Metody v ekologii mikroorganismů
Petr Baldrian
Laboratoř environmentální mikrobiologie
[email protected]; http:www.biomed.cas.cz/mbu/lbwrf
Prostředí a mikroorganismy
Mikroorganisy vnímaji prostředí v jiných měřítcích než makroorganismy.
Přirozené prostředí je vysoce komplexní a heterogenní.
Prostorová heterogeneita prostředí
0
L
Organic matter
Bacterial biomass
Fungal biomass
Respiration
1
O
Depth (cm)
2
3
4
Laccase
Mn-perox.
Endocell,
CBH
 -Glucos.
NAG-ase
Phosphatase
5
6
7
8
100
10
1
Relative value (%)
0.1
100
10
Ah
1
Relative value (%)
Soil properties along a vertical profile of forest topsoil.
Metodické přístupy ekologie mikroorganismů
Classical microbiology
Genomics
Transcriptomics
Proteomics
Analysis of microbial
processes
Study of nucleic acids and
proteins from the
environment:
Brock Biology of Microorganisms (2012)
metagenomics,
metatranscriptomics,
metaproteomics
Metodické přístupy ekologie mikroorganismů
Metody závislé na kultivaci
>IEH00WJ01BK2Y9 xy=533_195
ATTAGCAGTAAGATCCGTAGGTGAACCTGCGGAAGGATCATTATCGAAACGAATAGGAATGGGGGAGCAAGACG
GCAAAGCAAAAGACTGTCGCTGGCTAGATTCATTTCTGGCATGTGCACGTCCTTGCTTTTTTCGTCGACCTTTCTC
TTTCTTTCTTTCACACCTGTGCACCCGTTGTAGGTCCTCGAAAGAGGATC
>IEH00WJ01DVNL6 xy=1473_2492
TAGTGTAGATAGATCCGTAGGTGAACCTGCGGAAGGATCATTATCGAATCGTAGGCGAGGGTTGTCGCTGGCCT
CTCGGGGCATGTGCACGCCCGAGCCCTTGAATCCCAAACACCACATGTGAACCCACCGTAGGCCTTCGGGCCTA
TGTCTTATCATATAATCTGAATGTCTAATAGAATGTAAACCCATTTCGTTGC
>IEH00WJ01CDN03 xy=858_2645
CGTATGGACAGATCCGTAGGTGAACCTGCGGAGGAGCATATCAGTAAGCGGAGGAGCATATCAATAAGCGGAGG
AGCATATCAATAAGCGGAGGAATCCGTAGTGAACCTGCGGAGGAGCATATCAATAAGCGGAGGAGCATATCAATA
AGCGGAGGAGCATATCAATAAGCGGAGGAGCATATCAATAAGCGGAGGAGT
>IEH00WJ01BNPAZ xy=562_3657
TAGTCGCATAAGATCCGTAGGTGAACCTGCGGAGGGATCATTACAAGAACGCCCGGGCTTCGGCCTGGTTATTC
ATAACCCTTTGTTGTCCGACTCTCTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTT
CAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAA
>IEH00WJ01B2AI9 xy=729_323
ATACGACGTAAGATCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATACGTTTGGTTCTGATGCTGGCTCGTC
ACTGAGCATGTGCTCGATCCATAACTATTTATCTTCTCTTGTGCACCTTTTGTAGTCTTTCAGAGCAAGTGATAACT
CTCGCAGCAATGCGGTTTGGGGGACTTGGGCGTGAGCCCTTCCCCTTC
>IEH00WJ01DAD4P xy=1231_1655
TATCACTCAGAGATCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAGTAGAGGGCCCCTGGGGTCCAACCTA
CCCACCCGGTGTTTAATTGTAACCTTGTTGCTTCGGTGCGCCGCCTCACGGTCCGCCGGGGGCTTCTGCCCCGG
GTCCGCGCGCACCGGTAGACACCATTGAACTTCTTGTTCTGAACGATTGCAC
>IEH00WJ01AEBMK xy=45_4042
CTATGTACAGAGATCCGTAGGTGAACCTGCGGAAGGATCATTACAGTGTTCTCTGCCCTCACGGGTAGAAACGCT
CACCCTTGTATATTATATCTTTGTTGCTTTGGCAGGCCGCCCTCGGGCACCGGCTCCGGCTGGATCGCGCCTGC
CAGAGGAAACCCAAACTCTGAATGTTAGTGTCGTCTGAGTACTATCTAATA
>IEH00WJ01DFSEK xy=1292_3578
TAGTGTAGATAGATCCGTAGGTGAACCTGCGGAGGGATCATTACAGAGTTCATGCCCTTTAGGGTAGATCTCCCA
TCCTTTGTCTATATACCTCTGTTGCTTTGGCAGGCCGAACTATTAGTCTACCGGCTCTGCTGGTAAGCGCCTGCCA
GAGGACCCCCACTCTGAGAGTTAGTGTCGTCTGAGTACTATATAATAGT
>IEH00WJ01CMQ2E xy=962_500
CAGTACTGCGAGATCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAAACCGAGGTGCGAGGGCTGTCGCTGA
CCTTTTTTGGTCGTGCACGCCCGAGCGCTCTCACACAATCCATCTCACCCCTTGTGCACCACCGCGTGGGTTCCC
TTTCTGGCTTGTCCGAAGGGGGCTCGCGTTTTCACACAAACTTGAATTGGT
Analýza nukleových kyselin
•
•
•
Brock Biology of Microorganisms (2012)
Přímá vizualizace
Zahrnuje všechny mikroorganismy včetně těch
nekultivovatelných a neznámých
„druhy“ se tvoří uměle na základě matematické
podobnosti sekvencí
Identita sekvence (příslušný gen a jeho producent) je
určena nepřímo na základě podobnosti (větší nebo
menší) k některé známé sekvenci
Mikrobiální genomy slouží jako databáze informací o fenotypech
Brock Biology of Microorganisms (2012)
Analýza aktivního společenstva mikroorganismů
Prokaryota (bakterie)
16S
tRNA
23S
Eukarota (houby)
5S tRNA
18S
5.8S
ITS1 ITS2
28S
DNA
PCR produkt
(templátem je DNA)
RNA
transkript
PCR produkt
(templátem je RNA)
transkripce
PCR produkt
(templátem je DNA)
štěpení
PCR produkt
(templátem je RNA)
transkripce
štěpení
hotová
rRNA
PCR produkt
(templátem je RNA)
ribozóm
PCR product
(RNA as template)
RNA amplikony:
Identifikace mikroorganismů obsahujících ribosomy
RNA amplikony:
Identifikace mikroorganismů produkujících ribosomy
Analýza RNA umožňuje sledovat expresi genů
Výhody:
Kromě informace o složení společenstva v půdě máme šanci analyzovat i to, které procesy
právě probíhají.
Porovnáním DNA a RNA zjistíme, jaké má společenstvo v půdě složení (DNA) a které
mikroorganismy jsou v dané chvíli aktivní (RNA)
Nevýhody:
RNA je méně stabilní než DNA (štěpení RNAzami)
Obsah RNA v prostředí je řádově nižší než DNA
Většina RNA molekul nemusí mít informační hodnotu
RNA nelze sekvenovat přímo, je nutné ji nejdříve převést na DNA
Metody ekologie mikroorganismů - přehled
Metody ekologie mikroorganismů
Kvantifikace mikrobiální biomasy
– analýza lipidů
Charakteristika společenstvev (fingerprintové metody) – DGGE, T-RFLP
Analýza složení společenstva / metagenomu
– 454 pyrosekvenace
Analýza aktivních členů společenstva
- Stable Isotope Probing
Denaturing Gradient Gel Electrophoresis
(DGGE)
DGGE je elektroforetická separační metoda, která je založená na rozdílech v
teplotách tání dvouřetězcových fragmentů DNA. Elektroforéza obvykle probíhá ve
vertikálních aparátech na polyakrylamidovém gelu ve kterém je ustaven gradient
denaturačního činidla. Elektroforéza trvá poměrně dlouho (až desítky hodin) a tak je
nutné cirkulací elektroforetického pufru zabránit vyprázdnění horní nádrže. Gel také
musí být v homogenní teplotě (obvykle 60°C), čehož se dosahuje ponořením do
média, které je ohříváno a mícháno. Elektroforetické přístroje pro DGGE jsou proto
specifické a odlišují se od běžných elektroforéz.
Denaturing Gradient Gel Electrophoresis (DGGE)
Gely pro DGGE jsou gradientové,
obsahují tedy gradient denaturačního
činidla. Jako denaturační činidla se
používají například formamid a
močovina.
Výsledky separace jsou závislé na
použité koncentraci denaturačních
činidel, podobně jako při klasické
elektroforéze se používají široké
gradienty (pro studium rozdílných
DNA molekul) nebo úzké gradienty,
které jsou teoreticky schopny odlišit i
mutaci v několik málo párech bází.
Nalití gelu je klíčovým krokem pro
úspěch separace, k ustavení
gradientu je třeba použít vhodný
mixér.
Denaturing Gradient Gel Electrophoresis (DGGE)
Při DGGE se dělí PCR produkty
vhodné sekvence DNA - často rDNA
nebo sekvence genu,
charakteristického pro určitou skupinu
mikroorganismů. K PCR produktu se
ligázou připojuje GC-kotva (asi 20
bp), která zajišťuje vhodnou míru
denaturace dsDNA molekul a
usnadňuje migraci.
Elektroforéza probíhá po dobu
několika hodin (15-20).
Po skončení elektroforézy jsou gely
obvykle barveny ethidiumbromidem.
V optimálním případě by jeden pruh na gelu měl odpovídat jednomu druhu
(kmenu) mikroorganismu a intenzita pruhu (do určité míry) odpovídá zastoupení
dané molekuly v prostředí. Někdy je možné pruhy z gelu vyříznout a sekvenovat.
Denaturing Gradient Gel Electrophoresis (DGGE)
Typickým výsledkem DGGE analýzy je kladogram, který umožňuje srovnat
druhovou diverzitu a podobnost mikrobiálních společenstev. Analýza sekvencí
vybraných pruhů na gelu pomůže odpovědět na otázku, které taxonomické
jednotky (druhy, kmeny) mikroorganismů se v daném vzorku vyskytují.
Denaturing Gradient Gel Electrophoresis (DGGE),
Výhody a nevýhody metod
- metoda je vysoce citlivá (to je dáno použitím PCR kroku pro zmnožení
materiálu)
- ve spojení se sekvenací umožňuje taxonomickou identifikaci
- dá se použít pro určitou část populace (specifické primery)
- je semikvantitativní (díky PCR)
- omezený počet srovnávaných vzorků
- není možné analyzovat zároveň taxonomicky vzdálené skupiny (například
houby i bakterie)
- příprava gelů pro DGGE je pracná a obtížná
- náročná je optimalizace metody (volba vhodného primeru, vhodného rozmezí
gradientu)
- výsledky nemusí být úplně jednoznačné (jeden kmen může dát jako odezvu
dva proužky, proužky se mohou na gelu překrývat)
- ne vždy je možné použít proužek z gelu přímo k sekvenaci
Metoda volby: když potřebujeme identifikovat majoritní zástupce společenstva
Terminal Restriction Fragment Length Polymorphism (T-RFLP)
Metoda je založená na rozdílech v umístění restrikčních míst v sledované
sekvenci. Umístění restrikčního místa může být specifické pro daný taxon.
V prvním kroku prbíhá PCR amplifikace, při které je jeden primer označen
fluorescentní sondou.
Soubor PCR produktů je úplně naštěpen vybraným restrikčním enzymem.
Fragmenty po štěpení jsou elektroforeticky separovány. Pouze ty fragmenty,
které obsahují značený primer (tedy terminální) lze detekovat na základě
fluorescence a identifikovat jejich délku.
Terminal Restriction Fragment Length Polymorphism (T-RFLP)
Terminal Restriction Fragment Length Polymorphism (T-RFLP)
Analýza probíhá na kapilární
elektroforéze (podobně jako
klasická sekvenace).
Výsledkem analýzy je
elektroforetogram, v němž výšky
píků (osa y) odpovídají relativní
četnosti restrikčního fragmentu
dané délky (osa x).
Jeden pík reprezentuje všechny
fragmenty stejné délky, nikoli
individuální molekuly.
Příliš krátké (ani příliš dlouhé)
fragmenty nelze kvantifikovat.
Cena: 160 Kč / vzorek.
Terminal Restriction Fragment Length Polymorphism (T-RFLP)
Výhody a nevýhody metod
- metoda je vysoce citlivá (to je dáno použitím PCR kroku pro zmnožení
materiálu)
- dá se použít pro určitou část populace (specifické primery)
- je semikvantitativní (díky PCR), kvantifikace je přesnější než u DGGE
- teoreticky neomezený počet srovnávaných vzorků
- vyšší technická rozlišovací schopnost
- není možné analyzovat zároveň taxonomicky vzdálené skupiny (například
houby i bakterie)
- neumožňuje následnou sekvenaci a taxonomickou identifikaci
- část společenstva nemusí být v profilu zastoupena (chybí restrikční místo,
nebo je příliš blízko značeného primeru)
- jednotlivé píky často zahrnují mnoho (často příbuzných) taxonů
Metoda volby: když potřebujeme srovnat mnoho vzorků
Next-generation-sequencing : porovnání sekvenačních
platforem
Mil. sekvencí
v jednom běhu
Kč/milión
sequences
Délka
% chyb
capillary sequencing
0.000384
80 000 000
1100 b
454 Junior
0.08-0.1
16 000
700 b
1-4%
454 FLX+
1.0-1.2
10 000
750 b
1-4%
Ion Torrent
5-8
124
Illumina MiSeq
14
116
2 x 300 b 0.2-0.5%
Illumina HiSeq 2000
375
16
2 x 150 b 0.2-0.5%
<0.1
250-300 b >4%
Nejběžnější sekvenační platformy
© Tomáš Větrovský
Sekvenace poskytuje detailní obrázek složení mikrobiálního společenstva
Složení bakteriálního
společenstva ve vzorku půdy
Brock Biology of Microorganisms (2012)
Pro každou sekvenci lze teoreticky najít jejího producenta a funkci
Metagenomika ukazuje teoretický potenciál společenstva
Metatranskriptomika napovídá, které procesy právě probíhají
454 pyrosekvenace a sekvenace na Illumina MiSeq
Výhody a nevýhody metod
- umožňuje velkou taxonomickou hloubku (identifikace sekvencí, přítomných ve
velmi malém množství – několik setin procenta)
- rychlá a (relativně) levná sekvenace genomů
- vysoký poměr množství informace / cena
- jediná alternativa pro tvorbu metagenomů (které skupiny genů jsou v daném
prostředí dominantní ?)
- nelze technicky použít pro omezené množství sekvencí (nejmenší množství
cca 25 000 sekvencí)
- poměr informace / cena stoupá s velikostí vzorku
- metoda je více chybující než klasická sekvenace
Metoda volby: analýza metagenomů, transkriptomů a genomů
Analýza mikrobiálních lipidů
Podnětem pro využití analýzy mikrobiálních lipidů bylo zjištění, že složení
lipidické frakce mikroorganismů se odlišuje a je taxonomicky specifické, obvykle
pro vyšší taxony (G+ a G- bakterie, houby). I jednotlivé druhy mají specifické
složení lipidické frakce, které je ovšem do určité míry modifikováno podmínkami
prostředí.
Na podobném principu je založena stará metoda pro kvantifikaci biomasy hub na
základě obsahu lipidu ergosterolu ve vzorku.
Fakt, že složení lipidické frakce je závislé na nutričním stavu buňky (buňka v
příznivých a nepříznivých podmínkách se velmi liší obsahem zásobních lipidů)
vede k úvahám, zda by analýza mohla také určit fysiologický stav buňky.
Analýza lipidů se obvykle provádí jako:
- analýza všech lipidů (TLA)
- analýza membrávých lipidů (PLFA, phospoholipid fatty acids)
- analýza methylesterů mastných kyselin (FAME, důvodem je nutnost
esterifikace při analýze na plynovém chromatografu).
Analýza methylesterů mastných kyselin (FAME)
Mastné kyseliny jsou v mikrobiální buňce obvykle složkou buněčných a dalších
membrán.
Volné mastné kyseliny jsou obvykle označovány kódy, které znázorňují délku
řetězce, počet a umístění dvojných vazeb, větvení, přítomnost cyklopropanového
kruhu atd.
Analýza mikrobiálních lipidů
Základní kroky analýzy polárních lipidů
Postup získání profilů mikrobiálního společenstva na základě analýzy lipidů
1 .Extrakce lipidů z půdního vzorku
2. SPE –frakcionace lipidů
Uvolnění lipidů z
buněk do
chloroformu
i14:0
PLEL
i20:1
PLEL
i20:0
PLEL
EL-PLFA
3A. Uvolnění isoprenoidních
řetězců archaeálních
fosfolipidů (PLEL)
NEL-PLFA
4. Separace &
identifikace
PLFA/ PLEL
(GC-MS)
5. Specifické profily PLEL a PLFA
půdního mikrobního společenstva
HI
KOH
3B. Uvolnění mastných
kyselin z bakteriálních a
mikroeukaryotních PLFA
&
3C. PLFA frakcionace na
základě přítomnosti
esterově a neesterově
vázaných skupin
Fosfolipidy (PL)
Glykolipidy Neutrální lipidy
Original slide courtesy of Dana Elhottová
Analýza methylesterů
mastných kyselin (FAME)
Výsledkem stanovení na GC je
chromatogram, na jehož základě
se stanoví relativní a absolutní
množství jednotlivých MK ve
vzorku.
Vzhledem k tomu, že jednotlivé
mastné kyseliny jsou
charakteristické pro určité taxony,
umožňuje FAME určit podíl
biomasy G+ či G- bakterií nebo
hub.
Vzorky lze na základě profilů MK
srovnávat a stanovovat jejich
podobnost či diverzitu.
U čistých kultur je do určité míry
možno použít výsledků k
identifikaci ve spojení s databází
kmenů (např. systém Sherlock).
Analýza methylesterů mastných
kyselin (FAME)
Mastné kyseliny jsou v mikrobiální buňce obvykle
složkou buněčných a dalších membrán.
Volné mastné kyseliny jsou obvykle označovány
kódy, které znázorňují délku řetězce, počet a
umístění dvojných vazeb, větvení, přítomnost
cyklopropanového kruhu atd.
např.
18:0 je mastná kyselina s osmnáctiuhlíkatým
řetězcem, bez dvojných vazeb
18:2 ω 6,9 je rovněž osmnáctiuhlíkatá MK se
dvěma dvojnými vazbami na šestém a devátém
uhlíku od methylového konce molekuly
br označuje větvení
cy označuje pozici cyklopropanového kruhu
Před analýzou na plynovém chromatografu jsou
MK esterifikovány methylovou skupinou.
Analýza lipidů: Přeměna listového opadu
Analýza hlavních
komponent složení
mikrobiálního
společenstva v
opadovém sáčku na
základě profilů PLFA.
4
3
PC 2 (17.1%)
2
Enzymové aktivity na
rozkládajícím se opadu
ukazují sukcesivní
změny: pokles aktivity
β-glukosidázy, vzestup
aktivity endoglukanázy a
maximum produkce
ligninolytických
enzymům mezi 8.-10.
měsícem.
1
0
-1
Month
-2
-3
-4
-8
2
4
6
8
-6
10
12
18
-4
-2
0
PC 1 (52.4%)
2
4
Mikrobiální společenstvo
na rozkládaném opadu
se rovněž v čase vyvíjí.
Analýza mikrobiálních lipidů
Výhody a nevýhody metody
- metoda je založena na použití biomasy, nikoli nukleových kyselin; extrakce je
proto obvykle jednodušší, produkuje reprezentativnější vzorek a vzorek je
analyzován přímo (x PCR)
- umožňuje studovat zároveň populace bakterií, půdních hub i dalších
mikroorganismů
- poměrně nízká citlivost (metoda nezávislá na kultivaci)
-náročnost na vybavení (kapalinový nebo plynový chromatograf)
- zastoupení mikroorganismů v prostředí nemusí být homogenní (odebrání
reprezentativního vzorku)
- nerozlišuje se živá a mrtvá, aktivní a pasivní biomasa
- nemá vysokou taxonomickou diskriminační schopnost
- složení biomasy může odrážet fyziologický stav mikroorganismu
Stable Isotope Probing (SIP)
Metoda je založená na studiu inkorporace stabilního (neradioaktivního) isotopu
uhlíku 13C do mikrobiální biomasy. Umožňuje spojit studium funkce společenstva s
taxonomickou detekcí aktivních druhů (označených 13C). Do studovaného
systému se přidá 13C-značený substrát (například glukóza). Po inkubaci se
stanovuje obsah 13C v markerových molekulách.
Jako markerové molekuly se používají mastné kyseliny (ve spojení s analýzou
lipidů), 16S rDNA či 16S rRNA (rozdělení „lehkých“ a „těžkých“ molekul
diferenciální centrifugací).
Metoda SIP byla vyvinuta ve spojení s analýzou mastných kyselin. Využití DNA
umožnilo taxonomickou identifikaci mikroorganizmů. Nejnověji (v roce 2002) byla
popsána metoda RNA-SIP, která přinesla vysoké zvýšení citlivosti – protože
aktivně rostoucí bakteriální buňky mají až 18,000 kopií 16S rRNA namísto pouze
12 kopií 16S rDNA. Proto RNA-SIP umožňuje detekci využití substrátu v kratším
časovém úseku než se buňky stačí rozdělit, tedy dříve, než může přidání
substrátu ovlivnit složení společenstva.
Nutné vybavení: značený substrát, centrifuga o požadovaných parametrech.
Stable Isotope Probing (SIP)
Po přidání substrátu, značeného
stabilním isotopem 13C, se
značený isotop akumuluje v
biomase aktivně metabolizujících
mikroorganismů. Složení
„aktivního“ společenstva lze pak
vyhodnotit při analýze lipidů
anebo – po separaci „těžkých“
(značených) a „lehkých“ molekul
DNA pomocí molekulárních
metod.
Separace nukleových kyselin mezi
12C a 13C není obvykle v praxi úplně
bezproblémová, protože část
mikroorganizmů je značena pouze
částečně. Proto mezi frakcemi s 12C a
13C obvykle bývá postupný přechod.
Metody: Stable Isotope Probing (SIP)
13C-značená
celulóza
DNA
extrakce
Rozdělení DNA
ultracentrifugací na
základě vznášivé
hustoty
• DGGE
neoznačená
12C-DNA
13C
DNA
• T-RFLP
• Klonování a sekvenace
Mikrobiální
společenstvo
Vzorek CO2
vysráženi DNA ve
frakcích
vzorky obsahující 13C, nebo
12C DNA
identifikace frakcí v kterých je
přítomna DNA pomocí qPCR
1.2
1
0.8
0.6
13C
DNA
0.4
Podíl 13C-CO2
Celková respirace
0.2
0
1
Original slide courtesy of Mary Beth Leigh
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16 17 18 19 20 21
Aktivní část mikrobiálního společenstva:
Označení druhů, využívajících celulózu isotopem 13C
Podíl DNA mikroorganismů (qPCR),
využívajících celulózu (zeleně)
Bakterie
L horizont
Analýza společenstva hub pomocí T-RFLP
Zelené sloupce: houby využívající celulózu
Červené sloupce: ostatní druhy
Houby
L horizont
12C-DNA
400
300
200
100
0
O horizont
13C-DNA
O horizont
Houby
600
200
100
0
111
114
117
145
147
170
187
213
231
264
321
353
361
394
395
396
398
399
401
404
407
409
413
415
420
422
430
431
438
440
443
448
449
453
461
477
484
490
498
Bakterie
Stable Isotope Probing (SIP)
Výhody a nevýhody metody
- rozlišuje aktivní a neaktivní mikroorganismy (biomasu)
- umožňuje selektivně sledovat využití určitého (značeného) substrátu
- ve spojení s RT-PCR je extrémně citlivá a umožňuje detekci složení
nerostoucího společenstva
- vyžaduje spojení s dalšími technikami (PCR nebo RT-PCR a DGGE, RFLP nebo
FAME)
- nutné speciální vybavení (ultracentrufuga a nejlépe také RT-PCR)
- substráty značené stabilními isotopy jsou drahé (13C glukóza – 2.000 Kč/g,
13C celulóza – 36.000 Kč/g, 13C lignin – 500.000 Kč/g) a je jich k dispozici
omezený počet
Literatura k dalšímu studiu – metody v ekologii
mikroorganizmů
Alef K a Nannipieri P 1995. Methods in Applied Soil Microbiology and
Biochemistry. Academic Press – půdní mikrobiologie a biochemie.
Kowalchuk GA a kol. 2004. Molecular Microbial Ecology Manual. Kluwer
Academic Publishers – podrobné protokoly molekulárních (DNA)
metod.
Burns RG a Dick RP 2002. Enzymes in the Environment – Activity, Ecology
and Applications. Dekker – půdní enzymy.
Madsen EL 2008. Environmental Microbiology – From Genes to
Biogeochemistry. Wiley-VCH – environmentální mikrobiologie.
Paul EA a kol. 2007. Soil Microbiology, Ecology, and Biochemistry. Academic
Press, 3rd edition – metody v půdní ekologii, mikrobiologie půdy.
De Bruijn et al. 2011. Handbook of Molecular Microbial Ecology. Wiley –
molecular methods and metagenomics
DIPLOMOVÉ PRÁCE - EKOLOGIE MIKROORGANISMŮ
LABORATOŘ ENVIRONMENTÁLNÍ MIKROBIOLOGIE
Mikrobiologický ústav AV ČR
Saprotrofní houby v půdě • Exprese a aktivita enzymů v prostředí • Přeměna
organických látek v půdě • Interakce miroorganizmů • Procesy cyklu C a N
• Ekosystémy narušené lidskou činností
Více informací:
Petr Baldrian ([email protected], 723770570)
sránky skupiny a nabídka témat online: http://www.biomed.cas.cz/mbu/lbwrf
Download

Metody: Stable Isotope Probing (SIP)