2.20a
2.53ab
2.48b
2.54bc
2.76bc
3.29
2.91
Sx
0.06
0.06
0.08
0.09
0.09
0.08
0.10
x
Sx
1.79b
2.38b
2.45b
2.64ab
2.88ab
3.05
2.86
0.06
0.06
0.07
0.09
0.09
0.08
0.09
x
0.956
0.001
0.013
0.001
0.001
0.001
0.707
0.657
0.135
0.541
0.025
0.202
0.842
0.823
0.799
0.125
0.198
0.121
0.001
0.001
0.001
0.001
0.001
0.165
0.949
0.040
0.095
0.002
0.001
0.001
0.001
0.043
0.117
0.163
0.187
0.493
0.063
0.164
0.227
Sx
1.78b
2.01c
2.16c
2.27c
2.57c
3.08
2.84
0.06
0.06
0.08
0.09
0.09
0.08
0.10
Aynı satırda farklı harfleri taşıyan grup ortalamaları arasındaki fark önemlidir (P≤0.01).
Çizelge 4. Koyunların, gruplara göre aylık CA (kg) değişimlerine ilişkin saptanan en küçük kareler ortalama ( x
), standart hata ( Sx ) ve P değerleri
Gruplar1
Fizyolojik
Kontrol
Deneme
Grup Yaş Grup*Yaş
dönem2
Doğum
Laktasyon-1
Laktasyon-2
Laktasyon-3
Kuru dönem
Kuru dönem
x
Sx
x
Sx
68.83
61.66a
59.97a
58.83a
57.23a
57.86a
Kontrol-F
0.96
0.93
0.89
0.92
0.80
0.73
Kontrol
68.13
56.99b
54.62b
53.38b
53.21b
52.24b
Deneme-F
0.97
0.94
0.90
0.94
0.81
0.74
Deneme
x
Flushing
Aşım
Gebelik-1
Gebelik-2
Gebelik-3
Gebelik-4
Doğum
1
55.49ab
60.51a
60.82a
62.75
64.93
72.46a
67.15
Sx
1.24
1.31
1.31
1.34
1.37
1.62
1.43
x
56.16a
57.39ab
58.86ab
61.40
63.18
69.78ab
68.04
Sx
1.17
1.24
1.24
1.27
1.30
1.53
1.36
x
51.80b
58.13ab
58.05ab
60.69
62.48
69.10ab
66.57
Sx
1.08
1.15
1.15
1.18
1.20
1.42
1.26
x
51.75b
53.81b
54.86b
57.93
59.76
65.54b
62.94
0.608
0.001
0.001
0.001
0.001
0.001
0.484
0.649
0.523
0.517
0.749
0.918
0.415
0.447
0.589
0.612
0.776
0.516
0.010
0.005
0.014
0.073
0.060
0.027
0.055
0.577
0.583
0.636
0.453
0.469
0.496
0.164
0.793
0.364
0.274
0.339
0.260
0.253
0.213
Sx
1.18
1.25
1.25
1.28
1.31
1.55
1.37
Flushing başlangıcından itibaren flushing uygulanan (KF ve DF) ve uygulanmayanlar (K ve D) olmak üzere grup sayısı
dörde ulaşmıştır
2
Aynı satırda farklı harfleri taşıyan grup ortalamaları arasındaki fark önemlidir (P≤0.05).
Kan Metabolitleri;
Laktasyon ve kuru dönemler için takip edilen kan serum metabolitlerine (GLUC, TP, BUN ve
NEFA) ilişkin bulgular Çizelge 8’ de, flushing ve aşım dönemi için elde edilen bulgular ise
Çizelge 9’da sunulmuştur.
Deneme başlangıcında, Kontrol ve Deneme gruplarında takip edilen metabolitler (GLUC, TP,
BUN ve NEFA) bakımından farklılıklar önemsizdir (Çizelge 8; P>0.05). Laktasyonun 1.
ayının sonunda kısıtlı beslenen koyunların ortalama NEFA düzeyleri yeterli seviyede
beslenen gruba göre artış göstermiş (P=0.001), bu artış laktasyonun 2. ayında da devam
150
etmiştir (P=0.051). Gruplar arasında NEFA bulguları bakımından belirlenen bu farklılık.
laktasyonun son ayı ve kuru dönemde görülmemiştir (P>0.05). Ayrıca laktasyonun 3. ayında
NEFA düzeyleri üzerine yaşın etkisi önemli bulunmuştur (P=0.03). Laktasyonun 2. ayı
sonunda kısıtlı seviyede beslemeye bağlı olarak BUN düzeyinde düşüş görülmüş (P=0.001),
laktasyonun ilk ve son aylarında bu farklılık görülmemiştir (P>0.05). Gruplar arasında GLUC
ve TP değerleri bakımından laktasyonun üç dönemi boyunca gözlenen farklılık ise önemli
değildir (P>0.05).
Kuru dönemde gruplar arasında GLUC ve BUN değerleri bakımından belirlenen farklılıklar
önemlidir (P<0.01). Fakat bu dönem için TP ve NEFA değerleri bakımından gruplar arsındaki
farklılık önemsizdir (P>0.05). Flushing başlangıcında takip edilen tüm metabolitler
bakımından gruplar arsında gözlenen farklılık önemsiz bulunurken (P>0.05), BUN değerleri
üzerine yaşın etkisi önemlidir (P=0.014). Ek yemlemenin devam ettiği aşım dönemi
başlangıcında GLUC, TP ve BUN değerleri bakımından gruplar arasındaki farklılık önemli
(P<0.05), NEFA değerleri bakımından gözlenen farklılık ise önemsizdir (P=0.186). Kızgınlık
gününde flushing uygulanan grupların (Kontrol-F ve Deneme-F) NEFA değerlerinde flushing
uygulanmayan gruplara göre (Kontrol ve Deneme) gözlenen düşüş önemli (P=0.017)
bulunurken. GLUC, TP ve BUN değerleri bakımından gruplar arasındaki fark önemsizdir
(P>0.05).
Çizelge 5. Koyunlarda gruplara göre doğum, laktasyon ve kuru dönemde kan parametrelerine ilişkin saptanan en
küçük kareler ortalama ( x ), standart hata ( Sx ) ve P1 değerleri
Gruplar
Dönem
doğum
1. ay
(laktasyon)
2. ay
(laktasyon)
3. ay
(laktasyon)
4. ay
(kuru dönem)
5. ay
(kuru dönem)
1
Kontrol
Metabolit
GLUC (mg/dl)
TP (g/dl)
BUN (mg/dl)
NEFA (mE/l)
GLUC (mg/dl)
TP (g/dl)
BUN (mg/dl)
NEFA (mE/l)
GLUC (mg/dl)
TP (g/dl)
BUN (mg/dl)
NEFA (mE/l)
GLUC (mg/dl)
TP (g/dl)
BUN (mg/dl)
NEFA (mE/l)
GLUC (mg/dl)
TP (g/dl)
BUN (mg/dl)
NEFA (mE/l)
GLUC (mg/dl)
TP (g/dl)
BUN (mg/dl)
NEFA (mE/l)
P
Deneme
x
Sx
x
Sx
50.07
6.46
16.34
0.66
47.33
5.79
18.74
0.68b
39.46
5.61
15.65a
0.62b
38.67
5.65
16.75
0.60
27.05b
6.38
9.05b
0.59
34.88a
6.65
14.14a
0.65
0.99
0.08
0.45
0.01
0.83
0.10
0.53
0.02
0.61
0.07
0.49
0.01
0.71
0.08
0.54
0.01
0.71
0.07
0.35
0.01
0.93
0.07
0.44
0.01
52.02
6.51
17.14
0.68
46.63
5.72
19.52
0.76a
39.86
5.46
13.31b
0.64a
39.12
5.56
18.21
0.61
30.45a
6.57
10.36a
0.59
31.10b
6.62
10.86b
0.63
0.98
0.08
0.44
0.01
0.84
0.10
0.53
0.02
0.60
0.07
0.49
0.01
0.68
0.07
0.51
0.01
0.71
0.07
0.35
0.01
0.94
0.07
0.44
0.01
Grup
Yaş
Grup*Yaş
0.164
0.706
0.204
0.234
0.552
0.647
0.298
0.001
0.637
0.140
0.001
0.051
0.649
0.409
0.054
0.442
0.001
0.061
0.010
0.732
0.005
0.738
0.001
0.083
0.729
0.392
0.299
0.427
0.358
0.314
0.144
0.226
0.805
0.853
0.705
0.467
0.273
0.351
0.279
0.031
0.077
0.246
0.010
0.706
0.101
0.522
0.839
0.925
0.314
0.861
0.427
0.468
0.606
0.506
0.116
0.520
0.778
0.925
0.226
0.711
0.529
0.838
0.917
0.051
0.963
0.996
0.681
0.708
0.320
0.838
0.713
0.130
Aynı satırda farklı harfleri taşıyan grup ortalamaları arasındaki fark önemlidir (P<0.05).
Kızgınlık;
Çalışmada tüm gruplarda toplam 83 baş koyundan sadece D grubunda bulunan bir baş koyun
kızgınlık göstermemiştir. Kızgınlık oranları KF, K ve DF gruplarında % 100, D grubunda %
95 olarak gerçekleşmiştir (P=0.363). Toplam 17 baş koyun ikinci kez kızgınlığa gelmiştir.
İkinci kez kızgınlık gösteren koyun sayıları KF, K, DF ve D grupları için sırasıyla 5, 5, 2 ve 5
baş olarak gerçekleşmiş, gruplar arasındaki fark önemsizdir (P=0.530). Üçüncü kez kızgınlık
gösteren koyun bulunmamıştır. Kızgınlıkların toplulaşması ile ilgili veriler Çizelge 5’te
151
sunulmuştur. DF grubu koyunlarda kızgınlık diğer tüm gruplardan daha kısa sürede
gerçekleşmiştir (P=0.020).
Kızgınlık
Aşım dönemi
Flushing başı
1
Metabo
litler
Dönem
Çizelge 6. Gruplara göre flushing, aşım, ve kızgınlık günü kan parametrelerine ilişkin en küçük kareler ortalama
( x ), standart hata ( Sx ) ve P1 değerleri
Gruplar
Kontrol-F
Kontrol
P
Deneme-F
Deneme
Grup
Yaş
Grup*Yaş
1.11
0.898
0.534
0.617
7.07
0.12
0.520
0.483
0.582
0.67
16.66
0.68
0.228
0.014
0.864
0.01
0.60
0.01
0.492
0.049
0.810
c
1.42
0.019
0.816
0.571
bc
0.11
0.028
0.076
0.583
b
x
Sx
x
Sx
x
Sx
x
Sx
GLUC (mg/dl)
36.52
0.08
36.21
1.11
35.43
1.08
35.76
TP (g/dl)
6.96
0.11
7.04
0.12
6.85
0.11
BUN (mg/dl)
15.19
0.67
14.88
0.68
16.14
NEFA (mE/l)
0.62
0.01
0.63
0.01
0.62
GLUC (mg/dl)
TP (g/dl)
ab
36.14
6.50
ab
BUN (mg/dl)
29.65
NEFA (mE/l)
a
1.42
0.11
35.95
6.52
bc
a
c
a
1.38
39.43
0.11
c
6.11
1.38
0.11
ab
32.99
6.41
0.69
25.29
0.68
29.19
0.68
28.19
0.70
<0.001
0.310
0.646
0.64
0.02
0.66
0.02
0.60
0.02
0.61
0.02
0.186
0.453
0.735
GLUC (mg/dl)
47.38
1.99
41.58
2.01
47.53
2.05
43.59
2.10
0.108
0.769
0.302
TP (g/dl)
6.35
0.13
6.41
0.13
6.06
0.13
6.29
0.14
0.261
0.558
0.915
BUN (mg/dl)
24.43
0.88
24.15
0.89
25.57
0.90
26.39
0.93
0.276
0.503
0.811
NEFA (mE/l)
b
0.02
a
0.02
bc
0.02
ab
0.03
0.017
0.072
0.132
0.71
0.78
0.67
0.74
Aynı satırda farklı harfleri taşıyan grup ortalamaları arasındaki fark önemlidir (P<0.05).
Çizelge 7. Gruplarına göre koç katımından itibaren kızgınlıkların gözlendiği günlere ait en küçük kareler
ortalama, standart hata ( Sx ) ve P değerleri1
Grup
Özellik
Kontrol-F
Kontrol
Deneme-F
Deneme
Grup
Yaş
Grup*Yaş
n
21
21
21
19
Gün
11.00±1.20b
12.19±1.20b
7.05±1.20a
10.95±1.26b
0.020 0.968
0.300
1
Farklı harfleri taşıyan grup ortalamaları arasındaki farklılık önemlidir (P≤0.05).
Ovulasyon oranı; Ovulasyon oranı bakımından sağ ovaryumların (% 56,45) sol ovaryumlara
(% 43,55) göre daha aktif olduğu gözlenmiştir (P=0.002; Çizelge 8). En yüksek ovulasyon
oranı Kontrol-F grubunda gözlenirken bunu sırasıyla Kontrol, Deneme-F ve Deneme grupları
izlemiştir (P=0.296). Ayrıca en yüksek ovulasyon oranı 3 yaşlı koyunlarda (1.64±0.12) tespit
edilirken bunu sırasıyla 5 yaşlı (1.56±0.10) ve 4 yaşlı (1.39±0.09) koyunlar takip etmiştir
(P=0.03).
Çizelge 8. Gruplara göre koyunların ovulasyon oranlarına ilişkin en küçük kareler ortalama ( x ), standart hata (
Sx ) ve P değerleri
Grup
Özellik
Laparoskopi yapılan koyun
Tek ovulasyon gösteren koyun
İkiz ovulasyon gösteren koyun
Üçüz ovulasyon gösteren koyun
Ovulasyon oranı
Kontrol-F
21
10
8
3
1.67±0.13
Kontrol
21
9
11
1
1.62±0.13
Deneme-F
20
11
9
1.45±0.13
Deneme
19
12
7
1.37±0.14
P
0.296
Kuzulama sonuçları; Deneme toplam 83 baş koç altı koyundan 76 baş koyun doğurmuştur.
Kuzulama oranı, kısırlık oranı, KKDK ve DKDK özellikleri bakımından gruplar arasında
görülen farklılıklar önemsizdir (P>0.05; Çizelge 9).
Çizelge 9. Uygulama gruplarında bazı döl verim özellikleri
Grup
Özellikler
Koç altı koyun
Doğuran koyun
Kısır koyun
Tek doğuran koyun
Kontrol-F
21
18
3
9
Kontrol
21
20
1
11
Deneme-F
21
21
13
Deneme
20
17
3
11
152
İkiz doğuran koyun
8
9
8
Üçüz doğuran koyun
1
Doğan kuzu
28
29
29
Kuzulama oranı, %
85.71
95.24
100.00
Kısırlık oranı, %
14.29
4.76
0.00
Tek doğum oranı, %
50.00
55.00
61.91
İkiz doğum oranı, %
44.44
45.00
38.09
Üçüz doğum oranı, %
5.56
0.00
0.00
KKDK1
1.33±0.15
1.38±0.15
1.38±0.15
DKDK2
1.57±0.13
1.46±0.12
1.38±0.12
1
KKDK; koç altı koyun başına düşen kuzu sayısı. 2DKDK; doğuran koyun başına düşen kuzu sayısı.
6
23
85.00
15.00
64.71
35.29
0.00
1.10±0.15
1.36±0.13
Kuzuların canlı ağırlıkları;
Kuzularda DA, SKA ve GCAA için ortalama değerler sırasıyla 4,71 kg, 29,79 kg ve 261 g
olarak gerçekleşmiştir. Doğum ağırlığı (DA), sütten kesim ağırlığı (SKA) ve günlük canlı
ağırlık artışı (GCAA) üzerine grup ve ana yaşının etkisi önemsiz (P>0.05) bulunurken, doğum
tipi (P<0.01) ve cinsiyetin etkisi önemlidir (P<0.040).
Tartışma ve Sonuç:
Yetiştirme pratikleri ve üretimin yoğunluğu açısından koyunların vücut rezervlerinde
dolayısıyla KP, CA ve metabolitlerde, yıl boyunca; gebelik, laktasyon ve kuru dönem gibi
fizyolojik dönemlerinde önemli değişimler meydana gelir. Bu nedenle yıl içerisinde
koyunların KP ve CA’ larının takip edilmesi besleme koşullarının değerlendirilmesi açısından
önemli araçlardır (Chillard ve ark., 1998). Bu çalışmada, deneme başlanıcında gruplar
arasında KP, CA ve takip edilen tüm kan serum metabolitleri bakımından farklılıklar önemli
bulunmamıştır (Çizelge 3). Bu durum deneme başlangıcında benzer özelliklere sahip
grupların oluşturulduğunu göstermektedir. Fakat laktasyonun ilk ayından itibaren denemede
uygulanan besleme seviyelerine bağlı olarak KP, CA ve kan serum metabolitleri bakımından
gruplar arasında önemli farklılıklar gözlenmiştir (P<0.05). Bununla birlikte kan serum
metabolitleri bakımından gruplar arasında belirlenen farklılıklar ile kontrol dönemlerinde
takip edilen CA ve KP değişimlerinin uyumlu olduğu görülmüştür.
Laktasyon döneminde CA kaybı ırk ve doğum tipine bağlı olarak % 6-21 oranlarında
gerçekleşebilmektedir (Snowder ve Glimp, 1991; Joy ve ark., 2008). Chillard ve ark., (1998)
koyunların düşük seviyede beslenmeleri durumunda (% 34-40 yaşama payı) 1-2 haftanın
içerisinde CA’da %15 oranında düşüş görülebileceğini, bu düzeyde beslemenin devam
ettirildiği durumda (60-80 gün) CA’da gözlenen düşüşün %30 oranlarına kadar
yükselebileceğini bildirmektedirler. Seibert ve ark. (2004)’ları koyunların laktasyon
döneminde, doğal mera koşullarında % 8,0-13,4 arasında CA kaybı gösterdiğini
bildirmişlerdir. Alexandre ve ark., (2001) laktasyon döneminde düşük (%75) ve normal
(%100) besleme koşullarında koyunların vücut rezervlerini mobilize ederken yüksek seviyede
(% 150) beslenmeleri halinde KP ve CA kazandıklarını bildirmektedirler. Bu çalışmada
laktasyon döneminde KP ve CA kaybeden koyunlar kuru dönemi önemli bir kayıp yaşamadan
geçirmişler, flushing uygulaması sonucunda ise tüm gruplarda KP ve CA artışı gözlenmiştir.
Ayrıca flushing uygulanan gruplarda flushing uygulanmayan gruplara oranla daha fazla KP ve
CA artışı gerçekleşmiştir. Karacabey Merinosu koyunlar için bildirilen KP değerleri kuzulama
ve sütten kesim dönemleri için sırasıyla 3,4 ve 2,3 (Köycü ve ark., 2008), CA değerleri ise
62,6 ve 71,2 kg (Oğan, 1994; Altınel ve ark., 2000; Köycü v ark., 2008) aralığında
değişmektedir. Bu çalışmada elde edilen KP ve CA değerlerinin Karacabey Merinosları için
bildirilen değerlerden düşük olması ele alınan besleme uygulamalarının geçmiş yıllara ait
işletme pratiklerinin altında gerçekleşmesinden kaynaklanmış olabilir.
Laktasyon döneminde diğer fizyolojik dönemlere göre NEFA konsantrasyonu önemli oranda
yükselmektedir (Attı ve ark., 2004). Bu çalışmada laktasyonun ilk ayında en yüksek NEFA
düzeyi kısıtlı beslenen koyunlarda (Deneme) gözlenmiştir (Çizelge 5). Kızgınlık gününde
153
NEFA seviyesinde gözlenen artış ise üreme aktivitesinin metabolik süreçlere olan etkilerine
bağlı olarak şekillenmiş olabilir (Çizelge 6). Laktasyon döneminde gözlenen artış ise negatif
enerji dengesine bağlı olarak ortaya çıkmıştır. Kuru dönemde (mayıs ayı) meranın kalitesinin
iyi durumda olması sonucunda uygulama gruplarında NEFA düzeylerinin (0,59 mE/l) önemli
oranda düştüğü gözlenmiştir. Bununla birlikte Haziran ayında mera kalitesinin ve ot veriminin
düşmesine bağlı olarak şekillenen yetersiz ot tüketimi sonucunda serum NEFA seviyeleri tüm
gruplarda yükselmiştir (Çizelge 5).
Flushing uygulaması ile birlikte toplam enerji tüketiminde gerçekleşen artışa bağlı olarak
koyunların GLUC seviyesinin önemli oranda yükseldiği bildirilmektedir (Ermin ve Yurtman,
1999). Yine aşım döneminde kuru ot ve tahıl ağırlıklı olmak üzere iki farklı yöntemle
besledikleri koyunlarda Howland ve ark., (1966) yüksek oranda tahıl içeren rasyonların
rumende propiyonik asit oluşumunu hızlandırarak glikoneogenezi desteklediğini, bu
durumunda kan GLUC seviyesinin yükselmesi ile sonuçlandığını vurgulamaktadır. Bu
çalışmada ise serum GLUC seviyeleri kontrol dönemlerinde genel olarak farklı eğilim
göstermiş, GLUC seviyesinin en yüksek olduğu dönemler doğum, laktasyonun ilk ayı ve
kızgınlık dönemlerini kapsamıştır. Bu çalışmada serum GLUC seviyelerine ilişkin elde edilen
değerler mevcut bilimsel çalışmalar ile uyumludur (Ermin ve Yurtman, 1999; Pugh, 2002).
Fizyolojik dönem farklılıklarına bağlanabilecek değişimler dışında plazma TP seviyesinin
farklı besleme seviyesine bağlı uygulamalardan önemli ölçüde etkilenmemektedir (Yurtman
ve ark., 2000). Laktasyon döneminin ilerlemesine bağlı olarak koyunlarda serum TP
düzeylerinde düşüş görülebilir (Ouanes ve ark., 2011). Bu çalışmada da fizyolojik dönem
farklılıklarına bağlı olarak serum TP düzeylerinde önemli farklılıklar gözlenmiş ve laktasyon
döneminde serum TP düzeyi en düşük seviyelerde gerçekleşmiştir (Çizelge 6). Koyunlarda
kan TP düzeyi 6,0-7,9 g/dl arasında değişim göstermektedir (Yurtman ve ark., 2000; Pugh,
2002). Bu çalışmada elde edilen serum TP konsantrasyonları literatürde bildirilen aralıkta
gerçekleşmiştir. Besleme seviyesine bağlı olarak gruplar arasında sadece aşım döneminde
gözlenen farklılık önemli bulunmuştur.
Koyunlar için BUN referans değerleri farklı araştırmacılar tarafından 8,0-20 mg/dl aralığında
bildirilmiştir (Pugh, 2002; Anonim, 2011; Aitken, 2007). Bu çalışmada tüm gruplarda
fizyolojik dönemler içerisinde en düşük BUN değerleri mera otlatması dönemini kapsayan
kuru dönemde gerçekleşmiş, ek yemleme ve kızgınlık dönemlerinde ise BUN düzeyinde
önemli artış gözlenmiştir (Çizelge 6). Ruminantlarda BUN düzeyi yemlerin protein düzeyi ve
rumende amonyak üretimine bağlıdır (Torrel ve ark., 1974; Moghaddam ve Hassanpour,
2008) ve protein metabolizmasını değerlendirmek için yaygın olarak kullanılmaktadır
(Preston ve ark., 1965; Aydın, 2007). Sığırlarda 10 mg/dl’nin altındaki BUN değerleri protein
yetersizliğinin bir göstergesidir ve 20 mg/dl üzerindeki değerler ise gebelik oranını düşürdüğü
bildirilmiştir (Sonderman ve Larson, 1989; Butler, 1998). Kuzular için 10 mg/dl üzerinde
BUN düzeyinin protein tüketiminin yeterliliğinin göstergesi olduğunu bildirilmiştir (Preston
ve ark., 1965). Yine protein metabolizmasındaki artışa bağlı olarak gebelik döneminde
koyunların BUN değerleri daha yüksek bildirilmiştir (Moghaddam ve Hassanpour, 2008;
Gürgöze ve ark., 2009). Bu çalışmada elde edilen BUN düzeylerinin genel olarak literatür ile
uyumlu olduğu görülmüştür. Bununla birlikte flushing döneminde tüm gruplarda BUN
düzeyinin yemlemedeki artışa paralel olarak arttığı ve flushing uygulanan gruplarda daha
yüksek olduğu gözlenmiştir (P=0.001).
Kızgınlıkların toplu olarak ortaya çıkışı ile flushing uygulamaları arasında önemli bir ilişki
olduğu bilinmektedir (Kaymakçı, 2006; Elnageeb ve ark., 2008). Aşım dönemine düşük KP
ve CA ile giren koyunlar, üreme performansı açısından flushing uygulamalarına daha yüksek
oranlarda tepki vermektedirler (Stubbings, 2007). Diğer yandan aşım mevsimi başlangıcında
yüksek KP ve CA’ a sahip koyunlarda kızgınlıkların daha erken görüldüğü, dolayısıyla
yüksek KP ve CA’ a sahip koyunların kuzulama dönemine erken girdikleri bildirilmektedir
154
(Attı ve ark., 2001). Bu çalışmada ise flushing uygulaması sonucunda düşük KP ve CA sahip
koyunlarda kızgınlıklar daha erken ve toplu olarak şekillenmiş ve Deneme grubunda bulunan
bir baş koyun hariç tüm koyunlarda kızgınlık gözlenmiştir. Kızgınlık göstermeyen bir baş
koyunun aşım döneminde düşük KP (1,5) ve CA (45 kg) değerleriyle grup ortalamasının
altında olduğu gözlenmiştir. Laktasyon döneminde düşük seviyede beslenen ve aşım
döneminde flushing uygulanan grupta (Deneme-F) kızgınlıkların diğer gruplara (Kontrol-F,
Kontrol ve Deneme) kıyasla erken ve toplu olarak gerçekleşmesi flushinge bağlı olarak
gerçekleşmiştir.
Bu çalışmada kızgınlık oranı bakımından elde edilen değerler (ortalama % 98,8) Karacabey
Merinosu için bildirilen değerler (% 93-100) ile uyumludur (Oğan ve ark., 1994; Başpınar ve
ark., 1996; Altınel ve ark., 2000). Bununla birlikte toplam 82 baş kızgınlık gösteren koyundan
17 baş koyunun ikinci kez kızgınlık gösterdiği belirlenmiştir. Bu durum laparoskopi
uygulamasına bağlı olarak gerçekleşmiş ve uygulamaya bağlı stresin etkisi nedeniyle yüksek
oranda ikinci kez kızgınlık gözlenmiştir. Bununla birlikte Deneme-F grubunda tekrar
kızgınlık gösteren koyunların (2 baş) oranının düşük olduğu gözlenmiştir (P=0.530). Bu
durum gebeliğin devamı açısından flushing uygulamasının olumlu etkileri arasında sayılabilir.
Aşım dönemi ve gebeliğin ilk ayında aşırı besleme embriyo yaşama şansını olumsuz
etkilemektedir (Parr ve ark., 1987). Karacabey Merinosu koyunlarında flushing
uygulamasının DKDK sayısı üzerine önemli bir etkisinin olmadığı, bununla birlikte flushing
uygulanan koyunlarda bütün döl verimi özelliklerinin daha yüksek bulunması nedeniyle
flushing uygulamasının yararlı olacağı bildirilmiştir (Oğan ve ark., 1994). Ada ve ark. (2009),
Kıvırcık koyunlarında aşım sezonu KP’nın kuzu verimini önemli düzeyde etkilemediğini,
bununla birlikte KP 2,0’ın altında ve 3,0’ın üstünde olan koyunlarda kuzu veriminde düşüş
gözlendiğini bildirmektedirler. Aşım dönemi CA ve KP ile ovulasyon oranı arasında bildirilen
bu ilişkiler beslemenin üreme performansı üzerindeki statik etkilerinin bir sonucu olarak
ortaya çıkmaktadır. Bu çalışmada laktasyon döneminde yeterli beslenen ve flushing
uygulanan Kontrol-F grubunda ovulasyon oranının yüksek (1,67) gerçekleşmesine rağmen
KKDK sayısının düşmesi (1,33), ayrıca kuzulama oranının Kontrol-F (% 85,71) grubunda
Kontrol grubuna (% 95,24) kıyasla daha düşük gerçekleşmesi ek yemlemenin bu koşullardaki
olumsuz etkileri arasında sayılabilir. Bu çalışmadan doğum oranı ve KKDK sayısı açısından
elde edilen bulgular, aşım dönemi düşük KP’ na sahip olan koyunlarda flushing
uygulamasının üreme performansı üzerine etkilerinin daha fazla olduğu tezini (Hunt ve ark.,
1988; Ada ve ark., 2004) destekler niteliktedir. Ayrıca bu çalışmada KKDK sayısı
bakımından elde edilen sonuçlara göre aşım dönemi KP ve CA iyi durumda olan koyunlarda
kızgınlık sonrasında ek yemlemenin devam ettirilmesinin olumsuz etkilere sahip olduğu,
bununla birlikte aşım dönemi düşük KP’ na sahip koyunlarda ek yemlemenin kuzulama oranı
üzerinde olumlu etkiler yaptığı gözlenmiştir.
Karacabey Merinosu koyunlarında yürütülen farklı çalışmalarda ikiz doğum oranı % 34-53,
DKDK sayısı ise 1,3-1,5 arasında bildirilmiştir (Batmaz ve Başpınar, 1999; Altınel ve ark.,
2000). DKDK sayısı bakımından bu çalışmada elde edilen sonuçların Karacabey Merinosu
için bildirilen literatür değerleri ile uyumlu olduğu gözlenmiştir.
Karaca ve Cemal (2002), Karya koyunlarında en yüksek ovulasyon oranını 6 ve üzeri yaşlı
koyunlarda (2.65) tespit etmişler ve yaşın ovulasyon oranı üzerinde etkisinin önemli
olmadığını bildirmişlerdir. Bununla birlikte yaşın ovulasyon oranı üzerine etkisinin önemli
olduğu yine araştırma bulguları arasında yer almıştır (Schoenian ve Burfening, 1990; Kareta
ve ark., 2006). Schoenian ve Burfening (1990), ovulasyon oranını en düşük 2 yaşlı koyunlarda
(1,08) bulmuşlar ve yaşın ilerlemesine paralel olarak 5 yaşına kadar ovulasyon oranında artış
gözlemişler (1,66), 6 yaşından itibaren ise ovulasyon oranının düştüğünü (1,62)
bildirmişlerdir. Bu çalışmada en yüksek ovulasyon oranı 3 yaşlı koyunlarda (1,64)
belirlenmiş, bunu sırasıyla 5 (1,56) ve 4 yaşlı (1,39) koyunlar takip etmiştir (P=0.030). İlkine
155
doğum yapan koyunlarda DKDK sayısının düşük olduğu ve 5 yaşına kadar kuzu veriminin
arttığı bildirilmektedir (Oğan ve ark., 1994. Sezenler ve ark., 2007. Ada ve ark., 2009). Bu
çalışmada ise incelenen ölçütlerden KKDK ve DKDK sayısı üzerine yaşın etkisi önemsiz
bulunmuştur.
Sağ ovaryumun sol ovaryuma oranla daha aktif olduğu bilimsel çalışmalardan elde edilen
sonuçlar arasındadır (Casida ve ark., 1966; Moakhar ve ark., 2010). Scaramuzzi ve Downing
(1997), sağ ve sol ovaryumların ovulasyon oranı aktivitelerini sırasıyla % 53,4 ve % 46,6
olarak bildirmişlerdir. Bu çalışmada da CL sayılarının dağılımı bakımından sağ ovaryumların
sol ovaryumlardan daha aktif olduğu gözlenmiştir (P=0.002).
Ovulasyon oranı üreme özellikleri açısından en önemli parametrelerden birisidir ve kuzu
veriminin en yüksek düzeyini belirler. Karacabey Merinosu koyunlarında ovulasyon oranının
belirlenmesine yönelik bir çalışmaya tarafımızca rastlanılmamıştır. Bu çalışmada ovulasyon
oranı ortalaması Karacabey Merinosları için 1,53 olarak gerçekleşmiştir. En yüksek
ovulasyon oranı ise Kontrol-F (1,67) grubunda gerçekleşmiştir. Bu çalışmadan elde edilen
değerler ile Karacabey Merinosu koyunların ovulasyon oranı potansiyelinin yüksek olduğu
söylenebilir. Ayrıca kuzulama oranları açısından bu çalışmada elde edilen değerler Karacabey
Merinosları için bildirilen değerler ile uyumludur (Oğan ve ark., 1994; Başpınar ve ark.,
1996; Altınel ve ark., 2000; Sezenler ve ark., 2007).
Folliküler büyümenin devamlılığı başlıca gonadotropinler ve besleme gibi çevresel faktörlerin
etkisi altında gerçekleşmektedir (Webb ve ark., 2004). Robinson ve ark., (2002) aşım sezonu
öncesinde besleme koşullarının iyileştirilmesi ile atresia olan foliküllerin sayısının
azaltılabileceğini ve dolayısıyla ovulasyon oranında artış sağlanabileceğini bildirmektedirler.
Ayrıca yüksek KP’ na sahip koyunların flushing uygulanması koşullarında bile düşük KP’ lı
koyunlardan daha yüksek ovulasyon oranına sahip olduklarını bildirilmektedir (Hunt ve ark.,
1988). Bu çalışmadan elde edilen bulgular farklı fizyolojik dönemlerde besleme koşullarının
ovaryum follikülerinin gelişimini etkileme potansiyeline sahip olduğu tezini desteklemektedir.
Bu çalışmada sadece laktasyon döneminde yeterli beslenen Kontrol-F ve Kontrol gruplarında
üçüz ovulasyon belirlenmesi besleme çevresinin follikülogenesisi destekler yönüyle
açıklanabilir. Ovulasyon oranı bakımından gruplar arasında sayısal olarak gözlenen farkın
laktasyon dönemi besleme koşulları sonucunda gerçekleştiği düşünülmektedir. Bu durumun
beslemenin statik etkileri kapsamında tanımlanan koşullardan kaynaklandığı söylenebilir. Bu
çalışmada ovulasyon oranı en düşük 1.5 KP sahip (1.38) koyunlarda gözlenirken, en yüksek
ovulasyon oranı 3.0 KP’na sahip (2.0) koyunlarda gerçekleşmiştir.
Sonuç olarak;
Kan parametrelerinden GLUC, TP, BUN ve NEFA tanımlayıcı özellikleri bakımından önemli
parametreler arasında sayılmaktadır (Calderia ve ark., 2007; Khatun ve ark., 2011). Bu
çalışmada BUN ve NEFA oranlarında gruplar arasında gözlenen farklılıklar sayılan bu
metabolitlerin koyunların besleme seviyelerine metabolik tepkilerinin değerlendirilmesi
açısından taşıdığı önemi göstermektedir.
Flushingin özellikle aşım döneminde düşük KP ve CA sahip koyunlarda olumlu etkiler
gösterdiği, bununla birlikte aşım döneminde yeterli vücut rezervlerine sahip koyunlarda
embriyo yaşama şansını olumsuz etkileyebilme potansiyeli olduğu görülmüştür. Bu nedenle
flushing uygulanacak koyunlar mutlaka kondüsyonlarına göre sınıflara ayrılmalı ve iyi
kondüsyonda olan koyunların özellikle aşım sonrasında aşırı yem tüketimi engellenmelidir.
Bu çalışmanın koşulları altında laktasyon döneminde maruz kalınan yetersiz besleme
koşullarının üreme performansı üzerinde olumsuz etkiler meydana getirdiği görülmüştür. Bu
çalışmadan elde edilen bulgular aşım mevsiminden 6 ay öncesinden itibaren ele alınan
besleme uygulamalarının koyunların ovulasyon potansiyeli üzerinde belirleyici rol oynadığı
tezini destekler niteliktedir.
156
T.C.
GIDA, TARIM VE HAYVANCILIK BAKANLIĞI
Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü
PROJE SONUÇ RAPORU
GÜNEY KARAMAN VE KARACADAĞ ZOM KOYUNLARININ
FİLOGENETİK YAPILARININ MOLEKÜLER TEKNİKLERLE BELİRLENMESİ
PROJE NO
TAGEM/HAYSUD/12/07/01/03
PROJE LİDERİ
Mehmet Emin VURAL(GAPUTAEM)
PROJE YÜRÜTÜCÜLERİ
Ahmet KARATAŞ (GAPUTAEM)
Necdet AKAY (BDUTAEM)
Yrd. Doç. Dr. Selahattin KİRAZ (Harran Üniv.Zir.Fak.)
Doç. Dr. Seyrani KONCAGÜL (Harran Üniv.Zir.Fak.)
GAP ULUSLARARASI TARIMSAL ARAŞTIRMA VE EĞİTİM MERKEZİ
(GAPUTAEM)
ARALIK/ 2013
DİYARBAKIR
157
KISALTMA TANIMLARI
A
C
G
T
bp
dk
DNA
dH2O
dNTP
EDTA
Et-Br
GC
HCl
kb
lt
gr:
μg
μl
U
μmol
pmol
M
mM
mg/ml
NaCl
NCBI
EBI
PZR
SDS
sp.
TBE
TE
Tm
UPGMA
N-J
K2P
Hd
π
HG
Cty b
12S rRNA
UV
V
w
Adenin
Sitozin
Guanin
Timin
Baz çifti
Dakika
Deoksiribonükleik Asit
Distile su
Deoksi nükleotid trifosfat
Ethylendinitrilotetraasetat
Etidium Bromür
Guanin-Sitozin
Hidroklorik asit
Kilobaz
Litre
Gram
Mikrogram
Mikrolitre
Ünite
Mikromol
Pikomol
Molar
Milimolar
Miligram/mililitre
Sodyum klorür
National Center for Biotechnology Institute
European Bioinformatics Institute
Polimeraz Zincir Reaksiyonu
Sodium Dodesil Sülfat
Tür
Tris- Borik asit-EDTA
Tris-EDTA
Erime sıcaklığı
Unweighed Pair Group Method of Aritmetic Averages
Neighbor-Joining metot
Kimura-2-paremetre model
Haplotip farklılığı
Nükleotid farklılığı
Haplogrup
Sitokrom b geni
12S ribozomal RNA geni
Ultraviyole
Volt
Ağırlık
ÖZET: Bu çalışmada, Güney Karaman koyun ırkı ile Karacadağ yöresi Zom koyunlarının
filogenetik yapıları moleküler tekniklerle belirlenmeye çalışılmıştır. Koyunlardan genomik
DNA izolasyonu için kan örnekleri toplanmış ve tüm örneklerden genomik DNA izole
edilmiştir. Koyun DNA örneklerinde mitokondriyal D-loop bölgesini çoğaltmak için gerekli
ileri ve geri primerler tasarlanmıştır. Koyun D-loop gen bölgeleri polimeraz zincir reaksiyonu
tekniği (PCR) ile çoğaltılmıştır. PCR ürünlerinin gen dizi bilgileri elde edilmiştir.
Populasyonlar için toplam bölge sayısı, G+C oranı, polimorfik bölge sayısı (S), haplotip
sayısı (h), haplotip farklılığı (Hd) ve nükleotid farklılığı (π) değerleri hesaplanmıştır. Bu
çalışmadaki, Zom koyununa ait diziler ile referans haplogruplarla birlikte oluşturulan
filogenetik ağaçta, 20 haplotipten, 12’si B soyunda (%60), 8’i A soyunda (%40) yer almıştır.
158
Güney Karaman koyunlarında ise tespit edilen 10 haplotipten, 7’si B soyunda (%70), 2’si A
soyunda (%20), 1'i D soyunda (%10) yer almıştır. Sonuç olarak, Güney Karaman koyunu ile
Karacadağ yöresi Zom koyunlarının D-loop bölgesi gen dizileri belirlenmiştir. Gen dizi
bilgilerine göre koyunlarda mtDNA polimorfizmi, mtDNA haplotipleri ve haplogrupları
(soylar), haplotipler ve yabani koyunlar arasında filogenetik ilişkiler belirlenmiştir.
Anahtar Kelimler: Güney Karaman koyunu, Zom koyunu, mtDNA, filogenetik
GİRİŞ
Evcil koyun (Ovis aries), artiodactyla sınıfının içerisinde Bovidae familyasına aittir.
Başlangıcı miyosen dönemine (yaklaşık 20 milyon yıl önce) dayanan Bovidae familyası
günümüze kadar hızlı bir yayılma göstermiştir (Gatesy ve ark., 1992). Evcil koyun (Ovis
aries), insanlar için et, süt ve yapağı gibi çok faydalı ürünler sağlamanın yanında neolitik
devre uzanan erken dönemlerde tarım, ekonomi ve kültür gibi konularda önemli bir rol
oynamıştır. Yakın Doğu’daki arkeolojik bölgelerdeki bulgular, muhtemelen koyunun yaklaşık
8.000-9.000 yıl önce Yakın Doğu’daki Fertile Crescent bölgesinde ilk evcilleştirilmiş
olabileceğini desteklemektedir (Zeder, 2008).
Dünya’da koyun varlığı kıtalara, ülkelere ve aynı ülkenin çeşitli bölgelerine göre
değişmektedir. Dünya’da koyun varlığı 1.093.566.764 baş olarak belirtilmiştir (FAO, 2011).
Türkiye'de 25.031.565 baş koyun varlığı bulunmaktadır (TUİK, 2011).
Dünya’da, 1314 koyun ırkı olduğu bildirilmiştir (Galal, 2005). Türkiye’deki yerli
koyun ırkları, yağlı kuyruklu ve ince kuyruklu koyun ırkları olarak iki grupta ele alınmaktadır.
Yağlı kuyruklu koyun ırkları içinde Akkaraman (%47), Morkaraman %(20), Dağlıç (%16) ve
İvesi (%1.6) en önemli yerli ırklarımızdır. İnce kuyruklu yerli koyun ırklarımız ise Kıvırcık
(%6.3), Karayaka (%3), Sakız ve İmroz koyunlarıdır (Özcan, 1997). Ülkemizde yöresel ırklar
olarak adlandıran koyun ırkları ise, Amasya ve çevresi illerde yetiştirilen Herik koyunu, Kars,
Ardahan ve Iğdır çevresinde yetiştirilen Tuj koyunu, Kuzey Doğu Anadolu bölgesinde ve
Artvin yöresinde yetiştirilen Hemşin koyunudur. Ayrıca, Türkiye’de çeşitli kurumlarca
yapılan ıslah çalışmaları sonucunda yeni melez koyun tipleri geliştirilmiştir (Özcan, 1997).
Türkiye’de koyun varlığının son çeyrek yüzyılda yarıdan fazlası azalmıştır. Bu durum
yerli gen kaynaklarının korunmasını gündeme getirmektedir. Türkiye yerli hayvan genetik
kaynakları açısından zengin genetik çeşitliliğe sahiptir. Yerli genetik kaynaklarının korunması
amacıyla; ırkların genetik yapıları belirlenmeli, sürü kayıtları tutulmalı (pedigri kayıtları),
ırkların envanter çalışması yapılmalı, yetiştirici birlikleri kurulmalı, yerli ırklarda süt ve et
verimi için uygun seleksiyon kriterleri belirlenmelidir (Soysal ve ark., 2003a). Tüm bu
aşamaları başarı ile sonuçlandırmak için en önemli ve öncelikli yapılması gereken aşamanın,
yerli ırkların genetik yapılarının belirlenmesi, ırklar arası ve ırklar içi farklılıkların
incelenmesi gerektiği bildirilmiştir (Soysal ve ark., 2003b).
Evcil koyun genomu (2n=54), 26 çift otozomal kromozomu, 2 çift cinsiyet
kromozomu ve mitokondriyal genomu içermektedir. Ökaryotik hücrelerin nükleusunda
bulunan DNA’ya (nDNA) ek olarak az miktarda sitoplazmik DNA’ya da rastlanır. Bu
sitoplazmik DNA’lar mitokondrilerde (mtDNA) olup çift sarmal ve halkasal yapıdadır
(Hiendleder ve ark., 1998a). mtDNA; populasyonların genetik benzerlik veya farklılıklarından
yararlanılarak filogenetik ilişkilerin tespit edilmesi gibi çalışmalarda moleküler belirteç
(özellikle D-loop ve Sitokrom b gen bölgeleri) olarak kullanılmaktadır (Meadows ve ark.
2007). Koyun mitokondri genomu; protein kodlayan 13 bölge (sitokrom c oksidaz kompleksi
I, II ve III altbirimleri, ATPaz kompleksi 6 ve 8 altbirimleri, NADH dehidrogenez 1, 2, 3, 4L,
4, 5 ve 6 ile sitokrom b), 2 ribosomal RNA bölgesi (12S rRNA, 16S rRNA), kontrol bölgesi
(D-loop) ve 22 çeşit tRNA (60-75 bp) bölgelerinden oluşmaktadır (Hiendleder ve ark.,
1998a). Koyun mtDNA’sı 16640 bp uzunluktadır.
159
MATERYAL VE METOT
Hayvan Materyali ve Örnek Toplama
Araştırmanın hayvan materyalini, Bahri Dağdaş Uluslararası Tarımsal Araştırma
Enstitüsündeki (BDUTAEM) koruma sürülerindeki Güney Karaman koyunları (n=36) ile
Karacadağ yöresinde yetiştirilen Zom koyunları (n=100) oluşturmuştur. DNA izolasyonu için
kan örnekleri toplanmıştır.
Moleküler Çalışmalar
Moleküler çalışmalar, Harran Üniversitesi Ziraat Fakültesi Hayvansal Biyoteknoloji
Laboratuarında gerçekleştirilmiştir.
Genomik DNA İzolasyonu
Koyunlardan alınan kan örneklerinden genomik DNA izolasyon kiti (GeneJET Whole
Blood Genomic DNA Purification Mini Kit #K0781, Thermo) kullanılarak 136 örnekten
genomik DNA izole edilmiştir. İzole edilen DNA örneklerinin görüntülenmesinde %1’lik
agaroz jel kullanılmıştır.
Genomik DNA İzolasyon protokolü:
1. Kolon içeren 2 ml’lik tüplere Column preparation Solution’dan 500 ml eklenerek
12000 g’de 1 dakika santrifüj edilir ve alt kısım dökülür
2. Yeni bir tüp içerine 20 ml proteinase K, 200 ml örnek ve 20 ml RNase eklenerek 2
dakika bekletilir.
3. Tüp içerisine Lysis Solution’dan 200 ml eklenerek 15 sn vorteks yapılır ve 55 ºC’de 10
dakika inkübe edilir.
4. Daha sonra tüp içerisine 200 ml ethanol (%99) eklenerek 5-10 sn vorteks edilir ve
içerik kolon içeren tüplere dökülerek 6500 g’de 1 dakika santrifüj edilir ve alt kısım
dökülür
5. Daha sonra tüp içerisine 500 ml prewash solution eklenerek 6500 g’de 1 dakika
santrifüj edilir ve alt kısım dökülür.
6. Daha sonra tüp içerisine 500 ml wash solution eklenerek 12000 g’de 3 dakika santrifüj
edilir.
7. Daha sonra kolon yeni bir tüp içerisine alınarak 200 ml elution solution eklenerek 5
dakika bekletilir ve 6500 g’de 1 dakika santrifüj edilir.
8. Tüp içerisindeki kolon atılarak alt kısımda bulunan sıvıda DNA’nın varlığı agaroz jel
elektroforezinde görüntülenir. İzole edilen DNA moleküler çalışmalarda kullanılmak
üzere derin dondurucuda saklanır.
DNA Agaroz jel elektroforezi
Erlenmayer içerisine (250 ml’lik) 100 ml 1XTBE çözeltisi ve 1000 mg agaroz (Sigma)
tartılarak konulup mikrodalga fırın içerisinde eritilmiştir. Jel soğutulduktan sonra hemen
elektroforez küvetine dökülerek taraklar yerleştirilmiş ve jelin katılaşması beklenmiştir. Daha
sonra, 1XTBE içeren elektroforez tankına, küvet yerleştirildikten sonra, taraklar hafifçe
çıkartılmıştır. Jel kuyularının baş ve son kısmına moleküler ağırlık markeri yüklenmiştir.
Markerlardan DNA için 1 kb ladder kullanılmıştır (Fermentas). Diğer kuyulara, 5 ml DNA
örnekleri 1 ml yükleme tamponu ile birlikte yüklenmiştir Yükleme sonrası güç kaynağından,
jel tankına 100 Volt elektrik akımı verilerek jel 40 dakika koşturulmuştur. Daha sonra jel,
etidyum bromür içeren bir kabın içerisinde 10 dakika bekletilip DNA’ların boyanması
sağlanmıştır. Ultraviyole (UV) ışık altında DNA’nın varlığı görüntülenmiş ve fotoğrafı
çekilerek değerlendirmek üzere bilgisayara aktarılmıştır.
Primerlerin Tasarlanması
Koyun DNA örneklerinde mitokondriyal D-loop bölgesini çoğaltmak için gerekli ileri
ve geri primerlerin tasarlanması amacıyla öncelikle, Gen Bankası internet portalından
(http://www.ncbi.nlm.nih.gov), evcil koyun (Ovis aries) için tüm mitokondriyal genoma (Ovis
aries mitochondrion, complete genome) ait referans dizi bilgileri (RefSeq) temin edilmiştir
160
(NC_001941). Referans diziden D-loop, tRNA-Phe, 12S ribosomal RNA gen bölgesini
içeren dizi bilgilerini kullanarak, önceki çalışmalarda (Meadows ve ark., 2007; Pardeshi ve
ark., 2007) haplogrupların belirlenmesinde kullanılan D-loop gen bölgesine ait 525 bp’lık
kısmı içerecek şekilde primerler tasarlanmıştır.
İleri (foward) Primer: 5’CACTGAAGCATGTAGGGTATT’3
Tm=53.4°C, CG%=42.9, MW=6485, 21 bp
Geri (reverse) Primer: 5’GCTTGATACCTGCTCCTTTTA’3
Tm=53.6°C, CG%=42.9, MW=6512, 21 bp
D-loop gen bölgelerinin Polimeraz Zincir Reaksiyonu (PCR)
D-loop gen bölgesinin polimeraz zincir reaksiyonu tekniği ile çoğaltılmasında
kullanılan PCR karışımı Çizelge 2’de gösterilmiştir. Bu bileşenlerin tümü belirtilen
miktarlarda kuru buz üzerindeki 0.2 ml’lik PCR ependorf tüpleri içerisinde hazırlandıktan
sonra, PCR şartları önceden programlanmış PCR cihazına (Boeco) yerleştirilmiştir. Çalışılan
gen bölgesinin polimeraz zincir reaksiyonu tekniği ile çoğaltılmasında kullanılan PCR
amplifikasyon şartları Çizelge 3’de verilmiştir.
Çizelge 1 PCR Karışımı
Bileşenler
Konsantrasyon
Miktar
Kalıp DNA
20-30 ng/ml
1.0 ml
PCR Buffer
10X
4.0 ml
İleri Primer
10 pmol/ml
1.0 ml
Geri Primer
10 pmol/ml
1.0 ml
dNTP mix
1.0 nM
1.0 ml
Taq DNA polimeraz
5U/ml
0.5 ml
dH2O
32.0 ml
Toplam
40.0 ml
Çizelge 2 PCR amplifikasyon şartları
Döngü işlemi
Döngü sayısı
Süre
Sıcaklık (°C)
Ön denaturasyon
95
1
4 dakika
Denatürasyon
94
30 saniye
Yapışma (Tm)
51
30
30 saniye
Sentez
72
1 dakika
Son uzama
72
1
10 dakika
Bekleme
4
¥
¥
Çoğaltılan PCR ürünlerinin görüntülenmesinde %1,5’luk agaroz jel kullanılmıştır (1,5
g agarose/100 ml 1XTBE). PCR jellerinin koşturulmasında marker olarak 100 bp’lik ladder
(Fermentas) kullanılmıştır.
DNA Dizileme
D-loop gen bölgelerinin PCR amlifkasyonu gerçekleşmiş örnekler gen dizileme için
seçilerek ileri (F) ve geri (R) zincir olmak üzere örnekler 50 ml olarak (25 ml PCR ürünü + 25
ml ddH2O) hazırlanıp dizileme işlemine gönderilmiştir. DNA dizileme, İontek (İstanbul)
firmasına yaptırılmıştır. Burada dizi kromatoğramlardaki pikler incelenmiştir ve pik sinyalleri
belirgin ve kaliteli olan dizi örnekleri değerlendirilmeye alınmıştır.
DNA Polimorfizmi ve Filogenetik Analizler
Populasyonlar için dizi sayısı, polimorfik bölge sayısı (S), haplotip sayısı (h), haplotip
farklılığı (Hd: haplotype diversity), nükleotid farklılığı (π: nucleotide diversity) ve ortalama
nükleotid farklılığı sayısı (k) değerleri DnaSP 5.0 (Librado ve Rozas, 2009) programları
kullanılarak belirlenmiştir.
161
Koyunlarda filogenetik yapılarının araştırılmasında, D-loop bölgesi DNA dizi
bilgilerine göre öncelikle temel ve ileri filogenetik analizler yapılmıştır. Temel filogenetik
analizler; her bir ırkta genetik ilişkileri göstermek ve haplotipleri belirlemek amacıyla
UPGMA (Unweighted Pair Group Method with Arithmetic mean) yöntemine göre MEGA
4.0.1 programında (Tamura ve ark., 2007) ve Kimura-2-parametre model (Kimura, 1980)
kullanılarak yapılmıştır. Bu çalışmada belirlenen haplotipler ile önceki çalışmalarda koyunlar
için A, B, C, D ve E olarak belirlenen referans haplogruplar (HG A:DQ852286-852287, HG
B: DQ852282-DQ852285, HG C: DQ852283-DQ852284, HG D: DQ852288-DQ852289, HG
E:DQ852280-DQ852281, Meadows ve ark., 2007) birlikte değerlendirilerek örneklerimiz için
haplogrup tespiti ve ileri filogenetik analizler, Neighbour-Joining (NJ) (Saitou ve Nei, 1987)
metoduna göre Kimura-2-parametre (K2P) modeli kullanılarak MEGA 4.0.1 programında
(Tamura ve ark., 2007) yapılmıştır. Nodların (ağaç kolları) güvenirliğinin test edilmesinde
Bootstrap testi (1000 tekrarlı) kullanılmıştır (Nei ve Kumar, 2000).
Ayrıca filogenetik analizlerde, haplogrupları belirlenen koyunlar ile yabani koyunlarda
yapılan çalışmalara ait dizi bilgileri (AF242347: Ovis ammon ammon, JX673912: Ovis
ammon hodgsoni, AY091492: Ovis ammon collium, KF677288: Ovis orientalis anatolica,
AY091489: Ovis vignei arkal, AY091493: Ovis ammon nigrimontana, AF242348: Ovis
ammon darwini, AF039580: Ovis vignei bochariensis) Gen Bankasından (NCBI) temin
edilerek birlikte farklı filogenetik ağaçlar oluşturulmuştur.
BULGULAR
Moleküler Analiz Bulguları
Genomik DNA izolasyonu
Güney Karaman ve Zom koyunlarından toplanan kan örneklerinden genomik DNA
izole edilmiştir. Güney Karaman ve Zom koyunlarından izole edilen DNA’ların agaroz jel
görüntüsü sırasıyla Şekil 1 ve Şekil 2’de verilmiştir.
Şekil 1 Zom koyunlarından (01-18 nolu örnekler) izole edilen DNA örnekleri
(M:marker, ladder: 1 kb)
Şekil 2 Güney Karaman koyunlarından (01-18 nolu örnekler) izole edilen DNA örnekleri
(M:marker, ladder: 1 kb)
162
PCR Sonuçları
İzole edilen DNA örneklerinden, D-loop gen bölgesi için tasarlanan primerler
kullanılarak PCR amlifikasyon çalışmaları yürütülmüştür. Tüm örneklerde PCR ürünleri elde
edilmiştir. Evcil koyunlarda D-loop bölgesi 1180 bp uzunluğundadır, tasarlanan OVS
DLOOP (F) ve OVS DLOOP (R) primerleri ile bu genin 842 bp’lik kısmı Güney Karaman ve
Zom koyunlarında PCR ile çoğaltılmıştır (Şekil 3-4). PCR çalışmaları sonucu elde edilen tüm
PCR ürünleri, PCR saklama kapları içerisinde -20 ºC’de muhafaza edilmiştir.
Şekil 3 Zom koyunlarında (01-18 nolu örnekler) D-loop bölgesi: 842 bp
(M:marker, ladder: 100 bp)
Şekil 4 Güney Karaman koyunlarında (01-18 nolu örnekler) D-loop bölgesi: 842 bp
(M:marker, ladder: 100 bp)
Dizileme sonuçları
Güney Karaman ve Zom koyunları D-loop gen bölgelerinin PCR ürünlerinin gen dizi
analiz sonuçları elde edilmiştir. D-loop gen bölgeleri için elde edilen sırasıyla 842 bp PCR
ürünlerinden, dizilerin düzenlenmesi ve değerlendirilmesi sonucunda, sırasıyla 612 bp gen
dizi bilgisi elde edilmiştir (Güney Karaman koyunu için Ek 1, Zom koyunu için Ek 2). Elde
edilen gen dizilerine ait kromatoğramlardan gk2_F örnek olarak Şekil 5’de verilmiştir.
163
Şekil 5 Güney Karaman (gk2) D-loop bölgesi DNA ileri (gk2_F) zincir kromatoğramı
Filogenetik Analiz Sonuçları
D-loop gen dizisine göre DNA polimorfizmi
Güney Karaman ve Zom koyunlarında, D-loop gen dizisine göre; populasyonlar için
toplam dizi sayısı, polimorfik bölge sayısı (S), haplotip sayısı (h), haplotip farklılığı (Hd),
nükleotid farklılığı (π) ve ortalama nükleotid farklılığı sayısı (k) hesaplanarak DNA
polimorfizmi belirlenmeye çalışılmıştır. Bu DNA polimorfizm özellikleri kullanılarak temel
ve ileri filogenetik analizler yapılmıştır.
Güney Karaman ve Zom koyunlarında, D-loop gen dizisi belirlenmiştir. D-loop
geninin, D-loop bölgesi için tasarlanan primerler kullanılarak 842 bp’lik bölgesi
çoğaltılmıştır. Gen dizi analizleri ve düzenlemeler sonucunda tüm örnekler için 612 bp’lik
dizi bilgisi elde edilmiştir. Güney Karaman ve Zom koyunlarında D-loop gen dizi bilgileri
analiz edilerek, DNA polimorfizm özellikleri belirlenmiştir (Çizelge 4). Güney Karaman
koyunlarında, D-loop bölgesinde 27 polimorfik bölge tespit edilmiştir. Güney Karaman
koyunlarında, haplotip ve nükleotid faklılığı sırasıyla; 0.877±0.009 ve 0.00114±0.0004 olarak
bulunmuştur. Güney Karaman koyunları, D-loop bölgesine göre UPGMA genetik ağaçta, 10
haplotipe ayrılmıştır (Şekil 6). Zom koyunlarında ise 26 polimorfik bölge tespit edilmiştir.
Zom koyunlarında, haplotip ve nükleotid faklılığı sırasıyla; 0.957±0.004 ve 0.00117±0.0003
olarak bulunmuştur. Zom koyunları UPGMA genetik ağaçta 20 haplotipe ayrılmıştır (Şekil 7).
Çizelge 3 Koyunlarda D-loop gen dizisine göre DNA polimorfizmi
Özellikler
Toplam bölge sayısı
Polimorfik bölge sayısı (S)
Haplotip sayısı (h)
Haplotip farklılığı Hd:
Nukleotid farklılığı (π)
Ort. nükletid farklılığı sayısı (k)
Güney Karaman
612
27
10
0.877±0.009
0.0114±0.0004
6.975
Zom
612
26
20
0.957±0.004
0.0117±0.0003
7.176
Güney Karaman haplotipleri arasında genetik uzaklıklar Çizelge 5, Zom haplotipleri
arasında genetik uzaklıklar Çizelge 6 'de verilmiştir.
164
D-loop gen dizisine göre filogenetik analizler
Meadows ve ark. (2007) tarafından A, B, C, D, ve E soyları için belirlenen referans Dloop gen dizileri, bu çalışmada belirlenen haplotiplerin D-loop dizileri ile birlikte
değerlendirilerek, Güney Karaman ve Zom haplotiplerinin, haplogruplara veya soylara
dağılımı belirlenmiştir.
Güney Karaman koyunlarına ait D-loop dizileri ve referans diziler ile birlikte
oluşturulan filogenetik ağaç Şekil 8 ve 9'da verilmiştir. Şekil 8 ve 9 filogenetik ağaç
incelendiğinde, Güney Karaman koyunlarında tespit edilen 10 haplotipin, 7’si B, 2’si A ve 1
taneside D soyunda yer almıştır. Zom koyunlarında ise tespit edilen 20 haplotipin 12’si B, 8’i
A soyunda yer almıştır. mtDNA D-loop bölgesine göre Güney Karaman ve Zom
haplogrupları arasında genetik uzaklıklar Çizelge 7 ve 8’de verilmiştir.
gk29
32
gk11
H3
gk23
28
gk28
32
gk3
25
21
40
H4
gk32
H2
gk33
H7
gk17
H6
gk10
gk4
H5
92
gk16
98
gk2
gk6
gk25
gk30
H1
95
gk21
gk19
gk22
gk27
69
H10
gk5
H8
gk31
gk26
99
gk7
H9
66
gk24
0.010
0.008
0.006
0.004
0.002
0.000
Şekil 6 Güney Karaman koyunlarında D-loop bölgesine göre UPGMA ağacı
165
z9
z3
4
z20
H1
z42
1
z24
z44
2
H7
1
64
z46
z19
H4
z49
H3
z26
H11
1
1
z32
2
z17
H5
64
z22
7
12
7
z34
H8
z52
H2
z29
H9
z47
34
85
z28
H10
z36
z33
H12
z21
94
z23
H6
z48
37
96
26
11
38
12
17
z27
H20
z30
H16
z15
H17
z31
H14
z14
H19
z4
H13
z35
z56
H18
z54
19
z7
H15
64
z5
0.010
0.008
0.006
0.004
0.002
0.000
Şekil 7 Zom koyunlarında D-loop bölgesine göre UPGMA ağacı
166
Çizelge 4 mtDNA D-loop bölgesine göre Güney Karaman haplotipleri arasında genetik
uzaklıklar (K2P model)
[ H1]
[ H2]
[ H3]
[ H4]
[ H5]
[ H6]
[ H7]
[ H8]
[ H9]
[H10]
H1
H2
H3
H4
H5
H6
H7
H8
H9
0.0067
0.0067
0.0050
0.0103
0.0085
0.0085
0.0215
0.0196
0.0297
0.0033
0.0016
0.0067
0.0050
0.0050
0.0255
0.0235
0.0339
0.0016
0.0067
0.0050
0.0050
0.0255
0.0235
0.0339
0.0050
0.0033
0.0033
0.0235
0.0215
0.0318
0.0050
0.0085
0.0255
0.0235
0.0339
0.0067
0.0235 0.0235
0.0215 0.0215 0.0016
0.0318 0.0318 0.0177 0.0158
H10
Çizelge 5 mtDNA D-loop bölgesine göre Zom haplotipleri arasında genetik uzaklıklar (K2P
model)
[
H1]
[
H2]
[
H3]
[
H4]
[
H5]
[
H6]
[
H7]
[
H8]
[
H9]
[H1
0]
[H1
1]
[H1
2]
[H1
3]
[H1
4]
[H1
5]
[H1
6]
[H1
7]
[H1
8]
[H1
9]
[H2
0]
H1
H2
H3
H4
H5
H6
H7
H8
H9
H10
H11
H12
H13
H14
H15
H16
H17
H18
H19
0.00
16
0.00
16
0.00
16
0.00
16
0.00
50
0.00
16
0.00
16
0.00
33
0.00
33
0.00
16
0.00
50
0.02
15
0.02
55
0.02
35
0.02
35
0.02
35
0.02
35
0.01
96
0.01
58
0.00
33
0.00
33
0.00
33
0.00
67
0.00
33
0.00
33
0.00
50
0.00
50
0.00
33
0.00
67
0.02
35
0.02
75
0.02
55
0.02
55
0.02
55
0.02
55
0.02
15
0.01
76
0.00
33
0.00
33
0.00
67
0.00
33
0.00
33
0.00
50
0.00
50
0.00
33
0.00
67
0.02
35
0.02
75
0.02
55
0.02
55
0.02
55
0.02
55
0.02
15
0.01
76
0.00
33
0.00
67
0.00
33
0.00
33
0.00
50
0.00
50
0.00
33
0.00
67
0.02
35
0.02
75
0.02
55
0.02
55
0.02
55
0.02
55
0.02
15
0.01
76
0.00
67
0.00
33
0.00
33
0.00
50
0.00
50
0.00
33
0.00
67
0.02
35
0.02
75
0.02
55
0.02
55
0.02
55
0.02
55
0.02
15
0.01
76
0.00
67
0.00
67
0.00
84
0.00
84
0.00
67
0.01
02
0.02
73
0.03
15
0.02
94
0.02
94
0.02
94
0.02
94
0.02
53
0.02
13
0.00
33
0.00
50
0.00
50
0.00
33
0.00
67
0.02
35
0.02
75
0.02
15
0.02
55
0.02
55
0.02
55
0.02
15
0.01
76
0.00
50
0.00
50
0.00
33
0.00
67
0.01
96
0.02
35
0.02
15
0.02
15
0.02
15
0.02
15
0.01
76
0.01
39
0.00
67
0.00
50
0.00
85
0.02
15
0.02
55
0.02
35
0.02
35
0.02
35
0.02
35
0.01
96
0.01
58
0.00
50
0.00
50
0.02
15
0.02
55
0.02
35
0.02
35
0.02
35
0.02
35
0.01
96
0.01
58
0.00
33
0.01
96
0.02
35
0.02
15
0.02
15
0.02
15
0.02
15
0.01
76
0.01
39
0.01
96
0.02
35
0.02
15
0.02
15
0.02
55
0.02
15
0.01
76
0.01
39
0.00
33
0.00
16
0.00
50
0.00
50
0.00
16
0.00
16
0.00
50
0.00
50
0.00
85
0.00
85
0.00
50
0.00
50
0.00
85
0.00
67
0.00
67
0.00
33
0.00
33
0.00
67
0.00
33
0.00
33
0.00
33
0.00
67
0.00
33
0.00
67
0.01
03
0.00
33
0.00
67
0.00
33
H2
0
167
99
DQ852280
HG E
DQ852281
75
DQ852283
65
100
DQ852284
HG C
GKR_10
DQ852288
92
98
HG D
DQ852289
GKR_08
GKR_09
83
HG A
DQ852286
66
DQ852287
GKR_01
GKR_07
99
GKR_05
66
GKR_06
69
GKR_03
40
HG B
DQ852285
DQ852282
40
GKR_04
GKR_02
0.002
Şekil 8 Güney Karaman (GKR) haplotipleri ve referans haplogrup dizileri ile birlikte
oluşturulan filogenetik ağaç
Zom_13
29
16
DQ852287
DQ852286
8
Zom_18
12
Zom_19
HG A
12
Zom_15
28
Zom_14
Zom_16
84
37
Zom_17
Zom_20
40
10 0
DQ852280
HG E
DQ852281
70
DQ852283
10 0
HG C
DQ852284
DQ852288
10 0
HG D
DQ852289
Zom_06
Zom_12
96
Zom_09
34
Zom_10
7
Zom_02
4
Zom_04
7
Zom_11
1
HG B
Zom_08
2
Zom_05
1
Zom_03
1
Zom_07
2
DQ852285
3
11
DQ852282
Zom_01
0.0 12
0.010
0.008
0. 006
0. 004
0.002
0.000
(K2P model)
Şekil 9 Güney Karaman (GKR) haplotipleri ve referans haplogrup dizileri ile birlikte
oluşturulan filogenetik ağaç (K2P model)
168
Çizelge 6 mtDNA D-loop bölgesine göre Güney Karaman haplogrupları arasında genetik
uzaklıklar (K2P model)
Haplogruplar
HG A
HG B
HG C
HG D
HG E
HG A
HG B
HG C
HG D
0.0210
0.0165
0.0112
0.0187
0.0303
0.0292
0.0288
0.0189
0.0211
0.0099
Çizelge 7 mtDNA D-loop bölgesine göre Zom haplogrupları arasında genetik uzaklıklar (K2P
model)
Haplogruplar
HG A
HG B
HG C
HG D
HG E
HG A
HG B
HG C
HG D
0.0210
0.0136
0.0190
0.0176
0.0287
0.0287
0.0307
0.0099
0.0183
0.0217
Güney Karaman ve Zom haplogrupları ile diğer yerli koyun ırkları haplogrupları
arasında filogenetik ilişkiler
Güney Karaman koyunlarında tespit edilen 10 haplotipin, 7’si B, 2’si A ve 1 tanesi de
D soyunda yer almıştır. Zom koyunlarında ise tespit edilen 20 haplotipin 12’si B, 8’i A
soyunda yer almıştır. Burada, Meadows ve ark. (2007), Karakaş, Norduz, Morkaraman, Tuj,
Çine Çaparı, Sakız, Karya ve Karayaka koyun ırkları ile Demirci ve ark. (2013); Karayaka
(KRY), Akkaraman (AKK), Gökçeada (GOK), Dağlıç¸ (DAG), Morkaraman (MRK),
Kıvırcık (KIV), İvesi (IVE), Herik (HER), Karagül, (KRG), Hemşin (HEM), Çine Çaparı
(CIC), Sakız (SAK), Norduz (NOR) koyun ırklarını içeren çalışma sonuçlarına ait
haplogruplar ile filogenetik ilişkiler incelenmiştir. Bununla birlikte, Güney Karaman ve
yukarıda belirtilen önceki çalışmalardaki haplogrup A, B ve D içeren ırklar ile birlikte
oluşturulan fiogenetik ağaçlar sırasıyla Şekil 10, 11 ve 12’de, Zom koyununda ise haplogrup
A ve B içeren ırklar ile oluşturulan filogenetik ağaçlar sırasıyla Şekil 13 ve 14’te verilmiştir.
169
MORKARAMAN_KF677262
KARAKAS_DQ852287
GOKCEADA_KF677060
DAGLIC_KF677080
KARAYAKA_KF677035
NORDUZ_KF677206
CINECAPARI_KF677155
HERIK_KF677125
KARYA_DQ097445
HEMSIN_KF677225
KARAGUL_KF677145
IVESI_KF677116
AKKARAMAN_KF677059
GKR_09
SAKIZ_KF677181
0.0002
Şekil 10 Haplogrup A’da bulunan Güney Karaman ve diğer yerli ırklardan oluşan filogenetik
ağaç (K2P)
GKR_03
1
0
KARAYAKA_KF677038
0
KIVIRCIK_KF677232
0
HERIK_KF677131
0
GOKCEADA_KF677061
0
NORDUZ_KF677193
0
KARAKAS_DQ852285
0
KARAGUL_KF677149
0
KARYA_DQ097432
0
AKKARAMAN_KF677039
0
IVESI_KF677104
1
TUJ_DQ097431
SAKIZ_KF677183
HEMSIN_KF677227
DAGLIC_KF677078
Şekil 11 Haplogrup B’de bulunan Güney Karaman ve diğer yerli ırklardan oluşan filogenetik
ağaç (K2P)
68
AKKARAMAN_KF677056
MORKARAMAN_DQ852289
NORDUZ_KF677209
GKR_10
0.003
0.002
0.001
0.000
Şekil 12 Haplogrup D’de bulunan Güney Karaman ve diğer yerli ırklardan oluşan filogenetik
ağaç (K2P)
170
DAGLIC_KF677080
NORDUZ_KF677206
GOKCEADA_KF677060
KARAKAS_DQ852287
MORKARAMAN_KF677262
HEMSIN_KF677225
Zom_13
IVESI_KF677116
KARAGUL_KF677145
KARAYAKA_KF677035
HERIK_KF677125
KARYA_DQ097445
CINECAPARI_KF677155
SAKIZ_KF677181
0.0002
Şekil 13 Haplogrup A’da bulunan Zom ve diğer yerli ırklardan oluşan filogenetik ağaç (K2P)
NORDUZ_KF677193
KARAYAKA_KF677038
IVESI_KF677104
62 AKKARAMAN_KF677039
KARAKAS_DQ852285
KIVIRCIK_KF677232
GOKCEADA_KF677061
KARAGUL_KF677149
DAGLIC_KF677079
HERIK_KF677122
24
34
HEMSIN_KF677217
Zom_03
SAKIZ_KF677185
0.0014
0.0012
0.0010
0.0008
0.0006
0.0004
0.0002
0.0000
Şekil 14 Haplogrup B’de bulunan Zom ve diğer yerli ırklardan oluşan filogenetik ağaç (K2P)
Güney Karaman ve Zom haplogrupları ile yabani koyunlar arasında filogenetik ilişkiler
Güney Karaman ve Zom koyunlarında haplogrupları belirlenen koyunlar ile yabani
koyunlarda yapılan çalışmalara ait dizi bilgileri (AF242347: Ovis ammon ammon, JX673912:
Ovis ammon hodgsoni, AY091492: Ovis ammon collium, KF677288: Ovis orientalis
anatolica, AY091489: Ovis vignei arkal, AY091493: Ovis ammon nigrimontana, AF242348:
Ovis ammon darwini, AF039580: Ovis vignei bochariensis) birlikte değerlendirilerek
filogenetik analizler yapılmıştır.
Çizelge 8 Güney Karaman ve Zom haplogrupları ile Yabani koyunlar arasındaki genetik
uzaklıklar (K2P)
Haplogruplar
HG A
HG D
HG E
HG C
YABANİ
HG B
0.0210
0.0301
0.0289
0.0287
0.0431
HG A
*
0.0168
0.0131
0.0190
0.0387
HG D
HG E
HG C
*
0.0189
0.0212
0.0456
*
0.0099
0.0356
*
0.0374
Mitokondriyal DNA D-loop bölgesine göre Güney Karaman ve Zom haplogrupları ile
yabani koyunlar arasında genetik uzaklıklar Çizelge 9’da verilmiştir.
Güney Karaman ve Zom haplogrupları ile yabani koyunlar arasında filogenetik
ilişkiler farklı ağaç modelleri ile Şekil 15, 16 ve 17’de gösterilmiştir.
171
DQ852285
Zom_01
GKR_03
DQ852282
Zom_02
Zom_08
Zom_03
GKR_04
Zom_07
Zom_04
Zom_11
HG B
GKR_02
Zom_05
Zom_10
GKR_06
Zom_09
GKR_07
GKR_05
Zom_12
95
GKR_01
Zom_06
99 DQ852283
DQ852284
HG C
Ovis orientalis anatolica
DQ852280
99 DQ852281
HG E
99 DQ852288
DQ852289
87
HG D
GKR_10
Zom_20
Zom_16
77
Zom_17
Zom_14
Zom_19
Zom_15
GKR_08
HG A
Zom_18
Zom_13
DQ852287
GKR_09
DQ852286
Ovis vignei arkal
99
Ovis ammon nigrimontana
Ovis ammon collium
Ovis ammon hodgsoni
Ovis vignei bocheriensis
Ovis ammon ammon
71
Ovis ammon darwini
0.015
0.010
0.005
0.000
Şekil 15 Güney Karaman (GKR) ve Zom Haplotipleri ile yabani koyunlar arasında filogenetik
ilişkiler (K2P model)
172
10
GKR_
Q852288
DQ
8522
99
89
280
852 81
Q
DQ8522
84 is
22 Ov
85
Q
D
ca
oli
nat
a
s
ali
ent
ori
3
28
85
2
Q
D
98
99
Zom_19
Zo
GK
ZomR_0
_
Zom_03 80213
22
DQ855
_002
ZomR_
K
G
6
_0
8
_1
m
o
Z
15
m_
Zo R_08
GK
GK
D
Q R_0 Zom_14
85 9
22
86
13
m_
ZoQ852287
D
_20
Zom
m
Zom_12
GKR_01
73
97
Zom
Zo _16
m_
17
93
85
_
GK 05
R_
0
Zo 7
m
Zom__08
04
Zom_07
04 5
_
GKR 85228
DQ _02
m
Zo
Zom_11
KR
9
Zom_0 06
R_
GK _10
m
Zo
G
98
rkal
nei a
s vig
ontana
OviOvis ammon nigrim
llium
Ovis ammon co
Ovis ammon hodgsoni
Ovis vignei bo
cheriensis
Ovi
Ovis a
mmon
s am
ammo
m
o
n
n
dar
win
i
0.005
Şekil 16 Güney Karaman (GKR) ve Zom Haplotipleri ile yabani koyunlar arasında filogenetik
ilişkiler (K2P model)
173
Şekil 17 Koyun haplogrupları ile yabani koyunlar arasında filogenetik ilişkiler (K2P model)
174
TARTIŞMA ve SONUÇ
Güney Karaman koyunlarında, D-loop bölgesinde 27 polimorfik bölge tespit
edilmiştir. Güney Karaman koyunlarında, haplotip ve nükleotid faklılığı sırasıyla;
0.877±0.009 ve 0.00114±0.0004 olarak bulunmuştur. Güney Karaman koyunları, D-loop
bölgesine göre UPGMA genetik ağaçta, 10 haplotipe ayrılmıştır (Şekil 6). Zom koyunlarında
ise 26 polimorfik bölge tespit edilmiştir. Zom koyunlarında, haplotip ve nükleotid faklılığı
sırasıyla; 0.957±0.004 ve 0.00117±0.0003 olarak bulunmuştur. Zom koyunları UPGMA
Tablo 14: Entansif Yemleme+Süt+Mera Sistemine Dayalı Besleme Sisteminde Merinos Kuzularının Tahmin Edil
genetik ağaçta 20 haplotipe ayrılmıştır (Şekil 7).
Önceki Masraf
çalışmalarda,
koyunlar Avrupa (A) ve Asya tipler (B) olarak iki büyük gruba
Gelir-Marjinal
Değerleri
ayrılmıştır (Hiendleder ve ark, 1998). Daha sonra, Guo ve ark. (2005), Çin yerli koyun
ırklarında, Pedrosa ve ark. (2005) Türkiye yerli koyunlarında (Akkaraman, Karayaka,
Hemşin, Morkaraman ve Tuj) üçüncü bir soyun (C) varlığını tespit etmişlerdir. Bununla
birlikte Pereira ve ark. (2006), Portekiz yerli koyunlarında düşük frekansta C soyunun
bulunduğunu bildirmişlerdir. Tapio ve ark. (2006) Kuzey Kafkasya Karachai koyunlarında bu
belirtilen üç soydan ayrılan dördündü bir maternal soyun (D soyu) varlığı tespit etmişlerdir.
Son olarak, Meadows ve ark. (2007), ilk kez beşinci soy olarak E soyunun varlığını Türkiye
Tuj ve İvesi koyun ırklarında tespit etmişlerdir.
Meadows ve ark. (2007) Türkiye yerli koyun ırklarını içeren evcil koyunlarda A, B, C,
D, E haplogrupları ait diziler referans alınarak, bu çalışmada belirlenen haplotiplerin D-loop
bölgesi dizileri ile birlikte değerlendirilerek, Güney Karaman ve Zom koyun haplotiplerinin
haplogruplara veya soylara dağılımını belirlenmiştir. Bu çalışmadaki haplotiplere ait diziler
ile A, B, C, D, ve E soylarına ait dizilerle birlikte oluşturulan filogenetik Şekil 8 Şekil 9’da
verilmiştir. Şekil 8 ve Şekil 9 incelendiğinde, Güney Karaman koyunlarında tespit edilen 10
haplotipin, 7’si B, 2’si A ve 1 taneside D soyunda yer almıştır. Zom koyunlarında ise tespit
edilen 20 haplotipin 12’si B, 8’i A soyunda yer almıştır. Pedrosa ve ark. (2005) Türkiye evcil
koyun ırklarında (Akkaraman, Hemşin, Karayaka, Morkaraman ve Tuj) A, B ve C
haplogrupları için nükleotid farklılığı D-loop bölgesinde sırasıyla, 0.00679, 0.00701 ve
0.00881 olarak tespit etmişlerdir. Türkiye evcil koyun ırklarının A, B ve C haplogruplara
dağılım oranlarını (%) ise sırasıyla Akkaraman için 19, 43 ve 38, Hemşin için 6, 81 ve 13,
Karayaka için 30, 35 ve 35, Morkaraman için 53, 34 ve 13, Tuj için 27, 66 ve 7 olarak
belirlemişlerdir. Meadows ve ark. (2007), Karakaş, Norduz, Morkaraman, Tuj, Çine Çaparı,
Sakız, Karya, Karayaka koyun ırklarından ve Israil’den İvesi koyunlarından oluşan örnek
populasyonlarda beş mitokondriyal soyu (A, B, C, D ve E) tanımlamışlardır. Hayvanların
çoğunluğunun A, B ve C soyları içerisinde gruplandığı belirtilmiştir. Burada, Morkaraman (A,
B, C, D) ile Tuj ve İvesi (A, B, C, E) koyunlarının dört faklı soya, Sakız koyunlarının ise tek
soya (B) sahip olduğu belirtilmiştir. Demirci ve ark. (2013), Karayaka (KRY), Akkaraman
(AKK), Gökçeada (GOK), Dağlıç¸ (DAG), Morkaraman (MRK), Kıvırcık (KIV), İvesi (IVE),
Herik (HER), Karagül, (KRG), Hemşin (HEM), Çineçaparı (CIC), Sakız (SAK), Norduz
(NOR), mtDNA kontrol bölgesi dizi analizi ile HPG A (n=48), B (n = 66), C (n =43), D (n=
2), ve E (n =9) olmak üzere toplam 168 haplotip tespit etmişlerdir. A, B, C, D ve E
haplogruplarında; haplotip ve nükleotid farklılığı sırasıyla; 0.975±0.011, 0.987±0.006,
0.947±0.020, 1.000±0.500, 0.964±0.051 ve 3.9±0.129x10-3, 5.5±0.32x10-3, 2.9±0.26x10-3,
5.7±2.84x10-3, 6.5±0.94x10-3, olarak hesaplamışlardır. Öner ve ark. (2013), Türkiye yerli
koyun ırklarında (Dağlıç, Kıvırcık, İmroz, Sakız, Morkaraman, İvesi, Hemşin, Karayaka ve
Akkaraman), haplotip ve nükleotid farklılığı sırasıyla; 0.9496±0.011 ve 0.01407±0.00060
olarak hesaplamışlardır. Filogenetik ağaç, 63 mtDNA haplotipinin üç ayrı soya (soy A, B ve
C) ayrıldığını göstermiştir. Kiraz (2009), Akkaraman ve İvesi koyunlarında, D-loop bölgesi
gen dizi bilgilerine göre haplotip ve nükleotid farklılığı ise sırasıyla, 0.990±0.002 ve
175
0.03051±0.0021 olarak bulmuştur. Filogenetik ağaçta, 27 haplotipten, 9’u B soyunda, 9’u A
soyunda, 7’si C soyunda, 2'si E soyunda yer almıştır.
Güney Karaman haplotipleri arasında genetik uzaklıklar 0.0016-0.0339 arasında, Zom
haplotipleri arasında genetik uzaklıklar 0.0016-0.0315 arasında hesaplanmıştır. Güney
Karaman koyunlarında tespit edilen haplogruplarda genetik uzaklıklar; A ve B arasında
0.0210, A ve D arasında 0.0190, B ile D arasında 0.0292 olarak tespit edilmiştir. Zom
koyunlarında tespit edilen haplogruplarda genetik uzaklık ise A ve B arasında 0.0210 arasında
hesaplanmıştır. Burada haplogruplar arasında yaklaşık %2-3 olarak tespit edilen genetik
uzaklığın, Meadows ve ark. (2007) tarafından yapılan çalışmadan haplogruplar arasında,
tespit edilen değerden (%0.49-1.37) kısmen yüksektir.
Güney Karaman koyunlarında tespit edilen 10 haplotipin, 7’si B, 2’si A ve 1 tanesi de
D soyunda yer almıştır. Zom koyunlarında ise tespit edilen 20 haplotipin 12’si B, 8’i A
soyunda yer almıştır. Burada, Meadows ve ark. (2007), Karakaş, Norduz, Morkaraman, Tuj,
Çine Çaparı, Sakız, Karya ve Karayaka koyun ırkları ile Demirci ve ark. (2013); Karayaka
(KRY), Akkaraman (AKK), Gökçeada (GOK), Dağlıç¸ (DAG), Morkaraman (MRK),
Kıvırcık (KIV), İvesi (IVE), Herik (HER), Karagül, (KRG), Hemşin (HEM), Çine Çaparı
(CIC), Sakız (SAK), Norduz (NOR) koyun ırklarını içeren çalışma sonuçlarına ait
haplogruplar ile filogenetik ilişkileri gösteren Güney Karaman ve Zom koyunları ile yukarıda
belirtilen önceki çalışmalardaki haplogrup A, B ve D içeren ırklar ile birlikte oluşturulan
fiogenetik ağaçlar incelendiğinde, A soyunda, Güney Karaman ve Zom ile diğer ırkların
birlikte kümelenerek Sakız koyunundan ayrıldığı (Şekil 10, Şekil 13), B soyunda Güney
Karaman ve Zom ile diğer ırklar birlikte kümelenmiştir (Şekil 11, Şekil 14). D soyunda
Akkaraman ve Morkaraman birlikte küme oluştururken, Güney Karaman ayrı kümelenmiştir.
Türkiye yerli koyun ırklarını içeren farklı haplogruplara dahil hayvanlarla oluşturulan
filogenetik ağaçlarda, genetik benzenliklerin yüksek olması nedeni ile filogenetik ilişkiler çok
yüksektir.
Yabani koyunlar ile Güney Karaman ve Zom haplogrupları arasındaki genetik
uzaklıklar; A soyu ile %3.87, B soyu ile %4.31 ve D soyu ile %4.56 olarak tespit edilmiştir.
KANATLI VE KÜÇÜK EVCİLLER ARAŞTIRMALARI
PROGRAM DEĞERLENDİRME TOPLANTISI 02-07 MART 2014-ANTALYA
GÜNDEM
03 Mart 2014 Pazartesi
09.30-12.30
AÇILIŞ PROGRAMI
12:30-14:00
YEMEK ARASI
I.
14:00 – 15:00
Proje Lideri /
Sunan
Belgin GÜNBEY
OTURUM YENİ TEKLİF PROJELER
Divan Başkanı: Dr. Cengizhan MIZRAK
Katip Üyeler: Engin TÜLEK / Erkan TOPAL
Kurum
Proje / Sunum Adı
Gruba Bilgi Sunması
TAGEM
Bülent TARIM
Alternatif Barındırma Sistemlerinin Damızlık
Yumurtacılarda Performansa ve Bazı Kan
Parametrelerine Etkisi
Tavukçuluk
Arş. İst.
15:00-15:20
Ara
I.
15:20-17:30
Projenin
Durumu
Sunu
Yeni
OTURUM YENİ TEKLİF PROJELER
Divan Başkanı: Dr. Cengizhan MIZRAK
Katip Üyeler: Engin TÜLEK / Erkan TOPAL
Mustafa
KÖSOĞLU
Türkiye’de Paket Arıcılık Olanaklarının Araştırılması
Dr. Pınar
TUNÇER
Mustafa ÇINAR
Ege TAE
Yeni
Denizli ve Gerze Yerli Tavuk Irklarında Yumurta Kalite
Kriterleri
Hayvancılık
Merkez Arş.
Ens.
Yeni
Gaga kesimi ve genotipin zenginleştirilmiş kafes ve
aviary (kuşluklu) yetiştirme sistemlerinde büyütülen
yumurtacı piliçlerin büyütme ve verim dönemi
performansı üzerine etkileri
Erbeyli İncir
Arş. İst.
Yeni
04 MART 2014 SALI
II.
09:00-10:30
OTURUM YENİ TEKLİF PROJELER
Divan Başkanı: Prof. Dr. Mete KARACAOĞLU
Katip Üyeler: Bahattin KOÇER / Dilek KABAKÇI
Erkan TOPAL
Kiraz Tozlaşmasında Bal ve Bombus Arısı
Kullanılmasının
Verim
ve
Kaliteye
Etkisinin
Belirlenmesi
Ege TAE
Yeni
Doç.Dr.Mehmet
BOZKURT
Yumurtacı Piliç ve Tavuk Yetiştiriciliğinde Hayvan
Refahını İyileştirmeye Yönelik Çalışmalar
Erbeyli İncir
Arş. İst.
Yeni
10:30-10:50
Ara
10:50-12:30
II.
OTURUM YENİ TEKLİF PROJELER
Divan Başkanı: Prof. Dr. Mete KARACAOĞLU
Katip Üyeler: Bahattin KOÇER / Dilek KABAKÇI
Dr. Hüseyin
GÖGER
Kanat Tüylenme Hızına Göre Cinsiyet Ayırımı Yapılabilen
Beyaz Yumurtacı Ebeveyn Hatların Geliştirilmesi ve Yeni
Tavukçuluk
Arş. İst.
Yeni
Arıcılık Arş.
İst.
Yeni
Alternatiflerin Araştırılması
Salim AKTÜRK
12:30-14:00
14:00-15:40
Türkiye’nin Farklı İklim Bölgelerinde Kışlatmanın Bal Arısı
(Apismellifera L.) Kolonilerinin Fizyolojik ve Bazı Davranış
Karakterlerine Etkilerinin Araştırılması
Yemek Arası
III.
OTURUM YENİ TEKLİF PROJELER
Divan Başkanı: Prof. Dr. Musa SARICA
Katip Üyeler: Engin TÜLEK / Erkan TOPAL
Uğur YILDIRIM
Yağı Alınmış Un Kurdu (TenebrioMolitor) Larvasının
Yumurta Tavuğu Yemlerinde Kullanım Olanakları.
Tavukçuluk
Arş. İst.
Yeni
Dilek KABAKCI
Farklı Dozlarla Yapay Tohumlanan Ana Arıların Bazı
Fizyolojik Parametreler Üzerindeki Etkisinin Araştırılması
Arıcılık Arş.
İst.
Yeni
Erol BİNTAŞ
Gagası kesimi ile farklı form ve partikül büyüklüğündeki
yemle beslemenin yumurtacı piliçlerin büyütme ve verim
dönemi performansı üzerine etkileri
Erbeyli İncir
Arş. İst.
Yeni
15:40-16:00
Ara
III.
16:00-17:30
OTURUM YENİ TEKLİF - SONUÇLANAN PROJELER
Divan Başkanı: Prof. Dr. Musa SARICA
Katip Üyeler: Engin TÜLEK / Erkan TOPAL
Sunay DEMİR
Farklı Materyallerle Zenginleştirilen
Damızlık Horoz
Kümeslerinin Performans Ve Bazı Kan Parametreleri
Üzerine Etkisi
Tavukçuluk
Arş. İst.
Yeni
Ümit
KAYABOYNU
Karadeniz Bölgesinde
Bulunan
Ticari Ana Arı
İşletmelerinde Kullanılan Damızlık Kolonilerin Genetik
Çeşitliliğinin Belirlenmesi
Arıcılık Arş.
İst.
Yeni
Erbeyli İncir
Arş. İst.
Yeni
Doç. Dr.Mehmet
BOZKURT
Yem selüloz düzeyi ve kaynağı ile gaga kesiminin
yumurtacı piliçlerin büyütme ve verim dönemi
performansı üzerine etkileri
05 MART 2014 ÇARŞAMBA
IV.
09:00-10:30
Serdar KAMANLI
OTURUM SONUÇLANAN PROJELER
Divan Başkanı: Prof. Dr. H. Vasfi GENCER
Katip Üyeler: Bahattin KOÇER / Dilek KABAKÇI
BarredRock 1 Saf Hattında Bacak Rengine Göre Tavukçuluk Arş.
Sonuçlanan
İst.
Cinsiyet Ayırımı Olanağı Veren Bir Sürü Oluşturulması
Doç. Dr. Mehmet
BOZKURT
10:30-10:50
10:50-12:30
Cahit ÖZTÜRK
Şahnur Erdoğan
DEMİRTAŞ
12:30-14:00
14:00-15:40
Karma Yeme Esansiyel Yağ Karışımı, Prebiyotik,
Probiyotik ve Enzim İlavesinin Deneysel Koksidiyoz
Bulaştırılan Etlik Piliçlerin Performans, Dışkı Oosit
Atımı, Lezyon Skoru, Bağışıklığı İle Kimi Organ
Ağırlıkları Üzerine Etkileri
Erbeyli İncir
Arş. İst.
Sonuçlanan
Ara
IV. OTURUM SONUÇLANAN PROJELER
Divan Başkanı: Prof. Dr. H. Vasfi GENCER
Katip Üyeler: Bahattin KOÇER / Dilek KABAKÇI
Akdeniz Bölgesinde Arıcılık İşletmelerinin Teknik ve
Ekonomik Yapısının Belirlenmesi
BarredRock I ve Rhode Island Red I Saf Hatlarında
Kabuk Renginin İyileştirilmesi
Alata Bahçe
Kült. Arş. İst.
Sonuçlanan
Tavukçuluk
Arş. İst.
Sonuçlanan
Yemek Arası
V.
OTURUM SONUÇLANAN PROJELER
Divan Başkanı: Prof. Dr. Rüveyde AKBAY
Katip Üyeler: Engin TÜLEK / Erkan TOPAL
Serdar KAMANLI
Değişik ışık kaynaklarının yumurta tavuklarında bazı
verim ve yumurta kalite özellikleri üzerine etkisinin
belirlenmesi
Tavukçuluk
Arş. İst.
Sonuçlanan
Cahit ÖZTÜRK
Doğu Akdeniz Bölgesi koşullarında yetiştiriciliği yapılan
balarısı (Apismellifera L.) kolonilerinde hijyenik
davranış seleksiyonu ile hastalık ve parazitlere karşı
dayanıklı hat geliştirme olanaklarının araştırılması I
Alata Bahçe
Kült. Arş. İst.
Sonuçlanan
Yumurtacı Damızlıklarda Rasyona İlave Edilen Farklı
Yağların Verime, Kuluçka Özelliklerine ve Civciv
Kalitesine Etkileri
Tavukçuluk
Arş. İst.
Sonuçlanan
Eskişehir
Geç.Kuş.
Bilgi
Dr. Züleyha
KAHRAMAN
16:00-17:30
Soner YİĞİT
V.OTURUM SONUÇLANAN PROJELER
Divan Başkanı: Prof. Dr. Rüveyde AKBAY
Katip Üyeler: Engin TÜLEK / Erkan TOPAL
Türkiye Damızlık Tavuk Islah Projesi
2. Etçi Damızlık Islahı
Dr. Hüseyin
KİNET
Doku Kültürü Medyumuna Katılan Treha-loz,Sistein Ve
Dithioerythritol Antioksidanları İle Horoz Spermasının
Dondurulması
Hayvancılık
Merkez Arş.
Ens.
Devam
Diydem DOĞAN
Damızlık Yumurtalarda Kuluçka Sıcaklığının Kuluçka
Performansı Civciv Kalitesi Ve Eşey Oranına Etkisi
Tavukçuluk Arş.
İst.
Devam
Bal Arılarının (ApisMellifera L.) Beslenmesinde
Kullanılan Şuruba Farklı Düzeylerde Çinko İlavesinin
Arıcılık Arş. İst.
Devam
Ümit KARATAŞ
Larva Kabul Oranı, Larva Ağırlığı Ve Arı Sütü Verimi
Üzerine Etkisi İle Arı Sütündeki Miktarının Araştırılması
Şahnur E.
DEMİRTAŞ
Tavukçuluk Araştırma Enstitüsü’nde Bulunan Saf
Hatlardan Kanat Tüylenme Hızına Göre Cinsiyet
Ayırımına İmkan Sağlayan Soyların Geliştirilmesi
Tavukçuluk
Arş. İst.
Devam
Gökhan
AKDENİZ
Bal Arısının (Apismellifera L.) Bademin Polinasyonuna
Etkisinin Araştırılması
Arıcılık Arş. İst.
Devam
Bahattin KOÇER
Karma Yem Partikül Büyüklüğü ve Yem Formunun
Sıcak İklim Koşullarında Yetiştirilen Beyaz Yumurtacı
Tavukların Verim Performansı, Yumurta Kalitesi ile
Tüylenme Skoru ve Bazı İç Organ Ölçümleri Üzerine
Etkileri.
Erbeyli İncir
Arş. İst.
Devam
Cahit ÖZTÜRK
Doğu Akdeniz Bölgesinde, yetiştiriciliği yapılan balarısı
(Apismellifera L.) kolonilerinin gezginci arıcılık
koşullarında ahşap, plastik ve strafor kovanlarda
yaşama, gelişme, verim, hastalık ve zararlıların gelişimi
ve kışlatma üzerine etkilerinin araştırılması
Alata Bahçe
Kült. Arş. İst.
Devam
06 MART 2014 PERŞEMBE
VI.
09:00-10:30
OTURUM DEVAM EDEN PROJELER
Divan Başkanı: Doç. Dr. Mehmet BOZKURT
Katip Üyeler: Bahattin KOÇER / Dilek KABAKÇI
Dr. Eyup BAŞER
Süneyle Biyolojik Mücadele, Yaban Hayatının
GeliştirilmesiBiyolojik Çeşitlilik ve Hayvan Genetik
Kaynaklarının Korunması Temelinde Keklik Üretimi ve
AR-GE faaliyetlerinin Yürütülmesi Projesi
Bahri Dağdaş
Uluslararası
Tar. Arş. Enst.
Müdürlüğü.
Bilgi
Ahmet KUVANCI
Fazelya (Phaceliatanacetifolia B.), Engerek
Otu(Echiumvulgare L.) Ve Çayır Üçgülü
(Trifoliumpratense L.) Bitkileri Arasında Arı Tercihinin
Araştırılması
Arıcılık Arş.
İst.
Devam
Muhsin KARA
Erzurum Yöresi Bal Arılarında (Apismellifera L.) Saf
Hat Oluşturma
Doğu Anadolu
TAE
Devam
Tavukçuluk Araştırma Enstitüsü’ndeki Yumurtacı Saf
Hatların Islahı ve Bunlardan Ebeveyn ve Hibrit Elde
Etme Çalışmaları
Tavukçuluk Arş.
İst.
Devam
Arıcılık Arş. İst.
Devam
Erbeyli İncir
Arş. İst.
Devam
Dr. Hüseyin
GÖGER
Feyzullah KONAK
Doç. Dr. Mehmet
BOZKURT
Ülkesel Arıcılık: Batı ve Orta Karadeniz Bal
Arılarının ( Apismellifera L.) Islahı
Zorlamalı Tüy Döktürülen Ve Döktürülmeyen İleri
Yaştaki Yumurtacı Tavukların Yemlerine
Prebiyotik ve Kekik Yağı İlavesinin Yumurta
Verimi ve Kalitesi, Bağışıklık, Kan Parametreleri,
Bağırsak Mikroflorası İle Kemik Kalitesi Üzerine
Etkileri
10:30-10:50
10:50-12:30
Ara
VI. OTURUM DEVAM EDEN PROJELER
Divan Başkanı: Doç. Dr. Mehmet BOZKURT
Katip Üyeler: Bahattin KOÇER / Dilek KABAKÇI
Murat DOĞU
Yumurtacı Damızlık Kafeslerinde Farklı Yerleşim
Sıklığı ve Horoz Sayısının Performans Üzerine Etkileri
Tavukçuluk
Arş. İst.
Devam
Cahit ÖZTÜRK
İn vitro koşullarda balarısı ( Apismellifera L.) bireyleri
yetiştirilmesi,
bunların
gözlem
kovanlarında
incelenmesi ve arı yetiştiriciliği ile ıslahı bakımından
kullanım olanaklarının araştırılması
Alata Bahçe
Kült. Arş. İst.
Devam
Gökhan EGE
AntikoksidiyalMonensin Yerine Tamamen veya Kısmen
Kekik Esansiyel Yağı İkamesinin Eimeriaspp ile
Enfekte Edilmiş Etlik Piliçlerin Performans, Dışkı ile
Oosit Atımı, Lezyon Skoru ve Oksidatif Stres Üzerine
Etkisi
Erbeyli İncir
Arş. İst.
Devam
Şahnur
E.DEMİRTAŞ
Enstitü Koşullarında Yetiştirilen Beyaz Yumurtacı Saf
Hat Horozlarda Sperma Özellikleri ve Progesteron
Seviyelerinin Belirlenmesi
Tavukçuluk
Arş. İst.
Devam
Muzaffer DUMAN
Bal Arısı (Apismellifera L.) Kolonilerinde Farklı
Oranlarda Şeker Şurubu Verilerek Yapılan Besleme
Yöntemleri İle Üretilen Balların Ayırt Edilmesinde
Kullanılacak Fiziksel, Kimyasal ve Palinolojik Kriterlerin
Araştırılması
Arıcılık Arş.
İst.
Devam
Erbeyli İncir
Arş. İst.
Devam
Ege TAE
Devam
Tavukçuluk
Arş. İst.
Devam
12:30-14:00
14:00-15:40
Bahattin KOÇER
Üzeyir KARACA
Meltem
GÜLTEKİN
Yemek Arası
VII.
OTURUMDEVAM EDEN PROJELER
Divan Başkanı: Dr. Bekir ANKARALI
Katip Üyeler: Engin TÜLEK / Erkan TOPAL
Öğünlü Yemleme ve Otlamanın Serbest Otlaklı
Sistemde Yetiştirilen Etlik Piliçlerde Performans, Et
Kalitesi ve Kemik Mekanik Özellikleri Üzerine Etkileri
Batı Ege Bölgesi Balarılarının (Apismellifera L.)
Hijyenik Davranış Özelliklerinin Belirlenmesi ve Bu
Özellik Bakımından Populasyonların Geliştirilmesi
Aspir Tohumu Küspesinin Yumurta Tavuğu Yemlerinde
Kullanım Olanakları.
Gökhan AKDENİZ
Bal Arılarında (Apismellifera L.) Transgenik Soya Unu
Kullanımının Performans ve Davranış Üzerine Arıcılık Arş. İst.
Etkilerinin Araştırılması
Devam
Cahit ÖZTÜRK
Doğu Akdeniz Bölgesi koşullarında yetiştiriciliği yapılan
balarısı (Apismellifera L.) kolonilerinde hijyenik
davranış seleksiyonu ile hastalık ve parazitlere karşı
dayanıklı hat geliştirme olanaklarının araştırılması II
Devam
Alata Bahçe
Kült. Arş. İst.
Üzeyir KARACA
İzmir Yöresi Bal Arılarında (ApisMellifera L.) Saf Hat
Oluşturma Çalışmaları
15:30-16:00
Ara
16:00-17:30
VII .OTURUM DİLEK VE TEMENNİLER – KAPANIŞ
Divan Başkanı: Dr. Bekir ANKARALI
Katip Üyeler: Engin TÜLEK / Erkan TOPAL
Ege TAE
Devam
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Alternatif
Barındırma
Sistemlerinin
Damızlık Yumurtacılarda Performansa ve
Bazı Kan Parametrelerine Etkisi
Tavukçuluk Araştırma İstasyonu
Müdürlüğü
TAGEM
Bülent TARIM
Diydem DOĞAN
Sunay DEMİR
Meltem GÜLTEKİN
Murat DOĞU
Engin TÜLEK
01/12/2015 - 31/01/2017
7.000,00
Proje Özeti: :
Dünya’da çevre bilincinin artmasına paralel olarak, hayvan hakları yasalarla korunur
hale gelmiştir. Tüketiciler aldıkları hayvansal ürünlerin hangi koşullarda üretildiğini
sorgulamaktadır. Bu gelişmeler içerisinde en önemli yeri kanatlılar almaktadır. Bu nedenle
tüm ülkelerde barınma koşullarının, tavukların doğasına uygun hale getirilmesi için çalışmalar
yapılmaktadır. Bu çalışmalar ışığında hazırlanan projede, yumurta tavukları geleneksel ve
zenginleştirilmiş barındırma sistemlerinde barındırılacaktır. Kümesler, Avrupa Birliği
Ülkelerinin kabul ettiği standartlarda ve refah kararlarına uygun olarak hazırlanacaktır. Proje
ile barınma sistemlerinin yumurta verimi ve kalitesi üzerindeki etkileri belirlenecektir. Birim
kümes taban alanından elde edilecek verim esas alınarak barınma sistemleri karşılaştırılacak
ve ülkemiz için modellerin belirlenmesine çalışılacaktır.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Yağı Alınmış Un Kurdu (Tenebrio Molitor)
Larvasının Yumurta Tavuğu Yemlerinde
Kullanım Olanakları
Tavukçuluk Araştırma İstasyonu
Müdürlüğü
TAGEM
Uğur YILDIRIM
Dr.Engin YENİCE
Diydem DOĞAN
Hüseyin AYGÖREN
Meltem GÜLTEKİN
Barış ERTEKİN
01/05/2015 - 31/03/2016
29.000
PROJE ÖZETİ :
Projede, yumurta tavuğu rasyonlarına ilave edilen farklı oranlardaki Tenebrio Moliter
Larvasının, performans, yumurta kalitesi, kan ve yumurta kolesterol içerikleri ile yumurta tat,
koku, özelliklerine etkilerinin belirlenmesi amaçlanmıştır. Bu amaçla, hayvan materyali olarak
Tavukçuluk Araştırma İstasyonu Müdürlüğünde bulunan 24 haftalık yaşta, toplam 216 adet
ATABEY hibrit beyaz yumurtacı tavuk kullanılacaktır.
Yem materyali olarak tavuklara % 17 HP ve 2800 kcal/kg metabolik enerji içeren yumurta
tavuğu yemleri verilecektir. Yem karmaları izokalorik ve izonitrojenik olarak hazırlanacaktır.
Aşağıda verilen 4 farklı yem, özel bir yem fabrikasında hazırlanacaktır. 1: Kontrol grubu 2: %
2 Tenebrio Moliter Larvası; 3: % 4 Tenebrio Moliter Larvası; 4: % 8 Tenebrio Moliter Larvası
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Kanat Tüylenme Hızına Göre Cinsiyet
Ayırımı Yapılabilen Beyaz Yumurtacı
Ebeveyn Hatların Geliştirilmesi ve Yeni
Alternatiflerin Araştırılması
Tavukçuluk Araştırma İstasyonu
Müdürlüğü
TAGEM
Dr. Hüseyin GÖGER
Prof. Dr. Numan AKMAN
Şahnur ERDOĞAN DEMİRTAŞ
Şemin YURTOĞULLARI
Semih KOÇANAOĞULLARI
Hüseyin AYGÖREN
01.01.2015 - 01.03.2019
141.418,00
PROJE ÖZETİ
Tavukçuluk Araştırma İstasyonda 2010 yılına kadar hızlı kanat tüylenme özelliği
gösteren beyaz yumurtacı 4 saf hat bulunmaktaydı. Kanat tüylenme özelliğinden
yararlanılabilmesi için hızlı tüylenen hatların yanında yavaş tüylenenlere de ihtiyaç vardır. Bu
eksikliğin giderilebilmesi amacıyla yavaş tüylenen bir hat ithal edilmiştir. Yavaş tüylenme
özelliği gösteren tek hattın olması, yeni hibrit genotiplerin geliştirilmesi yönünde yapılacak
çalışmaları sınırlandırmaktadır. Bu sorunun aşılabilmesi amacıyla; yavaş tüylenme özelliği
gösteren mevcut hattan sentetik hatların geliştirilmesine ihtiyaç duyulmuştur. Bu kapsamda
öncelikle hat yetiştirme ile tek özellik yönünden geliştirilmiş baba ve ana hatlarının
oluşturulması gerekmektedir. Seleksiyonda birden fazla özellik üzerinde duruluyorsa,
bunların her biri için uygulanacak seleksiyon üstünlüğü düşer (Düzgüneş,1993). Özelliklerin
birbirinden bağımsız bulunmaları oranında bu düşüş fazlalaşır. Ayrıca bir özelliğin
iyileştirilmesi bir başka özellikte gerilemeye neden olabilir (yumurta sayısı ve ağırlığı vs.).
Çalışmada temel sürüden çekilecek, biri yüksek yumurta verimi (DYYV), diğeri düşük canlı
ağırlık (DDCA) yönünde seleksiyona tabi tutulacak iki ana hattı geliştirilecektir. Baba hattı
olarak geliştirilecek hatlarda; yumurta ağırlığının ve sayısının arttırılması, planlanmaktadır.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Farklı
Materyallerle
Zenginleştirilen
Damızlık
Horoz
Kümeslerinin
Performans ve Bazı Kan Parametreleri
Üzerine Etkisi
Tavukçuluk Araştırma İstasyonu
Müdürlüğü
TAGEM
Sunay Demir
Diydem DOĞAN
Bülent TARIM
Murat DOĞU
Engin TÜLEK
Barış ERTEKİN
01 / 08 / 2015 - 01 / 07 / 2016
6.000 TL
PROJE ÖZETI:
Bu projenin amacı, hayvan refahı konusunda Avrupa Birliği direktifleri göz önünde
bulundurularak, yumurtacı damızlık horozların standart yetiştirme kümes bölmeleri ile
zenginleştirilmiş kümes bölmelerinin horoz performans, kan parametreleri ve ayak refahına
etkilerini belirlemektir.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Denizli ve Gerze Yerli Tavuk Irklarında
Yumurta Kalite Kriterleri
Hayvancılık Merkez Araştırma
Enstitüsü/LALAHAN
TAGEM
Dr. Pınar TUNÇER
Doç. Dr. İ. Safa GÜRCAN
Dr. Neval ÖZDOĞAN
24/08/2015 – 26/08/2016
12.500,00
PROJE ÖZETI:
Projeye, Ağustos 2015 yılında başlanacak olup Hayvancılık Merkez Araştırma
Enstitüsü Tavuk Yetiştirme Şubesinde bulunan ex situ in vivo koruma sürülerinden Denizli ve
Gerze yerli ırklarına ait bireysel kafeste barındırılan 30’ar tavuğun birbirini izleyen üç güne ait
yumurtaları materyal olarak kullanılacaktır. Araştırma 16 hafta (30. Hafta-46. Hafta) sürecek
olup dört hafta aralıkla toplanan Denizli ve Gerze ırkı tavukların yumurtaları üzerinde aşağıda
yer alan iç ve dış kalite kriterleri tespit edilecektir. Çalışılacak iç ve dış kalite kriterleri;
yumurta ağırlığı g, özgül ağırlık g/cm³, şekil indeksi %, ak indeksi %, sarı indeksi %, sarıda et
ve kan doku düzeyi, sarı rengi, kabuk kalınlığı mm, kabuk ağırlığı g, Haugh Birimi, ak oranı
%, sarı oranı %, kabuk oranı %, sarı/ak oranı %.
Yapılacak olan analizler sonucunda ülkemizin yerli ırklarından olan Denizli ve Gerze
tavuk ırklarının yumurtalarına ait kalite kriterleri ortaya konacaktır. Elde edilecek bilgilerin
bilim dünyasına sunulması ile ileride yapılacak çalışmalara zemin hazırlayacağı
düşünülmektedir.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Gagası Kesimi İle Farklı Form Ve Partikül
Büyüklüğündeki
Yemle
Beslemenin
Yumurtacı Piliçlerin Büyütme Ve Verim
Dönemi Performansı Üzerine Etkileri
İncir Araştırma İstasyonu Müdürlüğü
TAGEM
Erol BİNTAŞ
Erol BİNTAŞ
Doç. Dr. Mehmet BOZKURT
Mustafa ÇINAR
Prof. Dr. Servet YALÇIN
Prof. Dr. Sezen ÖZKAN
Gökhan EGE
Bahattin KOÇER
Abdullah Uğur ÇATLI
Yrd. Doç. Dr. Kamil KÜÇÜKYILMAZ
Prof. Dr. Kamil SEYREK
Yrd. Doç. Dr. Hasan AKŞİT
Yrd. Doç. Dr. Ebru BORUM
Doç. Dr. Metin ÇABUK
Dr. Engin YENİCE
01/01/2015 - 31/12/2018
68.000
PROJE ÖZETI:
Hayvan refahı ile ilgili AB mevzuatında uygulamaya konulan yeni yaptırımların yanı sıra
ilgili çevrelerde 2020-2022 yılından itibaren yumurtacı civcivlerde gaga kesiminin tamamen
yasaklanmasının tartışılmaya başlanmış olması konuya önemli bir boyut getirmiştir. Zira
gaganın kesilmeden bırakılması ileriki yaşlarda kanibalizmi tetikleyen en önemli etken olduğu
gibi bazı durumlarda yem saçımının sorumlusu olabilmektedir. Yem formunun ve partikül
büyüklüğünün yumurtacı piliçlerin beslenmesindeki yeri hemen hemen hiç değinilmemiş bir
araştırma alanıdır. Pratik uygulamada yumurtacı piliçlerin büyütme döneminde toz formda
yem kullanılmaktadır. Yumurtacı civciv ve piliçlerde gaganın yapısal durumu ile yem partikül
büyüklüğü ve yem formu yem tüketimini etkileyen başlıca etmenlerdir. Bahsedilen yemleme
teknikleri piliçlerin yem tüketimi için harcadıkları zamanı, canlı ağırlığı ve üniformitesini,
yaşama gücünü, yem tüketimini ve tüylenme skorunu etkileyebilmektedir. Bu projenin amacı
yumurtacı piliçlerin büyütme ve verim döneminde gaga kesimi, yem formu ile yem partikül
boyutunun tüy çekme davranışı, yem alımı ve saçımı üzerine etkilerinin incelenerek bunların
davranış, sağlık ve performans açısından sonuçlarının ortaya konmasıdır. Deneme 2x2x2
faktöriyel düzende yürütülecektir. Gaganın kesimi (kesilmiş ve kesilmemiş), yem partikül
büyüklüğü (ince ve kalın) ve yem formu (toz ve granül) denemedeki değişkenleri
oluşturacaktır. Deneme piliç büyütme döneminin tamamını ve verim döneminin ise yarısını
kapsayacaktır.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Yem Selüloz Düzeyi Ve Kaynağı İle Gaga
Kesiminin Yumurtacı Piliçlerin Büyütme
Ve Verim Dönemi Performansı Üzerine
Etkileri
İncir Araştırma İstasyonu Müdürlüğü
TAGEM
Doç. Dr. Mehmet Bozkurt
Erol BİNTAŞ
Mustafa ÇINAR
Prof. Dr. Servet YALÇIN
Prof. Dr. Sezen ÖZKAN
Gökhan EGE
Bahattin KOÇER
Abdullah Uğur ÇATLI
Yrd. Doç. Dr. Kamil KÜÇÜKYILMAZ
Prof. Dr. Kamil SEYREK
Yrd. Doç. Dr. HASAN AKŞİT
Yrd. Doç. Dr. Ebru BORUM
Doç. Dr. Metin ÇABUK
Dr. Engin YENİCE
01/01/2015 - 31/12/2018
429.500 TL
PROJE ÖZETI:
Tüy çekme ve gagalama yumurtacı tavuklarda henüz çözülemeyen bir sorun olarak kabul
edilmektedir. Sürü içinde hızla yayıldığı, görülme oranının kimi zaman %60-80’lere kadar
yükseldiği bilinmektedir. Tüy çekme can acıtıcı olduğundan havan refahının gerilemesine de
neden olduğu kabul edilir. Şiddetli seyreden tüy gagalama, diğer hayvanların tüylerine zarar
verme ile başlayıp genellikle kanibalizm ile sonuçlanır. Gaga kesiminin çok yakın bir gelecekte
yasaklanacak olması, bu problemi daha ciddi boyutlara taşıyacaktır. Yumurtacı piliçlerde ve
tavuklarda tüy çekme eğilimini azaltmak amacıyla uygulanabilecek manejman yöntemlerinin
başında yem selüloz düzeyinin artırılması gelmektedir. Selülozca zengin yemler piliçlerin gün
içinde yem tüketimi için harcadıkları sürenin uzamasını sağlayabilmektedir. Selüloz kursaktan
yavaşça geçerek yemin sindirim sisteminde uzun süre kalmasını sağlamakta, bağırsak
içeriğinin motilitesini artırmakta, sonuç olarak doygunluk hissi sağladığından dolayı piliçlerde
tüy çekme ve yeme eğilimini azaltmaktadır. Tüylenme skorunda iyileşme yüksek selülozlu
yem tüketiminin sağladığı diğer bir avantajdır. Yem selüloz düzeyi ve kaynağı ile yumurtacı
civcivlerin gaga morfolojisinin büyütme ve yumurtlama dönemi performansı üzerine
etkilerinin incelendiği bu çalışma 2x3 faktöriyel düzeninde yürütülecektir. Yumurtacı piliç ve
tavukların beslenmesinde selülozca zengin tahılların ve küspelerin yanı sıra saf selüloz içeren
odun talaşı ile mısır-soya esaslı standart yemlerin selülozca zengin hale getirilmesinin etkileri
de araştırılacaktır.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Gaga
Kesimi
Ve
Genotipin
Zenginleştirilmiş
Kafes
Ve
Aviary
(Kuşluklu)
Yetiştirme
Sistemlerinde
Büyütülen Yumurtacı Piliçlerin Büyütme
Ve Verim Dönemi Performansı Üzerine
Etkileri
İncir Araştırma İstasyonu Müdürlüğü
TAGEM
Mustafa ÇINAR
Doç. Dr. Mehmet BOZKURT
Abdullah Uğur ÇATLI
Erol BİNTAŞ
Prof. Dr. Servet YALÇIN
Prof. Dr. Sezen ÖZKAN
Gökhan EGE
Bahattin KOÇER
Yrd. Doç. Dr. Kamil KÜÇÜKYILMAZ
Yrd. Doç. Dr. Çiğdem YAMANER
Prof. Dr. Kamil SEYREK
Yrd. Doç. Dr. Hasan AKŞİT
Yrd. Doç. Dr. Ebru BORUM
Doç. Dr. Metin ÇABUK
01/01/2015 - 12/31/2018
68.000 TL
PROJE ÖZETI:
Piliç büyütme kafeslerindeki yerleşim sıklığı hayvanların refahını, sağlığını,
performansını ve yumurtlama dönemindeki performanslarını etkileyen önemli bir faktördür.
Özellikle piliç başına düşen yemlik uzunluğu piliçlerin yem tüketimi ve dolayısıyla canlı
ağırlığın üniformitesini önemli düzeyde etkilemekte, aşırı yerleşim sıklığı bazı olumsuz
faktörlerle birlikte tüy çekme davranımına neden olabilmektedir. Ülkemizde yumurtlama
döneminde zenginleştirilmiş kafes kullanılmasını zorunlu hale getirilen yönetmelik
(01.01.2015) tavuk başına düşen kafes taban alanının konvansiyonel kafeslerdekine kıyasla %
50 oranında artırılmasını öngörmektedir. Buna ilaveten kafes kolonilerinin içinde bir folluk
ünitesi, tırnak törpüleme aparatı, eşinme yüzeyi ve tünek yerleştirilmesi zorunlu tutulmuştur.
Yumurtlama kafeslerinin donanımında ve boyutlarında yapılan bu önemli değişikliklerin
önümüzdeki yıllarda büyütme kafesleri için düşünülmesi kaçınılmaz gözükmektedir.
Genotipteki ve gaga morfolojisindeki farklılıklar ile alternatif sistemlerin sağladığı donanımlar
arasındaki ilişkileri inceleyen çalışma sonuçları ve pratik saha gözlemlerinin bulunmaması
konuyu yeni araştırmalar açısından cazip kılmaktadır. 2x2x2 faktöriyel düzeninde yürütülecek
olan çalışmada gagası kesilmiş ve kesilmemiş iki farklı genotipten civcivler 2 farklı piliç
büyütme sisteminde çıkıştan 16 haftalık yaşa kadar büyütme ünitesinde barındırılacak 17.
Haftanın başında yumurtlama kümesine taşınacaklardır. Bu çalışma ile iki farklı ticari hattan
yumurtacı piliçleri zenginleştirilmiş ve aviary piliç büyütme ve yumurtlama ünitelerinde
büyütmenin hayvan refahı, sağlığı, davranımları ile performans üzerindeki etkileri uzun süreli
bir çalışmada ele alınacaktır. Deneme her biri 4 tekerrürlü 8 gruptan oluşturulacaktır
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Yumurtacı Piliç Ve Tavuk Yetiştiriciliğinde
Hayvan Refahını İyileştirmeye Yönelik
Çalışmalar
İncir Araştırma İstasyonu Müdürlüğü
TAGEM
Doç. Dr. Mehmet BOZKURT
Erol BİNTAŞ
Mustafa ÇINAR
Abdullah Uğur ÇATLI
Prof. Dr. Servet YALÇIN
Prof. Dr. Sezen ÖZKAN
Gökhan EGE
Bahattin KOÇER
Yrd. Doç. Dr. Kamil KÜÇÜKYILMAZ
Prof. Dr. Kamil SEYREK
Yrd. Doç. Dr. Hasan AKŞİT
Yrd. Doç. Dr. Ebru BORUM
Yrd. Doç. Dr. Çiğdem YAMANER
Doç. Dr. Metin ÇABUK
Dr. Engin YENİCE
01/01/2015 - 31/12/2018
905.000 TL
PROJE ÖZETI:
Yumurtacı piliç ve tavuklarda ciddi yaralanma ve travmaya neden olan gaga kesimi
uygulaması ve tüy çekme davranımı üretim ekonomisi ve hayvan refahı açısından önemli bir
sorun teşkil etmektedir. AB ülkelerinde 2012 yılından itibaren uygulamaya konulan
konvensiyonel kafeslerde yumurtacı tavukların barındırılmasının yasaklanması ve muhtemelen
önümüzdeki yıllarda gaga kesimine izin verilmeyecek olması hayvan refahı konusundaki
yaptırımların giderek tavizsiz şekilde uygulanacağını göstermektedir. Bu gelişmeler benzer
uygulamaların yumurtacı piliçlerin kafeste büyütülmesi açısından geçerli olacağını
göstermektedir. Yemleme metotlarının, piliçlerin büyütme ve yumurtlama dönemindeki tüy
çekme eğilimini etkileyen önemli bir faktör olduğu bilinmesine rağmen şimdiye kadar bu
etkenlerin üzerinde yeterince durulmamıştır. Yemin formunda, partikül büyüklüğünde ve
selüloz oranında yapılacak değişimler yem tüketimine ilişkin davranımlarını etkileyerek
tavukların tüy çekme eğilimlerini azaltabilmektedir. Bahsedilen yemleme tekniklerinin yanısıra
uygun genotipin seçimi ve kafes / yerde yetiştirme sistemlerinde yapılacak düzenlemeler,
piliçlerin yem tüketimi için harcadıkları zamanı, canlı ağırlığı ve üniformitesini, yaşama
gücünü, yem tüketimini ve refahını, örneğin tüylenme skorunu etkileyebilmektedir. Bu
projenin amacı gaga kesimi, yetiştirme sistemi, genotip, yem formu, yem partikül boyutu ile
tüy çekme eğilimi arasındaki ilişkileri inceleyerek bunların yumurtacı piliçlerin büyütme ve
verim döneminde refah, davranış, sağlık ve performans üzerindeki olası etkilerinin
incelenmesidir.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Türkiye’nin Farklı İklim Bölgelerinde
Kışlatmanın Bal Arısı (Apis mellifera L.)
Kolonilerinin Fizyolojik ve Bazı Davranış
Karakterlerine Etkilerinin Araştırılması
Arıcılık Araştırma İstasyonu Müdürlüğü
TAGEM
Salim AKTÜRK
Prof. Dr.
Ahmet GÜLER
Ziraat Mühendisi Ahmet KUVANCI
Ziraat Mühendisi Tunay KILIÇİN
Ziraat Mühendisi Gökhan AKDENİZ
Ziraat Mühendisi Dilek KABAKÇI
Ziraat Mühendisi Ümit KARATAŞ
Ziraat Mühendisi Şeref CINBIRTOĞLU
Ziraat Mühendisi Serkan GÜNBEY
Veteriner Hekim
Seyit Hasan ÖZTÜRK
Tekniker
Ramazan KAYABAŞI
01/01/2015 - 31/10/2017
88.400
PROJE ÖZETI:
Arıcılıkta bir yıl boyunca süren işlemler birbirine bağlı dönemlerden oluşur. Bir yıllık
üretim, yetiştirme ve bakım çalışmalarından elde edilen başarı bir önceki dönemde yapılan
doğru tanım ve çalışmalarla elde edilir. Bir zincirin halkaları gibi düşünmemiz gereken bu
dönemlerin en önemli parçalarından birisi de kuşkusuz kışlatma evresidir.
Türkiye'nin coğrafik konumu ve yeryüzünün aldığı şekiller, farklı özellikte iklim
tiplerinin doğmasına yol açmıştır. Bu iklimlerde kış dönemi, sıcaklık, nem, günlük ısı değişimi
vb. değerler bakımından büyük farklılıklar mevcuttur. Kışlatma döneminde iklim faktörlerine
bağlı meydana gelebilecek koloni ölümlerini en aza indirip kayıpsız arı populasyonuyla
kolonilerin ilkbahara güçlü bir şekilde çıkması ekonomik yetiştiricilik açısından gereklidir.
Türkiye’deki bu iklim zenginliğinden yola çıkarak kışlatma bölgesi olarak
kolonileri Akdeniz ve Karadeniz ikliminde açık alanda, Orta Anadolu ve Doğu Anadolu gibi
karasal iklimin hâkim olduğu bölgelerde ise sırasıyla açık ve kapalı alanda kışlatmaya
bırakarak, koloni kayıpları, kışlatma yetenekleri, ısı regülasyonu, stok balları kullanım
durumları belirlenerek, koloni fizyolojik ve davranış karakterleri üzerine olan etkileri ortaya
konulacaktır.
Uygun kışlatma bölgelerinin belirlenerek, kışlatma dönemi sonunda kolonideki
populasyon düzeyinin korunması ve kışlatmaya bağlı koloni kayıplarının önlenmesi bu
çalışmanın başlıca amacıdır.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Farklı Dozlarla Yapay Tohumlanan Ana
Arıların Bazı Fizyolojik Parametreler
Üzerindeki Etkisinin Araştırılması
Arıcılık Araştırma İstasyonu Müdürlüğü
TAGEM
Dilek KABAKCI
Prof. Dr. Ahmet GÜLER
Ziraat Yük. Mühendisi Gökhan AKDENİZ
Ziraat Yük. Mühendisi Ümit KARATAŞ
Veteriner Hekim Seyit Hasan ÖZTÜRK
Ziraat Mühendisi Şeref CINBIRTOĞLU
Ziraat Mühendisi Salim AKTÜRK
Ziraat Mühendisi Tunay KILIÇİN
Tekniker Ramazan KAYABAŞI
Teknisyen Hayriye ŞEREFOĞLU
01.01.2015 - 31.12.2017
56000
PROJE ÖZETİ :
Bal arılarında koloninin tüm kalıtsal özelliklerinden Ana arı sorumludur. Ana arının
kovan dışında ve çok sayıda erkek arı ile çiftleşmesi genetik yapının kontrol edilmesini
imkansız kılmaktadır. Bu nedenle bal arısı (Apis mellifera L.) gen kaynaklarının muhafazası
izole bölge, kontrollü çiftleştirme alanı ve yapay tohumlama uygulamaları ile mümkündür. Saf
yetiştiricilik ve hibrit yetiştiriciliği gibi kontrollü çiftleştirme gerektiren çalışmalar ise ancak
yapay tohumlama ile başarılabilmektedir. Bu çalışmada aynı ana arıdan elde edilen kız kardeş
ana arılara yapay tohumlama yöntemiyle farklı dozlarda (2 µl, 4 µl ,8 µl ) tohumlama
yapılacak ve tohumlanan Ana Arıların yaşam uzunluğu ve Kuluçka Üretim Etkinliği,
Spermateka Hacmi ve Spermateka içindeki spermatozoa sayısına etkileri araştırılacaktır.
Deneme grupları;
1)
2 µl semenle tohumlanmış Ana Arılar
2)
4 µl semenle tohumlanmış Ana Arılar
3)
8 µl semenle tohumlanmış Ana Arılar
4)
Doğal Çiftleşen Ana Arılar
şeklinde oluşturulacak ve her deneme grubu 10 tekerrür üzerinden değerlendirilmek suretiyle
toplam 40 koloni ile araştırma yürütülecektir.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Karadeniz Bölgesinde Bulunan Ticari Ana
Arı İşletmelerinde Kullanılan Damızlık
Kolonilerin
Genetik
Çeşitliliğinin
Belirlenmesi
Arıcılık Araştırma İstasyonu Müdürlüğü
TAGEM
Ümit KAYABOYNU
Prof. Dr. Ahmet OKUMUŞ
Zir Müh. Muzaffer DUMAN
Vet. Hek. Fatih YILMAZ
Zir. Müh. Ahmet KUVANCI
Teknisyen Nazlı Pınar CANVERDİ
01/01/2015 - 31/12/2016
78.725 TL
PROJE ÖZETİ
Bal arıları taksonomik sınıflandırma içerisinde Apis cinsi içerisinde yer almaktadır. Apis
cinsini oluşturan türlerin büyük bir kısmı Asya kıtasında dağılım gösterirken, bunlardan
mellifera türü yani bal arısının gen merkezi, Afrika, Batı Asya ve Avrupa kıtalarıdır. Türkiye
üç kıtanın birbirine yakın olduğu yerde olmasından dolayı bal arısı genetik çeşitliliği yönünden
oldukça avantajlıdır. Sahip olduğu farklı coğrafik özellikler ve farklı iklimsel yapı nedeniyle
Türkiye'de oldukça fazla, birbirinden farklı bal arısı genotipi bulunmaktadır. Türkiye'de
Anadolu Arısı (Apis mellifera anatoliaca), Kafkas Arısı (Apis mellifera caucasica), Muğla
Arısı, Trakya Arısı, Gökçeada Arısı'nın yanı sıra İran Arısı (Apis mellifera meda), Suriye Arısı
(Apis mellifera syriaca), Karadeniz (Yığılca) Arısı gibi bazı ırk ve lokal genotiplerin
bulunduğu bilinmektedir (Güler, 2006).
Bu proje ile Karadeniz Bölgesinde bulunmakta olan ana arı işletmelerinin moleküler
yöntemlerle 32 primer (Solignac, 2003) kullanılarak genetik çeşitliliği tespit edilmeye
çalışılacaktır. Böylece ana arı satışlarıyla meydana gelebilecek gen karışıklıklarının düzeyleri
hakkında bilgi sahibi olunabilinecek ve ülkemizin sahip olduğu genetik çeşitliliği koruma
amacıyla yapılacak çalışmalara veri sağlanmış olunacaktır.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Kiraz Tozlaşmasında Bal ve Bombus Arısı
Kullanılmasının
Verim
ve
Kaliteye
Etkisinin Belirlenmesi
Ege Tarımsal Araştırma Enstitüsü
Müdürlüğü
TAGEM
Erkan TOPAL
Prof. Dr. Banu YÜCEL
Engin ALTUNOĞLU
Üzeyir KARACA
Mustafa KÖSOĞLU
Yıldız AYTUĞ
01.01.2015 - 30.12.2016
25.000
PROJE ÖZETI:
Önemli bir ihracat ürünü olan kiraz, ülkemizin dünya üretiminde lider olduğu ürünler
arasında yer almaktadır. İzmir ili Türkiye kiraz üretiminde %13’lük payla 1.sırada yer
almaktadır. Kirazın ilk hasad edildiği bölge olan Kemalpaşa; İzmir kiraz üretiminin %88’ini
karşılayan en büyük kiraz üreticisi ilçe olup Türkiye üretiminin %11,4’ünü tek başına
gerçekleştirmektedir (Tüik, 2012).
Kiraz yetiştiriciliğinde karşılaşılan en önemli sorunlarından biri tozlaşma ve döllenme
sorunudur. Kiraz bilindiği üzere kendine uyuşmazlık gösterir. Kiraz bahçesi tesis edilirken
tozlayıcı çeşitler bahçede mutlaka yer almalıdır. Optimum tozlaşma ve döllenmeye bağlı olarak
istenilen verime ulaşılması için tozlayıcı çeşitle birlikte polinatör olarak da arıların bahçe
ortamında bulunması gerekmektedir. Kiraz yetiştiriciliğinde çiçeklenme döneminde kimyasal
ilaçlar oldukça yoğun olarak kullanılmaktadır. Bu durum ister istemez tozlaşmada görev alan
balarıları için ölümcül tehlikeler doğurmaktadır. Meyve üreticileri kimyasal uygulamaları ile
doğal yaşamın önüne geçmekte, arı-bitki ilişkisini engellemektedirler.Proje ile arıcılara arı
ürünleri dışında da para kazanma imkânı doğacaktır. Meyve üreticisinindeoptimum tozlaşma
ile verim ve kalitede iyileşme sonucunda gelirinde artış sağlanmış olacaktır.
Bu proje kapsamında, kiraz tozlaşmasında balarıları ile bombus arılarının etkinliğini
belirlemek için arıcılık açısından; çiçek ziyaret sıklığı, polen yükü, tarlacı aktivitesi ve polen
mikroskobik olarak incelenecektir. Meyvecilik yönünden ise fenolojik gözlemler yapılacak,
meyve tutumu ve pomolojik özelliklere bakılarak kalite ve verime olan etkileri ortaya
konulacaktır.
PROJE ÖZETLERİ
Yeni Teklif
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Türkiye’de Paket Arıcılık Olanaklarının
Araştırılması
Ege Tarımsal Araştırma Enstitüsü
TAGEM
Mustafa KÖSOĞLU
Üzeyir KARACA
Prof. Dr. Banu YÜCEL
Erkan TOPAL
Prof. Dr. Gamze SANER
Doç.Dr. Hakan ADANACIOĞLU
Yrd. Doç. Dr. Devrim OSKAY
İsmail YILDIZDAL
01.01.2015 - 30.06.2017
174.650,00
PROJE ÖZETİ :
Proje başlığı, proje özeti ve anahtar kelimeler yazılmalıdır. Bu bölümde; çalışmanın
amaçları ve uygulanacak yöntemler ile hedef ve çıktılara ilişkin kısaca bilgi verilmelidir.
Özette, projenin Ar-Ge niteliği ile yaygın etkisine açıkça vurgu yapılmalıdır. Ayrıca nasıl
yürütüleceği (deneysel tasarım/yaklaşım, yöntemler, ekip, aşamalar ve zaman) özetlenmelidir.
Uzun süren sert kış koşulları, erken bahardaki ani hava değişimleri, arıcılıkta büyük
girdilere ve önemli kış kayıplarına neden olmaktadır. Bu nedenle, ılıman iklim koşullarına ve
zengin nektar kaynağına sahip bölgelerdeki arı üreticileri, sert kış koşullarının sürdüğü
yörelerdeki arıcılara arı satmaktadırlar. Çerçevesiz veya çerçeveli olarak satışı yapılan
kolonilere “paket arı” denir. Ülkemizde de özellikle ilkbaharda arı üretimine uygun olan Ege
Bölgesi arıcıları genellikle Trakya ve İç Anadolu Bölgesi’ne gitmektedirler. Projenin amacı,
erken ilkbaharda hızlı kuluçka gelişimi nedeniyle bu özelliğinden faydalandığımız Ege Bölgesi
arısından oluşturulan paket arıların, ağır kış koşullarının yaşandığı Trakya ve İç Anadolu’daki
arı kolonileri ile performanslarının karşılaştırılmasıdır. Çalışmada yapılacak ekonomik
analizle, paket arı üreticisi ile alıcısı açısından durumun karlılığı değerlendirilecektir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/11/13/02/01
Tavukçuluk Araştırma Enstitüsü’ndeki
Yumurtacı Saf Hatların Islahı ve
Bunlardan Ebeveyn ve Hibrit Elde Etme
Çalışmaları
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma İstasyonu
Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Dr. Hüseyin GÖGER
Yardımcı Araştırmacılar:
Dr. Cengizhan MIZRAK
Dr.Engin YENİCE
Ali Gazi BOĞA
Dr.İsmail DURMUŞ
Şahnur E.DEMİRTAŞ
Zafer ATİK
Şermin YURTOĞULLARI
Semih KOÇANAOĞULLARI
Turgay YILDIZ
Ender KARADEMİR
Dr.Züleyha KAHRAMAN
Zuhal DEMİR
Meltem CAN
Uğur YILDIRIM
Sunay DEMİR
Hüseyin AYGÖREN
Muhammet TUNCA
Serdar KAMANLI
Bülent TARIM
Murat DOĞU
M.Mustafa GÜRLE
Resmiye YÜCE
Başlama-Bitiş Tarihleri:
01.01.2011 – 31.12.2015
Projenin Toplam Bütçesi
4.565.000 TL
PROJE ÖZETİ :
Projenin amacı; verim seviyeleri yüksek hibritler için saf hatlardan başlayarak, ebeveyn
ve büyük ebevenler geliştirmektir.
Proje ile; saf hatların özelliklerinin bozulmadan korunması, populasyonların genişletilmesi ve
üzerinde durulan verim özelliklerinin daha iyi seviyelere çıkarılması hedeflenmektedir.
Proje, 1996 yılında başlayan ıslah projesinin devamıdır. Bu tür projeler süreklilik isteyen,
diğer bir deyişle bitmeyen projelerdir. Devam eden ana projeye ait 2003 ve 2010 yıllarında ara
rapor niteliği taşıyan sonuç raporları verilmiştir. Bu proje 2011 yılında başlamıştır ve 2015
yılında daha öncekilere benzer nitelikte sonuç raporu hazırlanarak gruba sunulacaktır.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/13/A-06/P-01/03
Enstitü Koşullarında Yetiştirilen Beyaz
Yumurtacı Saf Hat Horozlarda Sperma
Özellikleri ve Progesteron Seviyelerinin
Belirlenmesi
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma İstasyonu
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Şahnur E.DEMİRTAŞ
Yardımcı Araştırmacılar:
Dr.Hüseğin GÖĞER
Semih KOÇANAOĞULLARI
Şermin YURTOĞULLARI
Prof.Dr.Fatin CEDDEN
Barış ERTEKİN
Başlama-Bitiş Tarihleri:
01.04.2013 – 30.12.2014
Projenin Toplam Bütçesi
85.000 TL
PROJE ÖZETİ :
Bu çalışmada damızlık horozların spermatolojik özellikleri suni tohumlama öncesi düzenli
olarak incelenecek ve sperma özelliklerinin döllülük ve civciv çıkış gücüne olan etkileri
araştırılacaktır. Sperma abdominal masaj yöntemi ile toplanacaktır (Rouvier et al 1984). Proje
kapsamında, ejekülat hacmi, hareketlilik, motilite, sperma yoğunluğu ve anormal spermatozoid
oranları belirlenecektir. Horoz spermalarının incelenmesi Tekin, (1994) tarafından geliştirilen
yönteme göre yapılacaktır. Ayrıca kan ve seminal plazma progesteron seviyeleri
belirlenecektir. Spermatolojik özellikleri belirlenen horozlardan alınan spermalar suni
tohumlama ile tavuklara verilerek bu tavukların yumurtalarında döllülük ve çıkış gücü tespit
edilecektir. Spermatolojik incelemeler 4 haftada bir kez olmak üzere 4 defa yapılacaktır ( 28,
32, 36, 40, 44 ve 48. haftalarda).
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/11/13/02/03
Tavukçuluk
Araştırma
Enstitüsü’nde
Bulunan Saf Hatlardan Kanat Tüylenme
Hızına Göre Cinsiyet Ayırımına İmkan
Sağlayan Soyların Geliştirilmesi
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma İstasyonu
Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Şahnur E. DEMİRTAŞ
Yardımcı Araştırmacılar:
Dr.Hüseyin GÖĞER
Dr.İsmail DURMUŞ
Şermin YURTOĞULLARI
Başlama-Bitiş Tarihleri:
01.06.2011 – 31.12.2014
Projenin Toplam Bütçesi
750.50 TL
PROJE ÖZETİ :
Türkiye yılda yaklaşık 400 bin adet parent düzeyinde yumurtacı damızlık ithal
etmektedir. Bunun tamamı olmasa bile, önemli bir bölümünün yerli üretimle karşılanması
imkânını yaratmak için 1995 yılında Kanada’dan 10 adet saf hat ithal edilmiştir. Bu tarihten
itibaren yürütülen ıslah çalışmalarıyla ticari işletmelerin ihtiyaçlarına cevap verebilecek verim
seviyesi ve özelliklerine sahip 3 hibrit materyal geliştirilmiştir (Mızrak ve ark, 2007). Bir
yandan bunların nitelikleri artırılmaya çalışılırken diğer yandan da yeni genotipler elde etmeye
yönelik çalışmalar devam etmektedir. .
Tavukçulukta hem damızlık üretimi aşamasında, hem de yumurta üretiminde civciv
cinsiyetinin bilinmesi istenir. Günümüzde cinsiyetin tespiti kloaka bakılarak, kanat tüylenme
hızından, tüy ve ayak renginden yapılabilmektedir. Kloaka bakarak cinsiyet tespiti, bu işe özel
yetiştirilmiş uzman kişilerce yapılmaktadır. Buna rağmen civcivlerin hırpalanmasına neden
olan uygulamanın hem cinsiyeti doğru tespit etme yüzdesi görece düşük, hem de birim
zamanda değerlendirilebilen civciv sayısı nispeten azdır. Bu olumsuzluklar diğer cinsiyet tespit
yöntemlerinden kanat tüylenme hızı ve tüy rengine göre cinsiyet ayırma işlemini önemli hale
getirmiş ve bunların kullanımı yaygınlaşmıştır.
Cinsiyet ayırımının kanat tüylenme hızı veya tüy rengine göre yapılabilmesinin ilk koşulu bunu
sağlayacak soyların geliştirilmesidir. Daha önce yapılan ön çalışmalar ve hatları geliştirenlerin
ifadelerine göre Tavukçuluk Araştırma Enstitüsünde bulunan 3 saf hatta (Rhode Island Red I,
Barred Rock I ve Line 54) kanat tüylenme hızına göre cinsiyet ayırımına imkan verecek
genetik varyasyon bulunmaktadır. Ayrıca baba hattı olarak tasarlanan Rhode Island Red I
hattının diğer hatlarla (ana hatlarıyla) melezlenmesiyle elde edilen hibrit materyalde tüy
rengine göre cinsiyet ayırımı yapılabilmektedir. Özetle erkek ve dişi ayrımı saf hatlarda kloaka
bakılarak, hibritlerde de tüy renginden gerçekleştirilmektedir. Mevcut uygulama ebeveyn
aşamasında yukarıda sayılan olumsuzluklara ek olarak, hibritleri verecek yumurtalar başka
işletmelerde elde edildiğinde, saf hatların kurumun malı olarak korunmasını da riske
atmaktadır.
PROJE ÖZETLERİ
Devam Eden
Proje No:
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
TAGEM/HAYSUD/14/06/01/02
Yumurtacı Damızlık Kafeslerinde Farklı
Yerleşim Sıklığı ve Horoz Sayısının
Performans Üzerine Etkileri
Tavukçuluk Araştırma İstasyonu
Müdürlüğü
TAGEM
Murat DOĞU
Semih KOÇANAOĞULLARI
Sunay DEMİR
Bülent TARIM
Diydem DOĞAN
30/07/2014 - 31/12/2015
47.700 TL
PROJE ÖZETİ :
Bu projede, yumurtacı damızlıklarda farklı yerleşim sıklığı ve horoz sayısının
performans üzerine etkilerini saptamak amaçlanmıştır. Hayvan materyali olarak 1200 adet
Barred Rock-Ι ana hattı ile 120 adet Rhode Island Red-Ι baba hattına ait horoz damızlıklar
kullanılacaktır. Proje taban alanı 120x450 cm olan batarya tipi kafeslerde iki ayrı deneme
şeklinde yürütülecektir.
Deneme 1’de hayvan başına 1018,9 ve 683,6 cm2 olacak şekilde sırayla 53 ve 79 adet hayvan
yerleştirilecektir. Deneme 2’de ise, yine aynı tip kafeslere sırayla 60:5, 60:6 ve 60:7
oranlarında tavuk:horoz koyulacaktır. Kafeslerin alanı hayvan başına yaklaşık, 830.8, 806 ve
794.1 ve cm2 olacak şekilde yerleştirilecektir.
Denemelerde her bir gruptaki günlük yumurta ve ölü miktarları, kırık-çatlak ve kirli yumurta
oranları, 20, 32, 42 ve 52. haftalardaki canlı ağırlığı, yumurta ağırlığı, kuluçkalık yumurta
oranı, kuluçka sonuçları hesaplanacaktır.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSUD/14/06/02/01
Aspir Tohumu Küspesinin Yumurta
Tavuğu Yemlerinde Kullanım Olanakları
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma İstasyonu
Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Meltem GÜLTEKİN
Yardımcı Araştırmacılar:
Dr. Engin YENİCE
Dr. Züleyha KAHRAMAN
Barış ERTEKİN
Başlama-Bitiş Tarihleri:
01.07.2014 – 31.12.2015
Projenin Toplam Bütçesi
20000
PROJE ÖZETİ :
Projede, yumurta tavuğu rasyonlarına ilave edilen farklı oranlardaki aspir tohumu
küspesinin, performans, yumurta kalitesi, kan ve yumurta kolesterol içeriklerine etkilerinin
belirlenmesi amaçlanmıştır. Bu amaçla, hayvan materyali olarak Tavukçuluk Araştırma
İstasyonu Müdürlüğünde bulunan 24 haftalık yaşta, toplam 240 adet Atak-S hibrit kahverengi
yumurtacı tavuk kullanılacaktır.
Yem materyali olarak tavuklara % 16.50 HP ve 2750 kcal/kg metabolik enerji içeren yumurta
tavuğu yemleri verilecektir. Yem karmaları izokalorik ve izonitrojenik olarak hazırlanacaktır.
Aşağıda verilen 4 farklı yem, özel bir yem fabrikasında hazırlanacaktır. 1: Kontrol grubu (% 0
Aspir tohumu küspesi); 2: % 4 Aspir tohumu küspesi; 3: % 8 Aspir tohumu küspesi; 4: % 12
Aspir tohumu küspesi.
PROJE ÖZETLERİ
Devam Eden
Proje No:
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
TAGEM/HAYSUD/14/06/02/03
Antikoksidiyal
Monensin
Yerine
Tamamen veya Kısmen Kekik Esansiyel
Yağı İkamesinin Eimeria spp ile Enfekte
Edilmiş Etlik Piliçlerin Performans, Dışkı
ile Oosit Atımı, Lezyon Skoru ve Oksidatif
Stres Üzerine Etkisi
İncir Araştırma İstasyonu Müdürlüğü
TAGEM
Gökhan EGE
Doç. Dr. Mehmet BOZKURT
Prof. Dr. Kamil SEYREK
Yrd. Doç. Dr. Hasan AKŞİT
Yrd. Doç. Dr. Nuran SELEK
Dr. Fethiye ÇÖVEN
Erol BİNTAŞ
Bahattin KOÇER
Mustafa ÇINAR
01/01/2014 - 31/12/2015
49.000 TL
PROJE ÖZETİ :
Koksidiyozis, Eimeria türü protozoonlar tarafından tüm evcil hayvanlarda oluşturulan
bulaşıcı paraziter bir hastalık olup hayvan sağlığı ve verimleri üzerinde önemli ekonomik
kayıplar oluşturmaktadır. Hayvanların genel sağlık durumu kondisyonlarındaki kötüleşmenin
yanısıra iştahta azalma, verimlerde düşüş ve nihayet ciddi vakalarda ölümdeki artışlar
koksidiyozis ile bulaşık sürülerde tespit edilen başlıca semptomlardır. Ekonomik açıdan
değerlendirildiğinde broiler ve sığır yetiştiriciliğindeki koksidiyoz vakalarının sebep olduğu
ekonomik kayıpların yıllık tutarının 1-1,5 milyar dolar civarında olduğu görülmektedir.
Koksidiyozis’ den korunmak ve kanatlı hayvan yetiştiriciliğinde sebep olduğu ekonomik
kayıpları azaltmak amacıyla antikoksidiyal ilaçlar (koksidiyostatlar) çok uzun bir süredir
düzenli ve başarılı olarak kullanılagelmektedir.
Ancak kullanılan
koksidiyal ilaçlara dayanıklı Eimeria türlerinin ortaya çıkması ve antibiyotikli yem katkılarına
karşı gelişen kamuoyu tepkisi antikoksidiyal yem katkılarının 2016 yılından itibaren
yasaklanmasını gündeme getirmiştir. Bu yöndeki gelişmeler antikoksidiyal ilaçlara alternatif
metodların bulunması konusunda bütün dünyada hızlı arayışlara gidilmesine yol açmıştır.
Ancak tıbbi-aromatik bitkilerin esansiyal yağları antiprotozoal özelliğe sahip olmasına karşın
antibiyotikler kadar kadar etkili değillerdir
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
TAGEM/HAYSUD/14/06/02/04
Öğünlü Yemleme ve Otlamanın Serbest
Otlaklı
Sistemde
Yetiştirilen
Etlik
Piliçlerde Performans, Et Kalitesi ve
Kemik Mekanik Özellikleri Üzerine
Etkileri
İncir Araştırma İstasyonu Müdürlüğü
TAGEM
Bahattin KOÇER
Doç. Dr. Mehmet BOZKURT
Yrd. Doç. Dr. Kamil KÜÇÜKYILMAZ
Gökhan EGE
Abdullah Uğur ÇATLI
Mustafa ÇINAR
Serdar KAMANLI
Erol BİNTAŞ
Alper YILMAZ
Ramazan KONAK
01.01.2014 – 31.12.2016
66.000 TL
PROJE ÖZETİ :
Son yıllarda serbest otlaklı sistemde hayvansal üretime tüm dünyada giderek artan bir ilgi
oluşmaktadır. Serbest otlaklı sistemde kanatlı hayvan üretiminin de yaygınlaşmasına karşın
hayvan refahı, üretim performansı ve et kalitesi üzerine otlamanın önemi yeterince
incelenmemiştir. Otlak alanında kaliteli bitki örtüsünün tesis edilmesinin serbest otlaklı
sistemde etlik piliç yetiştiriciliği için verimliliği destekleyici ve tasarruf sağlayan bir yöntem
olduğu düşünülmektedir. Çünkü bitki örtüsü ilave makro ve mikro besin maddelerinin alımına
olanak vererek piliçlerin otlama alanından optimum yararlanmasını sağlamaktadır. Bu da
çiftliklerin mevcut kaynaklarından daha etkin yararlanmasına imkan verirken yem
maddelerinden tasarruf edilmesine olanak sağlamaktadır.
Modern broiler hibritleri yüksek büyüme performansının yanı sıra rasyonel yem dönüşüm
oranına ve et verimine sahiptirler. Ancak piliçlerin yüksek performans hedeflerine ulaşırken,
metabolik bozuklukların sıklığında önemli artışlar gözlenmiştir. Verimlilik ve karlılıkta önemli
kayıplara neden olan bu tür beklenmedik sağlık problemleri aşırı yem tüketimi ve buna ilişkin
yüksek metabolizma hızıyla yakından ilgilidir. Yem sınırlama programları bu tür sağlık
problemlerinin azaltılması ve yağsız vücut kitlesine sahip yüksek performanslı piliçlerin
yetiştirilmesi açısından tavsiye edilmektedir. Bu anlamda üretici ve tüketici beklentilerinin
karşılanması açısından bitki örtüsü ve öğünlü besleme uygulamalarının kombinasyonun
eklemeli avantajlar sağlayabileceği düşünülmektedir.
PROJE ÖZETLERİ
Devam Eden
Proje No:
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
TAGEM/HAYSUD/14/06/02/02
Zorlamalı
Tüy
Döktürülen
Ve
Döktürülmeyen İleri Yaştaki Yumurtacı
Tavukların Yemlerine Prebiyotik ve Kekik
Yağı İlavesinin Yumurta Verimi ve
Kalitesi, Bağışıklık, Kan Parametreleri,
Bağırsak Mikroflorası İle Kemik Kalitesi
Üzerine Etkileri
İncir Araştırma İstasyonu Müdürlüğü
TAGEM
Doç. Dr. Mehmet BOZKURT
Prof. Dr. Kamil SEYREK
Doç. Dr. Şükrü KIRAN
Yrd. Doç. Dr.Kamil KÜÇÜKYILMAZ
Yrd. Doç. Dr. Hasan AKŞİT
Yrd. Doç. Dr. Serap SAVAŞAN
Dr. Fethiye ÇÖVEN
Abdullah Uğur ÇATLI
Gökhan EGE
Mustafa ÇINAR
01.01.2014 – 21.12.2015
66.000 TL
PROJE ÖZETİ :
Zorlamalı tüy döktürme yumurtacı tavuk işletmelerinde uygulanan genel bir manejman
tekniğidir ve önemli bir stres faktörüdür. Uzun süreli açlığın tavuklar üzerinde oluşturduğu
sarsıntı etkisi nedeniyle hücresel bağışıklık sisteminin cevap yeteneği azalmakta, karaciğer,
dalak ve ovaryum da zoonotik patojen popülasyonu artmaktadır. Bu durum zorlamalı tüy
döktürmeye tabi tutulan sürülerde özellikle Salmonella Enteritidis enfeksiyonlarının
yaygınlaşmasına da sebep olarak hayvan ve insan sağlığını olumsuz yönde etkileyebilmektedir.
Antibiyotiklerin yeme katılmasının yasaklandığı günümüz koşulları altında yapılan çok sayıda
in vitro çalışma ile antimikrobiyal etkinlikleri kanıtlanan prebiyotik, probiyotik ve bitkisel
ekstraktlardan yararlanabilmek büyük önem arz etmektedir. Zira bu preparatlardan (prebiyotik
ve esansiyal yağlar) in vivo koşullarda antimikrobiyal anlamda etkin şekilde yararlanma
imkânının gösterilebilmesi, hayvan sağlığı açısından olduğu kadar insan sağlığı açısından ciddi
bir tehdidin azaltılması anlamına gelecektir. Sahip oldukları diğer etki mekanizmaları da
dikkate alındığında, bu tür preparatların kalıntı ve direnç problem oluşturmaksızın yumurta
verim performansını ve yumurta kalitesini destekleyerek yumurtacı tavuklardan maksimum
sürede faydalanmayı sağlaması beklenmektedir. Bu çalışmanın amacı maya kültürü bir
prebiyotik ve kekik esansiyel yağının yeme ilavesinin zorlamalı tüy dökümü yapılan veya
yapılmayan ileri yaştaki yumurtacı tavukların yumurta verim performansı ve kalitesi, kimi
bağışıklık ve stres parametreleri, bağırsak mikroflorası ve kemik kalitesi üzerine etkilerini
ortaya koymaktır.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSUD/12/06/02/01
Karma Yem Partikül Büyüklüğü ve Yem
Formunun Sıcak İklim Koşullarında
Yetiştirilen Beyaz Yumurtacı Tavukların
Verim Performansı, Yumurta Kalitesi ile
Tüylenme Skoru ve Bazı İç Organ
Ölçümleri Üzerine Etkileri
Projeyi Yürüten Kuruluş:
İncir Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Bahattin KOÇER
Yardımcı Araştırmacılar:
Doç. Dr. Mehmet BOZKURT
Yrd. Doç. Dr. Kamil KÜÇÜKYILMAZ
Yrd. Doç. Dr. Hasan AKŞİT
Abdullah Uğur ÇATLI
Mustafa ÇINAR
Erol BİNTAŞ
Sabri TOPBAŞ
Başlama-Bitiş Tarihleri:
01.01.2012 – 31.12.2013
Projenin Toplam Bütçesi
36.000 TL
PROJE ÖZETİ :
Sıcak stresinin etkileri piliçler, hindiler ve yumurta tavukları üzerindeki olumsuz etkileri
yapılan bilimsel çalışmalarla gösterilmiştir. Hayvan üzerindeki fizyolojik etkilerinin yanı sıra
yüksek çevre sıcaklıkları yumurtacı tavukların verim performansı üzerinde de önemli
ekonomik kayıplara neden olmaktadır. Sıcaklık stresi yem tüketiminde neden olduğu azalmaya
bağlı olarak canlı ağırlığı, yumurta ağırlığını ve yumurta kabuk kalitesini düşürmekte, yem
tüketimindeki azalma yumurta verimindeki azalmanın da başlıca nedeni sayılmaktadır. Küresel
ısınma sıcaklık stresinin olumsuz etkilerini daha da artırmaktadır. Bu nedenle tavukçuluk
endüstrisi sıcaklık stresinin olumsuz etkilerini azaltmak amacıyla yoğun çalışmalar
yürütmektedir.
Değişik manejman önlemlerinin yanı sıra kümes içi sıcaklığının olumsuz etkilerinin
azaltılması amacıyla beslemeyle ilgili kimi yöntemlerde araştırılmaktadır. Bu konuda
başvurulabilecek pratik çözümlerden biriside yem formunda yapılacak değişiklerdir. Sıcak
stresinin yem tüketimini azaltıcı yöndeki etkisi toz yerine granül veya pelet formda yemlerin
verilmesiyle nispeten hafifletilebilmektedir. Granül ve pelet yemler birim hacimde daha fazla
besin maddesi içerdiklerinden dolayı günlük besin madde alımını artırmaktadırlar.
Bu çalışmanın amacı sıcak çevre koşullarında yetiştirilen yumurtacı tavuklara iki farklı
partikül büyüklüğündeki toz form yerine pelet veya granül formda hazırlanacak yemlerin
verilmesinin yem tüketim davranımları, günlük besin madde alımları ile performans, yumurta
kalitesi, tüylenme skoru ve bazı iç organ ağırlıkları üzerine oransal olarak etkilerini
incelemektir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSUD/12/06/01/01
Doku Kültürü Medyumu’na Katılan
Trehaloz, Sistein ve Dithioerythritol
Antioksidanları İle Horoz Spermasının
Dondurulması
Projeyi Yürüten Kuruluş:
Hayvancılık Merkez Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Dr. Hüseyin KİNET
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
15.05.2012 - 01.01.2015
25.000 TL
PROJE ÖZETİ :
Bu projede, Lalahan Hayvancılık Merkez Araştırma Enstitüsü Tavuk Yetiştirme
Şubesindebulunan en az 30-70 haftalık yaşta 7 adet horoz ve suni tohumlamalar için 40 adet
tavuk kullanılacaktır. Horozlar sperma vermeye alıştırıldıktan sonra, abdominal masaj
yöntemiyle haftada 3 defa 1’er ejakülat alınacaktır. Elde edilen normo-ejakülatlar
kullanılacaktır. Horozlardan alınan normo-ejakülatlar birleştirildikten sonra eşit olarak dörde
bölünecek ve sırasıyla, birinci gurup içinde sadece doku kültürü medium’u (TCM) bulunan
sulandırıcı ile sulandırılarak kontrol gurubunu oluşturacaktır. Diğer 3 grup ise içerisine
antioksidan olarak trehaloz, sistein ve dithioerythritol antioksidanları eklenmiş doku kültürü
medium’u ile sulandırılacaktır. Kriyoprotektan olarak %5 oranında Dimethilsulfoksit (DMSO)
eklenecektir. Kontrol grubu antioksidansız ve diğer gruplar içerisine sırasıyla 25 mMTrehaloz,
5 mMSistein, 1 mMDithioerythritol antioksidanları katılmış, TCM sulandırıcıları ile
sulandırılarak her bir payette 250x106spermatozoa olacak şekilde dozlanacaktır. Sulandırılan
spermalar ekilibrasyonu takiben 0.25 ml’lik payetlere çekilerek, kontrollü dondurma cihazında
dondurulacak ve sıvı azot (-1960C) içinde saklanacaktır. Dondurma ve çözdürme arasında en
az 24 saat zaman farkı olacak şekilde payetler çözdürülerek spermatolojik parametreler
yönünden değerlendirilecektir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
TAGEM/HAYSÜD/14/06/02/05
Bal Arılarının (Apis Mellifera L.)
Beslenmesinde Kullanılan Şuruba Farklı
Düzeylerde Çinko İlavesinin Larva Kabul
Oranı, Larva Ağırlığı Ve Arı Sütü Verimi
Üzerine Etkisi İle Arı Sütündeki
Miktarının Araştırılması
Arıcılık Araştırma İstasyonu Müdürlüğü
TAGEM
Ümit KARATAŞ
Prof. Dr. Ahmet GÜLER
Gökhan AKDENİZ
Dilek KABAKCI
Hasan ESE
Ümit KAYABOYNU
Hayriye ŞEREFOĞLU
Nazlı Pınar CANVERDİ
Ömer YILMAZ
01/01/2014 - 31/01/2014
65.000 TL
PROJE ÖZETİ :
Bu araştırmada bal arısı kolonilerini (Apis Mellifera L.) çinko ile beslemenin larva kabul
oranı,larva ağırlığı arı sütü verimi üzerine etkileri ve arı sütüne geçen çinko miktarı
araştırılacaktır. Bu amaçla 24 adet başlatıcı kolonisi 4 gruba ayrılacak ve her gruba da 12’şer
destek kolonisi olmak üzere toplam 72 adet koloni ile araştırma yürütülecektir.
Araştırmada larva kabul oranı, larva ağırlığı, arı sütü verimi ve arı sütündeki çinko miktarı
incelenecektir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/ HAYSÜD / 13 / A-06/P-01/05
Bal Arısının (Apis mellifera L.) Bademin
Polinasyonuna Etkisinin Araştırılması
Projeyi Yürüten Kuruluş:
Arıcılık Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Gökhan AKDENİZ
Yardımcı Araştırmacılar:
Prof. Dr. Ahmet GÜLER
Prof. Dr. Yeşim OKAY
Ajlan YILMAZ
Ahmet KUVANCI
Şeref CINBIRTOĞLU
Dr. İzzet ACAR
Başlama-Bitiş Tarihleri:
01.01.2013 - 31.12.2014
Projenin Toplam Bütçesi
35.000 TL
PROJE ÖZETİ :
Bademin anavatanı arasında yer alan Türkiye’de badem üretim alanları hızlı bir şekilde
artmaktadır. Badem bahçelerinden bol ürün alabilmek için en az 2-3 çeşidin çiçeklerinin
karşılıklı olarak tozlanması esastır. Ticari badem yetiştiriciliğinde en önemli husus başarılı bir
tozlanmanın sağlanmasıdır. Badem tozlanmasında en etkili polinatör balarılarının olduğu
bilinen bir gerçektir.
Tarımda gelişmiş ülkeler, bitkilerde tozlaşmanın optimum düzeyde olmasına çok önem
vermişlerdir. Türkiye yaklaşık 5,6 milyon koloni varlığı ile büyük bir arıcılık potansiyeline
sahip olmasına rağmen, bal arısı tozlaşmada yaygın bir şekilde ve bilinçli olarak
kullanılmamaktadır. Bu nedenle arı ürünlerinden sağlanan gelirden yüzlerce kat daha fazla bir
ekonomik kayıp söz konusudur. Meyve yetiştiriciliğinde amaç bol ve kaliteli ürün elde
etmektir. Bunu sağlamanın önemli bir yolu da tozlaşma ve döllenme olaylarının sağlıklı bir
şekilde gerçekleşebilmesidir.
Bademinde içerisinde yer aldığı sert kabuklu meyve türlerinin tümünde tozlaşmanın ve
döllenmenin yetersiz olduğu durumlarda içli meyve tutumu gerçekleşmez ve meyve
tutumundan söz edilemez. Bu nedenle, badem benzeri meyve türlerinde döllenmenin,
dolayısıyla içli meyve tutumunun ön koşulu olan tozlanma aşamasının çok etkin bir biçimde
gerçekleşmesi gerekmektedir.
Badem benzeri meyve türlerinin tozlaşmasında bal arılarının önemi oldukça büyüktür. Hatta
meyve bahçelerinde tozlanma zamanında çevredeki arı faaliyetlerinin yoğunluğu dikkate
alınarak belli oranlarda arı kovanı bulundurulması önerilmektedir.
Bu yaklaşımdan yola çıkılarak planlanan araştırmada, bal arıları(Apis mellifera L.)’nın
Kilis ekolojik şartlarında yetiştirilen badem ağaçlarının tozlaşmasına, meyve verim ve kalitesi
üzerine olan etkilerinin araştırılması amaçlanmıştır.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/13/A-06/P-01/04
Fazelya (Phaceliatanacetifolia B.), Engerek
Otu(Echiumvulgare L.) Ve Çayır Üçgülü
(Trifoliumpratense L.) Bitkileri Arasında
Arı Tercihinin Araştırılması
Projeyi Yürüten Kuruluş:
Arıcılık Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Ahmet KUVANCI
Yardımcı Araştırmacılar:
Ahmet KUVANCI
Nurdoğan YAŞAR
Ümit KAYABOYNU
Muzaffer DUMAN
Fatih ALAY
Yrd. Doç. Dr. Metin DEVECİ
Başlama-Bitiş Tarihleri:
01/01/2013 - 31/12/2013
Projenin Toplam Bütçesi
16.500 TL
PROJE ÖZETİ :
Bu araştırmada Fazelya (Phaceliatanacetifolia B.), Engerek Otu (EchiumvulgareL.) ve
Çayır Üçgülü (TrifoliumPratense L.) bitkilerinin 3 parsele ekimleri yapılacaktır. Parseller
yanına bal arısı kolonisi konulmak suretiyle; bal arılarının nektar kaynağı bu bitkiler üzerindeki
tarlacılık tercihi ve bu bitkileri ne yoğunlukta polen kaynağı olarak kullandığı saptanacaktır.
Araştırma sonucunda elde edilecek veriler; bu bitkilerin yetiştiği yerlere arı tercihine göre
arı kolonilerinin konulmasına, arıların ilgisini çeken bitkilerin ekim alanlarının artırılmasındaki
planlamalara ve arı mer’aları tesis edilmesi suretiyle, bu bitkilerin doğal yayılış alanlarının
düzenlemesinde yapılacak planlamalara yardımcı olacaktır.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/13/A-06/P-02/02
Bal Arısı (Apis mellifera L.) Kolonilerinde
Farklı Oranlarda Şeker Şurubu Verilerek
Yapılan Besleme Yöntemleri İle Üretilen
Balların Ayırt Edilmesinde Kullanılacak
Fiziksel,
Kimyasal
ve
Palinolojik
Kriterlerin Araştırılması
Projeyi Yürüten Kuruluş:
Arıcılık Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Muzaffer DUMAN
Yardımcı Araştırmacılar:
Ümit KAYABOYNU
Nurdoğan YAŞAR
Ergül SARIKAYA
Mehmet YILMAZ
Fazıl GÜNEY
Fatih YILMAZ
Emre KARMAZ
Ömer YILMAZ
Tahsin DEMİR
Yrd.Doç.Dr. Bekir DEMİRTAŞ
Başlama-Bitiş Tarihleri:
01/01/2013 - 30/06/2014
Projenin Toplam Bütçesi
58.725 TL
PROJE ÖZETİ :
Koloni varlığı ve bal üretimiyle dünya sıralamasında ilk sıralarda yer alan Türkiye sahip
olduğu bitki örtüsü ve farklı iklim koşullarıyla dünyanın en kaliteli ballarını üretebilecek
durumdadır. Türkiye’de 5.602.669 koloni ile 81.115 bin ton bal üretilmekte olup koloni başına
ortalama verim 14.478 kg’dır. (TUİK 2010) Türkiye’de üretilen balların hepsi, bal tebliğine
göre üretilmemektedir. Bal Tebliğinde ifade edilen bal üretim yöntemi haricinde, üretim
döneminde farklı besleme yöntemleri ile üretilmiş ballar hatta bala benzeyen yapıda ürünler,
piyasada bal olarak bulunmakta ve satılmaktadır.
Türkiye’de yürürlükte olan yasal kıstaslar ile farklı besleme yöntemleri ile üretilen balların
ayırt edilmesi pratik olarak yapılamamaktadır. Ayrıca balda yapılan analizlerden hangi kıstasın
ayırt edici olduğu söylenememektedir. Sonuç olarak yapılan çalışmalar ilgilileri tatmin edici
sonuçlar ortaya koyamamaktadır. Bu çalışma ile farklı besleme yöntemleri ile üretilen balların
ayırt edilmesinde kullanılabilecek kıstasların ortaya konulmasına çalışılacaktır.
PROJE ÖZETLERİ
Devam Eden
Proje No:
Proje Başlığı:
TAGEM/ HAYSÜD / 13 / A-06/P-02/01
Bal Arılarında (Apis mellifera L.)
Transgenik Soya Unu Kullanımının
Performans
ve
Davranış
Üzerine
Etkilerinin Araştırılması
Projeyi Yürüten Kuruluş:
Arıcılık Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Gökhan AKDENİZ
Yardımcı Araştırmacılar:
Yrd. Doç. Dr. Devrim OSKAY
Feyzullah KONAK
Ahmet KUVANCI
Dilek KABAKCI
Fevzi AKSOY
Ümit KARATAŞ
Fatih YILMAZ
Emre KARMAZ
Başlama-Bitiş Tarihleri:
01.01.2013 – 31.05.2015
Projenin Toplam Bütçesi
59.900 TL
PROJE ÖZETİ : Arı kolonilerinin ana nektar akımına kuvvetli bir işçi arı populasyonu ile
girebilmeleri, yavru üretimini sürdürebilmeleri ve bunun sonucunda beklenen bal üretimini
gerçekleştirebilmeleri için, kolonilere ek besleme yapılarak nektar akım dönemine hazırlanmaları
gerekmektedir. Bunun yanı sıra Arı kolonileri elverişsiz hava koşullarında ve nektar
yetersizliğinde; petek işleme, yavru yetiştirme, oğul üretim dönemlerinde; teknik olarak paket arı
ve ana arı yetiştirme mevsiminde; kışa giriş döneminde ve erken ilk baharda, polinasyonda
kullanılacak kolonilerin hazırlanmasında, bal mevsimi öncesinde kolonilerin yavru üretiminin
teşvik edilmesinde ve zirai mücadele ilaçlarından zarar gören kolonilerde dengeyi sağlamak
amacıyla ek besleme (şurup, kek) uygulanması zorunlu olmaktadır.
Bu araştırmada, transgenik yağsız soya unu, yağsız soya unu ve polenli olarak üretilen
keklerin kolonilerin performans ve davranış özellikleri üzerine etkileri değerlendirilecektir. Bu
amaçla 48 adet koloni 4 gruba ayrılacak ve her grupta 12’şer arı kolonisi olacak şekilde araştırma
yürütülecektir.
Araştırmada kolonilerin yaşam gücü, populasyon gelişimi, kuluçka üretim etkinliği, petek
işleme yeteneği, hırçınlık, uçuş etkinliği, bal verimi, kışlama yeteneği, yaşam süresi ve larvapupa Ağırlığı parametreleri incelenecektir. Nihai ürün olan balda ve kullanılan soya unlarında
Gdo Analizi yapılacaktır.
Bu çalışma ile Arıcılık konusunda transgenik ürünlerin kullanılmasının ne gibi etkiler
ortaya çıkaracağı yönünde yeteri kadar çalışma olmamasından dolayı, transgenik ürün ile
yapılacak ek beslemenin arılarda performans ve davranışsal özelliklere etkilerinin belirlenmesi
amaçlamaktadır. Bu amaç doğrultusunda araştırmanın, konu ile ilgili spekülasyonları ortadan
kaldırmak adına ilerleyen dönemlerde yapılması gerekli olan arı- transgenik bitki ilişkisi
çalışmalarına yön verebileceği düşünülmektedir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/14/06/01/02
Batı ve Orta Karadeniz Bal Arılarının (
Apis mellifera L.) Islahı
Projeyi Yürüten Kuruluş:
Arıcılık Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Feyzullah KONAK
Yardımcı Araştırmacılar:
Hasan ESE
Ahmet KUVANCI
Şeref CINBIRTOĞLU
Gökhan AKDENİZ
Muzaffer DUMAN
Dilek KABAKCI
Fatih YILMAZ
Ümit KAYABOYNU
Hayriye ŞEREFOĞLU
Nazlı Pınar CANVERDİ
Başlama-Bitiş Tarihleri:
01.01.2014 – 31.12.2018
Projenin Toplam Bütçesi
217.300 TL
PROJE ÖZETİ :
Teklif edilen yeni teklif proje ile önceki yıllarda yapılan ülkesel arıcılık projesini
materyal ve metodunda belirtilen değişikliler yapılarak devam edilecektir. Proje kapsamında
her iki yılda bir 200 adet ana arı üretilerek suni tohumlama yoluyla kontrollü çiftleştirmeleri
yapılmakta ve iki yılda bir indeks değerlerine göre bir sonraki yılın çekirdek sürüsü olarak 50
koloni seçilmektedir. Seçilen çekirdek sürüden yine 200 adet ana arı üretilerek aynı işlemler
tekrar edilerek 5 yıl boyunca ıslah edilmektedir. Projede ölçümler için bal verimi, kuluçka
üretim etkinliği, kışlama yeteneği gibi karakterler gözlemlenmektedir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/14/A06/01/06
Batı Ege Bölgesi Balarılarının (Apis
mellifera
L.)
Hijyenik
Davranış
Özelliklerinin Belirlenmesi ve Bu Özellik
Bakımından Populasyonların Geliştirilmesi
Projeyi Yürüten Kuruluş:
Ege Tarımsal Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Üzeyir KARACA
Yardımcı Araştırmacılar:
Uzm. Mustafa KÖSOĞLU
Vet. Hek. Oya BORAN
Vet. Hek. C. Tamer ŞENER
Tekniker İsmail YILDIZDAL
Başlama-Bitiş Tarihleri:
01.01.2014 - 30.12.2016
Projenin Toplam Bütçesi
600.000 TL
PROJE ÖZETİ :
Pek çok canlı türünde olduğu gibi balarılarını (Apis mellifera L.) da etkileyen, yaşama gücünü
ve verimini düşüren birçok hastalık, parazit ve zararlıları vardır. Balarısı enfeksiyöz ve
paraziter hastalıklarının tümü bulaşıcı nitelikte olup, önlem alınmadığı durumlarda arılık
içerisinde koloniden koloniye, arılıklar arasında ve gezginci arıcılık nedeniyle bölgeler
arasında yayılarak kısa bir süre içerisinde tüm ülke arıcılığını etkileyecek duruma gelmektedir.
Dünya çapında yaygınlaşan Amerikan yavru çürüklüğü (Paenibacillus larvae larvae), kireç
hastalığı (Ascosphaera apis) ve varroa (Varroa jacobsoni Qudemans) tüm dünya arıcılığının
temel sorunu haline gelmiştir. Bu hastalık ve parazitlerle mücadelede hâlihazırda sadece
kimyasal mücadele uygulanmaktadır. Fakat son yıllarda, kullanılan kimyasallara karşı bu
hastalık ve zararlı etmenlerinin direnç kazanmaya başladıkları bir çok çalışmada kanıtlanmıştır
(Faucon ve ark., 1995; Milani, 1995; Milani ve ark., 1995a, 1995b).
Yukarıda kısaca önemi vurgulanan problemler ve çözümüne yönelik hazırlanan bu projede
balarısı hastalık ve parazitlerine karşı dayanıklı bir hat oluşturulması hedeflenmiştir. Bu
çalışmada hijyenik davranış özellikleri belirlenen kolonilerin; koloni performansı, davranış,
hastalık ve zararlılara ilişkin özellikleri belirlenecek ve hijyenik davranış özelliği yıldan yıla
artırılmaya çalışılacaktır. Hastalık ve zararlılara karşı genetik dayanıklılığın göstergesi olarak
kabul edilen hijyenik davranış özelliği yönünden üstünlük gösteren koloniler belirlenecek ve
elde edilen bu ana arıların arıcılara dağıtılması sonucu da arıcıların daha az ilaç kullanmaları
sağlanarak sağlıklı arı ürünlerinin üretilmesi amaçlanmaktadır.
Ülkemizde hijyenik davranış özelliklerinin belirlenmesi konusunda çalışmalar vardır fakat
henüz tamamlanmış bir çalışma mevcut değildir. Bu nedenle bu çalışma ülkemizde konunun
gündeme getirilmesi bakımından bir başlangıç çalışması niteliğindedir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/ HAYSÜD/03/12/02/01
İzmir Yöresi Bal Arılarında (Apis Mellifera
L.) Saf Hat Oluşturma Çalışmaları
Projeyi Yürüten Kuruluş:
Ege Tarımsal Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Üzeyir KARACA
Yardımcı Araştırmacılar:
Uzm. Mustafa KÖSOĞLU
Vet. Hek. Oya BORAN
Vet. Hek. Tamer ŞENER
Yavuz YAVRUTÜRK
Tekniker İsmail YILDIZDAL
Başlama-Bitiş Tarihleri:
01.01.2014 - 30.12.2018
Projenin Toplam Bütçesi
600.000 TL
PROJE ÖZETİ :
Ülkemiz sahip olduğu zengin doğal bitki örtüsü ve bölgeden bölgeye farklılık gösteren
ekolojik yapısıyla, başta Anadolu ırkı olmak üzere değişik bal arısı ırk ve ekotiplerinin gen
merkezi durumundadır. Bu konuma ve arıcılığımızda son yıllardaki gelişmelere rağmen kovan
(koloni) başına ortalama bal verimi ancak 15 kg'a yükseltilebilmiştir. Oysa arıcılığı gelişmiş
pek çok ülkede koloni başına ortalama bal verimi 30 kg dolayında olup, dünya ortalaması ise
22 kg'dır. Ülkemizin flora zenginliği ve sahip olduğu büyük arıcılık potansiyeli dikkate
alındığında, koloni başına ortalama bal veriminin yükseltilmesi bir zorunluluktur.
Bal arılarının nektar toplama kabiliyetleri ve buna bağlı olarak da bal üretim
potansiyelleri, çok sayıda çevresel ve genetiksel etki altında ortaya çıkan oldukça karmaşık bir
özellik olmasına karşın, yetiştirme tekniklerinin geliştirilmesi yanında üstün özellikler
yönünden yapılacak seleksiyon, populasyon düzeyinde bal verimini artırmanın ilk ve temel
yöntemidir.
Bu projenin amacı; İzmir yöresi bal arılarının bireysel üstünlüklerine dayanan kitlesel
(mass) seleksiyon ile verimli bir hattın oluşturulması, bu hattan üretilecek damızlık koloni
ve/veya ana arıların bölge arıcılarına ulaştırılarak üretici düzeyinde koloni başına birim
üretkenliğin artırılması, bu çalışmadan sonra başlatılacak melezleme ve hibrit çalışmaları için
gerekli materyalin oluşturulmasıdır.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD
Damızlık
Yumurtalarda
Kuluçka
Sıcaklığının Kuluçka Performansı Civciv
Kalitesi ve Eşey Oranına Etkisi
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Diydem DOĞAN
Yardımcı Araştırmacılar:
Sunay DEMİR
Bülent TARIM
Murat DOĞU
Başlama-Bitiş Tarihleri:
30.02.2014-30.09.2014
Projenin Toplam Bütçesi
10.000 TL.
PROJE ÖZETİ :
Bu proje inkübasyonun 0-18 günü ile son 3 (18-21) gününde uygulanacak olan 3 farklı
sıcaklık uygulamasının (36, 37.7 ve 39 0C ) cinsiyet oranına ve kuluçka parametrelerine
etkisini belirlemek amacıyla yapılacaktır. Yumurtalar 30-41 haftalar arasında RIR1*BAR1
sürülerinden toplanacak ilk aşamada 0-18 günlerde farklı sıcaklık uygulamaları için 2700
yumurta yerleştirilecek, daha sonra son üç günde inkübasyon sıcaklığı değiştirilecek ve
kuluçka parametrelerinin sonuçları değerlendirilecektir
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/12/06/01/02
İn Vitro Koşullarda Balarısı ( Apis
Mellifera L.) Bireyleri Yetiştirilmesi,
Bunların
Gözlem
Kovanlarında
İncelenmesi Ve Arı Yetiştiriciliği İle Islahı
Bakımından
Kullanım
Olanaklarının
Araştırılması
Projeyi Yürüten Kuruluş:
Bahçe Kültürleri Araştırma İstasyonu
Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Cahit ÖZTÜRK
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
01.01.2012 – 01.01.2014
67.000 TL
PROJE ÖZETİ :
Genellikle karanlık bir ortamda yuva yapmayı tercih eden bal arıların yaşamı gözlem
kovanlarında incelendikten sonra onların yaşamları ve biyolojileri ile ilgili birçok detay ortaya
çıkmıştır. Doğal koşullarda yaşamları incelenen arıların koloni koşulları taklit edilerek
kontrollü veya yarı kontrollü koşullarda da üretileceği konusunda son 10 yıl içerisinde
yoğunlaşan çalışmalar in vitro koşullarda da arı bireylerinin elde edilebileceğini göstermiştir.
Ancak halen işçi arı ve özellikle erkek arı bireylerinin üretiminde bazı sıkıntılar giderilmeye
çalışılmaktadır. Çünkü arıların yavrularını beslerken işçi ve erkek arıları besleme programı
oldukça karmaşık ve hassastır. Ancak Tüm yaşamı boyunca arı sütü ihtiyacı olan ana arı
üretimi daha kolay yapılabilmektedir.
Yapılacak araştırma ile Türkiye de ilk defa in vitro koşullarda arı bireyleri
yetiştirilmeye çalışılacak bu amaçla yapılan çalışmalardaki diyetler esas alınarak uygun diyet
karışımları belirlenecektir. Ayrıca yetiştirilebilen arı bireyleri işaretlenerek gözlem
kovanlarında normal koşullarda yetişmiş arı bireyleri ile karşılaştırılacaktır. Yapılan
karşılaştırma da ortaya çıkacak benzerlikler ve ilişkiler ışığında in vitro arı yetiştiriciliğinin arı
yetiştiriciliğinde ve ıslahında kullanım olanakları konusunda projenin devamı niteliğinde yeni
projeler sunulacaktır.
Özellikle ana arı yetiştiriciliği ve erkek arı üretme olanaklarına bağlı olarak yetiştiricilik
ve ıslah çalışmalarında kullanma olanakları üzerinde yoğunlaşılacaktır. Ancak bunların dışında
son yıllarda dünya genelinde görülen büyük arı kayıplarının araştırılması, çeşitli çevre
koşullarının arılar üzerinde etkileri, bitkisel üretimde kullanılan kimyasalların arıların yaşamı
üzerine etkisi ve her türlü arıcılık girdilerinin arılar üzerinde daha somut olarak etkilerinin
belirlenmesi çalışmalarında kullanılabilecektir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/14/06/01/04
Doğu Akdeniz Bölgesi Koşullarında
Yetiştiriciliği Yapılan Balarısı (Apis
Mellifera L.) Kolonilerinde Hijyenik
Davranış Seleksiyonu İle Hastalık Ve
Parazitlere Karşı Dayanıklı Hat Geliştirme
Olanaklarının Araştırılması II
Projeyi Yürüten Kuruluş:
Bahçe Kültürleri Araştırma İstasyonu
Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Cahit ÖZTÜRK
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
30/03/2014 - 30/03/2017
94.000 TL
PROJE ÖZETİ :
Balarıları yüzyıllardır yeryüzünde değişen çevre koşullarına ve düşmanlarına karşı çok iyi
adapte olarak bazı savunma mekanizmaları geliştirmişlerdir. Yapılan araştırmalar arıların bazı
hastalık ve zararlılara karşı bazı savunma mekanizmaları geliştirdiklerini göstermiştir. Bu
mekanizmalardan en önemlisi bazı hastalık ve parazitlere karşı bazı savunma mekanizmaları
geliştirdiklerini göstermiştir. Bu mekanizmalardan en önemlisi bazı hastalık ve parazitlere
karşı arıların gösterdikleri hijyenik davranıştır. Ancak genetik olarak bu mekanizmayı
çalıştıran genler mevcut popülasyonlarda ya resesif karakterde veya oldukça düşük
frekanslarda görülebilmektedir. Bu durum bu mekanizmaların fenotipik olarak görünüşüne çok
fazla yansımamakta ancak nesilden nesile aktarılmaktadır. Yapılacak iş bu genlerin
seleksiyonla popülasyondan ayrılması ve homozigot hale getirilerek popülasyonda oranının
artırılmasıdır.
Yukarıda kısaca önemi vurgulanan problemlerin çözümüne yönelik hazırlanan bu projede
bazı balarısı hastalık ve parazitlerine karşı dayanıklı bir hat oluşturulması hedeflenmiştir. Bu
çalışmada hijyenik davranış özellikleri kolonilerin, koloni performansı, bazı hastalık ve
parazitlere ilişkin özellikleri belirlenecek ve hijyenik davranış özelliği generasyondan
generasyona artırılmaya çalışılacaktır. Bazı hastalık ve zararlılara karşı genetik dayanıklılığın
göstergesi olarak kabul edilen hijyenik davranış özelliği yönünden üstün kolonilerden hat
oluşturulması ve bu hattan üretilecek ana arıların arıcılar tarafından kullanılması sonucu da
arıcıların daha az ilaç kullanmaları sağlanarak daha sağlıklı ve fazla miktarda arı ürünlerinin
üretilmesi hedeflenmektedir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Doğu Akdeniz Bölgesinde, Yetiştiriciliği
Yapılan Balarısı (Apis Mellifera L.)
Kolonilerinin
Gezginci
Arıcılık
Koşullarında Ahşap, Plastik Ve Strafor
Kovanlarda Yaşama, Gelişme, Verim,
Hastalık Ve Zararlıların Gelişimi Ve
Kışlatma Üzerine Etkilerinin Araştırılması
Bahçe Kültürleri Araştırma İstasyonu
Müdürlüğü
TAGEM
Cahit ÖZTÜRK
H. Hüseyin OLUĞ
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
30/03/2014 - 30/03/2016
30.000 TL
Projeyi Yürüten Kuruluş:
PROJE ÖZETİ :
Türkiye arıcılığının içinde bulunduğu önemli sorunlarından birisi hiç şüphesiz değişik
ekolojik koşullar için uygun kovan yönetimi tekniklerinin uygulamaya konulamamasıdır.
Genel olarak farklı bitki örtüsüne, klimatolojik ve topoğrafık yapıya sahip bölgelerde farklı
yetiştirme tekniklerinin kullanılması arı kolonilerinin verimliliğini artırmak bakımından
vazgeçilmez temel bir prensip olmalıdır. Çünkü balarıları (A. mellifera L) belirli çevre
koşullarında belirli reaksiyonlar göstermekte olup, koloni verimliliği büyük ölçüde çevre
koşullarına bağlıdır. Değişik bölge koşullarına uygun kovan tipi, kışlatma şekli, yemleme ve
bakım gibi tekniklerin ortaya çıkarılması, bu konularda yapılacak benzer çalışmaların farklı
ekolojilerde tekrarlanması ile mümkündür (Genç, F. 1996).
Doğu Akdeniz Bölgesi koşullarında da diğer bölgelerde olduğu gibi yaygın olarak
Langstroth tipi ahşap kovanlar kullanılmaktadır. Ancak son yıllarda değişik teknolojilerle elde
edilen yapı malzemelerinin kovan imalatında da kullanıldığı görülmektedir. Arı
yetiştiricilerinin bu konuda bilgi ve öneriler istediği görülmektedir. Ayrıca bazı arı
yetiştiricileri bu farklı kovanları kullanmaya başladıkları görülmektedir.
PROJE ÖZETLERİ
Devam Eden
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/ 05 /12/02/01
Erzurum
yöresi
bal
arılarında
(Apismellifera L.) Saf Hat Oluşturma
Projeyi Yürüten Kuruluş:
Doğu Anadolu Tarımsal Araştırma
Enstitüsü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Muhsin KARA
Yardımcı Araştırmacılar:
Erdoğan SEZGİN
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Metin KESKİN
01.01.2012 - 30.12.2016
300.000 TL
PROJE ÖZETİ :
Ülkemizdeki koloni başına birim üretkenliğin düşük olması, arıcılığımızın en önemli
sorununu oluşturmaktadır. Bu sorunun çözümü amacıyla, Doğu Anadolu Tarımsal Araştırma
Enstitüsün’ de 2006-2011 Yılları arasında “Erzurum Yöresi Bal Arılarında (Apismellifera L.)
Saf Hat Oluşturma Projesi” Tarımsal Araştırmalar Genel Müdürlüğü (TAGEM) Araştırmaları
sistemi içerisinde sürdürülmüştür. Bu çalışmalar sonucunda Erzurum yöresi bal arılarının
bireysel üstünlüklerine dayanan kitlesel (mass) seleksiyonu yapılmış ve Enstitü arılığında
verimli bir arı stoğu oluşturulmuştur.
Yukarıda verilen açıklamalar çerçevesinde birinci 5 yıllık dilimi tamamlanan bu projenin;
Bundan sonraki safhalarının gerçekleşmesi için elde edilen arı stokunun morfometrik
ölçümleri yapılacak, ikinci 5 yılda da bal arılarının bireysel üstünlüklerine dayanan kitlesel
(mass) seleksiyon çalışmaları sürdürülecek, 50 kolonilik üstün özelliklere sahip seçilmiş elit bir
stok oluşturulacak. Bu stok daha sonra yapılacak ana arı üretimi, hat geliştirme ve malzeme
çalışmalarda kullanılacak
PROJE ÖZETLERİ
Sonuçlanan
Proje No
Proje Başlığı:
TAGEM/HAYSÜD 10/13/02/03
Barred Rock I ve Rhode Island Red I Saf
Hatlarında Kabuk Renginin İyileştirilmesi
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma İstasyonu
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Şahnur Erdoğan DEMİRTAŞ
Yardımcı Araştırmacılar:
Dr. Hüseyin GÖGER
Şermin YURTOĞULLARI
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
01.05.2009-30.06.2013
58.000 TL
PROJE ÖZETİ :
Kabuk rengi kahverengi olan yumurtalarda; kabuk renginin koyu ve yumurtalar
arasındaki renk varyasyonunun az olması istenen bir özelliktir. Kabuk rengi tavuk yaşı
ilerledikçe açılmaktadır. Bu araştırmada kabuk rengine ait genetik parametreler ve özellikler
arasındaki genetik korelasyonlar tahmin edilmiştir. Araştırmada 1342 adet Barrad Rock-1
(BAR-1), 1158 adet Rhode Island Red- 1(RIR-1) ve 611 adet hibrit olmak üzere toplam 3111
adet tavuk kullanılmıştır. Konica Minolta Color Reader CR-10 cihazı ile L (parlaklık), a
(kırmızı/yeşil) , ve b (sarı/mavi) değerleri ölçülmüştür. L değerinin düşük, a ve b değerlerinin
yüksek olması istenen özelliklerdir. Proje süresince yapılan ölçümlerle, ilk haftalara göre son
haftalarda L ve b değerlerinde önemli bir değişim olmadığı, a değerinde ise azalma olduğu
görülmüştür. L, b ve a değerlerinin kalıtım dereceleri 0.32 ile 0.74 arasında tahmin edilmiştir.
Renk indeks değeri için 100-L+a+b formülü kullanılmıştır, burada değer yükseldikçe renk
koyulaşmaktadır.
PROJE ÖZETLERİ
Sonuçlanan
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/13/A-06/P-01/02
Değişik Işık Kaynaklarının Yumurta
Tavuklarında Bazı Verim Ve Yumurta
Kalite Özellikleri Üzerine Etkisinin
Belirlenmesi
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma İstasyonu
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Serdar KAMANLI
Yardımcı Araştırmacılar:
Bülent TARIM
Sunay DEMİR
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
01.06.2013 -01.11. 2014
15.000 TL
PROJE ÖZETİ :
Araştırma yumurta tavuklarının yumurtlama döneminde farklı üç tip aydınlatma kaynağı
ile aydınlatılan bölmelerde yetiştirilerek bazı veri özellikleri ve ışık kaynaklarının karlılık
durumunu belirlemek üzere yürütülmüştür. Çalışmada her grupta 120 olmak üzere toplam 360
adet ATAK-S ticari yumurtacı hibrit kullanılmıştır. Tüm hibritler aynı büyütme kümesinde
aynı şartlarda 16. hafta sonuna kadar büyütülmüşlerdir. 17. haftada akkor telli lamba, mini
floresan ve LED lamba ile aydınlatılan bölmelere alınarak tavuklar seviyesinde 20 lüx ışık
şiddeti olacak şekilde aydınlatma uygulanmıştır. Aydınlatma süresi 18 haftalık yaştan itibaren
haftada 1 saat artırılarak 16 saatte sabitlenerek 52. hafta sonuna kadar; cinsi olgunluk yaşı ve
ağırlığı, yem tüketimi, yumurta ağırlığı, yumurta kütlesi, ak indeksi, haugh unit, kabuk
kalınlığı, kabuk kırılma direnci, şekil indeksi, et-kan lekesi, dönem sonu canlı ağırlık ve
yaşama gücü belirlenmiştir. Cinsi olgunluk yaşı bakımından akkor telli lamba ile aydınlatılan
grup diğerlerinden daha erken cinsi olgunluğa ulaşmıştır (P<0.01). Gruplar arasında cinsi
olgunluk yaşı, şekil indeksi, ak indeksi ve dönem sonu canlı ağırlık değerleri bakımından
istatistiki fark elde edilmiştir (P<0.01). Şekil indeksi bakımından akkor telli lamba ile mini
floresan benzer değerler göstermişken, LED ile aydınlatılan grup diğerlerinden daha yüksek bir
şekil indeksi değeri sergilemiştir (P<0.01). Ak indeksi değeri LED grubunda diğerlerinden
daha yüksek gerçekleşmiştir. Dönem sonu canlı ağırlık bakımından gruplar arasında önemli
derecede fark oluşmuş, akkor telli lamba ve LED birbirine benzerken mini floresan grubu
diğerlerinden daha yüksek dönem sonu canlı ağırlığa ulaşmıştır. Gruplar arasında, cinsi
olgunluk ağırlığı, yumurta verimi, yumurta ağırlığı, yem tüketimi, yemden yararlanma oranı,
haugh unit, kabuk kalınlığı, kabuk kırılma direnci ve yaşama gücü bakımından fark
oluşmamıştır.
PROJE ÖZETLERİ
Sonuçlanan
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/10/13/02/01
Barred Rock 1 Saf Hattında Bacak Rengine
Göre Cinsiyet Ayırımı Olanağı Veren Bir
Sürü Oluşturulması
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma İstasyonu
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Serdar KAMANLI
Yardımcı Araştırmacılar:
Muhammed TUNCA
Zafer ATİK
Uğur YILDIRIM
Hüseyin AYGÖREN
Meltem CAN
Başlama-Bitiş Tarihleri:
01.05.2010 - 01.05.2013
Projenin Toplam Bütçesi
29.000 TL
PROJE ÖZETİ :
Bu çalışmada, Tavukçuluk Araştırma İstasyonunda bulunan Barred Rock - 1 saf hattına
ait civcivlerde bacak rengine göre cinsiyet ayrım olanağı veren bir sürü oluşturulması
amaçlanmıştır. Araştırmanın ilk yılında, 2000 adet 1 günlük yaşta Barred Rock -1 ırkı civciv
kullanılmıştır. Bu hayvanlardan 1000 adeti kloaktan bakılarak ayrılmış, diğer 1000 adeti bacak
renginden cinsiyet ayrımı işlemine tabi tutulmuştur. Ayrım işleminden sonra civcivlere kanat
numaraları takılarak hayvanlar 43 haftalık yaşa kadar bireysel olarak takip edilmişlerdir.
Kayıtları tutulacak her iki grupta da üzerinde durulan özellikler bakımından karşılaştırma
yapılmıştır. Kloaktan ayrım işlemi sadece ilk yıl uygulanıp daha sonra tekrar edilmemiştir. Bu
çalışma ile bacak rengine göre cinsiyet ayrımına olanak veren bir sürünün oluşturulması
hedeflenmiştir.
PROJE ÖZETLERİ
Sonuçlanan
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/13/A-06/P-01/01
Yumurtacı Damızlıklarda Rasyona İlave
Edilen Farklı Yağların Verime, Kuluçka
Özelliklerine ve Civciv Kalitesine Etkileri
Projeyi Yürüten Kuruluş:
Tavukçuluk Araştırma İstasyonu
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Dr. Züleyha KAHRAMAN
Yardımcı Araştırmacılar:
Şahnur ERDOĞAN
Şermin YURTOĞULLARI
Doç. Dr. Ebru ONBAŞILAR
Başlama-Bitiş Tarihleri:
01.01.2013-01.03.2014
Projenin Toplam Bütçesi
27.500TL
PROJE ÖZETİ :
Çalışmada yumurtacı damızlıkların rasyonlarına ilave edilen farklı yağların verim,
kuluçkalık yumurtalarda lesitin miktarı, kuluçka özellikleri ve civciv kalitesi üzerine olan
etkilerinin belirlenmesi amaçlanmıştır. Bu amaçla, hayvan materyali olarak Tavukçuluk
Araştırma İstasyonu Müdürlüğünde mevcut 20 haftalık yaştaki 180 adet BAR I ana hattına ait
damızlıklar ile 18 adet RIR I baba hattına ait horozlar kullanılmıştır. Tavuklar her birinde 7
hayvan bulunan 8 tekerrürlü 3 rasyon grubuna (% 3 ayçiçeği yağlı, % 3 soya yağlı ve % 3
lesitini alınmış soya yağlı rasyon) rastgele dağıtılmıştır. Bu damızlıklarda 20 haftalık yaştan
itibaren 40 haftalık yaşa kadar canlı ağırlık, yem tüketimi, yumurta verimi ve yemden
yararlanma oranı belirlenmiştir. Her bir yemleme grubundaki damızlıklardan 36 haftalık yaşta
elde edilen yumurtada yağ asidi ve lesitin düzeyi ile kuluçka randımanı, çıkış gücü, döllülük
oranı, embriyonik ölüm ve civciv ağırlığı belirlenmiştir. Rasyona % 3 düzeyinde ilave edilen
ayçiçeği, soya ve degummed soya yağının yumurtacı damızlıklarda yumurta ağırlığı,
yumurtada lesitin ve linolenik asit düzeyleri ile civciv ağırlığını etkilediği belirlenmiştir.
Piyasada satılan degummed soya yağlarında tam olarak lesitinin alınamadığı bunun sonucunda
da performans ile kuluçka sonuçlarında önemli bir değişiklik gözlenmediği düşünülmektedir.
PROJE ÖZETLERİ
Sonuçlanan
Proje No
Proje Başlığı:
TAGEM/HAYSUD/12/06/02/02
Karma Yeme Esansiyel Yağ Karışımı,
Prebiyotik, Probiyotik ve Enzim İlavesinin
Deneysel Koksidiyoz Bulaştırılan Etlik
Piliçlerin Performans, Dışkı Oosit Atımı,
Lezyon Skoru, Bağışıklığı İle Kimi Organ
Ağırlıkları Üzerine Etkileri
Projeyi Yürüten Kuruluş:
İncir Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Doç. Dr. Mehmet BOZKURT
Yardımcı Araştırmacılar:
Doç. Dr. Nuran AYSUL
Yrd. Doç. Dr. Kamil KÜÇÜKYILMAZ
Yrd. Doç. Dr. Süleyman AYPAK
Abdullah Uğur ÇATLI
Mustafa ÇINAR
Erol BİNTAŞ
Gökhan EGE
Başlama-Bitiş Tarihleri:
01/01/2012 – 31/12/2013
Projenin Toplam Bütçesi
22.000 TL
PROJE ÖZETİ :
Etlik piliç yetiştiriciliğinde sıklıkla kullanılan 5 adet performans arttırıcı yem katkı
maddesinin sağlıklı ve Eimeria spp. ile enfekte edilmiş piliçlerde performans, fekal oosit
saçımı, bağırsak lezyon skoru, oransal organ ağırlığı ve spesifik immun yanıt üzerine etkileri
araştırılmıştır. Bu amaçla günlük yaşta 2400 adet etlik civciv (Ross 308) eşit şekilde 2 gruba
ayrılmış, yarısı koksidiyozla bulaştırılmazken diğer yarısı Eimeria spp. ile 14 günlük yaşta
enfekte edilmiştir. Her iki uygulama benzer şekilde 6 gruptan oluşturulmuştur. Birinci gruba
temel yem karması verilirken diğer 5 deneme grubuna sırasıyla 60 mg/kg antikoksidiyal
salinomycin (SAL), 1 g/kg multi-enzyme (ENZ), 1 g/kg probiyotik (PRO), 1 g/kg prebiyotik
(PRE) ve 50 mg/kg esansiyal yağ karışımı (EYK) ihtiva eden yemler verilmiştir. Enfeksiyon
sonrasında ölçülen performans değerleri üzerine çok kuvvettli (P<0.001) muamele x
enfeksiyon interaksiyonu bulunması sağlıklı koşullarda veya paraziter bir hastalık stresi altında
yem katkı maddelerinin değişik cevaplar verdiğini göstermektedir. Ilk günlük yaştan itibaren
SAL, ENZ, PRO, PRE ve EYK yedirilen etlik civcivlerin ilerleyen dönemlerde koksidiyozun
olumsuz etkileri ile başa çıkabildikleri, fakat EYK’nın bu konuda etkisiz kaldığı görülmüştür.
Enfekte edilmeyen civcivlerin yerine SAL, PRE ve EYK ilavesi yemden yararlanma değerini
iyileştirmiştir. Kullanılan tüm katkı maddeleri ince bağırsağın orta ve aşağı kısımlarında
koksidiyal enfeksiyondan kaynaklanan lezyon skorlarını hafifletirken dışkı ile oosit saçımının
azalmasında yalnızca SAL ve EYK başarılı olmuştur. Yeme SAL ilavesi enfekte edilmiş etlik
piliçlerde serum IBD titresini yükseltmiştir (P<0.01). Elde edilen bulgular etlik piliç
yemlerinde kullanılan performans arttırıcı yem katkı maddelerinin koksidiyal enfeksiyona
bağlı büyüme geriliğini telafi edebileceğini göstermektedir.
PROJE ÖZETLERİ
Sonuçlanan
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/11/13/03/02
Doğu Akdeniz Bölgesi koşullarında
yetiştiriciliği yapılan
balarısı (Apis
mellifera
L.)
kolonilerinde
hijyenik
davranış seleksiyonu ile hastalık ve
parazitlere karşı dayanıklı hat geliştirme
olanaklarının araştırılması I
Projeyi Yürüten Kuruluş:
Alata Bahçe Kültürleri Araştırma
İstasyonu
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Cahit ÖZTÜRK
Yardımcı Araştırmacılar:
Prof. Dr. Numan ÖZCAN
Çukurova Üniversitesi
Başlama-Bitiş Tarihleri:
Mart 2011 – Mart 2013
Projenin Toplam Bütçesi
60.000 TL.
Bu çalışmada Mersin, Adana, Osmaniye, Hatay ve Kahramanmaraş illerinde arı
yetiştiricileri tarafından yetiştiriciliği yapılan bal arısı ( Apis mellifera L.) kolonilerine hijyenik
davranış testi uygulanmıştır. Test uygulanan 297 adet kolonide ortalama % 61.31 temizleme
davranışı görülmüştür. Bu test sonuçlarına göre %80 ‘in üzerinde temizleme davranışı
gösteren 70 adet koloni başlangıç sürüsü olarak seçilmiştir. Bu koloniler hijyenik davranış testi
sonuçlarına göre sıralanarak en yüksek temizleme davranışı gösteren 30 koloninin 10
tanesinden ana arı yetiştirilerek diğer 20 koloniden yetiştirilen erkek arılardan toplanan
spermler ile yapay olarak döllenmiştir. Bu çalışmalar tekrarlanarak 4 generasyon boyunca
sürdürülmüştür. 1., 2., 3. ve 4. generasyonlarda sırası ile ortalama % 65.32, % 67.88, % 68.57
ve %% 70.26 olarak belirlenmiştir. Generasyonlar arasında ve her generasyon içerisindeki ana
arı grupları arasında istatistiki olarak bir fark görülememiştir. Seleksiyon üstünlüklerinin ve
genetik ilerlemenin kullanılmasıyla hijyenik davranış için hesaplanan kalıtım dereceleri ise 1.
ve 2. generasyon arasında 0.12, 2. ve 3. generasyon arasında 0.03 ve 3. ve 4. generasyonlar
arasında ise 0.09 olarak hesaplanmıştır.
PROJE ÖZETLERİ
Sonuçlanan
Proje No
Proje Başlığı:
TAGEM/HAYSÜD/12/06/01/03
Akdeniz Bölgesinde Arıcılık İşletmelerinin
Teknik ve Ekonomik Yapısının
Belirlenmesi
Projeyi Yürüten Kuruluş:
Bahçe Kültürleri Araştırma İstasyonu
Müdürlüğü
Projeyi Destekleyen Kuruluş:
TAGEM
Proje Yürütücüsü:
Cahit ÖZTÜRK
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
01.01.2012 – 01.01.2014
20.000 TL
PROJE ÖZETİ :
Arıcılık; bitkisel kaynakları, arıyı ve emeği birlikte kullanarak, insanın var oluşundan bu
yana beslenme, sağlık koruma ve sağaltma amacıyla kullanmaktan vazgeçemediği bal, polen,
arı sütü, propolis, arı zehiri gibi ürünler ile günümüzde arıcılığın önemli gelir unsurlarından
olan ana arı, oğul, paket arı gibi canlı materyal üretme faaliyetidir. Arıların tozlaşmadaki etkin
rolü de düşünülürse arıcılığın tarım sektörü içerisinde asla küçümsenmemesi gereği ortaya
çıkmaktadır (Ören N. ve ark.2010).
Proje ile bölgede arıcılık faaliyetinin mevcut durumu ve gelecekteki gelişimi incelenerek,
bölgede faaliyet gösteren üreticiler açısından öneri ve tavsiyelerin geliştirilmesi ve gerekli kişi,
kurum ve kuruluşlara iletilmesi sağlanacaktır. Arıcılık faaliyetinin bölge için sosyo- ekonomik
açıdan öneminin ortaya konulması sağlanacaktır. Arıcılık üretim faaliyetinin birim maliyetleri
tespit edilerek, üreticilerin yaşam standardı ve gelir düzeyleri için önem arz eden geleceğe
dönük öneri ve stratejilerin ortaya konulması sağlanacaktır. Arıcılık faaliyeti için bölgedeki
etkinlik düzeyinin tespit edilmesiyle, kaynak kullanım etkinsizliğine neden olan faktörler
bölgedeki arıcılık faaliyetinin geleceği açısından son derece önemli olup, çalışma ile bu
faktörler ortaya konularak ve çözüm önerilerinin bulunması sağlanacaktır. Arıcılık faaliyetinde
uygulanan desteklerin üretici gelirlerine ve yaşam standardına etkileri ile mevcut bal üretiminin
pazarlama durumu ortaya konulacaktır.
Sonuç olarak bu çalışma ile bölgede kayıtlı arıcılık işletmeleri ve dışarıdan konaklama amacı
ile gelen işletmelerin mevcut teknik ve ekonomik yapıları incelenecektir. Bakanlık Üreticiler
ve Üniversitenin birlikte görev alması ile bölgenin potansiyeli ve sorunları ortaya konulup
etkili çözüm yolları ve stratejileri geliştirilmeye çalışılacaktır.
SU ÜRÜNLERİ ARAŞTIRMALARI PROGRAM DEĞERLENDİRME TOPLANTISI
03-07 MART 2014
03 MART 2014 PAZARTESİ
09.00-12.50
GENEL AÇILIŞ
12:30-14:00
YEMEK ARASI
14:00 – 15:30
I. OTURUM YENİ TEKLİF PROJELER
Yeni Teklif Projeler / Su Ürünleri – Balıkçılık Yönetimi Programı
Proje Lideri / Sunan
Proje / Sunum Adı
Kurum
Projenin
Durumu
TAGEM
Sunu
Akdeniz
SUAE
Yeni
Teklif
Erdinç VESKE
Su Ürünleri Araştırmaları
C. Menderes AYDIN,
Yrd.Doç.Dr. Mümtaz
TIRAŞIN
Türkiye’nin Akdeniz Kıyısındaki
Büyüklüklerinin Tahmini
Engin KOCABAŞ
Kuzey Ege Denizi Demersal Balık Stoklarının Araştırılması
Bandıma
KAI
Yeni
Teklif
Hülya ERCAN
Yrd.Doç.Dr. Aydın
ÜNLÜOĞLU
Antalya Körfezi'nde Ticari Karides Türlerinin Biyolojik Özellikleri ve
Stok Büyüklüklerinin Tahmini
Akdeniz
SUAE
Yeni
Teklif
Murat ŞİRİN
Marmara Denizi Demersal Balık Stoklarının Araştırılması
Bandıma
KAI
Yeni
Teklif
Doğan BAYKALER,
Prof. Dr. Bülent
CİHANGİR
Türkiye’nin Akdeniz Kıyısalında Kızıl Deniz Kökenli (Lesepsiyen)
Balıkların Trol Av Kompozisyonundaki Dağılımı
Akdeniz
SUAE
Yeni
Teklif
Eğirdir
SUAİ
Yeni
Teklif
GAP
TAEM
Yeni
Teklif
Demersal
Balık
Stoklarının
15:30-16:00
Ara
16:00-17:30
II. OTURUM YENİ TEKLİF PROJELER
Mehmet CILBIZ
Fatma Pınar
KARADUMAN
Uluabat Gölündeki Turna Balığı'nın (Esox lucius, Linnaeus, 1758)
Populasyon Büyüklüğünün Tahmin Edilmesi ve Avcılığında Kullanılan
Av Araçlarının Seçicilik Özelliklerinin Belirlenmesi
Atatürk Baraj Gölü ve Aşağı Fırat Havzası’nda Yaşayan
Mezopotamya Yayını (Silurus triostegus)’nın Avlanma Tercihlerinin
Belirlenmesi
Fuat BİLGİN
Amatör Balıkçılığın Beyşehir Gölü Balık Stoklarına Etkisi
Eğirdir
SUAİ
Yeni
Teklif
Rahmi UYSAL
İznik Gölü'ndeki Gümüş Balığının (Atherina boyeri) Avlanabilir Stok
Miktarının Tahmin Edilmesi, Avcılıkta Kullanılan Av Aracı Seçicilik
Özelliklerinin ve Uygun Avcılık Yerlerinin Belirlenmesi
Eğirdir
SUAİ
Yeni
Teklif
Uğur SENCER
(KKTC)
K.K.T.C. Denizlerinde Balık Stoklarının Araştırılması Projesi
KKTC
Bakanlık
Yeni
Teklif
04 MART 2014 SALI
09:00-10:30
Selahattin GÜRÇAY
Nuran ÇAVDAR
İsmail ERBATUR
Ayça GÜVEN
10:30-11:00
11:00-12:30
O. Tolga ÖZEL
Gürel Nedim
ÖRNEKÇİ
Soner SAVAŞER
III. OTURUM YENİ TEKLİF PROJELER
Su Ürünleri - Su Ürünleri Islah ve Yetiştiriciliği Programı
Gökkuşağı Alabalığının (Oncorhynchus mykiss) Normal Dönem ve Mevsim
Dışı Üretiminde Döl Verim Özellikleri ve Yavrularının Büyüme
Performanslarının Karşılaştırılması
Melatonin ve Seretonin'in Astacus leptodactylus (Eschscholtz, 1823)
Yavrularının, Yaşama Oranı, Büyüme Performansı, Kabuk Değişimi, Vücut
Kompozisyonu ve İmmun Sistem Üzerindeki Etkilerinin Araştırılması
İç Sular Yetiştiriciliği İçin Alternatif Bir Tür Olarak, Sudak Balığının (Sander
lucioperca (Linnaeus, 1758)) Kapalı Devre Sistemde Yaşama ve Büyüme
Oranları İle Stres Faktörlerinin Araştırılması
Doğu Karadeniz'de Dağılım Gösteren Bazı Kefal Türlerinin (Mugil cephalus
L., 1758 ve Liza aurata Risso, 1810) Biyoekolojik ve Kültür Özelliklerinin
belirlenmesi
IV. OTURUM YENİ TEKLİF PROJELER
Su Ürünleri - Su Ürünleri Islah ve Yetiştiriciliği Programı
Karadeniz Alabalığı (Salmo trutta labrax P., 1811) ve Gökkuşağı
Alabalığında (O. mykiss L., 1972) Farklı Üretim Modellerinin Verimliliğe
Etkisi
Alabalık Yeminde Fındık Küspesi Kullanımı ve Zeolit İlavesinin Balıkların
Büyüme Performansı ve Yem Değerlendirmesi Üzerine Etkileri
Gökkuşağı alabalıklarında (Onchorhyncus mykiss) zencefil ve çörek otunun
immunostimulant olarak kullanılması
Mersin Balıklarında Damızlık Stok Yönetimi
12:30-14:00
Yemek Arası
14:00-15:30
V. OTURUM YENİ TEKLİF PROJELER
Su Ürünleri - Su Ürünleri Islah ve Yetiştiriciliği Programı
İsa AYDIN, Prof. Dr.
Sevgi SAVAŞ
Levrek (Dicentrarchus labrax) larvalarında mikrokapsül yem ile
beslenmenin büyüme ve yağ asidi içeriğine etkisi
Mustafa BALCI
Elazığ İli Alabalık İşletmelerinde Balık Refah Düzeyinin Belirlenmesi
Prof.Dr. Sevgi
SAVAŞ, Durali
ERASLAN
Farklı Sürelerde Ticari Ürün ve L-karnitin ile zenginleştirilmiş Rotifer (B.
plicatilis)'in Besinsel İçeriğinin Belirlenmesi
Doç. Dr. Yılmaz
EMRE, Prof. Dr. R.
MAMADOV
İnulin, Kitosan ve B. subtilus'un A. leptodactylus Yavrularının Yaşama
Oranı, Büyüme Performansı, Vücut Kompozisyonu, İmmun Sistemi ve Bazı
Çevresel Stresörlere Karşı Toleransı Üzerine Etkilerinin Araştırılması
Cyclamen graecum ve Prospero autumnalis Ekstraklarının Aktif
Bileşenlerinin Karakterizasyonu, Bazı Deniz ve Tatlı Su Balıkları Üzerinde
Biyolojik Etkilerinin Araştırılması
15:30-16:00
Ara
16:00-17:30
VI. OTURUM YENİ TEKLİF - YENİ TEKLİF PROJELER
Mahmut YÜKSEL
Rıdvan TEPE
Mehmet
KÜÇÜKYILMAZ
Merve KARAKUŞ
Vedat YEĞEN
Yeni
Teklif
Eğirdir SUAİ
Yeni
Teklif
EĞİRDİR
SUAİ
Yeni
Teklif
SUMAE
Yeni
Teklif
SUMAE
Yeni
Teklif
Ara
Dr. Bilal AKBULUT
Kamile Gonca
EROL
Elazığ SUAİ
Atatürk Baraj Gölü Şanlıurfa Avlak Sahalarında Yetiştiricilik Açısından Su
Kalitesinin Tespiti, Kafeslerde Alabalık Yetiştiriciliğine Uygun Alanların
Belirlenmesi ve Taşıma Kapasitelerinin Bulunup İşletmelere Tahsisi
Hususunda Özel Hüküm Belirlenmesi
Karkamış Baraj Gölü’nde Kafeslerde Yapılan Yetiştiriciliğin Çevresel
Etkisinin Araştırılması
Özlüce Baraj Gölü’nün Trofik Seviye ve Taşıma Kapasitesi Yönünden
Araştırılması
Akdeniz’deki Makrobentik Omurgasızların Çeşitliliğinin ve Dağılımının
Belirlenmesi
İstilacı Bir Tür Çakıl Balığı (Pseudo rasboraparva, Temminckand
Schlegel,1846)'nın İç Ege, Göller Bölgesi ve İç Anadolu'daki yayılımı,
Genetik Özellikleri, Portörlük Durumu ve Biyoekolojik Özelliklerinin
Belirlenmesi
Elazığ SUAİ
Eğirdir SUAİ
Trabzon
SUMAE
Akdeniz
SUAE
Elazığ SUAİ
Yeni
Teklif
Yeni
Teklif
Yeni
Teklif
Yeni
Teklif
Yeni
Teklif
Akdeniz
SUAE
Yeni
Teklif
Eğirdir SUAİ
Yeni
Teklif
Akdeniz
SUAE
Yeni
Teklif
GAP
TAEM
Yeni
Teklif
Elazığ SUAİ
Elazığ SUAİ
Akdeniz
SUAE
Eğirdir SUAİ
Yeni
Teklif
Yeni
Teklif
Yeni
Teklif
Yeni
Teklif
05 MART 2014 ÇARŞAMBA
09:00-10:30
I. OTURUM YENİ TEKLİF PROJELER
Biyolojik Çeşitlilik ve Su Ürünleri Genetik Kaynakları Programı
Şirin FİRİDİN
Gen Bankası Veri tabanının Oluşturulması: Kalkan Balığı
Zübeyde HANOL
Şirin FİRİDİN
Türkiye'deki Kerevit Popülasyonlarının Genetik Yapısının Moleküler
Metotlarla Belirlenmesi
Karadeniz'deki Barbunya Balığının (Mullus barbatus) genetik yapısının
zamansal değişimi
Dr. F. Banu YALIM,
Doç. Dr. Ergün
TAŞKIN
Türkiye’nin Batı Akdeniz Kıyılarının Carlıt (Cartography Of Littoral) İle
Ekolojik Durumunun Belirlenmesi
Ayşe Gül ŞAHİN
Keban, Karakaya ve Atatürk Baraj Gölleri’nde Ağır Metal Kirliliğinin Bazı
Balık Türlerindeki Biyokimyasal Parametreler ve Et Kalitesi Üzerine Etkisi
10:30-11:00
Ara
II. OTURUM YENİ TEKLİF PROJELER
Kaynak Yönetimi ve Çevre
Atatürk Baraj Gölü’nde Su ve Sediment Örnekleri ile Ekonomik Öneme
Nurten ÖZBEY
Sahip Balık Türlerinde Poliaromatik Hidrokarbon Düzeylerinin
Belirlenmesi
Trabzon Açıklarında Deniz Suyunun Bazı Fiziksel Ve Kimyasal
M.Baran KILIÇ
Özelliklerinin Belirlenmesi
Antalya Körfezine Akarsularla Taşınan Kirletici Yüklerinin Belirlenmesi ve
Dr.Özgür AKTAŞ
Körfez Su Kalitesinin Mevsimsel Değişimi
Yeni Teklif Projeler / Su Ürünleri Sektöründe Sosyo-Ekonomik Arş. Programı
Doğu Anadolu Bölgesi’nde İç Su Balıkları Avcılığının Sosyo-Ekonomik
İlhan CANPOLAT
İndikatörleri
Karadeniz bölgesinde kültür balıkçılığının mevcut durumu ve
Tuna ÖZCELEP
projeksiyonlar: Yeni stratejiler geliştirme
12:30-14:00
Yemek Arası
SUMAE
Eğirdir SUAİ
SUMAE
Yeni
Teklif
Yeni
Teklif
Yeni
Teklif
Akdeniz
SUAE
Yeni
Teklif
Elazığ SUAİ
Yeni
Teklif
Elazığ SUAİ
Yeni
Teklif
11:00-12:30
SUMAE
Akdeniz
SUAE
Elazığ SUAİ
SUMAE
Yeni
Teklif
Yeni
Teklif
Yeni
Teklif
Yeni
Teklif
14:00-15:30
III. OTURUM DEVAM EDEN PROJELER
Su Ürünleri Islah ve Yetiştiriciliği Programı
Serap GELİBOLU
Çipura yemine farklı oranlarda eklenen Mannan-oligosakkarit (MOS)’in
Çipura (Sparus aurata)’lar da büyüme ve et kalitesi üzerine etkileri
Akdeniz
SUAE
Dr. Bilal AKBULUT
Mersin Balığı Yetiştiriciliği ve Koruma Stratejisi Geliştirilmesi
SUMAE
Nevim BİRİNCİ
Yukarı Fırat Havzası Yüzeysel Sularının Kalite ve Yetiştiricilik Açısından
Araştırılması
Eyüp ÇAKMAK
Karadeniz Alabalığı (S t. labrax)'nın Besin İhtiyaçlarının Belirlenmesi
SUMAE
Soner SEZEN
Türkiye İç Sularında Bulunan Bazı Aphanius Türlerinin (Aphanius mento,
Aphanius villwocki, Aphanius sureyanus) Yapay koşullarda Üreme
Özelliklerinin Belirlenmesi
Akdeniz
SUAE
Devam
Eden
15:30-16:00
Ara
16:00-17:30
IV. OTURUM YENİ TEKLİF - DEVAM EDEN PROJELER
/ Su Ürünleri Islah ve Yetiştiriciliği Programı
Durali ERASLAN
Sarıağız Balığı Yetiştiricilik Potansiyelinin Araştırılması
Akdeniz
SUAE
Dr. Ercan KÜÇÜK
Karadeniz Kalkan Balığı (Psetta maxima)’nın Yetiştiricilik Tekniklerinin
Geliştirilmesi
SUMAE
Yahya ÇAVDAR
Balık Çiftliklerinin Coğrafi Bilgi Sistemi (CBS) ile Konumsal Analizi
SUMAE
Devam
Eden
Devam
Eden
Devam
Eden
Devam Eden Projeler / Su Ürünleri – Balıkçılık Yönetimi Programı
Çanakkale Boğazı’ndan Hopa’ya: Lüfer (Pomatomus saltatrix)
Dr.Elvan ATILGAN
Populasyonunu İzleme Projesi
Uzunçayır Baraj Gölü (Tunceli) Balık Populasyonlarının Üreme Biyolojileri,
Fatih GÜNDÜZ
Populasyon Parametreleri ve Stok Analizleri Üzerine Bir Araştırma
Elazığ SUAİ
SUMAE
Elazığ
SUAİ
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
06 MART 2014 PERŞEMBE
09:00-10:30
Ferhat DEMİROL
Prof. Dr. Ali İŞMEN
I. OTURUM DEVAM EDEN PROJELER
Su Ürünleri – Balıkçılık Yönetimi Programı
Keban Baraj Gölü Kerevit (Astacus leptodactylus Eschscholtz, 1823)
Populasyon Büyüklüğünün Tahmini ve İzlenmesi
Marmara Denizindeki Derin Su Pembe Karidesinin (Parapenaeus
longirostris, Lucas, 1846) Stok Durumunun İzlenmesi ve Yönetimi
Elazığ SUAİ
KAİ
Dr.Yaşar GENÇ
Doğu Karadeniz’de Gırgır Balıkçılığının İzleme Projesi
SUMAE
Dr. Mustafa
ZENGİN
Batı Karadeniz’deki Demersal Balık Stoklarının Tahmini Projesi
SUMAE
Alpaslan KARA
Bandırma Körfezi İhtiyoplankton Bolluk ve Dağılımının Araştırılması
Bandıma
KAI
10:30-11:00
Ara
11:00-12:30
II. OTURUM DEVAM EDEN PROJELER
Biyolojik Çeşitlilik ve Genetik Kaynaklar-Su Ürünleri Genetik Kaynakları Programı
Dr. İlhan AYDIN
Balık Gen Bankası Oluşturulması İçin Ön Çalışma: Sperm Muhafazası
Alpaslan KARA
Saros Körfezi İhtiyoplankton Bolluk ve Dağılımının Araştırılması
Dr. Nimet Selda
BAŞÇINAR
Doğu Karadeniz Kıyılarının Ekolojik Kalite Durumlarının Belirlenmesi ve
Bentik Omurgasız Organizmaların Tür Çeşitliliği
Murat ERBAY
Türkiye Balık İsimleri ve Otolit Atlası
SUMAE
Oğuzhan EROĞLU
Türkiye’deki Kahverengi Alabalık (Salmo trutta L.) Populasyonlarının
Genetik Yapısının Mikrosatellit ve Dloop Sekans Analizi Yöntemi ile
Belirlenmesi
SUMAE
12:30-14:00
Yemek Arası
14:00-15:30
Dr.Orhan AK
Özkan ÖZBAY
Mustafa CEYLAN
Prof.Dr.Naim
SAĞLAM
Dilek FİDAN
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
SUMAE
Bandıma
KAI
AKDENİZ
SUAE
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
Devam
Eden
III. OTURUM DEVAM EDEN PROJELER
Biyolojik Çeşitlilik ve Genetik Kaynaklar-Su Ürünleri Genetik Kaynakları Programı
Doğu Karadeniz Bölgesinde Hamsi (Engraulis encrasicolus ponticus )
Yumurta, larva ve Genç Bireylerin Dağılım ve Bolluğu
Güneydoğu Anadolu Bölgesi Sülük Faunası ve Ekonomik Öneminin
Araştırılması
Göller Bölgesi Sülük Faunası ve Ekonomik Öneminin Araştırılması
Devam Eden Projeler / Doğal Kaynaklar ve Çevre
Doğu Karadeniz’de Karasal Kaynaklı Kirleticilerin Kıyı ve Deniz
Ekosistemine Etkilerinin Belirlenmesi
SUMAE
Elazığ SUAİ
Devam
Eden
Devam
Eden
Eğirdir SUAİ
Devam
Eden
SUMAE
Devam
Eden
15:30-16:00
Ara
16:00-17:30
IV. OTURUM YENİ TEKLİF - DEVAM EDEN PROJELER
Cafer BULUT
Eğirdir, Beyşehir, Uluabat ve İznik Göllerinin Su-Sediman Yapısı ile
Makrofit, Bentoz, Plankton ve Ekonomik Su Ürünleri Türlerinde Ağır
Metal Düzeylerinin Araştırılması
Eğirdir SUAİ
Devam
Eden
Beymelek Lagünü'nün Besin Ağ Yapısı'nın Duraylı Karbon ve Azot
İzotop Yöntemi ile Belirlenmesi
Akdeniz
SUAE
Devam
Eden
Karacaören I Baraj Gölü On Yıllık (2003-2013) Değişim Sürecinin
Limno-Ekolojik Yönden İncelenmesi
Akdeniz
SUAE
Devam
Eden
SUMAE
Devam
Eden
Elazığ SUAİ
Devam
Eden
Doç.Dr. Yılmaz
EMRE, Prof. Dr.
Şenol AKIN
Dr. F. Banu YALIM
Doç.Dr. İskender
GÜLLE
Dr. Sebahattin
KUTLU
Timur DEMİR
Doğu Karadeniz’de Avlanan ve Yetiştirilen Bazı Balıkların
Tütsülenmesinde Tüketici Kabulünün ve Depolama Stabilizesinin
Belirlenmesi
Adıyaman İli Çat Baraj Gölünün Alabalık Yetiştiriciliği Açısından, Su
Kalitesinin ve Taşıma Kapasitesinin Belirlenmesi
07 MART 2014 CUMA
09:00-10:30
I. OTURUM BİLGİ AMAÇLI SUNULAN PROJELERİN SUNUMU
Doç.Dr.Ali Cemal
GÜCÜ
Ulusal balıkçılık veri toplama programı için Karadeniz’de hamsi
Stoklarının Akustik Yöntem İle Belirlenmesi Ve Sürekli İzleme Modelinin
Oluşturulması
Prof. Dr. Metin
KUMLU
Akdeniz Koşullarında Karides Yetiştiriciliğinin Geliştirilmesi
Doç. Dr. Orhan
Tufan
EROLDOĞAN
Doğu Akdeniz Koşullarında Lahoz (Epinephelus aeneus)’un Larval
Yetiştiricilik Olanaklarının Araştırılması
Doç. Dr. Derya
GÜROY
Alternatif Bir Tür Olan Granyöz Balığının (Argyrosomus regius)
Besleme Rejiminin Belirlenmesi
Doç. Dr. Kenan
GÜLLÜ
Eşen Çayı Üzerinde Kurulu Alabalık Üretim Tesislerinin Ekosisteme
Dost, Sürdürülebilir Yönetim Modelinin Geliştirilmesi
10:30-11:00
Ara
11:00-12:30
II. OTURUM SONUÇLANAN PROJELER
Ercan SINAY
Güzelyurt Körfezi'nde deniz suyu ve ekonomik öneme sahip balık
türlerinde ağır metal düzeylerinin araştırılması
Erdemli
Deniz
Bilimleri
Çukurova
Ü., Su Ü.
Fak.
Çukurova
Ü., Su Ü.
Fak.
Yalova Ü.
Armutlu
MYO
Üretici
Merkez
Birliği
TÜBİTAK
1007
Projesi
KKTC
Bakanlık
KKTC
Projesi
Akdeniz
SUAE
Sonuç
SUMAE
Sonuç
SUMAE
Sonuç
Akdeniz
SUAE
Sonuç
SUMAE
Sonuç
Eğirdir
SUAİ
Sonuç
Bandıma
KAI
Sonuç
AR-GE
Projesi
AR-GE
Projesi
AR-GE
Projesi
AR-GE
Projesi
Sonuçlanan Projeler / Su Ürünleri - Su Ürünleri Islah ve Yetiştiriciliği Programı
Dr. Mehmet Ali T.
Su Ürünleri Yetiştiriciliği Kaynaklı Atıkların Azaltılması Üzerine Bazı
KOÇER
Araştırmalar
Sonuçlanan Projeler / Su Ürünleri – Balıkçılık Yönetimi ve Teknolojisi Programı
Batı Karadeniz’de (Sinop-Cide (Kastamonu)) Dağılım Gösteren Beyaz
Murat DAĞTEKİN
Kum Midyesi (Chamelea gallina (Linnaeus, 1758 )) Stoklarının Tahmini
Üzerine Bir Ön Çalışma
Dr. Mustafa
Karadeniz’deki Trol Balıkçılığını İzleme Projesi
ZENGİN
Coşkun Menderes
Posidonia oceanica’nın Taşıma Dikim ve Koruma Amaçlı Üretim
AYDIN
Olanaklarının Araştırılması
12:30-14:00
Yemek Arası
14:00-15:30
III. OTURUM SONUÇLANAN PROJELER
Dr.Orhan AK
Turgay MEKE
Engin KOCABAŞ
Trabzon Kıyılarında Yumurtadan Ergin Bireye İstavrit (Trachurus
mediterraneus,Steindachner, 1868): Yaş, Büyüme, Ölüm Oranları ve
Üreme
Göller Bölgesi Ova kurbağası Pelophylax ridibunda Pallas, 1771 (Rana
ridibunda Pallas, 1771) Stoklarının Araştırılması
Marmara Denizi’ne Giriş Yapan Lesepsiyen (Indo-Pasifik ve Kızıldeniz
Kökenli) Balık Türlerinin Araştırılması
15:30-16:00
Ara
16:00-17:30
IV. OTURUM DİLEK VE TEMENNİLER - KAPANIŞ
T.C.
GIDA TARIM ve HAYVANCILIK BAKANLIĞI
TARIMSAL ARAŞTIRMALAR ve POLİTİKALAR GENEL MÜDÜRLÜĞÜ
SU ÜRÜNLERİ ARAŞTIRMALARI PROGRAM
DEĞERLENDİRME TOPLANTISI
(03–07 Mart 2014)
ANTALYA
Tablo 14: Entansif Yemleme+Süt+Mera Sistemine Dayalı Besleme Sisteminde Merinos Kuzularının Tahmin Edil
Gelir-Marjinal Masraf Değerleri
233
SU ÜRÜNLERİ ARAŞTIRMALARI
PROGRAM DEĞERLENDİRME
TOPLANTISI
03 – 07 Mart 2014
ANTALYA
YENİ TEKLİF PROJELER
Yeni Teklif Proje
Proje No 1
Proje Başlığı:
Türkiye’nin Akdeniz Kıyısındaki Demersal Balık Stoklarının
Büyüklüklerinin Tahmini
Projeyi Yürüten Kuruluş:
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Projeyi Destekleyen Kuruluş:
Dokuz Eylül Üniversitesi, Deniz Bilimleri ve Teknolojisi Enstitüsü
Proje Yürütücüsü:
Yrd. Doç. Dr. Eyüp Mümtaz TIRAŞIN
Dokuz Eylül Üniversitesi, Deniz Bilimleri ve Tekn. Enstitüsü
Coşkun Menderes AYDIN
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Yardımcı Araştırmacılar:
Doç. Dr. YILMAZ EMRE, Yrd. Doç. Dr. Aydın ÜNLÜOĞLU, Prof. Dr.
Bülent CİHANGİR, Prof. Dr. Okan ÖZAYDIN, Prof. Dr. M. Alp
SALMAN, Araş. Gör. Dr. Sencer Akalın, Hülya ERCAN, Doğan
BAYKALER, Merve KARAKUŞ, Özge ÖZGEN
Hasan ERSÖNMEZ, Osman ARI
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
767.500
Deniz canlı kaynaklarından daha etkin ve sürdürülebilir bir şekilde yararlanabilmek için, bir
alandaki biyokütle miktarının ve bu miktardaki, yatay ve dikey mekana ve zamana (mevsim, yıl) bağlı
değişimlerin bilinmesi büyük önem taşımaktadır. Bu doğrultuda, ülkemiz denizlerinde 1980’li yıllardan
itibaren demersal balıkçılık kaynaklarının büyüklüğünü tahmin etmeye yönelik çeşitli araştırmalar
yapılmıştır.
Söz konusu bu çalışmalardan elde edilen verilerin oldukça sınırlı olması, hatta örnekleme
yöntemlerinde ve standartlarında farklılıklar arzetmesi nedeniyle değerlendirme ve karşılaştırma
bakımından yetersiz kalabildiği söylenebilir. Sonuç olarak, Akdeniz’de demersal balık stoklarının
büyüklüğünü belirlemeye yönelik çalışmalar hem sayı hem de içerik bakımından oldukça az ve
yetersizdir. Özellikle Batı Akdeniz’de yok denecek kadar azdır. Bu proje ile bölgede bilimsel verilere
dayalı balıkçılık yönetimi için gerekli bir çok bilgi elde edilebilecek ve bir veritabanı oluşturulacaktır.
Araştırma materyalini oluşturan demersal balıkçılık kaynakları, Fethiye’den İskenderun
Körfezi’ne kadar uzanan Türkiye’nin Akdeniz kıyısı boyunca dip tolü çekilerek toplanacaktır. Araştırma
Alanı batıdan doğuya doğru sırasıyla I: Fethiye Körfezi, II: Fethiye Körfezi ile Antalya Körfezi arasında
kalan alan, III: Antalya Körfezi, IV: Antalya Körfezi ve İskenderun Körfezi arasında kalan alan ve V:
İskenderun Körfezi olmak üzere 5 alt bölgeye ayrılacak ve her bir bölgede 50 m derinlikten itibaren
uygun dip yapısı varsa 999 m derinliklere kadar dip trolü çekilecektir. Derinlik tabakaları, A: 50-99 m, B:
100-199 m, C: 200-399 m, D: 400-599 m ve E: 600-999 m’ye kadar olarak 5 grupta değerlendirilecektir.
Trol örnekleme sayısı her bir bölgede her bir derinlik tabakasının büyüklüğü dikkate alınarak
belirlenecek ve örnekleme hatları rastgele seçilecektir. Ancak trol örneklemeleri her mevsimde aynı
hatlar üzerinde yapılacaktır. Örneklemeler AKSAM’a bağlı araştırma gemisiyle mevsimsel olarak
yapılacaktır. Söz konusu gemi ile ilgili herhangi bir teknik sorun meydana geldiğinde, DEÜ Deniz
Bilimleri ve Teknolojisi Enstitüsü işletiminde bulunan R/V K. Piri Reis ile örneklemelerin tamamlanması
planlanmaktadır. Araştırma alanının tamamı dikkate alındığında her bir mevsim yaklaşık 40 adet olmak
üzere toplam 160 adet trol örneklemesi yapılması planlanmaktadır.
Dip trolü örneklemeleri gündüz periyodunda gerçekleştirilecek ve örneklemelerde Akdeniz tipi
Türk-İtalyan modeli trol ağı (torba sonu 44 mm göz açıklığında) kullanılacaktır. Trol çekimleri, 2,5 deniz
mili/saat hızla ve ağ deniz tabanına oturduktan sonra mevcut şartlara göre 20-30 dk. süreyle
gerçekleştirilecektir. Her bir trol örneklemesinde, torba güverteye alındıktan sonra avın tamamı türlerine
göre ayrılarak sayıları kaydedilecek ve toplam ağırlıkları denizde ölçüm yapmak için tasarlanmış bir
terazi ile ölçülecektir. Her trol örneklemesi için kendi çekim süresi dikkate alınıp doğrusal orantı
kurularak 1 saatte yakalanan av miktarı (kg/s) hesaplanacaktır. Tutulan av kayıtları örnekleme alt
alanlarına, örnekleme derinliklerine ve mevsimlerine göre gruplandırılarak biyokütle değerleri tahmin
edilecektir. Biyokütle hesaplamalarında “Taranan Alan” yöntemi kullanılacaktır.
Araştırılan türlere ilişkin olarak Sürdürülebilir En Yüksek Verimin (MSY) tahmininde, Cadima’nın
(2003) halen avcılık baskısı altında olan stoklar için önerdiği eşitlik kullanılacaktır. Araştırma
kapsamında elde edilen trol kayıtları MS Excel programında bilgisayar ortamına aktarılacaktır. Her
trolde yakalanan türlerin her birinin bilimsel ismi, sayısı, ağırlığı, yakalandığı alan, trol kaydının alındığı
tarih (ay-gün-yıl formatında) trol numarası, trolün çekildiği yerin koordinatları ve ayrıca trolün gün içinde
çekildiği saat ve dakikası gibi bilgiler de bilgisayar ortamına girilecektir. Elde edilen bu trol kayıtları
zaman, alan, mevsim ve derinliğe bağlı olarak gruplandırılacaktır. Söz konusu gruplandırmada ise birim
zamanda yakalanan av miktarı (kg/saat), birim alandaki biyokütle miktarı (kg/km2), tür çeşitlilik,
düzenlilik ve benzerlik indeksleri hesaplanacaktır. Bray-Curtis benzerlik indeks değerleri kullanılarak
ortalama bağlantı yöntemi ile hiyerarşik kümeleme analizleri yapılacak, böylece trol av kompozisyonları
bakımından bölgeler arasındaki benzerlik seviyeleri ölçülecektir.
Bunlara ek olarak her bir trol çekim alanında, su sıcaklığı, tuzluluğu, yoğunluğu gibi abiyotik
değişkenlere ait veriler de CTD sistemi ile ölçülecektir. Bu verilerin değerlendirilmesi sayesinde,
biyokütle miktarları ile suyun fiziksel özellikleri arasında ilişki olup olmadığı da uygun istatistik yöntemler
kullanılarak araştırılacaktır.
Yeni Teklif Proje
Proje No 2
Proje Başlığı:
Kuzey Ege Denizi’nde Ekonomik Demersal Balık Stoklarının
Araştırılması
Projeyi Yürüten Kuruluş:
Bandırma Koyunculuk Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
Balıkesir Üniversitesi Fen-Edebiyat Fakültesi Biyoloji Bölümü
Proje Yürütücüsü:
Yrd. Doç. Dr. Dilek TÜRKER ÇAKIR, Balıkesir Üniversitesi FenEdebiyat Fakültesi Biyoloji Bölümü
Engin KOCABAŞ Kimya Yük. Müh.
Yardımcı Araştırmacılar:
Zeki ÖZER, Haşim İNCEOĞLU, Murat ŞİRİN, Alpaslan KARA, Habib
BAL, Ahmet ÖKTENER, Özgür Kemal TÜNAY, Kadriye ZENGİN
Aycan BÜYÜKMERT
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
336.500
Bu çalışmada, Kuzey Ege Denizi’nde dağılım gösteren demersal kıkırdaklı ve kemikli balıkların
tür tespiti, stok durumları ve bazı biyolojik özelliklerinin incelenmesi amaçlanmıştır. Aynı zamanda
ortam koşullarının durum tespiti için fiziko-kimyasal örneklemeler yapılacaktır. Böylece doğal
kaynakların korunup geliştirilmesine yönelik bilgi birikimi sağlanacaktır. Örnekler Ocak 2015-Aralık 2017
tarihleri arasında 0-50m, 50-100m, 100-200m ve 200>m derinliklerde mevsimlik trol çekimleri yapılarak
toplanacaktır. Elde edilen verilere dayanarak Kuzey Ege Denizi’nde demersal balıkların av
kompozisyonu, CPUE (kg/sa), birim alanda ürün miktarı (kg/km²) ve stok miktarı (ton), mevsimsel ve
derinlik dağılımları, görünme sıklıkları hesaplanarak, benzerlikler küme analizi (cluster) ile
araştırılacaktır. Ticari değeri olan demersal türlerin boy-ağırlık ölçümleri ve otolitleri alınarak, yaş-boy
dağılımı, büyüme, ölüm parametreleri, sömürülme oranları, eşey oranı, boy-ağırlık ilişkisi, üreme
zamanı, ilk eşeysel olgunluk boyu ve fekonditesi tespit edilecektir. Proje sonuçları ile bölgenin balıkçılık
kaynaklarının durumu ve uygulanan yönetim stratejisinin etkinliği değerlendirilerek, bu kaynakların
korunması ve sürdürülebilir üretimine yönelik bilimsel öneriler sunulacaktır.
Bu çalışma Barbaros isimli araştırma gemisi ile yürütülecektir. Araştırma Bölgesi Kuzey Ege
Denizi; Edremit Körfezi, Müsellim Geçidi, Bozcada, Gökçeada, Gelibolu Yarımadası, kuzeyde Trakya
kıyıları arasında ki Saros Körfezi’nin Türk Karasularında kalan alandan oluşmaktadır. Kuzey Ege
Denizi’nde trol çekimine elverişli alanlarda mevsimsel olarak balık avcılığı yapılacaktır. Denizel saha
çalışmaları Mart 2015-Şubat 2017 tarihleri arasında, 0-50 m, 50-100 m, 100-200 m ve 200-500 m
derinlik konturlarında mevsimsel olarak trol çekimi yapılarak gerçekleştirilecektir. Trol çekimleri 2,5-2,7
mil/saat hızında yarım saat olarak planlanmaktadır. Trol çekimleri esnasında ağa takılacak olan CTD
cihazıyla avcılık sahasının sıcaklık, tuzluluk ve derinlik verileri gerçek zamanlı olarak kaydedilecektir.
Yakalanacak olan balıkların av miktarının (ürün) hesabı, birim zamanda yapılan avcılık yöntemiyle
hesaplanacaktır. Her bir trol örneklemesinde avın tamamı türlerine göre ayrılarak, toplam ağırlık
ölçümleri teknede terazi ile yapılacaktır. Örnekleme işlemi Holden ve Raitt (1974) yöntemine göre
yapılacaktır. Trolde yeterli miktarda av çıkmadığı durumlarda avın tamamı örnek olarak alınacak, fazla
çıktığı durumlarda ise alt örnekleme uygulanacaktır. Her trolün kendi çekim süresi dikkate alınarak 1
saatte yakalanan av miktarları (kg/sa) hesaplanacaktır. Tutulan av kayıtları derinlik konturlarına ve
mevsimlere göre gruplandırılarak ve ağırlık ortalamaları bulunacaktır. Araştırma süresince elde edilen
türlerin teşhisi Whitehead vd. (1986), Fischer vd. (1987)‟a göre yapılacaktır. Balıkların sistematik
isimlendirilmesi ve türlerin adlandırılmasında Froese ve Pauly (2008)‟e uyulacaktır
Balık örnekleri laboratuar çalışmaları için soğuk muhafaza koşullarında taşıma kapları ile
Balıkesir Üniversitesi Fen-Edebiyat Fakültesi Biyoloji Bölümü Zooloji laboratuvarına nakledilecektir.
Laboratuvara getirilen örnekler üzerinde toplam boy, vücut ağırlığı, cinsiyet, gonad ağırlığı, gonad
safhası ölçümleri alınacaktır. Yaş tayini için otolitleri çıkarılacaktır.
Birim alandaki stok miktarları (biyokütle kg/km²) tarananalan yöntemine göre hesaplanacaktır.
(Bingel ve ark. 1995; İşmen, 2001; Avşar, 2005). Bu yöntem, birim alanda ya da birim çabada ağırlık
olarak ortalama av miktarının birim alandaki biyokütleye oransal olmasına dayanmaktadır (Sparre vd.,
1989). Toplam biyokütle tahmini, farklı derinlik konturlarına göre yapılacaktır.
Yeni Teklif Proje
Proje No 3
Proje Başlığı:
Antalya Körfezi’nde Ticari Karides Türlerinin Biyolojik
Özellikleri ve Stok Büyüklüklerinin Tahmini
Projeyi Yürüten Kuruluş:
Akdeniz Su Ürünleri Araştırma, Üretme ve Eğitim Enstitüsü
Müdürlüğü
Projeyi Destekleyen Kuruluş:
Dokuz Eylül Üniversitesi, Deniz Bilimleri Enstitüsü
Proje Yürütücüsü:
Yrd. Doç. Dr. Aydın ÜNLÜOĞLU, Dokuz Eylül Üniversitesi, Deniz
Bilimleri Enstitüsü
Hülya ERCAN, Su Ürünleri Yük Müh, Akdeniz SÜAÜE
Yardımcı Araştırmacılar:
Doç. Dr. Yılmaz EMRE, Yrd. Doç. Dr. Eyüp Mümtaz TIRAŞIN,
Coşkun Menderes AYDIN, Doğan BAYKALER, Merve KARAKUŞ,
Osman ARI
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
628.500
Ülkemiz denizlerinde altmıştan fazla karides türü tespit edilmiş olmasına rağmen karidesler
üzerine yapılan araştırmalar oldukça az sayıdadır. Akdeniz’de ticari türler arasında Aristeo
morphafoliacea, Aristeus antennatus, Melicertus kerathurus, Metapenaeus monoceros, Parapenaeus
longirostris, Penaeus japonicus, Penaeus semisulcatus, Plesio nikamartia gibi türler örnek gösterilebilir.
Önerilen bu araştırma projesi ile Antalya Körfezi’ndeki ticari karides türlerinin stok büyüklükleri
tahmin edilecek ve söz konusu bu türlerin boy dağılımı, üreme ve büyüme gibi bazı temel populasyon
özellikleri tespit edilecektir. Örneklemeler Akdeniz Su Ürünleri Araştırma, Üretme ve Eğitim Enstitüsü’ne
bağlı araştırma gemisiyle dip trolü çekilerek aylık aralıklarla yapılacaktır. Örneklemeler 50 m ile 999 m
arasındaki 6 derinlik tabakasında yürütülecektir. Söz konusu bu derinlik tabakaları şu şekildedir;A:50-99
m, B: 100-199 m, C: 200-399 m, D: 400-599 m ve E: 600-799 ve F:800-999 m. Trol örnekleme sayısı
herbir derinlik tabakasının büyüklüğü dikkate alınarak belirlenecek (her derinlik tabakasında en az 2
adet) ve örnekleme hatları rastgele seçilecektir. Trol örneklemeleri, her örnekleme periyodunda aynı
hatlar üzerinde yapılacaktır. Her bir trol örneklemesinde, torba güverteye alındıktan sonra avın tamamı
türlerine göre ayrılarak sayıları kaydedilecek ve toplam ağırlıkları denizde ölçüm yapmak için
tasarlanmış bir terazi ile ölçülecektir. Tutulan av kayıtları, örnekleme derinliklerine ve aylarına göre
gruplandırılarak biyokütle değerleri tahmin edilecektir. Biyokütle hesaplamalarında “Taranan Alan”
yöntemi kullanılacaktır. Ticari karides türleri için tahmin edilen stok büyüklükleri derinliğe ve örnekleme
ayına göre değerlendirilecektir. Bu çalışmanın sonunda Antalya Körfezi’ndeki ticari karidesler için bir
balıkçılık yönetim planı da sunulacaktır.
Araştırma konusunu oluşturan ticari karides türleri Antalya Körfezi’nden dip trolü ile
örneklenecektir. Örneklemeler Akdeniz Su Ürünleri Araştırma, Üretme ve Eğitim Enstitüsü’ne bağlı
araştırma gemisiyle aylık aralıklarla yapılacaktır. Örneklemelerde Akdeniz tipi Türk-İtalyan modeli trol
ağı (torba sonu “codend” 44 mm göz açıklığında) kullanılacak ve trol çekim hızı ortalama 2,5 knot ve
trol çekim süresi trol ağı deniz tabanına oturduktan sonra 30 dakika tutulacaktır. Örneklemeler 50 m ile
999 m arasındaki 6 derinlik tabakasında yürütülecektir. Söz konusu bu derinlik tabakaları şu şekildedir;
A: 50-99 m, B: 100-199 m, C: 200-399 m, D: 400-599 m ve E: 600-799 ve 800-999 m. Trol örnekleme
sayısı herbir derinlik tabakasının büyüklüğü dikkate alınarak belirlenecek (her derinlik tabakasında en
az 2 adet) ve örnekleme hatları rastgele seçilecektir. Trol örneklemeleri, her örnekleme periyodunda
aynı hatlar üzerinde yapılacaktır. Her bir trol örneklemesinde, torba güverteye alındıktan sonra avın
tamamı türlerine göre ayrılarak sayıları kaydedilecek ve toplam ağırlıkları denizde ölçüm yapmak için
tasarlanmış bir terazi ile ölçülecektir. Her trol örneklemesi için kendi çekim süresi dikkate alınıp
doğrusal orantı kurularak 1 saatte yakalanan av miktarı (kg/s) hesaplanacaktır. Tutulan av kayıtları
örnekleme derinliklerine ve aylarına göre gruplandırılarak biyokütle değerleri tahmin edilecektir.
Biyokütle hesaplamalarında “Taranan Alan” yöntemi kullanılacaktır (Sparre ve Venema, 1992).
Taranan alanın hesaplanmasında trol ağının ortalama ağız açıklığının belirlenebilmesi için
örneklemelerde "Net Sounder" sistemi kullanılacaktır. Trol çekimleri esnasında Net Sounder’a ait
sensörler, trol kapıları ve trol ağı üzerine monte edilecektir. Bu sensörler trol ağının ağzının yatay ve
dikey açıklıkları ile ağın tabandan yüksekliğini ölçüp, verileri gemi karinasındaki özel bir hidrofona
iletmektedir. Hidrofonla bağlantılı olan bilgisayara ulaşan verilerin özel bir bilgisayar yazılımı ile
değerlendirilmesi sayesinde, dipteki ağın durumu ağ çekim süresince ekranda grafik olarak
izlenebilmektedir. Böylece her bir trol örneklemesi sırasında ağın tabana oturma ve kalkma zamanları
ile trol kapıları arasındaki mesafeler belirlenerek, trol çekim süresi ve taranan alan hassas olarak
ölçülebilmektedir (Cihangir ve Benli, 1999; Benli vd., 2000).
Yeni Teklif Proje
Proje No 4
Proje Başlığı:
Marmara Denizi Ekonomik Demersal Balık Türlerinin
Popülasyon Yapısı ve Stok Tahmini
Projeyi Yürüten Kuruluş:
Koyunculuk Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
Çanakkale 18 Mart Üniversitesi
Proje Yürütücüsü:
Prof. Dr. Ali İŞMEN, Çanakkale 18 Mart Üniversitesi
Deniz Bilimleri ve Teknolojisi Fakültesi
Murat ŞİRİN, Su Ürünleri Yüksek Mühendisi
Koyunculuk Araştırma İstasyonu -Su Ürünleri Bölümü
Yardımcı Araştırmacılar:
Zeki ÖZER, Haşim İNCEOĞLU, Murat ŞİRİN, Alpaslan KARA, Habib
BAL, Ahmet ÖKTENER, Özgür Kemal TÜNAY, Kadriye ZENGİN
Aycan BÜYÜKMERT
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
380.000 TL
Bu çalışmada Türkiye Balıkçılığında önemli bir yere sahip Marmara Denizi’ndeki demersal balık
populasyonlarının yapısı, stok miktarı, zamansal-alansal dinamikleri incelenerek, ekonomik türlerin
populasyon parametreleri saptanacaktır. Örnekler Mayıs 2015-Şubat 2017 tarihleri arasında 0-50m, 50100m, 100-200m ve 200>m derinliklerde mevsimlik trol çekimleri yapılarak toplanacaktır. Elde edilen
verilere dayanarak Marmara Denizi’nde demersal balıkların av kompozisyonu, CPUE (kg/sa), birim
alanda ürün miktarı (kg/km²) ve stok miktarı (ton), mevsimsel ve derinlik dağılımları, görünme sıklıkları
hesaplanarak, benzerlikler küme analizi (cluster) ile araştırılacaktır. Ticari değeri olan demersal türlerin
boy-ağırlık ölçümleri ve otolitleri alınarak, yaş-boy dağılımı, büyüme, ölüm parametreleri, sömürülme
oranları, eşey oranı, boy-ağırlık ilişkisi, üreme zamanı, ilk eşeysel olgunluk boyu ve fekonditesi tespit
edilecektir. Proje sonuçları ile bölgenin balıkçılık kaynaklarının durumu ve uygulanan yönetim
stratejisinin etkinliği değerlendirilerek, bu kaynakların korunması ve sürdürülebilir üretimine yönelik
bilimsel öneriler sunulacaktır.
Bu çalışma Koyunculuk Araştırma İstasyonu Müdürlüğü’ne ait olan Barbaros isimli araştırma
gemisi ile yürütülecektir. Marmara Denizi’nde trol çekimine elverişli alanlarda mevsimsel olarak balık
avcılığı yapılacaktır. Denizel saha çalışmaları Mayıs 2015-Şubat 2017 tarihleri arasında, 0-50 m, 50100 m, 100-200 m ve 200>m derinlik konturlarında mevsimsel olarak trol çekimi yapılarak
gerçekleştirilecektir. Trol çekimleri 2,5-2,7 mil/saat hızında yarım saat olarak planlanmaktadır. Trol
çekimleri esnasında ağa takılacak olan CTD cihazıyla avcılık sahasının sıcaklık, tuzluluk ve derinlik
verileri gerçek zamanlı olarak kaydedilecektir. Yakalanacak olan balıkların av miktarının (ürün) hesabı,
birim zamanda yapılan avcılık yöntemiyle hesaplanacaktır. Her bir trol örneklemesinde avın tamamı
türlerine göre ayrılarak, toplam ağırlık ölçümleri teknede terazi ile yapılacaktır. Örnekleme işlemi Holden
ve Raitt (1974) yöntemine göre yapılacaktır. Trolde yeterli miktarda av çıkmadığı durumlarda avın
tamamı örnek olarak alınacak, fazla çıktığı durumlarda ise alt örnekleme uygulanacaktır. Her trolün
kendi çekim süresi dikkate alınarak 1 saatte yakalanan av miktarları (kg/sa) hesaplanacaktır. Tutulan av
kayıtları derinlik konturlarına ve mevsimlere göre gruplandırılarak ve ağırlık ortalamaları bulunacaktır.
Araştırma süresince elde edilen türlerin teşhisi Whitehead vd. (1986), Fischer vd. (1987)’a göre
yapılacaktır. Balıkların sistematik isimlendirilmesi ve türlerin adlandırılmasında Froese ve Pauly
(2008)’e uyulacaktır.
Yeni Teklif Proje
Proje No 5
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Projenin Toplam Bütçesi
Türkiye’nin Akdeniz Kıyısalında Kızıl Deniz Kökenli
(Lessepsıyan) Balıkların Trol Av Kompozisyonundaki Dağılımı
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Dokuz Eylül Üniversitesi, Deniz Bilimleri ve Teknolojisi Enst.
Prof. Dr. Bülent CİHANGİR
Dokuz Eylül Üniversitesi, Deniz Bilimleri ve Teknolojisi Enst.
Doğan BAYKALER
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Doç. Dr. YILMAZ EMRE, Doç. Dr. E. Mümtaz TIRAŞIN, Yrd. Doç.
Dr. Aydın ÜNLÜOĞLU, Cem DALYAN, Özge ÖZGEN, Coşkun
Menderes AYDIN, Hülya ERCAN, Merve KARAKUŞ, Osman ARI
01.01.2015-31.12.2017
436,500 TL
Doğu Akdeniz’de Süveyş Kanalı’nın 1869 yılında açılmasıyla birlikte, coğrafik olarak birbiriyle
tamamen ayrı olan iki farklı denizel alanın “buluşması” sağlanmış, günümüze kadar çok sayıda karşılıklı
olarak “canlı takası” oluşa gelmiştir. Bilindiği üzere son yıllarda küresel ısınma ve iklim değişimlerine
bağlı olarak da Akdeniz ekosistemi üzerinde “yerli olmayan” Kızıl Deniz kökenli balıkçılık kaynaklarının
mevcudiyeti gün geçtikçe artmakta; söz konusu artış yerli türlerin varlığını belirgin bir şekilde
etkilemekte ve hatta bazı türler için tehdit unsuru bile oluşturabilmektedir. Bütün denizlerimizde 500
civarında balık türü yaşarken bu sayının %10 civarında bir bölümünü Kızıl Deniz kökenli (Lessepsiyan)
türlerden oluşmaktadır. Kızıl Deniz kökenli türlerin varlığıyla ilgili olarak günümüze kadar yapılmış çok
sayıda münferit çalışma mevcut olmakla birlikte; söz konusu bölgede (İskenderun-Anamur arası)
yapılmış en kapsamlı genel çalışma (Gücü ve diğ, 1994) 20 yıl öncesine dayanmaktadır. Balıklar ile ilgili
en son derleme Bilecenoğlu (2010) tarafından, omurgasızları da içine alan derleme ise Çınar ve diğ.
(2011) tarafından hazırlanmıştır. Akdeniz genelinde yabancı tür girişi ile ilgili olarak Zenetos ve diğ.
(2012), Galil ve Goren (2014) tarafından hazırlanan derleme en kapsamlı ve güncel olanıdır.
Şimdiki çalışmada Fethiye-İskenderun Körfezi arasında kalan kıta sahanlığında yapılacak trol
örneklemeleriyle, Lesssepsiyan türlerin trol av kompozisyonundaki dağılımları ve ticari olarak
değerlendirilebilecek türlerin popülasyon özellikleri tespit edilecektir. Ayrıca örnekleme yapılan her
bölgedeki balıkçı barınaklarında ve/veya su ürünleri kooperatiflerinde doğrudan üreticiyle ve/veya balık
hallerindeki komisyoncularla anket uygulaması yapılarak avlanan türler hakkında veri toplanacaktır.
Yeni Teklif Proje
Proje No 6
Proje Başlığı:
Uluabat Gölündeki Turna Balığı’nın (Esox lucius) Populasyon
Büyüklüğünün Tahmin Edilmesi ve Avcılığında Kullanılan Av
Araçlarının Seçicilik Özelliklerinin Belirlenmesi
Projeyi Yürüten Kuruluş:
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Projeyi Destekleyen Kuruluş:
-Çanakkale Onsekiz Mart Üniversitesi
-Bursa İl Gıda Tarım ve Hayvancılık Müdürlüğü
-S.S. Gölyazı Su Ürünleri Kooperatifi
Proje Yürütücüsü:
Mehmet CİLBİZ (Su Ürünleri Yüksek Mühendisi)
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Yardımcı Araştırmacılar:
Doç.Dr.Adnan AYAZ, Bayram KORKMAZ, Şakir ÇINAR, Kadir
ÇAPKIN, S.Oğuz KORKUT, Mustafa CEYLAN, Dr.Ramazan
KÜÇÜKKARA, Osman YENER, Zübeyde HANOL
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
97.555 TL
Turna Balığı, Uluabat Gölü’ndeki ekonomik değeri en yüksek olan balık olup, bu gölde avcılık
yapan yaklaşık 400 balıkçının en önemli geçim kaynağıdır. Ancak göldeki üretim miktarlarına
bakıldığında, son 10 yılda önemli dalgalanmalar gözlemlenmekte ayrıca son birkaç yıllık üretim
miktarlarındaki ciddi bir düşüş dikkati çekmektedir. Bu bilgilerin yanında ortalama boylardaki düşüş ve
birim av cabasındaki azalma, bu balığının göldeki geleceğinin tehlike altında olduğunu göstermektedir.
Bu durumun temel nedenlerine baktığımız zaman belirlenen yıllık av kotasının yüksek olması
(populasyon büyüklüğü ve avlanabilir stoğun gerçek anlamda bilinmiyor olması), üreme boyunun
altındaki bireylerin avlanıyor olması (av aracı seçiciliği ile ilgili sorunlar), denetim yetersizlikleri ve
eğitimsizlik sorunları karşımıza çıkmaktadır. Tüm bu sorunlara çözüm bulmak amacıyla hazırlanmış
olan bu projede; Virtual Populasyon Analizi yöntemi ile Uluabat Gölü’ndeki Turna Balığının popülasyon
büyüklüğü, Thompson ve Bell metoduna göre de geleceğe yönelik ürün ve biyomas tahmini
yapılacaktır. Select Metot (Millar and Walse, 1992; Millar ve Holst, 1997) ile gölde Turna Balığı
avcılığında kullanılan uzatma ağları, paraketalar ve balık pinterlerinin seçicilik özellikleri belirlenecektir.
Bu çalışmalarda gölde halen kullanılmakta olan av araçlarının seçicilik özelliklerinin ortaya
konulmasının yanında bu av araçlarının seçiciliğini artırmaya yönelik bir takım modifikasyonlar
yapılacaktır. Böylece göl için boy ve tür seçiciliği en yüksek olan av aracı belirlenmiş olacak, av
araçlarının hedef dışı av oranları azaltılmış olacaktır. Bu av araçlarının kullanımının yaygınlaşması ile
ekolojik balıkçılık hedefine katkı sağlanacaktır. Örnekleme çalışmalarında av araçlarından elde edilen
Turna Balığı dışındaki ekonomik balıklarında tür, yaş, boy ve eşey dağılımlarına yönelik veri
toplanacak, bu sayedeki göldeki diğer balık türleri hakkında bir takım bilgiler edinilmiş olacaktır. Proje
sonucunda balıkçılık yönetim otoritelerine göldeki Turna Balığı popülasyonu ve av araçlarının seçicilik
özelliklerine yönelik kapsamlı bilgiler sunulacak; Turna Balığı avcılığında kullanılan av araçlarının
seçicilik özelliklerine ilişkin literatür boşluğu doldurulacak; av aracı seçiciliğine yönelik denetim
elemanlarına ve balıkçılara eğitim çalışmaları gerçekleştirilecektir.
Yeni Teklif Proje
Proje No 7
Proje Başlığı:
Atatürk Baraj Gölü ve Aşağı Fırat Havzası’nda Yaşayan
Mezopotamya Yayını (Silurus triostegus)’nın Avlanma
Tercihlerinin Belirlenmesi
Projeyi Yürüten Kuruluş:
GAP Tarımsal Araştırma Enstitüsü Müdürlüğü
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Fatma Pınar KARADUMAN, Balıkçılık Tekn. Yüksek Mühendisi,
GAPTAEM
Yardımcı Araştırmacılar:
Mahmut YÜKSEL, Oğuz Yaşar UZUNMEHMETOĞLU, Reşit DEMİR
Mustafa Şeref ŞELLİ
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2018
Projenin Toplam Bütçesi
42.600 TL
Mezopotamya Yayın Balığı (Silurus triostegus), Siluridae familyasına ait bir türdür.
Mezopotamya Bölgesi’nde yani Suriye, Irak, İran ve Türkiye’de yayılım gösterir. Üreme zamanı Mayıs,
Haziran ve Temmuz aylarıdır. Mezopotamya yayını ekonomik açıdan önemli bir türdür. Dişi ve
erkeklerde ortalama kondüsyonfaktörü sırasıyla 0,99055/kg. ve 0,95625/kg.’dır. En yüksek kondüsyon
faktörü değeri Nisan, en düşük ise Aralık ayındadır. Eşeysel olgunlaşma yaşı dişilerde IV, erkeklerde III’
tür. Ortalama yumurta çapı 1,035 mm ile temmuz ayında en düşük, 1, 937 mm ile mayıs ayında en
yüksek, yumurta sayısı ise 6800 ile 120300 arasındadır (Oymak ve ark., 2000). Morfolojik olarak ise, 4
dorsal yüzgeç ışını, 81-86 anal yüzgeç ışınlarına sahiptir. Ayrıca ilk solungaç kemeri üzerinde 12-16
diken vardır. Büyük bir ağıza sahip ve alt çene üst çeneden daha uzundur. Bıyıklara sahiptir. Anal
yüzgeç kaudal yüzgeç (kuyruk yüzgeci) ile kaynaştığından ayırt edilemez. Ayrıca vücudun üst kısmında
sarı-kahverengi ve siyah, yine karın bölgesinde de siyah beneklere sahiptir (Ünlü ve ark., 2012).
Maksimum ağırlığı: 8,5kg. ve maksimum uzunluğu dişilerde 99 cm., erkeklerde ise 81cm.
olabilmektedir.
Bu çalışmanın, Atatürk Baraj Gölü ve Aşağı Fırat Havzası’ndan mevsimsel olarak belirli
periyotlarla (şubat-mart, temmuz-ağustos, kasım-aralık) alınan balık örneklerinin laboratuvar
koşullarında sindirim aygıtlarının (mide) incelenmesiyle birlikte tanımlanan balıkların teşhis edilerek
gruplandırılması ve sayılması yoluyla yürütülmesi planlanmaktadır. Çalışma 3 yıl sürecektir. Daha önce
beslenme stratejisi hakkında herhangi bir çalışmaya rastlanılmayan Mezopotamya yayınının (Silurus
triostegus Heckel, 1843) avlanma (besin) tercihlerini belirlemeye ayrıca herhangi bir besin seçiciliği olup
olmadığı tespit edilmeye çalışılacaktır.
Yeni Teklif Proje
Proje No 8
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Amatör Balıkçılığın Beyşehir Gölü Balık Stoklarına Etkisi
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Isparta Sportif Olta Balıkçılığı ve Su Hayatını Koruma Derneği
Fuat BİLGİN, Su Ürünleri Yüksek Mühendisi
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Yardımcı Araştırmacılar:
Doç. Dr.Yıldız BOLAT, Rahmi UYSAL, Mehmet CESUR, Vedat
YEGEN, Niyazi Can GÖKÇINAR, Kadir ÇAPKIN, Mehmet CİLBİZ
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
88.608 TL
Amerika ve Kanada gibi ülkelerde ticari boyutta olta balıkçılığı yapılmaktadır. Kamu ve özel
sektörce, belirli bölgelerde olta balıkçılığına yönelik turizm yaratılmıştır. Burada balık ticari bir araca
dönüştürülmüş ve balıklandırma programları, çevre koruma programları paralelinde desteklenmektedir.
Bu şekilde yürütülen çalışmalarla milyar dolarlık bir sektör yaratılmış ve çeşitli alanlarda turizm
etkinlikleri geliştirilerek hizmet sektörü haline gelmiştir. Ülkemizde ise sportif olta balıkçılığı konusunda
yapılan çalışmalar maalesef çok yetersiz kalmakta, sektörün ihtiyaçları, sorunları ve ekonomik
büyüklüğü hakkında yeterli veriler bulunmamaktadır. Ülkemizde ne kadar sportif olta balıkçısının
bulunduğu dahi yasal düzenlemelerin eksik kalması nedeniyle tam olarak bilinmemektedir.
Bugün Türkiye’de amatör olta balıkçılığıyla uğraşanların sayısının 1 milyon civarında olduğu
tahmin edilmektedir. Büyük bir potansiyeli olan sektörün var olan balık stokları üzerinde ne kadar baskı
oluşturduğu da bilinmemektedir. Bu durum içsularda bulunan balık populasyonları ve tür çeşitliliği
açısından önem arz etmektedir. Sportif avcılıkla ilgili gerekli yasal düzenlemelerin yapılması ile
sürdürülebilir balıkçılık ve türlerin neslinin korunması sağlanmış olacaktır. Diğer taraftan sportif
balıkçılığın kontrollü bir şekilde desteklenmesi ile hem bu potansiyelin ülke ekonomisine sağladığı katkı
ve yarattığı katma değer, oluşturduğu istihdam düşünüldüğünde konu daha fazla değer kazanmaktadır.
Bu konuyla ilgili ülkemizde hiçbir veri bulunmamaktadır. Bu çalışma ile Beyşehir gölünde amatör
balıkçıların sosyo-ekonomik yapıları belirlenecek, amatör balıkçılık faaliyetlerinin var olan balık
stoklarına ne derecede etki ettiği saptanacak, kamu kuruluşlarınca amatör olta balıkçılığına yönelik
yasal düzenlemelere altyapı oluşturulacaktır.
Yeni Teklif Proje
Proje No 9
Proje Başlığı:
İznik Gölündeki Gümüş Balığının (A. boyeri) Avlanabilir Stok
Miktarının Tahmin Edilmesi; Avcılıkta kullanılan Av Aracının
Seçicilik Özelliklerinin ve Uygun Avcılık Yerlerinin Araştırılması
Projeyi Yürüten Kuruluş:
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Projeyi Destekleyen Kuruluş:
İznik, Çakırca, Orhangazi ve Narlıca Su Ürünleri Kooperatifleri
Proje Yürütücüsü:
Rahmi UYSAL Su Ürünleri Mühendisi
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Yardımcı Araştırmacılar:
Mahmut YÜKSEL, Oğuz Yaşar UZUNMEHMETOĞLU, Reşit DEMİR
Mustafa Şeref ŞELLİ
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
66.310 TL
İstilacı bir tür olmasına karşın İznik Gölü’nde ilk defa varlığı Altun (1991) tarafından bildirilen
Atherina boyeri avcılığından elde edilen ürünün büyük çoğunluğu yurt dışına gönderilmektedir. İznik
Gölü balıkçıları için önemli bir gelir kaynağı olan Gümüş balığı avcılığı’nın düzenlenmesi ile ilgili olarak
yapılan çalışma sayısı oldukça sınırlıdır. Bu türün avcılığında kullanılan av aracından ötürü, kendi
populasyonunun sürdürülebilirliği yanında diğer türleri de direkt olarak etkilemektedir. Bu proje ile
gümüş balığının sürdürülebilirliğine esas avlanabilir stoğunun belirlenmesi, üreme ve büyüme
özelliklerinin tespit edilmesi, verimli ve ekolojik bir avcılığa yönelik avlama alanlarının ortaya konması,
avcılıkta kullanılan av araçlarının boy seçiciliğine yönelik çalışmalar ile hedef dışı av oranın
azaltılmasına yönelik araştırmalar yapılacaktır. Bu çalışma ile İznik Gölü Gümüş balığı avcılığı ile ilgili
olarak balıkçılık yönetim otoritelerine güncel ve son derece kapsamlı veriler sunulacaktır. Ekolojik
yaklaşımlı avcılık konusunda balıkçılara yönelik eğitim faaliyetleri de yapılacaktır.
Yeni Teklif Proje
Proje No 10
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
K.K.T.C. Denizlerinde Balık Stoklarının Araştırılması Projesi
KKTC Hayvancılık Dairesi-Su Ürünleri Şubesi
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Dokuz Eylül Ü., Deniz Bilimleri ve Teknolojisi Enstitüsü
Proje Yürütücüsü:
Uğur SENCER Su Ürünleri Mühendisi
KKTC Hayvancılık Dairesi-Su Ürünleri Şubesi
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2018
Projenin Toplam Bütçesi
1.200.000 TL
Mevcut stokların optimum ve sürdürülebilir kullanımını sağlamak, her şeyden önce mevcut
durumun tespit edilebilmesi ve izlenmesi ile mümkündür. Dünyada ve Anavatan Türkiye”de artık stok
çalışmaları çok geniş yer tutmaya başlamışken, KKTC de yapılan çalışmalar yetersiz kalmıştır.
Önerilen araştırma projesi, başlığından anlaşılacağı üzere, münferit bir projeden ziyade her biri
proje özelliğinde olan birçok farklı ancak bağıntılı araştırma konularını içeren bütünleşik bir program
şeklinde tasarlanmıştır. Bu tasarımın nedeni, AB’nin Ortak Balıkçılık Politikası kapsamındaki balıkçılık
ve balıkçılık kaynaklarının yönetimi ile ilgili olarak, ülkemizin öteden beri gereksindiği balıkçılık
stoklarımızın mevcut durumu ve bunu ortaya çıkaran etmenler hakkında somut ölçülebilir veri ve
bilgilerin üretilmesi olmasıdır. Bu sayede, AB mevzuatı gereği belirlenecek paylaşılan stoklar, av
kotaları, avcılık filosunun büyüklüğü, ulusal ve uluslararası koruma ve/veya avcılığa sınırlı alanların
belirlenmesi ve nihayetinde balıkçılık ve balıkçılık kaynaklarının yönetim ilkelerinin bilimsel ve
kanıtlanabilir bilgi ve belgelere dayanılarak tartışılmasını sağlanabilecektir. Elde edilecek bulgular ile bu
alanlardaki bilimsel altyapı eksikliğinin giderilmesi, Av yasak ve sınırlarının belirlenmesine ışık
tutulması ve KKTC balıkçılığının daha bilimsel ve sistemli yeniden yapılandırılmasına olanak
sağlanması amaçlanmaktadır.
Yeni Teklif Proje
Proje No 11
Proje Başlığı:
Levrek (Dicentrarchus labrax) larvalarında mikrokapsül yem ile
beslenmenin büyüme ve yağ asidi içeriğine etkisi
Projeyi Yürüten Kuruluş:
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enst. Müdürlüğü
Projeyi Destekleyen Kuruluş:
Süleyman Demirel Üniversitesi, Su Ürünleri Fakültesi
Proje Yürütücüsü:
İsa AYDIN, Su Ürünleri Yüksek Mühendisi
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Prof. Dr. Sevgi SAVAŞ (Eş Lider)
Süleyman Demirel Üniversitesi Su Ürünleri Fakültesi
Yardımcı Araştırmacılar:
Doç. Dr. Yılmaz EMRE, Durali ERASLAN, Abdullah DEMİR, Adem
KURTOĞLU, Dr. Hüseyin Sevgili
Başlama-Bitiş Tarihleri:
01.06.2014-31.01.2016
Projenin Toplam Bütçesi
66.405 TL
Levrek larvalarında büyüme ve yaşama oranındaki başarı ilk beslemenin kalitesine bağlıdır.
Levrek yetiştiriciliğinde larvalar ilk beslenme dönemlerinde canlı yeme ihtiyaç duymakta ve kuru yeme
yavaş yavaş adapte edilerek beslenmektedir. Levrek larval döneminde mikrokapsül yemler birçok
kuluçkahanede yoğun olarak kullanılmaktadır. Bu çalışmada levrek (D. labrax) balığının larvalarının ilk
beslenme periyodunda, mikrokapsül yem kullanılacaktır. Kontrol grubundaki (K) larvalar sadece artemia
ile beslenecektir. Larvalarda oluşturulacak besleme rejimine göre I. grupta besleme Artemia nauplii ile
başlatılacaktır. Besleme, farklı günlerde ve farklı boyutlardaki mikrokapsül yem (11. gün; Gemma 75,
20. gün; Gemma 150; ve 32. gün; Gemma 300) ile devam ettirilecektir. II. grupta besleme, Artemia
kullanılmaksızın farklı günlerde ve boyutlardaki mikrokapsül yemle (8. gün; Gemma 75, 20. gün;
Gemma 150; ve 32. gün; Gemma 300) yapılacaktır. Mikrokapsül yem kullanımının, canlı yem kullanım
süresinin azaltılmasına, larvaların yaşama ve büyüme oranları ile yağ asidi içeriğine etkisinin
belirlenmesi amaçlanmıştır.
Yem teknolojisindeki hızlı gelişmeye rağmen entansif balık ve kabuklu yetiştiriciliğinde yumurta
kesesi çekilmiş larvaların ilk beslenme periyodunda canlı yem organizmaları ile yapılan besleme,
larvaların büyüme ve yaşama oranını arttırmaktadır. Bu çalışmada deniz balıkları yetiştiriciliğinde
ekonomik önemi olan levrek balığı seçilmiştir. Levrek yetiştiriciliğinde larvalar ilk beslenme
dönemlerinde canlı yeme ihtiyaç duymakta ve kuru yeme yavaş yavaş adapte edilerek beslenmektedir.
Bu çalışmada levreklerin larval döneminde birçok kuluçkahanede yoğun olarak kullanılan Gemma
partikül yem ile uygulanacak besleme rejiminde canlı yem kullanım süresinin azaltılması amaçlanmıştır.
Çalışmadan elde edilecek sonuçlar ile canlı yemsiz veya kısa süreli canlı yemle besleme sonrası
mikpartikül yeme adaptasyonun sağlanması ortaya konulacaktır. Pratikte kuluçkahanelerde
uygulanabilirliği bilimsel olarak tespit edilerek, yoğun üretim yapan kuluçkahanelerde uygulanması
durumunda ekonomik verim üzerine yüksek oranda katkı sağlayacağı düşünülmektedir. Amaçlanan
hedef çıktılarından birisi rotifersiz ve artemia olmadan yani canlı yemsiz uygulanacak beslemenin
larvanın büyüme ve yaşama oranındaki etkisinin ortaya konulmasıdır. Ayrıca larvalardaki yağ asidi
içeriğinin belirlenmesi ile yem ve besinsel kompozisyon arasındaki ilişkide ortaya konulacaktır. Levrek
larvalarında yapılmış sınırlı sayıdaki çalışmaya katkı sağlayacak bu proje önergesinin sonuçları ile
litaratüre katkı sağlayacaktır. Ayrıca proje önergesinde elde edilecek sonuçlarla hem kuluçkahanelerde
uygulanabilirliği hem de farklı balık türlerinde yapılacak ileriki araştırmalara da ışık tutulması ve katkı
sağlanması da beklenmektedir.
Yeni Teklif Proje
Proje No 12
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Melatonin ve Serotonin’in, Astacus leptodactylus (Eschscholtz,
1823) Yavrularının Yaşama Oranı, Büyüme Performansı, Kabuk
Değişimi, Vücut Kompozisyonu ve İmmün Sistemi Üzerine
Etkilerinin Araştırılması
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Nuran ÇAVDAR (Su Ürünleri Yüksek Mühendisi)
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Prof. Dr. Mevlüt AKTAŞ, Nuran ÇAVDAR, Remziye ÖZKÖK
Kamile Gonca EROL, Mustafa CEYLAN
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
93.250 TL
Kerevit olarak bilinen tatlı su istakozu, (Astacus leptodactylus, Esch.1823) ülkemiz tatlı sularının
doğal bir ürünüdür. Ülkemizde kerevit üretimi sadece avcılık yoluyla yapılmakta olup, elde edilen
ürünün tamamına yakını ihraç edilmektedir. Kerevit yetiştiriciliğinde gelişmiş ülkeler dünya
pazarlarından önemli bir gelir sağlamaktadır. 1980’li yılların başlarına kadar kerevit ihracatından önemli
bir kazanç sağlanmasına karşın, hastalıklar ve bilinçsiz avcılık gibi nedenlerden dolayı üretim her geçen
gün azalmaktadır. Bundan dolayı birçok ülkede kerevit yetiştiriciliğinde esas amaç, yavru kerevit üretimi
üzerine yoğunlaşmış durumdadır. Ülkemizde ise kerevit üretimi avcılığa dayanmakta olup, yetiştiriciliği
yapılmamaktadır. Bu nedenle yetiştiricilik faaliyetlerinin hızlandırılması çok büyük önem arz etmektedir.
Ayrıca yapılan bilimsel araştırmalar genellikle taksonomi, hastalık, avcılık, biyolojik, et verimi, ekoloji ve
morfolojik özellikler gibi konularda olduğu görülmektedir.
Su ürünleri için de alternatif tür aranmasındaki gereklilik, protein oranı ve yüksek besin içeriği
nedeniyle kabuklu su ürünlerine yönelim kaçınılmaz olmuştur. Yetiştiricilik sektöründe, canlının bakım
ve beslenmesi ile genetik yapısının iyi hale getirilmesi yanında, verimlerini arttırmak amacıyla yem katkı
maddeleri olarak; antibiotikler, iyonoforlar ve hormon etkisine sahip büyüme ve yaşama oranını arttırıcı
maddelerin kullanımı önemli yer tutmaktadır.
Kerevit yetiştiriciliğinde karşılaşılan en büyük sorunlar olarak özellikle ilk yavru döneminde;
beslenme, stok yoğunluğu, barınak yetersizliği, stres, agresif davranış ve kanibalizm gibi çeşitli
sebeplerden kaynaklanan yüksek oranda ölümler meydana gelmesidir. Bu sebeple, tasarlanan proje ile
güçlü bir antibiyotik olduğu düşünülen, yapılan çalışmalarda fizyolojik ve davranışla ilgili olaylarda,
günlük ritim ve içsalgı hormonlarının düzenlenmesinde, ayrıca immün sistemini özelliklede hücresel
bağışıklık üzerinde oldukça önemli olduğu tespit edilen melatonin ile krustaselerde kanibalizm ile
bağlantısı olduğu ve bağışıklık sistemi üzerinde de önemli etkisi olduğu bilinen serotonin hormonlarının
kerevit yetiştiriciliğinde kullanılabilirliği araştırılacaktır. Yapılacak çalışmanın sonucunda biyojenik
aminlerin (melatonin ve serotonin) tatlı su istakazu A. leptodactylus yavrularında büyüme, gelişme,
vücut kompozisyonu, immün sistemi üzerindeki ve bazı çevresel stresörlere karşı etkileri belirlenecek,
Türkiye’de ticari ölçekte kerevit yetiştiriciliğine geçmeden önce yetiştiricilik için sorun oluşturabilecek
etkenlerin ortaya çıkarılması ve çözüm yolları geliştirilmesi planlanmaktadır.
Yeni Teklif Proje
Proje No 13
Proje Başlığı:
İçsu Balık Yetiştiriciliğine Alternatif Bir Tür Olarak, Sudak
Balığının (Sander lucioperca (Linnaeus, 1758)) Kapalı Devre
Sistemde Yaşama ve Büyüme Oranları İle Stres Faktörlerinin
Araştırılması
Projeyi Yürüten Kuruluş:
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
İsmail ERBATUR (Ziraat Yüksek Mühendisi)
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Yardımcı Araştırmacılar:
Abdulkadir YAĞCI, Mustafa CEYLAN, Cafer BULUT, Ufuk
AKÇİMEN, Osman YENER
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
142.400 TL
Avrupa ülkelerinin doğal türü olan etçil sudak balığı, ülkemizdeki içsulara 1950’li yıllarda
aşılanmış ve zamanla stoklarda diğer türleri baskı altına alarak bazılarının yok olmasına, bazı balıkların
populasyonunun azalmasına sebep olduğu bildirilmektedir. Aynı yıllarda Eğirdir Gölü’ne de aşılanan
sudak balığı zamanla avcılığı en çok yapılan tür olmuştur (Balık vd., 2006). Ülkemizde yetiştiricilik
faaliyetleri ile elde edilen su ürünleri miktarı her yıl artarak 2012 yılında denizlerde 193.420 ton/yıl
kapasiteli 408 adet işletmede 100.853 tona, içsularda 242.322 ton/yıl kapasiteli 1.883 tesiste 111.557
ton üretime ulaşmıştır. 2012 yılında içsulardaki toplam 111.557 ton üretimin 111.335 tonu alabalık, 222
tonu ise sazan balığı oluşturmaktadır. Üretim istatistiklerinden de anlaşılacağı üzere 242.322 ton/yıl
kapasitesi bulunan işletmelerin kapasitelerinin yarısından fazlası (130.765 ton) kullanılmamaktadır
(TÜİK, 2013). Sudak balığı ülkemizde perakende olarak 12 TL/kg fiyatla satılırken, alabalık 7 TL/kg
fiyatla satılmaktadır. Sudak balığının alternatif bir tür olarak kültüre alınması sonucunda hem iç
sularımızda atıl bekleyen işletme kapasiteleri değerlendirilecek hem de fiyat olarak daha yüksek
değerde olan sudak balığı yetiştiriciliği yapılarak iç tüketime sunulacak ve ihracat yapılarak ekonomiye
büyük oranda katkıda bulunulacaktır. Bu konuda ülkemizde 1980’li yıllardan sonra üretim faaliyetlerine
hız verilen Çipura (Sparus aurata L., 1758) balığının 2012 yılı itibari ile 275.5 milyon TL, Levrek
(Dicentrarchus labrax L., 1758) balığının 720 milyon TL’ lik bir ekonomik büyüklüğe ulaşmış olması bu
çalışma için bir örnek teşkil etmektedir (TÜİK, 2013).
Ülkemizde, yetiştiriciliği yapılmayan sudak balığının, doğal ortamda avlandıktan sonra kapalı
devre sisteme adaptasyon sürecinde, strese karşı tepkileri, yaşama oranları, büyüme oranları, yemden
yararlanma oranları, nakil süreci ile ilgili bilgiler ve bu balık türünün yetiştiriciliğine yönelik bilgi birikimi
oldukça kısıtlıdır. Bu proje ile sudak balığının yetiştiriciliğinin yapılabilmesi hakkında ihtiyaç duyulan
konularda önemli bilgi birikimi ve tecrübe sağlanacaktır. Ayrıca proje çıktıları doğadan yakalanılarak
adaptasyon ve yetiştiriciliğe alınması düşünülen diğer balık türleri ile ilgili çalışmalara da ışık tutacaktır.
Bu proje ile sudak balığı doğal ortamından avlanıp kapalı devre yetiştiricilik sistemine alınacaktır. Stok
3
yoğunluğu 2 kg/m olacak şekilde tanklara bırakılacaklardır. 60 günlük adaptasyon ve yeme alışma
sürecinden sonra, balıklar yine 5’ er cm boy grupları halinde sırasıyla 2 kg/m3, 3 kg/m3 ve 4 kg/m3 stok
yoğunluğu olacak olacak şekilde farklı tanklara aktarılacak ve 6 ay boyunca günde 3 defa %40-45 ham
protein içeren ekstrüde alabalık yemi ile besleneceklerdir. Bu çalışma ile balıkların nakil evresindeki
yaşama oranları, kapalı devre sisteme adaptasyon sürecinde ve farklı stok yoğunluklarında yaşama,
büyüme, yemden yararlanma oranları, kondüsyon faktörü, gonadların gelişimi ve balıklarda görülen
hastalık vb. tespiti, sudak balığının kültür ortamına adaptasyonu ve farklı stok yoğunluklarında
belirlenen büyüme parametrelerindeki farklılıklar ile ilgili önemli veriler elde edilecektir. Bu veriler
neticesinde, ülkemizde alabalık ve sazan balığı temelinde yürütülen içsu yetiştiricilik sektörüne
ekonomik analizlerinin de yapıldığı alternatif bir türün kazandırılma olanakları irdelenecektir.
Yeni Teklif Proje
Proje No 14
Proje Başlığı:
Doğu Karadenizde Dağılım Gösteren Bazı Kefal Türlerinin
(Mugil cephalus L. 1758 ve Liza aurata, Risso 1810) Kültür
Özelliklerinin Belirlenmesi
Projeyi Yürüten Kuruluş:
Trabzon Su Ürünleri Merkez Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
S S Doğu Karadeniz Su Ürünleri Kooperatifleri Bölge Birliği, Yomra
Su Ürünleri Ltd. Şti., Deva Su Ürünleri Ltd. Şti.
Proje Yürütücüsü:
Ayça GÜVEN, Balıkçılık Teknolojisi Yüksek Mühendisi, Trabzon Su
Ürünleri Merkez Araştırma Enstitüsü
Yardımcı Araştırmacılar:
Eyüp ÇAKMAK, Dr. Ercan KÜÇÜK, Zafer AKPINAR, Hamza POLAT
Atila HAŞİMOĞLU, İlkay ÖZCAN AKPINAR, Osman Tolga ÖZEL
Dr. Nazlı KASAPOĞLU, Dr. Elvan ATILGAN, Cemil ALTUNTAŞ
Hüseyin ALP, Cem CANKIRILIGİL, Oğuzhan EROĞLU, Şirin
FİRİDİN, Z.Duygu BAK, Doç.Dr.Hacer SAĞLAM, İlknur KURT
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
373.700 TL
1970’li yılların başında ülkemizde gökkuşağı alabalığı ile başlayan yetiştiricilik çalışmaları geçen
yıllar içinde sürekli ivme kazanarak su ürünleri istihsalindeki payını yükseltmiştir. Günümüzde su
ürünleri yetiştiricilik sektöründe yetiştirilen türler, yetiştiricilik alanları ve toplam kapasiteleri ile
uluslararası boyutta önemsenir hale gelmiştir. Kısa zamanda hızlı sayılabilecek bu gelişmenin nedenleri
arasında su ürünleri konusunda hizmet veren kamu araştırma kurumlarının alt yapısının iyileştirilmesi,
ülkemiz tatlı su, deniz, doğal göl ve son yıllarda hızla artan baraj gölleri gibi su kaynaklarının sektörün
kullanımına açılması sayılabilir.
Ülkemizde yetiştiriciliği yapılan türlerin sayısı ve kapasiteleri sürekli artmakta olup bu türlerin
beslenmesi avcılıkla elde edilen üretime bağımlı olmaktadır. Son yıllarda avcılık üretiminin azalma
eğiliminde olması yetiştiricilik sektöründe balık yemi temininde darboğaza sebep olabilecektir.
Yetiştiriciliği yapılan türlerin karnivor türler olması hayvansal yağ ve protein ağırlıklı beslenmeyi mecbur
kılmaktadır. Son yıllarda yem sektöründe yaşanan ham madde temini ve fiyat artışı gibi sorunlar
araştırıcıları omnivor veya herbivor türlerin kültürüne yönelik çalışmalara itmiştir.
Bu projede, katadrom balıklardan olan, üremelerini denizlerde gerçekleştiren, beslenmek için
ise lagünleri tercih eden, beslenme özellikleri bakımından omnivor olan ve Karadeniz’de dağılım
gösteren kefal balığı türleri (Mugil cephalus L. 1758 ve Liza aurata, Risso 1810) çalışılacaktır.
Yapılacak çalışmalarla Doğu Karadeniz’de dağılım gösteren her iki türün biyolojik ve genetik
özellikleriyle beraber kültür şartlarına adaptasyonu, yaşama oranı, kültüre alınabilirliği belirlenecektir
Yeni Teklif
Proje No 15
Proje Başlığı:
Karadeniz Alabalığı (Salmo trutta labrax P., 1811) ve Gökkuşağı
Alabalığında (Oncorhynchus mykiss W., 1972) Farklı Üretim
Modellerinin Verimliliğe Etkisi
Projeyi Yürüten Kuruluş:
Su Ürünleri Merkez Araştırma Enstitüsü Müdürlüğü/Trabzon
Projeyi Destekleyen Kuruluş:
Trabzon İçsu Ürünleri Yetiştiricileri Üretici Birliği
Pınar Alabalık Üretim Çiftliği; Ardesom Alabalık Üretim Çiftliği
Yomra Su Ürünleri Ltd Şti
Proje Yürütücüsü:
Osman Tolga ÖZEL
Su Ürünleri Merkez Araştırma Enstitüsü Müdürlüğü/Trabzon
Yardımcı Araştırmacılar:
Ekrem Cem ÇANKIRILIGİL, Ayça GÜVEN, Dr. Ercan KÜÇÜK,
Hamza POLAT, Nafiye PERKER, Tuna ÖZCELEP, Hasan ERGÜN
Hüseyin SALİHOĞLU, Eyüp ÇAKMAK, Murat DAĞTEKİN
Mustafa TÜRE, Cemil ALTUNTAŞ
Başlama-Bitiş Tarihleri:
01.01.2015-31.06.2017
Projenin Toplam Bütçesi
99.580 TL
Bu çalışma ile bölgemizde üç farklı üretim modeli (akarsu, göl ve deniz) kullanılarak, üretimi
yapılan Karadeniz alabalığı (Salmo trutta labrax P., 1811) ve gökkuşağı alabalığı (Oncorhynchus
mykiss W.,1972)türlerinin hangi zaman aralığında, ne kadar yem kullanılarak ne kadar büyüme
sağlandığı belirlenerek birim maliyetleri ortaya koymak amacıyla yapılacaktır.
Bu amaçla, 3 farklı üretim modelinde üretim gerçekleştiren, akarsu (kuluçkahane ve havuz
sistemi), baraj gölü kafes ve deniz ağ kafes sistemleri bulunan işletmelerle protokol karşılığı işbirliği
yapılacaktır.
Çalışmada, farklı üretim modellerinin Karadeniz alabalığı (Salmo trutta labrax P., 1811) ve
gökkuşağı alabalığı(OncorhynchusmykissW.,1972) türlerinin büyümeleri üzerine etkisi ve modellerin
karlılıkları saptanacaktır. Ayrıca farklı işletme modellerinin bölgemiz şartlarında işletme ve üretim
masrafları belirlenerek, brüt kar, net kar, sabit sermaye faizi, rantabilite oranları hesaplanacak ve
uygulanan farklı işletme modellerinin bölgemiz şartlarında karlılığı belirlenecektir. Ve işletmelerin
pazarlama organizasyonunun etkinliği incelenecektir.
Araştırma süresi boyunca bölgemizden elde edilen sonuçlar değerlendirilecektir. Proje sonunda
elde edilecek verilere göre uygulanan üretim modeli ile sağlanan büyüme performansının getirdiği
karlılık belirlenerek hangi üretim modelinin daha avantajlı olduğu ortaya konulacaktır.Ayrıca bölgemizde
alabalık yetiştiriciliğine yönelik yetiştiricilik yapan üreticilere kaynak teşkil edecektir.
Yeni Teklif Proje
Proje No 16
Proje Başlığı:
Alabalık Yeminde Fındık Küspesi Kullanımı ve Zeolit İlavesinin
Balıkların Büyüme Performansı ve Yem Değerlendirmesi
Üzerine Etkileri
Projeyi Yürüten Kuruluş:
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
Tunceli Ü., Su Ürünleri Fakültesi, Fırat Ü., Mühendislik Fak. Çevre
Müh. Bölümü, Türkaylar Alabalık Su Ürünleri Ltd. Şti.
Proje Yürütücüsü:
Gürel Nedim ÖRNEKCİ (Su Ürünleri Mühendisi), Elazığ Su Ürünleri
Araştırma İstasyonu Müdürlüğü
Yardımcı Araştırmacılar:
Yrd. Doc.Dr. GÜLŞAD USLU, Ali Atilla USLU, Gökhan KARAKAYA,
Timur DEMİR, Burcu TEMUR
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
66.000 TL
Bu araştırma, Elazığ ilinde bulunan Keban Baraj Gölü 6. Bölgesinde yapılacak tır. Çalışma 2
grup halinde 3 tekerrürlü yapılacaktır. %10, %20, %30 ve %40 oranlarında fındık küspesi katılarak
hazırlanacak olan yeme %0,5-1 oranlarında zeolit katılarak balık yemi oluşturulacaktır. Birinci
denemede 10 gr ağırlığında ki yavru balıklar 50 gr ağırlığa, ikinci grupta ise 70 gr ağırlığında ki balıklar
250 gr ağırlığa ulaşıncaya kadar büyütülecektir. Bu çalışma ile hammaddesini tamamen yurt içinden
temin ettiğimiz bitkisel protein kaynağı olan fındık küspesinin ve bir mineral olan zeolitin, balık yeminde
kullanılması ile balıkların büyüme parametreleri üzerindeki olası etkileri araştırılacaktır. Ayrıca Keban
Baraj Gölü’nde seçilecek olan 3 pilot su ürünleri yetiştiricilik işletmesinde, herhangi bir müdahale
yapılmadan, yavru alabalıkların porsiyonluk büyüklüğe gelene kadar, alabalıkların büyüme
hesaplamaları, işletmelerin kar analizleri takip edilerek kayıt altına alınacak ve yapılacak olan
çalışmamız ile karşılaştırma yapılacaktır.
Yeni Teklif Proje
Proje No 17
Proje Başlığı:
Gökkuşağı Alabalıklarında (Oncorhynchus mykiss) Zencefil
(Zingiber officinale) ve Çörekotunun (Nigella sativa)
İmmunostimulant Olarak Kullanımı
Projeyi Yürüten Kuruluş:
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Soner SAVAŞER (Ziraat Yüksek Mühendisi)
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Yardımcı Araştırmacılar:
Ufuk AKÇİMEN, Mustafa CEYLAN, Zübeyde HANOL, Osman
YENER, Cafer BULUT
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
85.210 TL
Avrupa Birliği’nin 2002 yılında almış olduğu kararla, 2006 yılından itibaren hayvan yemlerine
yem katkı maddesi olarak antibiyotik vb. maddelerin katılmamasına karar vermesi ile bilim adamları
doğal kaynaklı ilaçları araştırmaya yönelmiştir. Bu alternatif ürünler enzimler, organik asitler,
probiyotikler, prebiyotikler, bağışıklık uyarıcı ürünler, polisakkaritler, bakteriyel parçacıklar baharatlar,
bitki öz suları ve hayvansal kaynaklı veya bitkisel ekstraktlardır.
Kemoterapötik ajanların yaygın kullanımı patojenlerde antimikrobiyel direncin artmasına sebep
olurken alıcı ortamdaki canlılar içinde risk teşkil ettiği bilinen bir gerçektir. Balıklarda bağışıklık arttırıcı
(uyarıcıların) kullanımı diğer tedavi metotlarıyla karşılaştırıldığında çevre şartları ve balıktaki patojenlere
karşı direncin arttırılması bakımından tercih edilmelidir. Bu tür ürünlerin su ürünleri üretiminde kullanımı
ile insan ve çevre sağlığını tehdit eden kemoterapötik kullanım miktarlarının azaltılacağı veya tamamen
elemine edileceği kabul edilmektedir.
Tarih boyu insanlar tedavi amaçlı olarak bitkilerden yararlanmışlardır. Asya kökenli şifa
geleneğinin temelini bitkiler teşkil etmekte olup hastalıkları tedavi etmek için şifalı otların kullanımı 3000
yıl öncesine kadar uzanmaktadır. Bu tür ürünlerin su ürünlerinde kullanılmasıyla ilgili özellikle son 10
yıldır dikkate değer invitro ve invivo çalışmalar mevcuttur. Ülkemizde çok sınırlı sayıda alabalık
işletmelerinde kitosan ve glukan gibi immunostimulant kullanımı denenmektedir. İşletmelerin büyük bir
kısmı bu ürünlerden habersizdir. Çünkü bu konuda yapılan çalışmalar üreticilere net tavsiyelerde
bulunulabilecek seviyelerde değildir.
Gerek hayvan sağlığı gerek su ürünleri sağlığı ve bilhassa insan sağlığı konusunda bağışıklık
arttırıcı, verim artışı sağlayıcı bitkisel ürünler veya bitkisel katkılı destek ürünleri çok büyük bir ticari
sektör haline gelmiştir. Hiçbir ürünün güvenirliliği olmadığı gibi çok pahalı maliyetlerde ortaya
konmaktadır. Bu sebeplerden dolayı insanlar ticari ürünlere haklı olarak şüphe ile bakmaktadırlar.
Bu projenin amacı sektörde kullanılabilecek ticari bir meta ortaya çıkarmak değil üreticilerin
direk tıbbi bitkilerden istifadesini sağlayabilmektir. Bu sebepten denemelerde etken madde, ekstrakt,
uçucu yağ yerine direk bitkilerin kendilerinin kullanılması düşünülmüştür. Bu şekilde olumlu sonuç
alınabilecek, üreticilere tavsiye edilebilecek bitki veya baharatı üretici çok kolay ve ucuza elde
edebilecek ve kullanarak hastalıklarla mücadele giderlerini düşürebilecektir. Günümüzde yem fiyatları
maliyetlerin % 60 gibi yüksek bir oranını oluşturduğundan zaten üreticinin maliyeti yükseltecek diğer
öğelere bütçe ayırması imkânsızdır. Küçük üreticilerin büyük bir çoğunluğu hastalıklarla mücadele ve
koruma ile ilgili hususlara para ayıramadığından balık kayıplarına razı olur durumdadır. İşletmelerin
tamamına yakını, ihtiyacı olandan daha fazla anaç bulundurmakta fazladan anaç bakımı masrafları
yapmakta, fazladan yavru üretmekte ve bu yavrulardan sağ kalanlarla kapasitesini ancak
karşılayabilecek şekilde veya düşük kapasiteyle üretime devam etmektedir. Böyle bir durumda
üreticilere ticari formata dönüştürülmüş ürünler dışında; bulunması, kullanılması kolay ve ucuz ürünlerin
sunulması ve bunların uygun dozajlarının belirlenmesi hem ülkemiz ürünleri sektörü hem de dünya için
çok faydalı olacaktır. Bu çalışmanın amacı ülkemizde su ürünleri üretimi denilince ilk akla gelen
gökkuşağı alabalığında şifalı bitkilerin kullanımıyla ilgili literatüre destek vermek, literatürdeki eksiklikleri
gidermek ve en önemlisi pratikte kullanılabilecek ve ekonomik olarak geri dönüş sağlayacak veriler elde
edilerek sonuçların su ürünleri yetiştiricilik sektöründe kullanılabilmesini sağlamaktır.
Balık ve diğer su ürünleri üretiminde yaygın olarak kullanılan kemoterapötiklerin insan ve çevre
sağlığı ile ekolojik denge üzerindeki olumsuz etkilerini azaltmak veya tamamen ortadan kaldırmak için
yeni ve alternatif ürünler arandığı bir dönemde bu çalışma ile elde edilebilecek sonuçlarla üreticilere;
bulunması, kullanılması kolay ve de ucuz bağışıklık arttırıcı ürünler tavsiye edilebilecektir.
6 kişilik ekiple yürütülecek ve 2 sene sürecek olan bu çalışma kapsamında zencefil (Zingiber
officinale) ve çörekotunun (Nigella sativa), gökkuşağı alabalıklarında (Oncorhynchus mykiss)
nonspesifik savunma mekanizmalarına etkisi araştırılacaktır.
Yeni Teklif Proje
Proje No 18
Proje Başlığı:
Farklı sürelerde ticari ürün ve L-karnitin ile zenginleştirilen
rotifer (Brachionus plicatilis)’in besinsel içeriğinin belirlenmesi
Projeyi Yürüten Kuruluş:
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Projeyi Destekleyen Kuruluş:
Süleyman Demirel Üniversitesi Su Ürünleri Fakültesi
Proje Yürütücüsü:
Prof.Dr. Sevgi SAVAŞ SDÜ Su Ürünleri Fakültesi
Durali ERASLAN Yük.Müh. AKSAM
Yardımcı Araştırmacılar:
Doç. Dr. Yılmaz EMRE, Abdullah DEMİR
Başlama-Bitiş Tarihleri:
01.06.2014-01.09.2015
Projenin Toplam Bütçesi
53.472 TL
Rotiferler (Brachionus plicatilis) deniz balıkları ve kabukluların larva üretiminde ilk besin kaynağı
olarak çok yaygın bir şekilde kullanılmaktadır. Larvanın büyüme ve yaşama oranındaki başarı besinin
kalitesine bağlıdır. Larvayı beslemek için rotifer kullanıldığında zenginleştirme gereklidir. Çünkü onların
besinsel içeriği sindirilen besine göre değişmektedir. Rotiferlerin besinsel içeriğinin artırılması ticari
zenginleştirici ürünler ile başarılabilir. Bu çalışmada, rotifer (Brachionus plicatilis)’lere bazı ticari
zenginleştirici ürünler ile L-karnitin kombinasyonundan oluşan besleme uygulanacaktır. Rotiferlerin L
karnitin miktarı ve yağ asidi kompozisyonu üzerine farklı besinlerin ve zenginleştirme süresinin etkisinin
belirlenmesi amaçlanmıştır.
Son yıllarda farklı balık türlerinde yapılan çalışmalarda L-carnitinin kuru yeme ilavesinin
etkilerinin incelendiği çalışmalardan elde edilen olumlu sonuçlar bu konudaki çalışmaların artmasına
neden olmuştur. Bu konuda diğer omurgalılarda elde edilen bilgiler de dikkate alınarak yetiştiricilikte
yeme L-carnitin ilavesinin, yemdeki yağların daha yüksek oranda kullanımasını sağladığı ve böylece
daha az protein içeren yem rasyonlar ile daha iyi bir büyüme elde edilebileceği bildirilmiştir. Yeme ilave
edilen L-carnitinin, balıklardaki fizyolojik ve biyokimyasal öneminin anlaşılması üzerine artan
çalışmalarla bu konulara açıklık getirilmeye çalışılmıştır (Harpaz, 2005; Chatzifotis vd., 1997).
Kuluçkahanelerde özellikle çipura, levrek, kalkan larvalarının ilk beslenme periyodunda verilen rotiferler
ticari zenginleştirici ürünler ile firmaların tavsiye ettiği süre ve dozlarda zenginleştirilerek verilmektedir.
Öte yandan bazı balık türleri (sarı kuyruk balığı, cod balığı gibi) daha yüksek DHA ya da DHA/EPA
içeren besine ihityaç duymaktadır. Bu larvalar için yeterli besinsel içeriğe sahip rotiferler üretilmesi
amacı ile daha yüksek oranda DHA yada EPA içeren besinler geliştirmiştir. Yüksek oranda DHA gibi
esansiyel yağ asidlerince zengin ürünlerin kullanılması halinde rotiferlerin yağ asidi içeriğinin
artırılmasındaki başarı zenginleştirme süresi yada kullanılan yem miktarına bağlı olarak değişebileceği
belirtilmektedir (Rainuzzo vd. 1997; Copeman vd. 2002). Buna karşın L- karnitin zenginleştirmesinin
rotiferlerin yağ asidi içeriğine etkilerine yönelik ilk yapılan Tübitak projesinde elde edilen olumlu
sonuçlar bu konuda daha kapsamlı çalışmalar yapmaya teşvik etmiş olup, bu konuda literatürde
rotiferler ile yapılmış mevcut bir araştırma bulunmamaktadır. Dahası rotiferlerde zenginleştiri ürünler ile
L- karnitinin kombine edilerek uygulanan besleme rejimine yönelik mevcut bir çalışma
bulunmamaktadır. Bu proje çalışmasında seçilen ticari zenginleştirici ürünler kuluçkahanelerde yaygın
bir şekilde kullanılmaktadır. Olio w3 (Bernaqua) EPA içeriği yüksek bir ürün iken, DHA protein selco
(INVE) ve Algamac 3050 (Bio- Marine) ise DHA yağ asidince zengin ticari bir üründür. Bu ürünler ile
zenginleştirilen rotiferlerin yüksek doymamış yağ asidleri EPA ve DHA içeriği yüksek olacağı
düşünülebilir. Fakat yüksek yağ içerine sahip ticari ürünler ile birlikte L-karnitin ilaveli ortamda üretilen
rotiferlerin yağ asidi içerinin belirlenmesi özellikle de L- karnitinin yağ metabolizması üzerindeki bilinen
etkisi düşünüldüğünde örneğin EPA içeriği yüksek ürünlerle beslenen rotiferlerdeki EPA miktarının
artırılmasındaki etkisinin olup olmayacağı da ortaya konulacaktır. Ayrıca farklı zenginleştirme süreleri
uygulanarak rotiferlerin L-karnitin ile ticari ürünlerin kombine kullanılması halinde rotiferlerdeki L-karnitin
miktarına etkisinin belirlenmesi ile ilgili yapılacak bu çalışma önem taşımaktadır. Böylece L-karnitin ile
zenginleştirmede uygulanacak süre ve konsantrasyonun rotiferlerin endojen karnitini üzerindeki etkisi
ve birikimi yapılacak L-karnitin analizi ile ortaya konacaktır. Proje sonucunda elde edilen bulgulara göre
rotifer üretiminde L- karnitin ilavesinin olumlu sonuçlar vermesinden dolayı bu çalışmada farklı ticari
zenginleştirici ürünler ile L-karnitinin kombine edilerek uygulanan zenginleştirme metodunun rotiferlerin
yağ asidi içerine etkilerinin ortaya konması hedeflenmektedir. Yapılan önceki TÜBİTAK projesinde
rotiferler sürekli aynı konsantrasyonda L-karnitinli ortamda üretilen bireyler ile gerçekleştirilmiştir. Bu
öngörülen proje çalışmasında ise L-karnitin diğer ticari zenginleştirilmiş ürünlerde olduğu gibi belirlenen
sürelerde uygulanacaktır. Ayrıca farklı zenginleştirme sürelerinin uygulanması halinde rotiferlerdeki yağ
asidi içeriğindeki değişim belirlenerek en uygun zenginleştirme süresinin irdelenmesi de
amaçlanmaktadır. Bu araştırmada ortaya konulacak bilimsel sonuçlara göre zenginleştirme metodunun
pratikte ticari kuluçkahanelerde kolaylıkla uygulanabilirliği ve başarılı bir üretim sağlayacağı
öngörülmektedir.
Yeni Teklif
Proje No 19
Proje Başlığı:
Gökkuşağı Alabalığının (Oncorhynchus mykiss) Normal Dönem
ve Mevsim Dışı Üretiminde Döl Verim Özellikleri ve Yavrularının
Büyüme Performanslarının Karşılaştırılması
Projeyi Yürüten Kuruluş:
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
Fırat Ü., Su Ürünleri Fakültesi, Keban Alabalık A.Ş
Keban-İç Sular Yetiştiricileri Birliği,
Proje Yürütücüsü:
Selahattin GÜRÇAY Su Ürünleri Mühendisi
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Yardımcı Araştırmacılar:
Doç. Dr. Kenan KÖPRÜCÜ, Tacettin YILDIRIM, Erdem
MEMİŞOĞLU, Timur DEMİR, İlhan CANPOLAT, Mehmet
ÇATALKAYA, Murat KARABULUT, Halil İbrahim EROL
Başlama-Bitiş Tarihleri:
01.12.2014-01.09.2016
Projenin Toplam Bütçesi
46.000 TL
Gökkuşağı alabalığı yetiştiriciliği; 2012 yılı verilerine göre Türkiye’de 111.335 (TÜİK) ton
üretimiyle yetiştiriciliği yapılan soğuk su balıkları arasında en önemli ekonomik tür haline gelmiştir. Bu
türün yetiştiriciliği ise yeterli miktarda kaliteli yumurta ve larva üretimine bağlıdır. Gökkuşağı alabalığı
yetiştiriciliğinde yumurta ve larva safhası en hassas ve kritik dönemdir. Ticari işletmelerde sağımdan
pazarlama büyüklüğüne kadar %25-50 (ortalama %40) kayıp olduğu göz önünde tutulursa işletmelerde
önemli ölçüde yumurtaya özellikle de kaliteli yumurtaya ihtiyaç vardır.
Biyoteknoloji dediğimiz dişi ve kısır bireylerin üretimi, mevsim dışı yumurta alımı ve damızlık
yönetimi alanındaki gelişmelerin, ülkemizde yeterince uygulanamaması nedeniyle işletmelerin yumurta
ihtiyaçları, yurt içi üretimlerle karşılanamadığından kısa vadeli çözüm olarak, kış ve yaz yumurtası
olmak üzere yurt dışı alımlarına gidilmektedir. Buna bağlı olarak her yapılan ithal yumurta alımı, bulaşıcı
bakteriyel ve viral hastalıkların ülkeye taşınma riskini arttırmaktadır. Bu nedenle, kaliteli ve fazla
miktarda yumurtanın her dönemde sağlanması için damızlık balık seçimi ve mevsim dışı yumurta alma
gibi konuların, işletmelerde yaygın bir şekilde uygulanması gerekmektedir.
Su ürünleri yetiştiriciliğinde balık çiftliklerine mevsim dışı yıl boyu kaliteli yumurta ve yavru temin
edilmesi için yöntemler geliştirilmeye çalışılmaktadır. Bunlar arasında dikkate değer öneme sahip
olanlardan birisi yapay fotoperiyot (ışık periyodu) yöntemidir. Yapay fotoperiyot; üretilen türe göre
değişmekle beraber sadece yılın belirli bir zamanında yumurta ve sperma alımıyla oluşan
yetiştiricilikteki üretimin sınırlanışı sorununa bir çözüm getirilerek, üretim sürekliliği sağlanmaktadır.
Ayrıca bu şekilde canlının yem alım ve yemden yararlanma süreleri uzatılıp büyüme hızlandırılarak,
daha kısa sürede daha yüksek canlı ağırlıklara ulaşılmaktadır. Böylece pazara tüm yıl boyunca
porsiyonluk ürün sunulabilmektedir (Bromage ve ark., 2001).
Yeni Teklif
Proje No 20
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Mersin Balıklarında Damızlık Stok Yönetimi
Su Ürünleri Merkez Araştırma Enstitüsü Müdürlüğü
Kevser Alabalık Çiftliği, Trabzon
Nejat Dede Alabalık Çiftliği, Rize
Proje Yürütücüsü:
Dr.Bilal AKBULUT, Balıkçılık Tekn. Yük. Müh.
Su Ürünleri Merkez Araştırma Enstitüsü Müdürlüğü
Yardımcı Araştırmacılar:
Tuna ÖZCELEP, Oğuzhan EROĞLU, Hasan ERGÜN, Mustafa
TÜRE, Osman Tolga ÖZEL, Ekrem Cem ÇANKIRILIGİL
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
347.600 TL
Bu projede mevut olan damızlık stokuğu ülkemiz doğal sularında bulunan mersin balıklarıyla
güçlendirmek, yeni teknolojiler ve genetik bilgiler ışığında ülkemiz şartlarına uygun yetiştirme
tekniklerinin geliştirilmesi amaçlanmıştır.
Projede kapsamında mevcut damızlık stoğun güçlendirilmesi için doğadan alınan mersin
balıkları havuz ortamına ve pelet yeme alıştırıldıktan sonra damızlık olarak kullanılacaktır. Damızlık
stoğun yönetimi için stoğa yeni katılan balıklarda genetik çalışmalar yapılacaktır. Damızlık stoğundaki
balıklarında cinsiyet ve cinsi olgunluk ultrason ve sonda yöntemleri ile incelenecektir. Kapalıdevre
sistemde cinsi olgunluğa gelen balıklardan döl alma çalışmaları yapılacaktır. Mersin balıklarının
yetiştiriciliğinde görülen viral, bakteriyel ve paraziter hastalıklar dünya literatürü ve yapılan
uygulamalardan yararlanılarak belirlenecektir. Bu hastalıkların tanınması ve tedavi yöntemleri
araştırılacaktır. Damızlık stoğundaki balıklarda görülecek hastalıkların teşhis ve tedavileri yapılacaktır.
Proje yürütülürken iki alabalık çiftliği ile işbirliği yapılacaktır.
Mersin balıklarının doğal stoklarının zenginleştirilmesi ve yetiştiriciliğinin yaygınlaştırılması
öncelikle uygun büyüklükte bir damızlık stoğu ve yetiştiricilik tekniklerinin geliştirilmesine bağlıdır. Bu
nedenle projede damızlık stoğu iyileştirme ve ülkemiz şartlarına uygun yetiştirme tekniklerinin
geliştirilmesine yönelik verilerin toplanmasına ağırlık verilmiştir. Söz konusu projenin yürütülmesi,
mersin balıkların yetiştiricilik sektörüne kazandırılmaları, doğal stokların korunması ve
zenginleştirilmesi, gıda olarak değerlendirilmeleri ve gen kaynaklarının korunması çalışmalarına önemli
katkı sağlayacaktır.
Yeni Teklif Proje
Proje No 21
Proje Başlığı:
Elazığ İli Alabalık İşletmelerinde Balık Refah Düzeyinin
Belirlenmesi
Projeyi Yürüten Kuruluş:
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
Fırat Üniversitesi Su Ürünleri Fakültesi
Elazığ İli İç Sular Üretim ve Yetiştiriciliği Birlik Başkanlığı
Proje Yürütücüsü:
Mustafa BALCI-Su Ürünleri Mühendisi
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Yardımcı Araştırmacılar:
Prof. Dr.Naim SAĞLAM, Yrd.Doç.Dr. M. Enis YONAR, Yrd. Doç. Dr.
M. Nuri ÇAKMAK, Dr. Serpil Mişe YONAR, Dr. Mücahit EROĞLU,
Nevim BİRİCİ, Selami ARCA, Özkan ÖZBAY, Memet ÇATALKAYA,
M. Raşit SÜNBÜL
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
72.000 TL
Ülkemizde alabalık yetiştiriciliği 1000’den fazla orta ve büyük işletme ile önemli bir sektör haline
gelmiştir. Elazığ Tarım İl Müdürlüğü 2013 yılı verilerine göre Elazığ, yaklaşık 150 işletme ve 30.000
ton/yıl üzerinde kapasite ile Türkiye’de iddialı bir konumda bulunmaktadır. Balık yetiştiriciliğinin
artmasıyla beraber Avrupa Birliği (AB) standartlarında yetiştiriciliği yapılan türlerde stresin en aza
indirilerek, balık refahının geliştirilmesi gerekmektedir. Balık refahının geliştirilmesi işletmelerde balıkları
strese sokan faktörlerin ortadan kaldırılması ile mümkündür. Stresi ortadan kaldırmanın, öncelikle
işletmelerdeki balıklarda stres bulunup bulunmadığının tespiti ve muhtemel stres var ise bunun
kaynağının tespit edilerek düzeltilmesi ile sağlanabilmektedir. Balıkların stresten uzak ve refah düzeyi
yüksek bir şekilde yetiştirilebilmesi için AB ve ulusal bazda bazı yasal düzenlemeler yapılmıştır. Ulusal
anlamda balık refahının yerleştirilebilmesi ve geliştirilmesi için çeşitli yasal düzenlemeler bulunmaktadır
(Su ürünleri kanunu, Su ürünleri yönetmeliği, su ürünleri yetiştiriciliği yönetmeliği, 5199 sayılı Hayvanları
Koruma Kanunu, Katkı kalıntının izlenmesi yönetmeliği, vs.). Avrupa Birliği’nde yetiştiriciliği yapılan
hayvanların korunmasına yönelik konsey direktifi (98/58/EC) yayınlanmış ve bu direktife bağlı bir çok
düzenleme hazırlanmıştır. Bu yasal düzenlemeler çerçevesinde balıkçılık işletmelerinde de artık balık
refahı uygulamaları dünya genelinde bir zorunluluk halini almaya başlamıştır.
Kimyasal ve biyolojik faktörler ve rutin işlemler balıklardaki en önemli stres kaynaklarıdır.
Belirtilen faktörler balığın yaşam standartlarına ne kadar uygun şekilde hazırlanırsa balıklar o kadar
stresten uzak ve refah düzeyi yüksek şekilde yetiştirilmiş olurlar. Bu faktörlere bağlı olarak oluşan stres,
hormonal ve enzimsel düzeyde olmak üzere iki şekilde belirlenebilmektedir. Hormonal olarak stres
kortizol ve glukoz düzeyinde oluşan değişimlerle belirlenirken enzimsel düzeyde okisdatif stres, lipid
peroksidasyon vb. enzim düzeylerindeki değişimlerle tespit edilebilmektedir. Ayrıca diğer canlılarda
olduğu gibi balıklarda da kan değerleri balık sağlığı hakkında ipuçları verebilmektedir. Bu bağlamda
balıklarda hematokrit değer çevresel, kimyasal ve oksidatif stresin tespitinde önemli bir indikatördür.
Proje çerçevesinde Elazığ’da bulunan farklı alabalık işletmelerine her ay gidilecek ve daha
önceden hazırlanan formlar kullanılarak işletmeler hakkındaki tüm gerekli bilgiler toplanacaktır. Bu
işletmelerdeki balıklardan kan örnekleri alınacaktır. Kan örneklerinde hematokrit değer tespit edildikten
sonra plazmaları ayrılacaktır. Elde edilen plazmalarda lipid peroksidasyon, kortizol ve glukoz düzeyleri
belirlenecektir. Çalışma sonunda alabalık işletmelerinin yapısal ve işletme aşamalarında balıklar
üzerinde etkili olan stres kaynaklarının ortaya konulması sağlanacaktır. Stres kaynaklarının tespiti ve
ortadan kaldırılması balıkların refahını arttıracağı gibi balık hastalıklarına yakalanma riskini de
minimuma indirecektir.
Yeni Teklif Proje
Proje No 22
Proje Başlığı:
Diyete İlave Edilen Prebiyotik İnülin ve Kitosan İle Probiyotik
Bakteri Bacillus subtilis’in Astacus leptodactylus (Esch. 1823)
Yavruları Üzerine Kombine Etkilerinin Araştırılması
Projeyi Yürüten Kuruluş:
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Kamile Gonca EROL Su Ürünleri Yüksek Mühendisi
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Yardımcı Araştırmacılar:
Kamile Gonca EROL, Remziye ÖZKÖK, Nuran ÇAVDAR, Mustafa
CEYLAN
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
95.100 TL
Son yıllarda yapılan yetiştiricilik çalışmalarında, probiyotik ve prebiyotik kullanımının balık,
kabuklu su ürünlerinin larva ve yavrularının hayatta kalma oranı, gelişimleri ve bağışıklık sistemleri
üzerinde olumlu etkiler yarattığı ortaya konulmaktadır. Bu çalışmada da probiyotik ve prebiyotiklerin
kullanımı ile kültür koşullarında üretilen II. dönem Astacus. leptodactylus yavrularında görülen yüksek
orandaki ölümleri azaltmak, bağışıklık sistemini güçlendirerek hastalıklara karşı daha dirençli sağlıklı
yavrular elde etmek ayrıca yavruların bazı çevresel stresörlere karşı toleransını da arttırarak iyi bir
büyüme ile daha başarılı bir yetiştiriciliği mümkün kılmak amaçlanmaktadır. Çalışma, kerevit
yavrularının anaçtan ayrılıp bağımsız yaşamaya ve ilk yem almaya başladığı dönemden başlayarak,
3’er aylık iki farklı besleme denemesi şeklinde, yemlerde (canlı yem- pelet yem), prebiyotiklerden inülinkitosan ve probiyotik bakteri B. subtilis’in tek başına ve kombine olarak kullanılması ile yavrulardaki
yaşama oranları, büyüme performansları, vücut Kompozisyonları, immun Sistemi ve bazı çevresel
stresörlere karşı toleransları üzerine etkileri ortaya konmaya çalışılacaktır.
Yeni Teklif Proje
Proje No 23
Proje Başlığı:
Cyclamen graecum ve Prospero autumnale Ekstraktlarının Aktif
Bileşenlerinin Karakterizasyonu, Bazı Deniz ve Tatlı Su Balıkları
Üzerinde Biyolojik Etkilerinin Araştırılması
Projeyi Yürüten Kuruluş:
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enst. Müdürlüğü
Projeyi Destekleyen Kuruluş:
Pamukkale Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü
Proje Yürütücüsü:
Prof.Dr. Ramazan MAMMADOV
Pamukkale Ü., Fen Edebiyat Fakültesi Biyoloji Bölümü
Doç. Dr. Yılmaz EMRE
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enst. Müd.
Yardımcı Araştırmacılar:
Prof.Dr. Olcay DÜŞEN, Doç.Dr. Serdar DÜŞEN, Yard. Doç.Dr.
Sevilay CENGİZ, Doç. Dr. Derya GÜROY, Nesrin EMRE, Dr. F.
Banu YALIM, Faruk PAK, Dr. Abdülkerim AKSOY
Başlama-Bitiş Tarihleri:
01.06.2015-31.05.2017
Projenin Toplam Bütçesi
60.500 TL
Bu proje ile Myrsinaceae ve Asparagaceae familyalarına ait ve Türkiye florasında doğal olarak
yayılış gösteren 2 geofit bitki türünün (Cyclamen graecum ve Prospero autumnale) ekstraktlarının
kimyasal bileşimlerinin analizi, ekstreleri ile biyolojik aktivitelerinin ve incelenen balıkların büyüme
performansı ve et kalitesine etkilerinin incelenmesi amaçlanmaktadır. Elde edilen ekstrakt, çalışılması
planlanan balık türlerine uygulanarak, bu ekstraktların balık karaciğer ve kalp dokularındaki enzimatik
reaksiyonlara olan etkileri tespit edilecektir..
Yeni Teklif Proje
Proje No 24
Proje Başlığı:
Atatürk Baraj Gölü Şanlıurfa Avlak Sahalarında Yetiştiricilik
Açısından Su Kalitesinin Tespiti, Kafeslerde Alabalık
Yetiştiriciliğine Uygun Alanların Belirlenmesi ve Taşıma
Kapasitelerinin Bulunup İşletmelere Tahsisi Hususunda Özel
Hüküm Belirlenmesi
Projeyi Yürüten Kuruluş:
GAP Tarımsal Araştırma Enstitüsü Müdürlüğü
Projeyi Destekleyen Kuruluş:
Kahramanmaraş Sütçü İmam Üniversitesi Ziraat Fakültesi ve Harran
Üniversitesi Ziraat Fakültesi
Proje Yürütücüsü:
Mahmut YÜKSEL, Balıkçılık Teknolojisi Yük. Mühendisi,
GAP Tarımsal Araştırma Enst. Müd.
Yardımcı Araştırmacılar:
O.Yaşar UZUNMEHMETOĞLU, M.Şeref ŞELLİ, F.Pınar
KARADUMAN, Zeliha SAVRUNLU, Deha Ali DENİZ, Mehmet
BADILLI, Reşit DEMİR, İrfan GÜNGÖR, Y.Tuba TEKGÜL, Prof.Dr.
Ahmet ALP, Yrd.Doç.Dr. Volkan BİLGİLİ
Başlama-Bitiş Tarihleri:
01.04.2015-31.04.2018
Projenin Toplam Bütçesi
153.659 TL
Şanlıurfa, Adıyaman ve Diyarbakır illerine kıyısı bulunan 81700 hektar alana sahip Atatürk
Baraj gölü 21 avlak sahasına ayrılmaktadır. Bu avlak sahalarının 7’si Şanlıurfa, 11’i Adıyaman ve 3’ü
Diyarbakır illerine aittir. Atatürk Baraj gölünde kafeslerde alabalık yetiştiriciliği için DSİ ve TÜGEM
arasında imzalanan protokolle %0.1’lik bir alan serbest bırakılmıştır. Bu proje ile Şanlıurfa iline ait (3, 4,
5, 6 ve 7 no’lu) avlak sahalarının (18.300 Ha) batimetrik ölçümleri yapılarak, suyun fiziksel, kimyasal ve
biyolojik analizleri ile birlikte kafes yetiştiriciliğine uygun koy’ların yüzey alanları tespit edilip taşıma
kapasiteleri ortaya konularak kurulması planlanan işletmelerin kapasitelerine göre bakanlık tarafından
uygun yerler gösterilip düzenli, dengeli ve planlı bir dağılımla uygulama eylem planı ortaya konulmaya
çalışılacaktır. Bu amaçla çalışma sahaları (avlak alanları) eşit aralıklarla gridlere ayrılarak, batimetrik
ölçümler yapılacak, örnekleme yapılmayan alanlardaki batimetrik değerlerin tahmini, batimetrik ve su
analiz sonuçlarının sayısal haritaları ve alan tespiti CBS ortamında jeoistatistiksel teknikler (ordinary
kriging, co-kriging) kullanılarak yapılıp, değişkenlerin uzaysal dağılımları belirlenecektir.
Tahminlerin ve haritalamanın doğruluğu çarpraz validasyon ve bağımsız data setleri
kullanılarak gerçekleştirilecektir. Aşağı Fırat havzasında yer alan Atatürk Baraj Göl’ü nün su ürünleri
yetiştiriciliği açısından en verimli şekilde kullanılabilmesine yönelik yapılacak bu araştırma ile hem
girişimcilere karlı yatırım sahalarını göstermek, hem geçimini balıkçılıkla sağlayan bölge halkına
sürdürülebilir balıkçılık noktasında ışık tutmak ve hem de işsizliğin önüne geçebilmek adına su ürünleri
çalışmalarında doğru adımların atılabilmesi için ülkemizin su ürünleri yetiştiriciliği konusunda su
havzalarını doğru politikalarla yönetebilmesi hedeflenmiştir.
Yeni Teklif Proje
Proje No 25
Proje Başlığı:
Karkamış Baraj Gölünde Yapılan Kafes Yetiştiriciliğinin
Çevresel Etkisinin Araştırılması
Projeyi Yürüten Kuruluş:
Elazığ Su ürünleri Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
Fırat Üniversitesi- Tunceli Üniversitesi
Proje Yürütücüsü:
Rıdvan TEPE- Su Ürünleri Mühendisi
Elazığ Su ürünleri Araştırma İstasyonu Müdürlüğü
Yardımcı Araştırmacılar:
Doç.Dr.Serap SALER, Doç.Dr.Feray ÖZRENK SÖNMEZ, Yr.Doç.Dr
Banu KUTLU, Dr.M.Ali Turan KOÇER, Hilal BULUT, Ahmet SESLİ,
Kenan ALPASLAN, Mehmet KÜÇÜKYILMAZ, Nurten ÖZBEY,
Gökhan KARAKAYA
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
39.500 TL
Dünyada bilim ve teknoloji hızla gelişmekte, nüfus sürekli artmaktadır. Teknolojideki gelişmeler
ve nüfusun artması pek çok sorunu da beraberinde getirmektedir. Bu sorunlardan birisi de artan
nüfusun besin ihtiyacının karşılanmasıdır. Su ürünleri yetiştiriciliği besin ve protein ihtiyacının
karşılanmasında önemli bir kaynaktır.
Su ürünleri yetiştiriciliği özellikle balık yetiştiriciliği üzerinde yoğunlaşmıştır. Bu yetiştiricilik
yöntemlerinden birisi olan kafeslerde balık yetiştiriciliğinde, kafes çiftliklerinden kaynaklanan atıklar,
tüketilmeyen yem, dışkılar ve boşaltım ürünlerinin oluşturduğu çözünmeyen ve çözünebilir formda
maddeler; organik karbon, azot ve fosfor kısımlarıdır (Beveridge, 1984; Gowen ve McLusky, 1988; Enell
ve Ackefors, 1991). Bu atık maddelerin suda çözünmeleri veya sedimentte birikmeleri, sucul ortamda
besleyici elementlerin artışına, suyun fiziksel-kimyasal bazı özeliklerinde değişime, planktonik
organizmaların bolluk, tür çeşitliliği ve sayısında değişmelere sebep olabilmektedir.
Balıkların yoğun yetiştiriciliğinin sebep olabileceği bu iç kirlenmenin boyutları yoğunluk,
besleme tarzı, sıcaklık, su kalitesi, işletmecilik, kültüre alınan tür ve yetiştiricilik tekniğine göre
değişmektedir. Ülkemizde kafeslerde balık yetiştiriciliğinin yapıldığı iç su alanlarından birisi de Karkamış
Baraj Gölü’dür. Karkamış Barajı ve HES Tesisi, Fırat Nehri üzerinde, Suriye Sınırı’na4.5 km. mesafede,
beton ağırlık ve toprak dolgu tipinde ve Türkiye’de nehir santrali tanımıyla gerçekleştirilen ilk
uygulamadır. Bu araştırmada, Karkamış Baraj Gölünde bulunan, kafeslerde balık yetiştiriciliğinden
kaynaklanan toplam besin tuzu akışı tespit edilerek, ekosisteme etkisinin belirlenmesi
amaçlanmaktadır. Bu amaçla, Karkamış Baraj Gölü’n de 12 ay süresince yüzey ve farklı derinliklerdeki
su örnekleri; fiziksel-kimyasal ve bakteriyolojik yönden izlenecek, zooplankton ve fitoplankton
değişimleri gözlemlenecektir. Ayrıca baraj gölü tabanında oluşan birikimleri ortaya koymak amacıyla
sediment örnekleri alınacaktır. Alınan sonuçlara göre, Karkamış Baraj Gölü’ndeki balık çiftliklerinin
çevresel etkisi belirlenerek, etkinin kabul edilebilir sınırlar aralığında tutulması için, işletmelere kirlilik
kontrol önlemleri önerilecektir. Ayrıca alabalık yetiştiricilik çiftliklerinden çevreye verilen kirletici
parametreler için, kirlilik kontrol stratejileri sunulacaktır. Araştırma bulgularının baraj göllerimizde gittikçe
yaygınlaşan kafes sistemlerinin çevresel etkileri konusuna ışık tutacağı düşünülmektedir. .
Yeni Teklif Proje
Proje No 26
Proje Başlığı:
Özlüce Baraj Gölünün Trofik Seviye ve Taşıma Kapasitesi
Yönünden Araştırılması
Projeyi Yürüten Kuruluş:
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
İnönü Üniversitesi Su Ürünleri Fakültesi
Dicle Üniversitesi Fen Fakültesi Biyoloji Bölümü
Proje Yürütücüsü:
Mehmet KÜÇÜKYILMAZ, Su Ürünleri Mühendisi
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Yardımcı Araştırmacılar:
Yrd.Doç.Dr.Mehmet VAROL, Doç.Dr. Aysel BEKLEYEN, Hakan
AKGÜN, G. Nedim ÖRNEKÇİ, A. Atilla USLU, Kenan ALPASLAN
Gökhan KARAKAYA, Nurten ÖZBEY, Gülden ARISOY
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
74.000 TL
Kafes balıkçılığı Türkiye’de, göl, nehir ve baraj göllerinde hızlı bir şekilde gelişmiştir. Hızlı ve
kontrolsüz gelişim bazı çevresel sorunları da beraberinde getirmiştir. Henüz kafes balıkçılığına
açılmamış olsa da Özlüce Baraj Gölü’nde kafes balıkçılığı için çok sayıda müracaatların olduğu
bilinmektedir. Baraj gölünün bulunduğu alanın; ulaşım zorluğu ve güvenlik sorunlarının sık yaşandığı bir
bölge olması nedeni ile limnolojik özellikleri ile ilgili henüz detaylı bir çalışma yapılmamıştır.
Baraj gölü çeşitli kullanımlara açılmadan önce; ortamın ekolojik şartlarını oluşturan su kalitesi
parametreleri ve taşıma kapasitesinin bilinmesi oldukça önem arz etmektedir. Bu çalışmada, baraj
gölünün su kalitesinin fiziksel ve kimyasal parametrelerinin aylık değişiminin belirlenmesi
amaçlanmıştır. Bu amaçla, baraj gölünde belirlenmiş olan beş istasyondan bir yıl boyunca farklı
derinliklerden su ve sediment örnekleri alınacak elde edilen sonuçlar göz önüne alınarak gölde alabalık
yetiştiriciliği, gölün taşıma kapasitesi, fitoplankton ile zooplankton kompozisyonu ve trofik seviyesi
üzerinde bazı değerlendirmelerde bulunulacaktır..
Yeni Teklif Proje
Proje No 27
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
Akdeniz’deki Makrobentik Omurgasızların Çeşitliliğinin ve
Dağılımının Belirlenmesi
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Dokuz Eylül Üniversitesi
Merve KARAKUŞ/ Balıkçılık Teknolojisi Yüksek Mühendisi Akdeniz
Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Doç.Dr. Yılmaz EMRE, Yrd.Doç.Dr. Aydın ÜNLÜOĞLU, Yrd.Doç.Dr.
Mümtaz TIRAŞIN, Dr. F. Banu YALIM, Dr.Özgür AKTAŞ, Hülya
ERCAN, Coşkun Menderes AYDIN, Doğan BAYKALER, Ramazan
UYSAL, Özge ÖZGEN
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
685,800 TL
Türkiye’nin Akdeniz kıyılarında dağılım gösteren bentik organizmalar ve bunların oluşturdukları
toplulukların yapısal özelliklerine ilişkin araştırmalar, daha çok kıyı çizgisinden 10-15 m derinliklere
kadar olan kıyısal bölgelerde yoğunlaşmıştır. Oysa Akdeniz, birçok yerinde aniden derinleşen ve 10002000 m derinliklere kadar ulaşan bir dip yapısına sahiptir. Bu dip yapısı nedeniyle Türkiye kıyılarında
alan olarak oldukça geniş derin deniz ekosistemleri bulunmaktadır. Söz konusu bu alanlarda yapılan
çalışmalar oldukça az ve yetersizdir. Dolayısıyla bu çalışma ile Türkiye’nin Akdeniz kıyılarında; batıdan
doğuya doğru sırasıyla I: Fethiye Körfezi, II: Fethiye Körfezi ile Antalya Körfezi arasında kalan alan, III:
Antalya Körfezi, IV: Antalya Körfezi ve İskenderun Körfezi arasında kalan alan ve V: İskenderun Körfezi
olmak üzere 5 alt bölgede, 1000 metreye kadar olan farklı derinliklerden bentik örneklemeler yapılarak,
bölgenin bentik tür çeşitliliği ve topluluk yapıları ortaya konacaktır. Yapılacak araştırma ile hem büyük
bir bilgi eksikliğinin giderilmesi hem de değişik ekosistem değerlendirme ya da modellerinde
yararlanılabilecek bir veritabanı oluşturulması hedeflenmektedir.
.
Yeni Teklif Proje
Proje No 28
Proje Başlığı:
İstilacı Bir Tür Olan Çakıl Balığı (Pseudorasbora parva
Temminck&Schlegel, 1846)’nın İç Ege, Göller Bölgesi ve İç
Anadolu’daki Yayılımı, Genetik Özellikleri, Portörlük Durumu ve
Biyoekolojik Özelliklerinin Belirlenmesi
Projeyi Yürüten Kuruluş:
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Projeyi Destekleyen Kuruluş:
-Hacettepe Üniversitesi Fen Fakültesi
-Muğla Sıtkı Koçman Üniversitesi Su Ürünleri Fakültesi
Proje Yürütücüsü:
Vedat YEĞEN (Su Ürünleri Yüksek Mühendisi)
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Yardımcı Araştırmacılar:
Rahmi UYSAL, Fuat BİLGİN, Dr. Soner ÇETİNKAYA, Niyazi Can
GÖKÇINAR, Bayram KORKMAZ, Soner SAVAŞER, Ufuk AKÇİMEN
Zübeyde HANOL, Osman YENER, Şakir ÇINAR, Erdinc VESKE
Dr. M. Altuğ ATALAY
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
440.576 TL
Ülkemizdeki varlığı ilk defa 1982 yılında Trakya’da, 1996 yılında da Anadolu’da tespit edilen
Çakıl balığı (Pseudorasbora parva)’nın, son yıllardaki yayılımı hızlanmıştır. Günümüzde; Sakarya,
Bakırçay, Büyük Menderes, Kızılırmak, Orta Akdeniz ve Susurluk havzalarında yayılım göstermektedir.
Ülkemizde, ekolojik açıdan tehlikeli türler arasında nitelendirilen bu türün, Avrupa ülkelerinde son
yıllarda yapılan çalışmalarda bazı Cyprinidae ve Salmonidae üyeleri üzerinde ölümcül etkileri olan bir
patojen parazit (Sphaerothecum destruens) taşıdığı da belirlenmiştir. Bu parazit 2013 yılında ülkemizde
de tespit edilmiştir.
Hızlı bir şekilde büyüme göstermesi, yüksek genetik çeşitliliği, güçlü üreme stratejisi, farklı
çevresel şartlara adaptasyon kabiliyeti ve bulunduğu bölgedeki doğal fauna bireyleri üzerinde
oluşturduğu olumsuz etkilerden dolayı dünyadaki en etkili istilacı omurgalılardan biri kabul olarak edilen
bu türün ölümcül bir hastalık etkeni de taşıması, türle mücadele yöntemlerinin geliştirilmesi ve
uygulamaya geçirilmesini gerektirmektedir. Avrupa’da türle ilgili uygulanan mücadele yöntemlerinin
yeterli başarıyı gösterememesi, ülkemizde ağırlıklı olarak türün yayılım alanları ile ilgili bilgilerin olması,
biyolojisi, genetik çeşitliliği ve hastalık taşıyıcılığı konularında sınırlı sayıda çalışma bulunması bu türle
mücadelede eyleme geçilmesini kısıtlamaktadır.
Bu çalışmanın amacı istilacı bir tür olan P. parva’nın İç Ege, Göller Bölgesi, İç Anadolu
bölgelerindeki yayılım alanlarının ortaya çıkarılması, bu alanlardaki genetik çeşitliliği ile hastalık
taşıyıcılığı durumunun belirlenmesi ve türle mücadele yöntemleri geliştirebilmek için gerekli bilimsel
altyapının hazırlanmasıdır.
.
Yeni Teklif Proje
Proje No 29
Proje Başlığı:
Gen Bankası Veri Tabanının Oluşturulması: Kalkan Balığı
(Psetta maxima)
Projeyi Yürüten Kuruluş:
Trabzon Su Ürünleri Merkez Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Şirin FİRİDİN, Uzman Biyolog
Trabzon Su Ürünleri Merkez Araştırma Enstitüsü
Yardımcı Araştırmacılar:
Oğuzhan EROĞLU, Z.Duygu BAK, Feridun AFAN, İlyas KUTLU
Eyüp ÇAKMAK, Dr.İlhan AYDIN, Hamza POLAT, D.Selim MISIR
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
215.000 TL
Yassı balıklar sıra dışı morfolojik özellikleri ve kendine has yapıları nedeni ile uzun yıllardan
beri araştırmacıların ilgisini çekmektedir. Yassı balıkların bazı türleri tüm dünya genelinde yüksek
ekonomik öneme sahip türlerdir. Bu nedenle her geçen gün artan av baskısı nedeni ile tehdit altındadır.
Ekonomik önemi nedeni ile yetiştiricilik faaliyetlerine başlatılmış ve alternatif tür olarak bazı bölgelerde
üretimi yapılmaktadır. Bu kapsamda yetiştiricilik faaliyetleri sonucunda balıklandırma ve doğaya kaçma
gibi nedenlerle doğal stoklarla bir etkileşim içerisindedir. Yetiştiricilik faaliyetlerinin yanında ekolojik
tahribatlar nedeni ile habitatları tehdit altında olan bu türlerin stokları gün geçtikçe azalmaktadır. Tehdit
altındaki stokların ve türün korunması çalışmalarında popülasyonların genetik yapısının bilinmesi çok
önemli olmaktadır.
Bu çalışmada örnekleme Türkiye’nin Karadeniz kıyılarında Kalkan balığının göç senaryosuna
uygun olarak aralarında 200km mesafeler olacak şekilde belirlenen istasyonlardan (Artvin, Trabzon,
Ordu, Samsun, Kastamonu, Zonguldak, Kocaeli, İstanbul, Kırklareli, Balıkesir, Marmara Denizi
(Bandırma-Silivri)) yapılacaktır. Her istasyondan 50 şer adet örnekten 2-3 cm’lik kuyruk dokusu alınarak
%98’lik ethanol içerisine konulacaktır. DNA ekstraksiyonu ticari kitler kullanılarak yapılacaktır. cDNA
kütüphanesi için ise kas, karaciğer, solungaç ve böbrek dokularından örnekler alınıp RNA ladder içinde
muhafaza edilecek uygun protokolle cDNA kütüphanesi oluşturulacaktır Çalışılacak mikrosatellit
lokusların ve mtDNA genleri PZR optimizasyonları yapıldıktan sonra belirlenen lokuslar floresan işaretli
primerler ile çoğaltılarak fragment analizleri yapılacaktır. mtDNA genlerinin sekansları ise çift taraflı
olarak belirlenecektir. Ayrıca SNP analizleri yapılarak mutasyon düzeyine bakılacaktır. Veri analizi; her
bir fragment sonucuna göre allel büyüklükleri belirlenerek, her bir populasyon içerisindeki allel sayıları
ve frekansları belirlenerek populasyon genetiği parametreleri (Ne, Nm, Ho, He, F-istatistikleri, genetik
mesafe, HWE vb.) hesaplanacaktır. Sekans analizleri ise düzenlendikten sonra genbanktan alınacak
sekanslar ile birlikte filogenetik analizlerde kullanılacak ayrıca çalışılan genlerin karakterizasyonu
yapılacaktır. Çalışılan balıklardan elde edilecek olan spermler karyoprezarvasyon yöntemiyle
saklanacaktır. Tüm bu moleküler karakterizasyonlar morfometrik ve meristik analizlerle
desteklenecektir.
Islah çalışmaları için genetik kaynak, yetiştirme çalışmalarına materyal temini ve tür tescil
komitesinin kriter belirleme ihtiyacına yönelik veri toplanarak veri üretimi ve veri depolama arasındaki
uyumsuzluğun giderek artması ve sömürülen stokların sürdürülebilir kullanımı ve korunması için
bilgilendirici ve tekrarlanabilir referans veritabanı oluşturacak ve balıkçılık yönetimi için gelecekteki
bilimsel çalışmaları destekleyecek sürekli veri erişilebilirliğine katkıda bulunulacaktır. Türün damızlık
yönetimi, ıslahı ve biyoteknolojik uygulamalarına yönelik uygulamalar gen materyali ve bilgi kaynağı
sağlayacaktır ve bu sayede balıklandırma uygulamalarında kullanılacaktır.
.
Yeni Teklif Proje
Proje No 30
Proje Başlığı:
Türkiye’deki Kerevit (Astacus leptodactylus) Popülasyonlarının
Genetik Yapısının Moleküler Metotlarla Belirlenmesi
Projeyi Yürüten Kuruluş:
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Projeyi Destekleyen Kuruluş:
Elazığ Su Ürünleri Araştırma İstasyon Müdürlüğü
Proje Yürütücüsü:
Zübeyde HANOL Uzman Biyolog
Su Ürünleri Araştırma İstasyonu Müdürlüğü - Eğirdir
Yardımcı Araştırmacılar:
Prof.Dr.Cemal TURAN, Zübeyde HANOL, Soner SAVAŞER,
Mehmet CİLBİZ, Osman YENER, Ferhat DEMİROL
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
266.780 TL
Dünya üzerinde 3 familyaya ait olan 600’den fazla kerevit türü olup dağılımları farklılıklar
göstermektedir. Bu türlerden biri sadece ülkemizde bulunan tatlısu istakozu Astacus leptodactylus’tur.
A. leptodactylus ülkemizde ilk defa Marmara Bölgesi’ndeki Uluabat (Apolyont) ve Manyas göllerinde,
1960’lı yıllarda avlanarak ihraç edilmeye başlanmıştır. Artan taleplerle diğer göllerimizde de avcılığı
başlamış olup, başta Eğirdir, Işıklı, Beyşehir, Akşehir, Eber ve Hotamış gölleri olmak üzere bütün
rezervuarlarımızdan avlanarak, ihraç edilmiştir. O dönemde üretimin % 60’lık kısmı tek başına Eğirdir
Gölü’nden sağlanmıştır. Ancak, 1985 yılında ortaya çıkan Aphanomyces astaci’nin neden olduğu
‘Kerevit Vebası hastalığı’, bilinçsiz avcılık, rekabet, su kirliliği ve diğer nedenlerden dolayı 1984 yılında
8.000 ton civarında olan kerevit üretimi 200 tona kadar düşmüş ve stoklarımız bitme tehlikesiyle karşı
karşıya kalmıştır. Stokları tehlikede olan bu canlıların neslinin devamı için var olan popülasyonların
korunması gerekmektedir. Bu yüzden popülasyonlar arasındaki genetik çeşitlilik hayati önem
taşımaktadır. Fakat ülkemizde kerevitlerin popülasyon genetiği ile ilgili çalışmalar yok denecek kadar az
olup var olan çalısmaların genellikle hastalık, avcılık, biyolojik ve morfolojik özellikler, et verimi ve
ekoloji alanında yoğunlaşmış olduğu görülmektedir. Dolayısıyla, A. leptodactylus türünün Türkiye’de
bulunan popülasyonlarının genetik yapılarının bilinmesi, bu türe ait popülasyonların ve bu türün
sürdürebilirliğinin sağlanması ve korunması açısından çok önemlidir. Ayrıca kerevit stoklarının genetik
yapısının ortaya koyulması ileride yapılacak genetik yapı – hastalık ilişkisi ve hastalığa dayanıklı,
kültüre alınmaya daha uygun bireylerin tespiti çalışmalarına bilimsel temel olacaktır. Tüm bunlardan
yola çıkarak çalışmamızda moleküler mitokondrial DNA (mtDNA) dizin analizi tekniğini kullanılarak
Türkiye’de A. leptodactylus popülasyonlarının genetik yapıları ve alt tür olarak bildirilen A. leptodactylus
leptodactylus ve A.leptodactylus salinus’un genetik farklılıkları incelenecektir. Örneklemeler A.
leptodactylus ‘un Türkiye’de dağılım gösterdiği bölgelerden ve alt tür düzeyinde farklılık gösterdiği iddia
edilen bölgelerden (34) her kaynağı temsil edecek kadar 30 bireyin kas(chela ya da preopod)
dokusundan örnek alınıp % 98’lik etanole konulacak ve laboratuvara getirilerek, DNA izolasyonu
yapılana kadar -20˚C’de saklanacaktır. DNA izolasyonu yapıldıktan sonra populasyon çalışmalarında
yaygın olarak kullanılan ve yüksek mutasyon gösteren mtDNA D-loop, 16S rDNA and Cytochrome b
bölgeleri için üniversal primerler kulanılarak PCR amplifikasyonu yapılacaktır. PCR ürünleri
saflaştırıldıktan sonra DNA, dizi analizi için dizin analizi yapan firmalara gönderilecektir. mtDNA
genlerinin polimorfizmi kontrol edilecek ve yüksek polimorfizm gösteren genden rutin analizler
yapılacaktır. Genetik istatistik programları kullanılarak genetik çeşitlilik ve farklılıklar değerleri
belirlenmeye çalışılacaktır.
Yeni Teklif Proje
Proje No 31
Proje Başlığı:
Karadeniz’deki Barbunya Balığı (Mullus barbatus)
Popülasyonlarının Genetik Yapısının Zamansal
Değişiminin(1989-2015) Belirlenmesi
Projeyi Yürüten Kuruluş:
Trabzon Su Ürünleri Merkez Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Şirin FİRİDİN, Uzman Biyolog
Trabzon Su Ürünleri Merkez Araştırma Enstitüsü
Yardımcı Araştırmacılar:
Oğuzhan EROĞLU, Z.Duygu BAK, Feridun AFAN, İlyas KUTLU
Eyüp ÇAKMAK, Dr.Yaşar GENÇ,Dr. Orhan AK, İlkay Ö. AKPINAR
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
224.000 TL
Tüm gıda türlerinin tarımsal biyoçeşitliliği, genel biyoçeşitliliğin vazgeçilmez bir parçası olup, gıda
zincirinin, dünyanın her yanındaki çiftçiler, hayvan yetiştiricileri ve balıkçılar tarafından geliştirilen ve
korunan ilk halkasıdır. Ülkemizde hayvan genetik kaynakları yeterince değerlendirilememiş hatta
bazıları ya hiç tanımlanmadan ya da tam olarak tanımlanmadan yok olmuş veya yok olma tehlikesi ile
karşı karşıya kalmıştır. Deniz türlerine bakıldığında aşırı avcılığın yanı sıra yetersiz kontrol ve takipsizlik
birçok türün yaşamını sürdürmesini engelleyen en büyük tehditlerdir.
Vahşi doğanın genetik yapısı analiz edilirken kısa zamanda ve sık aralıklarla genellikle 2 veya 3
örneklemeyle veya mekânsal karşılaştırmalara dayalı çalışmalar olmuştur. Genetik yapı üzerine gen
akışı, seleksiyon ve genetik sürüklenme gibi faktörlerin göreceli rolleri içinde değerli bilgiler ortaya
konulmasına rağmen gen frekanslarının kısa zamanda ayrıt etmek zordur. Son zamanlardaki PCR
(Polimerasechainreaction) kullanımı özellikle DNA çalışmalarına ayrı bir ivme kazandırmış, 100 yıl veya
daha öncesinden saklanmış balık pulu ve otolit örnekleri ile bile çalışma imkanı sağlamıştır. Ayrıca
canlıyı öldürmeden alınan çok küçük bir doku parçasıyla çalışma imkanı vermesi diğer bir artı özelliktir.
Bu günlerde çoğunlukla kullanılan moleküler metotlar arasında mitokondrial DNA (mtDNA)’nın sekansı,
RFLP (RestrictionFragmentLenghtPolimorphism) analizi, minisatellit ve mikrosatellit DNA markır
çalışmaları gelmektedir.
Zamansal genetik çalışmalar için kullanılan DNA ‘nın en önemli kaynağını arşivlenmiş otolitler
oluşturur. Balıklarda otolit konusunda yapılan pek çok çalışma mevcut olup bu konunun zengin bir
geçmişi bulunmaktadır. Balıklardaki çalışmalar genellikle yıllık yaş halkalarından yola çıkarak yaş tayini,
buna bağlı olarak boy-yaş ilişkileri, mevsimsel büyümeler, üreme dönemleri gibi konularda olmaktadır.
Son yıllarda balık larvalarında otolit araştırmaları da hız kazanmış durumdadır. Bu konuda çok sayıda
ve çok farklı amaçlar içeren araştırmalar vardır.
Bu çalışmada arşivlenmiş örnekler için öncelikle Doğu Karadeniz olmak üzere Artvin, Trabzon ve
Sinop(Şekil 1) , yeni alınacak örneklerde ise tüm Karadeniz’i içine alacak şekilde Artvin, Trabzon,
Samsun,
Sinop,
Zonguldak
ve
İstanbul
kıyılarını
içermektedir.
Proje
sonucunda
Mullusbarbatuspopülasyonlarının 1989-1995 ve 2007 yıllarına ait arşivlenen otolit koleksiyonları
kullanarak genetik olarak karakterize edilmesi, ayrıca ekonomik öneme sahip bu balık türünün; 2015
yılında örneklemesi yapılarak genetik, morfometrik ve meristik ölçümleri alınarak veri tabanı
oluşturulacak böylelikle günümüz verilerinin geçmişle karşılaştırılması sağlanarak varsa polimorfizim
düzeyi ortaya çıkartılmış olacaktır..
Yeni Teklif Proje
Proje No 32
Proje Başlığı:
Türkiye’nin Batı Akdeniz Kıyılarının Carlıt (Cartography of
Littoral) İle Ekolojik Durumunun Belirlenmesi
Projeyi Yürüten Kuruluş:
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Müdürlüğü
Projeyi Destekleyen Kuruluş:
Celal Bayar Ü., Fen Edebiyat Fakültesi Biyoloji Bölümü
Proje Yürütücüsü:
Doç.Dr. Ergün TAŞKIN, Celal Bayar Üniversitesi Fen Edebiyat
Fakültesi Biyoloji Bölümü
Dr. F. Banu YALIM, Akdeniz Su Ürünleri Araştırma Üretme ve
Eğitim Enstitüsü Müdürlüğü
Yardımcı Araştırmacılar:
Serkan ERKAN, Murat YEŞİLTAŞ, Özge AYDOĞAN
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
30.328 TL
AB Su Çerçevesi Direktifi (SÇD) (2000/60/EC) ve 2008 yılında yürürlüğe giren AB Deniz
Stratejisi Direktifi (DSÇD) (2008/56/EC) uygulamalarına yönelik olarak; akuatik ortamların ekolojik
durumlarının belirlenmesi ve beş sınıfta (Yüksek, İyi, Orta, Zayıf, Kötü) toplanması amaçlanmıştır. Bu
nedenle kıyı ve geçiş sularının ekolojik durum tespiti yapılırken makrofitler (makroalgler ve
angiospermler) diğer canlı grupları olan bentik omurgasızlar, fitoplankton ve balıklar gibi biyolojik
element olarak kabul edilmiştir.
Akdeniz Coğrafi İnterkalibrasyon Grubu (MEDGIG) tarafında Akdeniz eko-bölgesinde CARLIT
(CARtography of LITtoral) yöntemi intekalibre edilmiştir.
Türkiye denizlerinde makroalgler ile angiospermler kullanarak kıyı ve geçiş sularının sınıflandırılmasına
yönelik çalışmalar yok denecek kadar azdır. Bu projede çalışmasında CARLIT (CARtography of
LITtoral) metodu ile Türkiye’nin Batı Akdeniz kıyılarının (Gazipaşa-Fethiye Arası) ekolojik durumu
belirlenecektir. Ayrıca ekolojik durum tespiti yapılırken araştırma bölgesinde bulunan bentik makroflora
(makroalgler ve angiospermler) çeşitliliği de belirlenecektir.
.
Yeni Teklif Proje
Proje No 33
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Yardımcı Araştırmacılar:
Keban, Karakaya ve Atatürk Baraj Gölleri’nde Ağır Metal
Kirliliğinin Bazı Balık Türlerindeki Biyokimyasal Parametreler ve
Et Kalitesi Üzerine Etkisi
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Fırat Üniversitesi-Kafkas Üniversitesi-Adıyaman Üniversitesi- Tunceli
Üniversitesi
Ayşe Gül ŞAHİN, Su Ürünleri Yük. Mühendisi
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Doç. Dr. Özden BARIM ÖZ, Hakan AKGÜN, Prof. Dr. Mine ERİŞİR
Doç.Dr. Fulya BENZER, Yrd. Doç. Dr. Semra TÜRKOĞLU, Doç. Dr.
Özgür FIRAT, Prof. Dr. Ebru BEYTUT, Hülya ŞAHİN, Nurten ÖZBEY
Mehmet KÜÇÜKYILMAZ, Tacettin YILDIRIM, Tunay ŞEKER, Gürel
Nedim ÖRNEKÇİ
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
68.250 TL
Bu araştırma, Doğu ve Güneydoğu Anadolu Bölgesi’nde önemli bir yere sahip olan, bölgesel
ağır metal kirliliğinin belirlendiği; Keban (Canpolat, 2007),Karakaya (Ural vd., 2009)ve Atatürk Baraj
(Karadede ve Ünlü E., 2000; Alhas, 2009; Fırat vd., 2010; Mol vd., 2010) Gölleri’nden, insanların
tüketimine sunulan balıkların avlandığı bölgelerde yapılacaktır. Buradan alınan balıkların(Capoeta trutta
ve Cprinus carpio carpio) dokularında (kas, karaciğer) önemli ve etkin olan antioksidanlardan
süperoksitdüsmütaz (SOD), Glutatyonperoksidaz (GSH-Px) ve glutatyon (GSH) seviyeleri, oksidatif
stresin göstergesi lipidperoksidasyonun son ürünü olan malondialdehit (MDA) düzeyi belirlenecektir.
Ayrıca dokulardaki protein yapısını teşkil eden amino asit kalitesi ve mineral madde seviyeleri (bakır
(Cu), demir (Fe), çinko (Zn), krom (Cr), nikel (Ni), kadmiyum (Cd) da tespit edilecektir. Böylece temiz ve
kirli bölgelerde karşılaştırmalı olarak yapılacak bu çalışmada; et kalitesinde bozulmaya sebep
olabilecek bir zincir reaksiyonu (serbest radikal-mineral madde-antioksidan-MDA-aminoasitler)
irdelenerek yıkımlanma oranı ve bu etkinin mekanizması araştırılacaktır.
Yeni Teklif Proje
Proje No 34
Proje Başlığı:
Atatürk Baraj Gölü’nde Su ve Sediment Örnekleri ile Ekonomik
Öneme Sahip Balık Türlerinde Poliaromatik Hidrokarbon
Düzeylerinin Belirlenmesi
Projeyi Yürüten Kuruluş:
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
İnönü Üniversitesi, Su Ürünleri Fakültesi Fırat Üniversitesi, Veteriner Fakültesi
Proje Yürütücüsü:
Nurten ÖZBEY, Kimya Müh. Elazığ Su Ürünleri Araştırma İstasyonu
Müdürlüğü
Yardımcı Araştırmacılar:
Yrd. Doç. Dr. Memet VAROL
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
152.440 TL
Amerikan Çevre Koruma Ajansı’nın (USEPA) belirlemiş olduğu öncelikli kirleticiler listesinde yer
alan poliaromatik hidrokarbonlar (PAH’lar), toksik, mutajenik, teratojenik ve karsinojenik özelliklere
sahip olup petrol ve petrol türevlerinde yaygın olarak bulunurlar. Degredasyona karşı dirençli olan
PAH’lar, doğal su ortamlarına girdiklerinde sedimentlerde ve sucul organizmalarda birikirler ve
biyomagnifiye olarak besin zincirinin en son halkasında bulunan insanlara daha da yoğunlaşmış olarak
ulaşırlar.
Atatürk Baraj Gölü, elektrik enerjisi üretimi, tarımsal sulama, kültür balıkçılığı, su ürünleri avcılığı
ve rekreasyon açısından Güneydoğu Anadolu Bölgesi için önemli bir su kaynağıdır. Buna karşın, petrol
boru hatlarında meydana gelen sızıntılar/patlamalar, baraj gölünün su kalitesini ve ekosistem sağlığını
olumsuz yönde etkilemektedir. Atatürk Baraj Gölü’nün su kalitesi ve ağır metal kirliliği ile ilgili bazı
çalışmalar yapılmasına rağmen, baraj gölünün poliaromatik hidrokarbon düzeylerinin belirlenmesine
yönelik henüz hiçbir bilimsel araştırma yapılmamıştır. Bu bakımdan baraj gölünden toplanacak çeşitli
matrislerde (su, sediment ve balık) PAH düzeylerinin belirlenmesine yönelik kapsamlı bir çalışmanın
yapılması, ekosistem ve insan sağlığı açısından büyük önem taşımaktadır.
Önerilen bu proje ile, Atatürk Baraj Gölü’nde belirlenen örnekleme noktalarından 1 yıl boyunca
mevsimsel olarak toplanacak ekonomik öneme sahip balık türleri ile su ve sediment örneklerinde 15
poliaromatik hidrokarbon bileşiğin konsantrasyonlarının belirlenmesi amaçlanmaktadır. Örneklerdeki
PAH bileşiklerinin kalıntı düzeyleri, flüoresans detektörlü yüksek performanslı likit kromatografi (HPLCFLD) cihazı ile tayin edilecektir.
Bu araştırma projesi ile doğal su ekosistemleri için önemli bir tehdit oluşturan PAH’ların Atatürk
Baraj Gölü su, sediment ve balık örneklerindeki düzeyleri ilk kez belirlenecektir. Farklı matrislerdeki
PAH’ların analiz sonuçları, ulusal ve uluslararası kriterler/standartlar ile karşılaştırılarak baraj gölü
ekosistemi ve insan sağlığı açısından risk oluşturabilecek PAH’lar tespit edilecektir. Ayrıca proje
sonuçlarının, ileride bu konuda yapılacak olan bilimsel çalışmalara önemli katkılar sağlayacağı
düşünülmektedir.
Yeni Teklif Proje
Proje No 35
Proje Başlığı:
Trabzon Açıklarında Deniz Suyunun Bazı Fiziksel Ve Kimyasal
Özelliklerinin Belirlenmesi
Projeyi Yürüten Kuruluş:
Trabzon Su Ürünleri Merkez Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Muhammed Baran KILIÇ, Çevre Yüksek Mühendisi
Trabzon Su Ürünleri Merkez Araştırma Enstitüsü
Yardımcı Araştırmacılar:
Dilek FİDAN, Bayram ZENGİN, Ufuk AKBAŞ, Ömer KALIPÇI
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2018
Projenin Toplam Bütçesi
36.400 TL
Karadeniz, Dünya denizleri içerisinde farklı özelliklere sahiptir. Ekosistem olarak incelendiğinde
pek çok bilimsel problemin cevap beklediği ve aktüel önemi görülmektedir. Karadeniz’de uzun yıllardan
beri yapılan oşinografik araştırmalar, sistemin genel fiziksel ve biyokimyasal özelliklerinin
tanımlanmasında önemli rol oynamasına rağmen, bu araştırmaların yeterli oldukları söylenemez.
Deniz suyunun bileşimini genel olarak etkileyen kimyasal, biyokimyasal ve fiziksel olayların
anlaşılabilmesi için sıcaklık, tuzluluk, yoğunluk, pH, alkalinite, elektriksel iletkenlik, çözünmüş gazlar,
besleyici ve inorganik elementler gibi parametrelerin vertikal ve horizontal dağılımlarının zaman
içerisindeki değişimlerinin belirlenmesi gereklidir.
Bu anlamda proje ile su kolonunda bazı fiziksel ve kimyasal parametrelerin (sıcaklık, tuzluluk,
sigma-t, elektriksel iletkenlik, pH, çözünmüş oksijen, klorofil-a, ışık geçirgenliği, seki diski) aylık ve
mevsimsel değişimleri incelenerek farklı amaçlar doğrultusunda kullanılabilecek uzun süreli verilere
dayalı bir veri tabanının oluşturulması hedeflenmiştir. Bu parametrelerin ölçümü SBE-25 model CTD
sistemi kullanılarak yapılacaktır.
Yeni Teklif Proje
Proje No 36
Proje Başlığı:
Antalya Körfezine Akarsularla Taşınan Kirletici Yüklerinin
Belirlenmesi ve Körfez Su Kalitesinin Mevsimsel Değişimi
Projeyi Yürüten Kuruluş:
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Müdürlüğü
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Dr. Özgür AKTAŞ, Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim
Enstitüsü Müdürlüğü
Yardımcı Araştırmacılar:
Dr. Özgür AKTAŞ, Doç. Dr. Yılmaz EMRE, Dr. F. Banu YALIM, Dr.
Mehmet Ali Turan KOÇER, Prof. Dr. Ayşe MUHAMMETOĞLU
Faruk PAK, Hatice ORUÇ, Seçil T. DUĞAN, Gazi UYSAL
Nesrin EMRE, Murat YEŞİLTAŞ, Merve BAYOĞLU
Başlama-Bitiş Tarihleri:
01.01.2015-30.06.2017
Projenin Toplam Bütçesi
268.250 TL
Dünya nüfusunun sürekli olarak artması çevreyi olumsuz yönde etkilemektedir. Gelişmekte olan
ülkeler, kalkınma çabası gösterirken çevre kirlenmesine karşı alınması gereken önlemleri göz ardı
etmektedir. Tüm dünyada olduğu gibi ülkemizde de kıyısal kesimde gözlenen nüfus yoğunluğu, hızlı
sanayileşme ve tarımsal kökenli kirleticiler, su ve çevre kirliliğine sebep olmakta ve biyolojik kaynaklar
üzerinde baskı oluşturmaktadır. Türkiye’nin Akdeniz kıyısındaki en büyük kentlerinden biri olan Antalya,
sahip olduğu tarihi ve doğal güzellikleri ile iç ve dış turizmin ülkemizde en yoğun olduğu bölgelerin
başında gelmektedir. Turizm istihdamının bir sonucu olarak bölge oldukça yoğun bir iç göçe ev sahipliği
yapmaktadır. Bölgenin sürdürülebilir turizm faaliyetleri için, deniz ve kıyı alanlarının korunması ve
kirliliğin önlenmesi ile mümkün olacaktır. Bu nedenle Antalya kıyılarının sürdürülebilir kalkınma ilkesi
çerçevesinde, kıyı yönetiminin sağlanması hem karasal kaynaklı kirleticilerin, hem de deniz suyu
kalitesinin ve biyolojisinin izlenmesine yönelik çalışmalar ile gerçekleştirilir. Proje kapsamında karasal
kaynaklı kirleticilerin kıyı ve deniz ortamındaki etkilerinin alansal ve zamansal değişimlerinin
belirlenmesi hedeflenmiş olup Antalya Körfezinin Demre’den Gazipaşa’ya kadar olan bölümünde
seçilecek istasyonlarda su, sediment ve plankton örnekleri üzerinde çalışmalar gerçekleştirilecektir.
Yeni Teklif Proje
Proje No 37
Proje Başlığı:
Doğu Anadolu Bölgesi’nde İç Su Balıkları Avcılığının SosyoEkonomik İndikatörleri
Projeyi Yürüten Kuruluş:
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Projeyi Destekleyen Kuruluş:
Ankara Üniversitesi Ziraat Fakültesi
Su Ürünleri Mühendisliği
Proje Yürütücüsü:
İlhan CANPOLAT, Mühendis
Elazığ Su Ürünleri Araştırma İstasyonu Müdürlüğü
Yardımcı Araştırmacılar:
Doç. Dr. A.Şeref KORKMAZ, Erdem MEMİŞOĞLU, Mehmet
KÜÇÜKYILMAZ, Selami ARCA, Mustafa BALCI, Selahattin
GÜRÇAY, Tolga COŞKUN
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2016
Projenin Toplam Bütçesi
45.000 TL
Türkiye’de bugüne kadar balıkçılık yönetiminin kararlarında çeşitli ülkelerde kullanılan biyolojik
indikatörler dikkate alınmış, sosyo-ekonomik indikatörler ise hiç göz önüne alınmamıştır. Doğu Anadolu
Bölgesi Türkiye iç su balıkları avcılığında büyük paya (%32,49) sahip ve ulusal su ürünleri sektörüne
katkı sağlayan bölgelerden birisi olması nedeniyle önemli bir balıkçılık sahasıdır.Bölgedeki iç sularda su
ürünleri avcılığı yapan 31 adet Su ürünleri kooperatifine bağlı 458 adet balıkçı teknesi mevcut olup, bu
teknelerde doğrudan istihdam edilen yaklaşık 800 balıkçı ile sektöre hizmet veren yan sektörlerde
çalışanlar da dikkate alındığında, birkaç bin kişi geçimini balıkçılıktan sağlamaktadır.
Ayrıca, sadece Van ilinde avlanan ve endemik bir tür olan Van Gölü inci kefalinin (Alburnus
tarichi) avlandığı bölge olması bakımından da özel bir önem taşımaktadır. Türkiye’de iç su balıkları av
miktarının yaklaşık 1/3’ünü sağlayan avlama işletmeleri Doğu Anadolu Bölgesi’nde olmasına rağmen,
bu bölgedeki balıkçılığın sosyal ve ekonomik indikatörlerinin saptanmasına yönelik bir araştırma
bulunmamaktadır.
Türkiye’de iç su balıkçılığına yönelik ve bölgesel düzeyde yürütülecek bu ilk araştırmada, Doğu
Anadolu Bölgesi’ndeki balıkçılığın sosyo-ekonomik yapısı incelenerek sosyal ve ekonomik indikatörlerin
belirlenmesi ve balıkçılık yönetimi yetkililerine sürdürülebilir balıkçılık için veri temin edilmesi
amaçlanmıştır.
Bu araştırma, Türkiye iç balıkçılık sektöründe önemli bir yeri olan Doğu Anadolu Bölgesi’nde
sürdürülebilir iç su balıkları avcılığı için avlama filosunun fiziksel ve teknik özellikleri ile işletmelerin
sosyal ve ekonomik yapılarının belirlenmesi ve sürdürülebilir balıkçılığın önemli parametrelerinden
sosyo-ekonomik indikatörlerin tespiti amacıyla planlanmıştır. Araştırmada elde edilecek sonuçların
balıkçılık yönetimi tarafından (BSGM) uygulanabilir ve sürdürülebilir balıkçılık yönetim politikalarının
hazırlanmasında, destekleme politikalarının belirlenmesinde, bölgesel farklılıkların tespitine ışık tutması
hedeflenmiştir.
Türkiye’de avlama işletmelerinin sosyo-ekonomik indikatörlerinin tespitine yönelik çalışmaların
oldukça sınırlı olması ve iç sulardaki avlama işletmelerine ilişkin herhangi bir çalışma olmaması
nedeniyle, yapılacak bu araştırmanın bundan sonraki araştırmalar için temel oluşturacağı da
düşünülmektedir. Proje kapsamında hazırlanan anket formları projede yer alan araştırmacılar
tarafından balıkçı/yöneticiyle yapılan birebir görüşmelerle doldurulacaktır.
Yeni Teklif Proje
Proje No 38
Proje Başlığı:
Projeyi Yürüten Kuruluş:
Projeyi Destekleyen Kuruluş:
Proje Yürütücüsü:
Karadeniz Bölgesi’nde Kültür Balıkçılığı’nın Mevcut Durumu ve
Projeksiyonlar: Yeni Stratejiler Geliştirme
Su Ürünleri Merkez Araştırma Enstitüsü Müdürlüğü/Trabzon
Tuna ÖZCELEP
Balıkçılık Tekn. Yük. Müh., Su Ürünleri Merkez Araştırma Enstitüsü
Müdürlüğü/Trabzon
Yardımcı Araştırmacılar:
Ali ÇANKAYA, Ekrem Cem ÇANKIRILIGİL, Eyüp ÇAKMAK, Hasan
ERGÜN, Hüseyin SELEN, Murat DAĞTEKİN, Osman Tolga ÖZEL
Başlama-Bitiş Tarihleri:
01.01.2015-31.12.2017
Projenin Toplam Bütçesi
157.000 TL
Ülkemizde yetiştiricilik endüstrisi birçok sorunla karşı karşıyadır. Üreticilerin ve işletmecilerin
başarılı bir tanımlama ve teşvik sistemine ihtiyaçları vardır. Ayrıca hayvan ıslahı, çevresel etkilerin
azaltılması, pazar rekabet gücünün artırılması, küçük ve orta boy işletmelerin devamlılığının ve tüketici
güveninin sağlanması gibi birçok sorunun üstesinden gelinmesi gerekmektedir.
Ülkemizde bu sorunları ayrı ayrı ve bir kısmını bir arada inceleyen bazı çalışmalar mevcuttur.
Bu çalışmada Karadeniz Bölgesi’ndeki yetiştiricilik endüstrisi komple bir şekilde ve tüm bileşenleri,
birbirleriyle etkileşimli olarak incelenecektir.
Coğrafik olarak Karadeniz Bölgesi’nin tamamını içine alan bu çalışma, Artvin-Düzce arasında
yer alan 17 ilde ve kısmen bu bölgede yer alan 6 ilin (Çorum, Çankırı, Erzincan, Erzurum, Sivas ve
Sakarya illerinin) Karadeniz Bölgesi’nde kalan ilçelerinde tatlı su, deniz suyu, balık türü ve kapasite
ayrımı yapılmaksızın yaklaşık 500 işletmede gerçekleştirilecektir.
Bu proje; geçmişte yapılan çalışmalarla ortaya konulan durumu, günümüzdeki durumla
karşılaştırma imkanı verecektir. Ayrıca Karadeniz Bölgesi’ndeki işletmelerin bugünkü durumuna
bakarak, geçmişte yapılan eksiklikleri ve geleceğe yönelik yapılacakları tespit etmek amacıyla yapılacak
olan bu çalışma, bölgemiz ve ülkemiz yetiştiricilik sektörü açısından faydalı olacak veriler içerecektir.
Böylece sektörün gelişiminin nasıl sağlam temeller üzerine atılabileceğinin resmi çekilebilecektir.
SU ÜRÜNLERİ ARAŞTIRMALARI
PROGRAM DEĞERLENDİRME
TOPLANTISI
03-07 Mart 2014
ANTALYA
Tablo 14: Entansif Yemleme+Süt+Mera Sistemine Dayalı Besleme Sisteminde Merinos Kuzularının Tahmin Edil
Gelir-Marjinal Masraf Değerleri
DEVAM EDEN PROJELER
261
Devam Eden Proje
Proje No TAGEM/HAYSUD/2013/A11/P-01/1
Proje Başlığı:
Çipura yemine farklı oranlarda eklenen Mannan-oligosakkarit
(MOS)’in Çipura (Sparus aurata)’lar da büyüme ve et kalitesi
üzerine etkileri
Projeyi Yürüten Kuruluş:
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Müdürlüğü
Projeyi Destekleyen Kuruluş:
Çukurova Üniversitesi Su Ürünleri Fakültesi
TabloYürütücüsü:
14: Entansif Yemleme+Süt+Mera
Sistemine Dayalı
Besleme
Sisteminde
Merinos Kuzularının Tahmin Edil
Proje
Serap GELİBOLU,
Su Ürünleri
Yüksek
Mühendisi
Akdeniz Su Ürünleri Araştırma Üretme ve Eğitim Enstitüsü
Gelir-Marjinal Masraf Değerleri Müdürlüğü
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
01.03.2013-30.06.2015
Projenin Toplam Bütçesi
48.000 TL
Bütün işletmelerde ekonomik yetiştiricilik için temel hedeflerin başında daha az yemle daha
yüksek canlı ağırlık kazancı elde etmek ve yemden yararlanma oranını artırmak gelmektedir. Balık unu
yem yapımı için gerekli hammaddelerin başında en önemli protein kaynağı olarak gelmektedir. Balık
unu maliyetinin artması ve balık unu olarak kullanılabilecek balık stoklarının giderek daralması su
ürünleri sektörünü yem yapımı için balık ununa alternatif hammadde arayışına zorunlu bırakmıştır. Son
yıllarda verim arttırıcı yem katkı maddeleri üzerinde sıklıkla çalışma yapılmaktadır. Bu yem katkı
maddelerinden biri de ekmek mayası olarak da bilinen Saccharomyces cerevisiae’nin hücre duvarından
elde edilen mannan-oligosakkarit (MOS) dir. MOS, mannan şekerlerinin yetiştiricilik için kullanılabilecek
özellikleri bakımından daha zengin bir formudur. Bu şekerlerin hayvan metabolizmasında; bağışıklık
sistemini düzenlemede, patojenik mikroorganizmaları engellemede (Newman, 1994) olumlu etkileri
belirlenmiştir. Bu çalışmada ülkemizde özellikle Ege ve Akdeniz de doğal olarak yaşayan ve yetiştiricilik
açısından oldukça önemli olan Sparidae familyasına ait Çipura (Sparus aurata) balığı kullanılacaktır.
MOS’un alternatif bir yem katkısı olarak balık yetiştiriciliğinde, özellikle çipura beslemede kullanılabilme
imkanı araştırılacaktır. Çalışma kapsamında büyüme performansını artıracağı düşünülen MOS’un
büyüme üzerine ve MOS kullanımından sonra et kalitesi üzerine etkileri incelenecektir.
Devam Eden Proje
Proje No TAGEM/HAYSUD/2011/A11/P-01/5
Proje Başlığı:
Mersin Balığı Yetiştiriciliği ve Koruma Stratejisi Geliştirilmesi
Projeyi Yürüten Kuruluş:
Su Ürünleri Merkez Araştırma Enstitüsü
Projeyi Destekleyen Kuruluş:
Sinop Üniversitesi, Su Ürünleri Fakültesi
İstanbul Üniversitesi, Su Ürünleri Fakültesi
Ondokuz Mayıs Üniversitesi Biyoloji Bölümü
Proje Yürütücüsü:
Dr. Bilal AKBULUT
Su Ürünleri Merkez Araştırma Enstitüsü
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
01.01.2011-31.12.2014
Projenin Toplam Bütçesi
150.000 TL
Projenin amacı, mersin balıklarının yetiştiriciliğini başlatmak, yumurta alımı ve yavru büyütme
faaliyetlerini gerçekleştirmek, etkin koruma stratejisi ve mersin balıklarına özel bir yönetim planı
geliştirmektir. Özel sektör ve iki üniversite işbirliğinde yürütülecek olan proje dört ana iş paketinden
oluşmaktadır. Projede canlı olarak bölgedeki balıkçılardan alınacak balıklar adaptasyon ve yeme
alıştırma sonrasında, anaç adayı olarak kullanılmak üzere canlı muhafazaya alınacaktır. Anaç
stoğundaki balıkların genetik yapısı belirlenerek yetiştiricilik çalışmaları yapılacaktır. Bu balıklarının
yetiştiriciliğinde karşılaşılan hastalıklar incelenerek tanıma ve tedavi yöntemleri belirlenecektir. Mersin
balıklarının temel üreme alanı olan nehirde kirlilik izlenecektir. Kamuoyunu bilgilendirme çalışmaları
yapılacak ve gerek habitat rehabilitasyonu gerekse Karadeniz’deki stokların mevcut durumlarının
iyileştirilmesine yönelik koruma stratejisi ve yönetim planı geliştirilecektir.
262
Devam Eden Proje
Proje No TAGEM/HAYSUD/12/11/01/01
Proje Başlığı:
Yukarı Fırat Havzası Yüzeysel Sularının Kalite ve Yetiştiricilik
Açısından Araştırılması
Projeyi Yürüten Kuruluş:
TAGEM/HAYSUD/12/11/01/01
Projeyi Destekleyen Kuruluş:
Elazığ Su Ürünleri Araştırma İstasyonuMüdürlüğü
Proje Yürütücüsü:
Fırat Üniversitesi Çevre Mühendisliği Bölümü
Erzincan Üniversitesi Tercan M.Y.O
Yardımcı Araştırmacılar:
Nevim BİRİNCİ (Su Ürn.Müh.)
Elazığ Su Ürünleri Araştırma İstasyonuMüdürlüğü
Başlama-Bitiş Tarihleri:
01.01.2012-31.07.2014
Projenin Toplam Bütçesi
195.000 TL
Yukarı Fırat havasında bulunan Bayburt, Erzincan, Gümüşhane, Sivas ve Tunceli illeri su
kaynakları yönünden çok zengin olmasına karşın su ürünleri, tarımsal yapı içerisinde bitkisel üretim ve
hayvancılığa oranla fazla gelişmemiştir. Mevcut illerde alabalık üretimine uygun dere ve kaynak suları
büyük oranda değerlendirilememiştir.
Bu proje kapsamında Yukarı Fırat havzasında yer alan su kaynaklarının kalitesinin araştırılarak
su ürünleri yetiştiriciliğinde kullanılabilirliğinin incelenmesi, bu su kaynakları üzerinde kurulmuş ve
kurulacak olan tesislerin sucul ekosisteme etkileri, su kaynakları üzerindeki baskının ve kuraklık
etkilerinin belirlenmesi, su kaynaklarının korunması ve yararlı kullanımını sağlayacak entegre ve
sürdürülebilir kaynak yönetiminin geliştirilmesine katkı sağlayacak bilgilerin elde edilmesine
çalışılacaktır.
Devam Eden Proje
Proje No TAGEM/HAYSUD/2011/A11/P-01/3
Proje Başlığı:
Karadeniz Alabalığı (Salmo trutta labrax)'nın Besin İhtiyaçlarının
Belirlenmesi
Projeyi Yürüten Kuruluş:
Su Ürünleri Merkez Araştırma Enstitüsü Müdürlüğü Trabzon
Projeyi Destekleyen Kuruluş:
Atatürk Üniversitesi Su Ürünleri Fakültesi
Proje Yürütücüsü:
Eyüp ÇAKMAK Mühendis
Yardımcı Araştırmacılar:
Başlama-Bitiş Tarihleri:
01.01.2011-31.12.2014
Projenin Toplam Bütçesi
350.000 TL
Dünyada, kültürü en fazla yapılan tatlı su salmonidi gökkuşağı alabalığı (Onchorhyncus
mykiss)’dır. Ayrıca, günümüzde kahverengi alabalık (Salmo trutta) ve kaynak alabalığı (Salvelinus
fontinalis)’nın yetiştiriciliği gerek sportif balıkçılık gerekse balıklandırma amacı ile artış göstermektedir.
Ülkemizde yerli gen kaynaklarımızdan Karadeniz alabalığı (Salmo trutta labrax)’nın yetiştiricilik
performansı Trabzon Su Ürünleri Merkez Araştırma Enstitüsü tarafından çalışılmış ve bu türün pazar
değerinin gökkuşağı alabalığından daha yüksek olduğunu belirlenmiştir. Ancak türün sektöre ekonomik
bir kültür türü olarak kazandırılabilmesi için üretim periyodu süresince nerede? Hangi dönemde? Nasıl
bir yem ile beslenmesi gerektiği belirlenmelidir. Su ürünleri yetiştiriciliğinde balık besleme başarılı bir
yetiştiriciliğin ilk ve en önemli basamağını teşkil etmektedir. Bir türün kültüre kazandırılabilmesi için
metabolik gereksinimlerinin doğru ve dengeli karşılanması gerekmektedir. Son yıllarda balığın büyüme,
üreme, vb. gibi temel metobolizmasına biyoteknolojik uygulamaların çalışmasına ihtiyaç duyulmaktadır.
Bu da büyüme, üreme ve diğer fizyolojik aktivitelerini normal olarak sürdürebilmesini sağlayan uygun
yemlerin hazırlanmasında katkı sağlayacaktır.
Yürütülecek bu projede öncelikle doğal ortamdan alınan örneklerin yumurta, gonad, karaciğer
vb. farklı dokularından biyokimyasal analizler yapılacaktır. Ayrıca Karadeniz alabalığının yumurta
kalitesi belirlenecektir. Elde edilen ilk veriler ışığında optimum protein, amino as