Výzkumný ústav pícninářský, spol. s r.o. Troubsko
Zemědělský výzkum, spol. s r.o. Troubsko
a
Odbor rostlinolékařství ČAZV,
Pícninářská komise ORV ČAZV
a Agrární komora ČR
AKTUÁLNÍ POZNATKY V PĚSTOVÁNÍ,
ŠLECHTĚNÍ, OCHRANĚ ROSTLIN
A ZPRACOVÁNÍ PRODUKTŮ
Úroda 12/2012, vědecká příloha časopisu
Výzkumný ústav pícninářský, spol. s r.o. Troubsko
Zemědělský výzkum, spol. s r.o. Troubsko
a
Odbor rostlinolékařství ČAZV,
Pícninářská komise Odboru rostlinné výroby ČAZV,
a Agrární komora ČR
Aktuální poznatky v pěstování, šlechtění,
ochraně rostlin a zpracování produktů
Úroda 12/2012, vědecká příloha časopisu
Editor:
Ing. Barbora Badalíková
Ing. Jaroslava Bartlová
Organizační výbor:
Ing. Barbora Badalíková - předseda
Ing. Jaroslava Bartlová
Ing. Pavel Kolařík
Ing. Jaroslav Lang
Ing. Karel Vejražka, Ph.D
Mgr. Tomáš Vymyslický
Vědecký výbor:
RNDr. Jan Nedělník, Ph.D. - předseda
Ing. Barbora Badalíková
doc. Ing. Bohumír Cagaš, CSc.
Ing. Jaroslav Čepl, CSc.
RNDr. Jan Hofbauer, CSc.
Ing. Miroslav Hochman
Ing. Pavel Kolařík
Ing. Slavoj Palík, CSc.
Ing. Jan Pelikán, CSc
Ing. Karel Vejražka, Ph.D.
Příspěvky byly recenzovány členy vědeckého výboru
Doporučná citace příspěvků:
Autoři příspěvků: Název příspěvku. Úroda 12, 2012, vědecká příloha, s. 9 – 463
ISSN 0139-6013
„Úroda 12/2012, vědecká příloha časopisu“
OBSAH
Nedělník J: Úvodní slovo ........................................................................................................... 9
Referáty
Sekce "Šlechtění"
Vejražka K., Pelikán J., Hofbauer J.: Je žádoucí šlechtění minoritních plodin? ...................... 11
Urban, M. O., Klíma, M., Vítámvás, P., Kučera, V.: Aktuální mrazuvzdornost řepky olejky
(LT50) v závislosti na akumulaci dehydrinů ............................................................................. 15
Macháčková I., Ptáček V., Bučánková A.: Zkušenosti s využitím čmeláka zemního (Bombus
terrestris L., Apidae) ve šlechtění ozimé řepky (Brassica napus L.) ...................................... 21
Řepková J., Simandlová J., Jakešová H., Nedělník J., Soldánová M.,
Hajšlová J., Schulzová V.: Vztah rodičovských genomů u mezidruhových hybridů Trifolium
pratense x Trifolium medium ................................................................................................... 27
Pavelek, M., Tejklová, E., Bjelková, M.: Nové směry ve šlechtění olejného lnu.................... 31
Kopecký P., Cenklová V., Dušek K.: Studium odolnosti vybraných genotypů tuřínu vůči
nádorovitosti brukvovitých ...................................................................................................... 37
Sekce "Rostlinolékařství"
Kolařík P., Rotrekl J.: Rezistence škodlivých organismů vůči pesticidům.............................. 43
Bagar M., Psota V.: Alginure – prostředek pro zvýšení odolnosti rostlin k houbovým
chorobám a jeho využití proti původci strupovitosti jabloně (Venturia inaequalis) ................ 49
Hrudová E., Seidenglanz M., Kolařík P., Tóth P., Rotrekl J., Poslušná J.: Převládající druhy
stonkových krytonosců na lokalitách Troubsko, Lednice a Šumperk ...................................... 55
Kamenová A., Bárta J., Bártová V.: Hodnocení vlivu odrůdových rozdílů termostabilních
proteinů hlíz bramboru (Solanum tuberosum l.) na inhibici růstu vybraných druhů
fytopatogenních hub ................................................................................................................. 61
Sekce "Technologie pěstování plodin a ekologie"
Šarapatka B., Čáp L., Netopil P.: Vliv různých systémů zpracování půdy na půdní vlastnosti a
životní prostředí........................................................................................................................ 67
Čížek M., Svobodová A., Čepl J.: Vliv hnojení a sponu výsadby na výnos nadzemní biomasy
a hlíz topinamburu .................................................................................................................... 73
Haberle J., Svoboda P.: Distribuce kořenů plodin v půdním profilu a využitelná zásoba dusíku
a vody ....................................................................................................................................... 79
Badalíková B.: Zlepšení půdních vlastností pomocí aplikace podpůrného přípravku ............. 85
Středová H., Středa T., Podhrázská J.: Větrná eroze na jižní Moravě – potenciál, monitoring,
účinnost biotechnických opatření ............................................................................................. 91
Strašil Z.: Pěstování ozdobnice (Miscanthus x Giganteus) určené pro energetické využití .... 97
Zemánek P., Burg P.: Možnosti využití technologií pro získání energetické štěpky z vinic . 103
Holubec V., Paprštein F., Řezníček V., Dušek K.: Krajové odrůdy rostlin jako kulturní
dědictví národa ....................................................................................................................... 109
3
„Úroda 12/2012, vědecká příloha časopisu“
Sekce "Kvalita a zpracování produktů"
Středa T., Hajzler M., Chloupek O.: Kořenový systém - skrytá polovina rostliny ................ 115
Burg P., Zemánek P.: Hodnocení účinnosti separačního zařízení pro separaci jader z Hroznů
................................................................................................................................................ 121
Erban V., Eichlerová E., Landfeld A., Čírtková V., Houška M.: Předpověď mikrobiologické
kvality potravin pomocí modelování růstu patogenů - listerie .............................................. 127
Šottníková V., Kučerová J.: Vliv skladování na kvalitu brambor různých ............................ 131
Postery
Sekce "Šlechtění"
Bláha L., Vyvadilová M., Urban M. O.: Vybrané znaky semen řepky ozimé ovlivňující růst,
vývoj a výnos v podmínkách sucha ........................................................................................ 135
Brabcová A., Bárta J., Bártová V., Horáčková V.: Genotypová variabilita
lipidacylhydrolasové aktivity u patatinových bílkovin purifikovaných z hlíz vybraných druhů
brambor .................................................................................................................................. 139
Bradová J., Papoušková L., Faměra O., Dvořáček V., Dotlačil L.: Vztah mezi podjednotkami
gluteninů a reologickou kvalitou genetických zdrojů pšenice ............................................... 143
Ehrenbergerová J., Jirsa O., Martinek P., Balounová M., Stehno Z., Pluháčková H.,
Laknerová I., Macháň, P.: Netradiční obilniny a možnosti jejich využití .............................. 147
Havlíčková L., Jozová, E., Hejna O., Čurn V.: Využití molekularních markerů ve šlechtení F1
hybridních odrůd řepky (B. napus L.) .................................................................................... 151
Heřmanská A.1, Bláha L.: Velikost kořenového systému – možné selekční kritérium pro
suchovzdornost pšenice .......................................................................................................... 155
Jozová E., Havlíčková L., Čurn V., Kučera V., Klíma M., Vyvadilová M.: Využití
molekulárních markerů pro hodnocení diverzity genetických zdrojů řepky (Brassica napus L.)
................................................................................................................................................ 159
Knotová D., Hutyrová H.: Stanovení podobností v české kolekci štírovníku růžkatého (Lotus
corniculatus L.) ...................................................................................................................... 163
Leišová-Svobodová L., Štočková L., Bradová J.: Variabilita HMW gluteninů pšenice ....... 167
Vaculová K., Kýhos K., Balounová M., Sedláčková I.: Vliv podmínek skladování na klíčivost
a obsah živin v zrninách ......................................................................................................... 171
Sekce "Rostlinolékařství"
Dostálová R., Ondřej M. a Ondráčková E.: Šlechtění hrachu na rezistenci ke komplexu viróz a
antraknóz ................................................................................................................................ 175
Cholastová T., Hujslová M.: Využití PCR metody při identifikaci houbových patogenů rodu
Fusarium vyskytujících se na trvalých travních porostech .................................................... 179
Jílková B., Víchová J., Pokorný R., Vejražka K.: Klíčivost konidií Colletotrichum acutatum
po aplikaci účinných látek vybraných fungicidů .................................................................... 183
Jonášová K., Horák O.: Druhové spektrum plevelů v máku setém........................................ 187
Kmoch M., Šafránková I., Pokorný R.: Vliv odrůdy, ošetření, lokality a ročníku na napadení
obilek jarního ječmene patogeny rodu Fusarium ................................................................... 191
Krejzar V., Pánková I., Kůdela V.: Relativní četnost původců černání stonku bramboru
v České republice v roce 2012 ............................................................................................... 195
4
„Úroda 12/2012, vědecká příloha časopisu“
Neischl A., Winkler J., Klepáčková V., Zelená V.: Vliv předplodiny a zpracování půdy na
diverzitu a druhové spektrum plevelů .................................................................................... 199
Pánková I., Krejzar V., Mertelík J., Kloudová K.: Potvrzený výskyt původce bleeding canker
................................................................................................................................................ 203
Plachká E., Macháčková I.: Vliv lokality na kontaminaci semen řepky olejky ozimé patogeny
Alternaria brassicae, Alternaria brassicicola a Leptosphaeria maculans, Leptosphaeria
biglobosa ................................................................................................................................ 207
Poslušná J., Plachká E.: Odolnost vybraných genotypů ozimé řepky vůči houbovým
patogenům testovaných v mezistaničních zkouškách výkonu v letech 2010–2012............... 211
Psota V., Bagar M.: Využití metody matení samců proti nesytce jabloňové (Synanthedon
myopaeformis) ........................................................................................................................ 215
Sapáková E., Hasíková L., Hřivna L., Stavělíková H., Šefrová H.: Intenzita napadení různých
odrůd česneku vlnovníkem Aceria tulipae (Keifer) (Acari: Eriophyidae) ............................. 219
Sumíková T., Žabka M.: Identifikace původců fuzarióz klasu pomocí multiplex PCR ........ 223
Svoboda J.: Hodnocení odolnosti vybraných novošlechtění okurek nakládaček k viru žluté
mozaiky cukety (ZYMV) ....................................................................................................... 227
Svoboda J., Leišová-Svobodová L.: Výskyt fytopatogenních virů na tykvovité zelenině
pěstované v České republice .................................................................................................. 231
Šmahel P., Kolaříková E.: Regulace plevelů u cizrny beraní a hrachoru setého ................... 235
Vrbovský V., Rychlá A., Endlová L.: Obsah glukosinolátů v zelených částech řepky a jejich
vliv na vybrané škůdce ........................................................................................................... 243
Winkler J., Blažková H.: Druhové spektrum plevelů ozimých plodin v provozních
podmínkách ............................................................................................................................ 247
Žabka M., Pavela R., Sumíková T.: Skrining antifungálních vlastností vybraných rostlinných
extraktů ................................................................................................................................... 251
Sekce "Technologie pěstování plodin a ekologie"
Badalíková B., Bartlová J.: Zamezení vodní eroze půdy při využití meziplodin .................. 255
Bartlová J.: Vliv úhorového hospodaření na vodostálost půdních agregátů .......................... 259
Brtnický M., Kučerová J., Kynický J., Janzová A., Pokorný E.: Monitoring půdní respirace
v CHKO Žďárské vrchy v letech 2008 - 2010 ....................................................................... 263
Červinka J., Pospíšil J., Svoboda M.: Techniky zpracování půdy a její vliv na zhutnění ..... 267
Dědouchová M., Kubátová B., Cvrčková H., Máchová P., Vortelová L.: Hodnocení genetické
variability autochotonních populací jilmu.............................................................................. 271
Frydrych J., Andert D., Gerndtová I., Volková P., Juchelková D., Raclavská H., Zajonc O.:
Využití trav pro energetické účely ......................................................................................... 275
Hakl, J., Šantrůček, J.: Dynamika růstu vojtěšky v první seči v závislosti na stáří porostu . 279
Huňady I., Hochman M., Pozdíšek J., Ponížil A.: Možnosti využití luskovino-obilních směsek
ke zvýšení soběstačnosti v produkci krmiv v ekologickém zemědělství ............................... 283
Jandák J., Mašíček T., Raus J.: Vliv pěstování kostřavy červené a jetelotravní směsi na
nasycenou hydraulickou vodivost .......................................................................................... 287
Knot P.: Vliv obalení osiva hnojivem na klíčivost a charakteristiky primárního kořene ...... 291
Knotová D.: Produkce osiva svazenky vratičolisté v podmínkách ekologického zemědělství
................................................................................................................................................ 295
Konvalina P., Moudrý J. jr., Capouchová I., Stehno Z., Suchý K., Moudrý J.: Suchovzdornost
genetických zdrojů pšenice .................................................................................................... 299
Koprna R., Dundálková L., Spíchal L., Strnad M., Svobodová I., Spáčilová V., Valenta R.:
Aktuální výsledky aplikace cytokininových derivátů v jarním ječmeni ................................ 303
5
„Úroda 12/2012, vědecká příloha časopisu“
Kučerová J., Pokorný E., Brtnický M.: Sledování některých biologických vlastností u
vybraných hlavních půdních jednotek černozemí .................................................................. 307
Kurešová G., Raimanová I.: Růst obilek a ukládání dusíkatých látek v průběhu dozrávání zrna
pšenice .................................................................................................................................... 311
Lang, J.: Dynamika zastoupení travních komponentů u jetelovinotravních směsí na orné půdě
................................................................................................................................................ 315
Lošák M., Ševčíková M.: Vliv ošetřování na vývoj botanického složení extenzivních trávníků
................................................................................................................................................ 319
Madaras M., Mayerová M.: Rozdíly odrůd pšenice ozimé ve schopnosti čerpat draslík z
půdních silikátových minerálů v raných stadiích růstu .......................................................... 323
Macháč R., Smočková M., Both Z.: Možnosti pěstování jílku mnohokvětého jednoletého na
semeno v režimu ekologického zemědělství .......................................................................... 327
Marada P., Valtýniová S., Verner F.: Hodnocení setrvalosti hospodaření na orné půdě ....... 331
Martinek J., Svobodová M., Králíčková T., Šantrůček J.: Vývin metlice trsnaté v trávníku 335
Mašíček T., Toman F., Jandák J., Šácha J.: Vliv trvalého travního porostu a orné půdy na
rychlost vsaku vody do půdy .................................................................................................. 339
Matějková Š., Vocetková M.: Bilance fosforu v půdě dlouhodobého stacionárního pokusu v
Hněvčevsi ............................................................................................................................... 343
Mühlbachová G., Káš M.: Vliv minerálního a organického hnojení na obsah živin v půdě a
výnos pšenice ozimé............................................................................................................... 347
Mühlbachová G.: Mikrobiální aktivity po aplikaci chelátů do dlouhodobě kontaminované
půdy ........................................................................................................................................ 351
Pelikán J., Hutyrová H.: Možnosti pěstování žita svatojánského k výrobě osiva v
ekologickém zemědělství ....................................................................................................... 355
Pospíšilová L., Formánek P., Drápelová I., Živna T.: Vliv aplikace kompostu na biologické
parametry půdy ....................................................................................................................... 359
Raab S.: Zhodnocení vybraných morfologických charakteristik některých druhů rodu Salvia
L.. ............................................................................................................................................ 363
Raab S., Machač R.: Výroba osiva hořčice jarní v ekologickém zemědělství ....................... 367
Raimanová, I., Kurešová, G.: Zhodnocení výživného stavu révy vinné ve vztahu k obsahu
dostupných živin v půdě ......................................................................................................... 371
Sochorec M., Hejduk S.: Vliv rozdílného obhospodařovávání travních porostů na infiltrační
schopnost ................................................................................................................................ 375
Svoboda P.: Změny obsahu a forem minerálního dusíku v půdním profilu pod rozvezenými
polními hnojišti ...................................................................................................................... 379
Vach M., Hýsek J.: Nové poznatky o vlivu efektivních technologií zpracování půdy a
biofungicidů na ozimou pšenici ............................................................................................. 383
Vach M., Javůrek M.: Vliv zpracování půdy na omezení následků vodní eroze na půdě typu
Cambisol................................................................................................................................. 387
Vlček V., Hybler V.: Změny půdních vlastností a poměrů některých biogenních prvků na
erodované půdě na spraši – případová studie ......................................................................... 391
Volková P., Šrámek P.: Vliv frekvence sečení a úrovně hnojení na výnosy a botanické složení
trvalého travního porostu ....................................................................................................... 395
6
„Úroda 12/2012, vědecká příloha časopisu“
Sekce "Kvalita a zpracování produktů"
Cwiková O.: Mikrobiologická jakost luštěninových salátů ................................................... 399
Gabrovská D., Ouhrabková J., Rysová J., Holasová M., Fiedlerová V., Laknerová I.,
Winterová R., Pinkrová J., Eichlerová E., Erban V., Strohalm J., Němečková I.: Směsné
zeleninové šťávy se zvýšeným obsahem bioaktivních látek .................................................. 403
Hartman I., Benešová K., Psota V., Sachambula L.: Vliv teploty a délky sladování na obsah
vitaminu E ve sladu ................................................................................................................ 409
Hrušková M., Švec I.: Hodnocení retenční kapacity kompozitních směsí pšeničné a konopné
mouky ..................................................................................................................................... 413
Hřivna L., Burešová I., Sapáková E.: Vztah mezi výnosem, kvalitou zrna ječmene a čerpáním
N a S během vegetace ............................................................................................................ 417
Kučerová J., Šotníková V., Machková M.: Vliv vybraných surovin a přísad na kvalitu těstovin
................................................................................................................................................ 421
Laknerová I., Mašková E., Fiedlerová V., Holasová M., Gabrovská D., Winterová R.,
Ouhrabková J., Vaculová K., Martinek P.: Pekařské výrobky s přídavkem netradičních
obilovin, obohacené kyselinou listovou ................................................................................. 427
Nedomová Š., Simeonovová J., Cwiková O., Buchar J.: Hodnocení vybraných jakostních
znaků těstovin ......................................................................................................................... 431
Psota V., Sachambula L., Tvarůžek J.: Vybraná kritéria kvality ječmene pro výrobu sladu . 435
Rysová J., Ouhrabková J.: Využití sojového pudru do pekařských výrobků ......................... 439
Skala O., Střalková R., Pivec V.: Zastoupení oleje v semenech révy vinné .......................... 443
7
„Úroda 12/2012, vědecká příloha časopisu“
8
„Úroda 12/2012, vědecká příloha časopisu“
ÚVODNÍ SLOVO
Předkládaná vědecká příloha časopisu Úroda, jako nedílná součást čísla 12/2012, je dle
názoru editora jednou z efektivních možností, jak ukázat úspěšný transfer poznatků a nových
technologií do praxe. Více než 110 příspěvků zahrnuje výsledky mnohých výzkumných
projektů na široké disciplinární bázi. Využití genetických zdrojů rostlin pro šlechtění, aktuální
změny v koncepci rostlinolékařské péče a její reflexe do českého prostředí, možnosti
optimalizace pěstebních technologií polních plodin či aktuální pohled na kvalitu rostlinných
produktů jsou některá z témat uvedených ve vědecké příloze.
Editor spolu s autory doufá, že mnohé příspěvky si najdou svoje čtenáře a mnohé výsledky
najdou další uplatnění v praxi.. Podpořit transfer technologií a spolupráci mezi výzkumnými
ústavy a aplikačními partnery je jedním z hlavních cílů této přílohy.
Vzhledem k počtu příspěvků byla zvolena po dohodě s vydavatelstvím Profi Press, s.r.o. a
redakcí časopisu Úroda distribuce v elektronické formě. Všechny příspěvky byly
recenzovány. Distribuce několika tisíc CD umožňuje širokému okruhu čtenářů udělat si
obrázek o zaměření zemědělského aplikovaného výzkumu.
Inovace a jejich aplikaci, nové výzkumné poznatky a efektivní transfer do zemědělské praxe
jsou témata i nového programovacího období navazujícího na Program rozvoje venkova. Bez
nových poznatků nebude možné udržovat konkurenceschopnost českého zemědělství a také
by bylo obtížné udržovat a rozvíjet krajinné celky. Proto by zemědělský výzkum a šlechtění
mělo do budoucna sehrávat ještě významnější roli než dosud.
Motorem všech inovací musí ale být nutně zpětná vazba, všichni účastníci tvorby a zadávání
výzkumných zakázek by se měli podílet i na formulování základních výzkumných směrů.
Pokud do výzkumu jsou investovány veřejné zdroje musí být i zpětná kontrola jejich alokace.
Věřím, že tato vědecká příloha k takovéto zpětné vazbě přispěje.
Mnohé výsledky již také reflektují závěry Strategické výzkumné agendy, kterou zpracovala
Česká technologická platforma rostlinných biotechnologií (www.rostlinyprobudoucnost.com),
a které ukazují možné směry rozvoje geneticko-šlechtitelského výzkumu.
Na tomto místě si dovoluji informovat čtenáře o projektu „Podpora transferu inovací
v zemědělství, potravinářství a oblasti bioenergií do praxe“, který byl podpořen z OP
„Vzdělávání pro konkurenceschopnost“ a jehož hlavním cílem je vedle rozvoje lidského
potenciálu také transferovat nové poznatky do praxe. V rámci projektu jsou pořádané
semináře a odborné konference, na které tímto odbornou veřejnost zveme
(www.inovacezvt.cz).
Jan Nedělník
9
„Úroda 12/2012, vědecká příloha časopisu“
10
„Úroda 12/2012, vědecká příloha časopisu“
JE ŽÁDOUCÍ ŠLECHTĚNÍ MINORITNÍCH PLODIN?
Is it desirable minor crop breeding?
Vejražka K., Pelikán J., Hofbauer J.
Zemědělský výzkum, spol. s r.o. Ttroubsko
Šlechtění nových odrůd je ekonomicky i časově velmi náročnou záležitostí. Návratnost
vložených investic je přímo závislá na uplatnění na pěstebních plochách a době životnosti
dané odrůdy. Rozsah pěstování určité odrůdy je výrazně limitován celkovou výměrou dané
plodiny. Na základě tohoto faktu je vhodné si určitým způsobem plodiny modelově rozdělit.
V podmínkách ČR si dovolíme rozdělit plodiny na dvě skupiny. Mezi velkoobjemové
zařadíme pšenici ozimou, ječmen, kukuřici a řepku ozimou. Ostatní plodiny, i když plochy
pěstování kolísají od jednotek do tisíců (50) hektarů, zařadíme do maloobjemových. Pro
cukrovku, brambory, hrách i další plodiny je toto označení z historického hlediska téměř
nepatřičné, ale poměrně dobře vystihuje současnou realitu v České republice.
Situace s velkoobjemovými plodinami
U tzv. velkoobjemových plodin (pšenice, ječmen, kukuřice, řepka) se výměry jen v ČR
pohybují v stovkách tisíc hektarů (Tab. 1). Významné je i uplatnění těchto odrůd na
zahraničních trzích s podobnými podmínkami pro pěstování. V případě uchycení odrůdy na
zahraničním trhu je šance na návratnost vložených investic poměrně reálná. Tato skutečnost je
patrná z počtu/výměr zahraničních odrůd, které jsou v ČR pěstovány. Pěstování takových
odrůd sebou nese výhody a nevýhody, avšak v delším časovém období převažují spíše
výhody. Dokladem toho je např. nižší mrazuvzdornost zahraničních odrůd pšenice, která cca
1x za 7 let způsobí problémy části zemědělců, avšak zemědělci u těchto odrůd, s výkyvem
v následujícím roce, zpravidla zůstávají. Druhým faktorem je délka životnosti odrůdy na trhu.
V oblasti velkoobjemových plodin je na trhu velké množství odrůd, které si vzájemně silně
konkurují. V roce 2011 bylo v ČR přihlášeno na množení osiv více než 50 odrůd pšenice a
více než 20 odrůd ozimého ječmene (Horáková a kol. 2012). Je však třeba zdůraznit, že
poměry ploch jednotlivých odrůd můžou být výrazně rozdílné. Množství odrůd lze
demonstrovat i na počtu 332, v ČR registrovaných, hybridů kukuřice v roce 2011 (Povolný,
Vacek 2011). S ohledem na volný trh Evropské unie do hry navíc mohou vstupovat veškeré
odrůdy z Evropského katalogu odrůd. Při takové konkurenci pak není problém najít odrůdy,
které z trhu vypadávají po 3-4 letech pěstování. Dochází tak k poměrně výrazné obměně
pěstovaných odrůd. U kvalitních odrůd výrazně roste podíl farmářských osiv.
Situace s maloobjemovými plodinami
U maloobjemových plodin se výměry v ČR pohybují v rozmezí jednotek hektarů až po
desítky tisíc hektarů u brambor (cca 23), jetele lučního (45), máku (51) a cukrovky (56).
V počtu odrůd lze mezi jednotlivými plodinami nalézt výrazné rozdíly na trhu. U cukrovky a
bramboru je registrováno či v registracích přes 150 odrůd, jetel luční (58), u máku pak jen 21,
u hořčice bílé 9 a u svazenky 8 odrůd. U dalších plodin je v ČR registrována třeba jen jedna
odrůda, např. jetel alexandrijský, vičenec, lesknice, saflor, úročník, čičorka, tomka, komonice
(ÚKZÚZ 2012). U cukrovky a bramboru je na takové množství odrůd moc malá pěstební
plocha a lze pochybovat o návratnosti v případě, že se odrůdy neuplatní na zahraničních
trzích. U cukrovky tato skutečnost přispěla k zániku českého šlechtění a probíhá jen jako
součást nadnárodního programu. Většina maloobjemových druhů/odrůd je charakteristická
tím, že má, v poměru, k ostatním malé plochy pěstování a malou nebo nulovou konkurenci
v podobě jiných odrůd stejného druhu. Podíl farmářských osiv je obecně poměrně nízký.
11
„Úroda 12/2012, vědecká příloha časopisu“
Výhody a nevýhody
Mezi výhody velkoobjemových plodin je jejich snadné uplatnění produkce na trhu (tradiční
využití) a velmi dobře propracované technologie pěstování, které nevyžadují nadstavbové
vybavení. Mezi nevýhody velkoobjemových plodin patří jednostranné zatížení/zaměření (jen
obilniny a brukvovité) a nízká pestrost ekosystému, o který by měl zemědělec také pečovat.
Mezi výhody maloobjemových plodin patří bezproblémový odbyt za nadstandardní ceny
z jednotky plochy, pokud je dopředu kontraktován a je dodržena kvalita produkce. Jsou ve
většině případů přerušovače obilných (širokolisté, hluboko kořenící, dvouděložné) a
brukvovitých sledů plodin. Působí příznivě na strukturní vlastnosti půdy. Skupina druhů
z čeledi vikvovité zvyšuje rentabilitu díky fixaci vzdušného dusíku. Mezi hlavní nevýhody
patří méně propracované technologie (minimum registrovaných přípravků na OR),
problematické časování termínu sklizně, a v některých případech potřeba dnes již
specifických strojů. V podnicích bez živočišné výroby mohou způsobovat problémy první
seče, které se u vybraných pícnin provádějí. Poslední nevýhodou je čas – naučit se pěstování
maloobjemových plodin, včetně osivářských porostů, není na jeden rok a vyžaduje trpělivost.
Osevní postupy v České republice prochází poměrně viditelnou změnou, což dokladuje
tabulka č. 1. Tato změna je charakteristická zjednodušováním, koncentrací plodin v osevním
postupu a silnou orientací na okamžitý zisk. Není výjimkou najít osevní postupy typu ozimá
řepka, ozimá pšenice, kukuřice, někdy i jarní ječmen s absencí organického hnojení a
případným odvozem slámy do spaloven. Lze si představit, co se děje s úrodností těchto
pozemků a je chybou vlastníků, že něco podobného dopustí. Přesto i za takového stavu mají
maloobjemové plodiny své malé místo na polích a je po nich poptávka. Tato poptávka je
z velké části tvořena i nastavením jednotlivých dotačních titulů, u nichž se připravuje výrazná
změna právě ve prospěch maloobjemových plodin jako komponent do směsí. Již v současné
době je takových komponent na trhu nedostatek a jejich cena stoupá.
Ukázka odbytu osiv maloobjemových plodin z Troubska
Pro demonstraci prodejů osiv maloobjemových plodin jsme vybrali období let 2004-2011 a
druhy a odrůdy, které jsou ve vlastnictví Výzkumného ústav pícninářského s.r.o. a
Zemědělského výzkumu s.r.o. Troubsko. V tabulce č. 2 je pro jednotlivé odrůdy uvedeno
množství produkce a množství exportu osiv z Troubska v kategorii C, resp. v kvalitě
odpovídající této kategorii. V tabulce nejsou zahrnuta množství osiv vyšších stupňů množení
(SE, E) ani osiva vyprodukována v rámci licenčního množení jinými subjekty. Při znalosti
realizačních cen osiv vyjmenovaných druhů a průměrném kurzu 25 Kč/Euro lze spočítat, že
průměrný roční export tvořil obrat přes 1 milion Kč.
Závěr
Při zohlednění nákladů na šlechtění maloobjemových plodin, délku životnosti odrůdy a nízké
úrovni farmářských osiv je pravděpodobnost návratnosti vložených investic poměrně vysoká.
Tyto plodiny tak představují pro ty pěstitele/množitele, kteří chtějí ještě dělat poctivé
zemědělství, finančně zajímavou činnost, jistotu odbytu a jistou míru stavovské elity. Dělat
dobře osiva, a navíc maloobjemových plodin, totiž umí jen opravdová špička v oboru.
12
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 1 Vývoj osevních ploch zemědělských plodin upraveno dle Českého statistického
úřadu (v ha)
Plodina
2005
2006
2007
2008
2009
2010
Crop
Obiloviny celkem
1 593 487
1 527 104
1 561 191
1 552 717
1 528 020
1 459 505
Cereals, total
pšenice
820 440
781 519
810 987
802 325
831 300
833 577
Wheat
žito
46 903
22 481
37 503
43 399
38 453
30 249
Rye
ječmen
521 527
528 145
498 692
482 395
454 820
388 925
Barley
oves
51 667
57 697
59 016
49 049
50 021
52 278
Oats
triticale
64 811
41 023
50 051
57 758
52 950
45 871
Triticale
kukuřice na zrno
79 981
84 900
93 065
107 899
91 610
99 945
Grain maize
ostatní obiloviny
8 158
11 339
11 877
9 893
8 868
8 661
Other cereals
Luskoviny celkem
39 260
39 021
30 668
22 306
29 003
31 318
hrách setý
29 123
27 148
22 888
17 385
21 147
24 391
ostatní luskoviny
10 137
11 873
7 780
4 921
7 855
6 927
Other pulses
Okopaniny celkem
102 925
92 016
87 364
81 167
82 206
84 492
Root crops, total
2 894
1 802
2 147
1 926
2 062
1 721
Early potatoes1)
brambory ostatní
33 179
24 178
25 606
23 605
22 797
21 745
Other potatoes2)
brambory sadbové
.
4 044
4 160
4 257
3 875
3 613
Seed potatoes
cukrovka technická
65 570
60 959
54 272
50 380
52 465
56 388
krmná řepa
1 142
840
807
845
619
908
Forage beet
ostatní okopaniny
140
193
373
153
388
118
Other root crops
415 490
450 773
461 628
490 146
494 156
499 792
Industrial
total
267 160
292 246
337 570
356 924
354 826
368 824
Rape
brambory rané1)
2)
plodiny
Technické
celkem
řepka
slunečnice
na semeno
Pulses, total
Peas
Industrial
beet
sugar
crops,
39 648
47 068
24 425
24 468
25 621
27 172
Sunflower for seed
soja
9 276
9 641
7 525
4 339
6 046
9 472
Soya
mák
44 615
57 786
56 915
69 793
53 623
51 103
Poppy
hořčice na semeno
27 085
21 167
21 349
26 246
41 790
26 819
Mustard for seed
len setý olejný
7 336
7 869
2 640
1 171
2 631
4 094
Oil flax
ostatní olejniny
4 411
2 164
1 233
910
1 997
2 936
len setý přadný
4 499
2 904
705
162
153
13
Fibre flax
kořeninové rostliny
5 144
3 428
2 815
1 615
2 135
3 887
Spice plants
léčivé rostliny
3 211
2 429
2 369
2 400
3 539
3 977
Medicinal plants
3 105
4 071
4 083
2 119
1 797
1 494
Other
crops
491 881
459 344
428 599
406 161
396 713
406 450
210 565
190 600
180 481
179 777
179 663
181 939
Green
maize
60 398
56 122
42 272
38 139
36 536
43 213
Other annual fodder
crops3)
jetel červený3)
57 635
55 474
55 657
48 196
46 481
44 900
Red clover3)
vojtěška3)
83 626
80 885
77 203
72 509
68 974
65 821
Lucerne3)
79 657
76 263
72 985
67 540
65 058
70 577
8 917
9 970
10 272
9 732
8 838
8 583
Market
total
1 080
1 327
1 855
1 391
1 108
1 280
Flowers
and
ornamental plants
ostatní
plodiny
technické
Pícniny
na
půdě celkem
na
jednoleté
ostatní
pícniny3)
víceleté
Zelenina
celkem
konzumní
Květiny a
rostliny
oleaginous
industrial
orné
kukuřice
zeleno a na siláž
ostatní
pícniny3)
Other
crops
okrasné
13
Arable fodder crops
and
silage
Other
perennial
fodder crops3)
vegetables,
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 2 – Výroba a export osiv vybraných druhů maloobjemových plodin za období
2004-2011 (v tunách)
druh
Čičorka pestrá
Sléz přeslenitý
Světlice barvířská
Žito lesní
Lesknice kanárská
Komonice bílá
Tolice dětelová
výroba
60
30
15
85
37
4,7
5
export
51
26
8
60
3,3
2,6
4,3
Pozn. Nezahrnuje osiva vyšších stupňů ani osiva vyprodukovaná dalšími subjekty v rámci licenčních množení.
Dedikace
Příspěvek byl zpracován za institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace.
Použitá literatura
Horáková V., Dvořáčková O., Mezlík T. 2012: Seznam doporučených odrůd 2012, Pšenice
ozimá, ječmen jarní, ječmen ozimý, triticale ozimé, oves setý (pluchatý), hrách polní. 1.
vyd., Brno, Gill s.r.o., 203 s., ISBN 978-80-7401-059-0
Povolný M., Vacek E. 2011: Přehled odrůd 2011, Kukuřice. 1. vyd., Brno, Gill s.r.o., 82 s.,
ISBN 978-80-7401-049-1
ÚKZÚZ, 2012: Databáze odrůd na internetu. http://nou.ukzuz.cz/ido/, cit. 17.10.12
Kontaktní adresa:
Ing. Karel Vejražka, Ph.D.
Zemědělský výzkum, spol. s r.o.
Zahradní 1, 66441 Troubsko
[email protected]
14
„Úroda 12/2012, vědecká příloha časopisu“
AKTUÁLNÍ MRAZUVZDORNOST ŘEPKY OLEJKY (LT50)
V ZÁVISLOSTI NA AKUMULACI DEHYDRINŮ
Frost tolerance (LT50) according to dehydrins accumulation
Urban, M. O.1; Klíma, M.2; Vítámvás, P.2; Kučera, V.2
1
2
PřF UK, Praha 2
Výzkumný ústav rostlinné výroby, v. v. i., Praha 6-Ruzyně
Abstrakt
Cílem této studie bylo ověřit, zda existuje vztah mezi stupněm mrazuvzdornosti, zjištěným pomocí
tzv. terčíkové metody, a akumulací specifických proteinů (dehydrinů; DHN) otuženými listy tří
vybraných odrůd ozimé řepky olejky. Úroveň akumulace jak součtu všech vizualizovaných dehydrinů,
tak i vybraných dehydrinů (DHN 45 a 47 kD) byla u sledovaných odrůd přímo úměrná aktuální
mrazuvzdornosti (stanovené pomocí LT50) těchto odrůd. Předběžné výsledky u třech odrůd naznačují,
že akumulaci dehydrinů by bylo možné využít jako potenciální marker mrazové odolnosti i u širšího
spektra genotypů ozimé řepky.
Klíčová slova: řepka olejka ozimá, dehydrin, mrazová odolnost, proteinové markery, aklimace
Abstract
The aim of this study was to determine whether there is a relationship between the degree of frost
tolerance, identified by the leaf spot method, and the accumulation of specific proteins (dehydrins;
DHN) in hardened leaves of three selected genotypes of winter oilseed rape. The level of accumulation
of the sum of visualized dehydrins, as well as selected dehydrins (DHN 45 and 47 kD) was observed
in genotypes proportional to the actual frost resistance (determined by LT50) of these genotypes.
Preliminary results in three genotypes suggest that accumulation of dehydrins could be used as a
potential marker of frost resistance in a wider range of genotypes of winter oilseed rape.
Keywords: winter oilseed rape, dehydrins, frost tolerance, protein marker, acclimation
Úvod
Spolehlivost stanovení mrazové odolnosti šlechtitelských materiálů ozimé řepky a dalších
plodin v polních podmínkách na základě stupně přezimování závisí na průběhu zimy, který je
pro každý rok specifický, s účastí řady faktorů různého účinku a délky trvání. Proto je snaha
do šlechtitelského procesu zavést relevantnější metody stanovení mrazuvzdornosti.
Jako perspektivní se ukazuje sledování akumulace specifických proteinů – dehydrinů (DHN)
v pletivech rostlin během procesu otužování. Akumulace výše zmíněných proteinů v
souvislosti s působením abiotických stresorů (sucho, chlad) je na základě mnoha studií
považována za jeden z významných genotypově podmíněných znaků, přispívajících k
odolnosti rostlinných buněk vůči ztrátě vody (dehydrataci). Dehydriny tvoří samostatnou
skupinu v rámci velké rodiny LEA proteinů (tzv. LEA II nebo LEA-D11 proteiny). Zatímco
jejich chemická podstata je již známa, úloha těchto proteinů při stresové zátěži není ještě zcela
prozkoumána. DHN se vyskytují u všech vyšších rostlin zejména v povrchových
parenchymatických (nebo s povrchem blízce sousedících) pletivech 1a. Tato pletiva jsou
většinou jako první vystavena dehydrataci. Schopnost dehydrinů vázat molekuly vody a
schopnost interakce s povrchem membrán nebo s dalšími proteiny zabraňuje nadměrným
ztrátám vody z buněk takto exponovaných pletiv. DHN také chrání enzymy před chladovými
změnami skupenství vody (např. WCS120 u pšenice; 2). Navíc jsou DHN schopny
neutralizovat reaktivní formy kyslíku a jeho radikály 1a. Díky těmto vlastnostem jsou DHN
považovány za významnou skupinu stresově indukovatelných proteinů. Sledování jejich
expresních profilů (množství transkriptů DHN v buňkách, pletivech) umožňuje jejich využití
15
„Úroda 12/2012, vědecká příloha časopisu“
jako fyziologických markerů odolnosti u některých plodin, případně na základě jejich
akumulace v pletivech lze hodnotit hladinu stresové odpovědi. K těmto účelům může sloužit:
1) alelická variabilita DHN sekvencí - různé alely ve výsledku podmiňují odlišnou citlivost či
odolnost daného genotypu (např. u vikve; 1b). Tyto rozdíly v genomu mohou sloužit jako
markery při dehydrataci u velmi podobných genotypů. Aby se tyto markery daly využít při
šlechtění nových odrůd, kdy jsou na základě exprese těchto kandidátních genů vybírány
rodičovské komponenty, musíme znát funkční projevy rozdílných alel.
2) kvantitativní exprese mRNA pro DHN (množství mRNA a následně translatovaných
funkčních DHN proteinů v buňkách). U některých dehydrinů bylo zjištěno, že kvantitativní
míra jejich exprese koreluje s mírou stresové tolerance daného genotypu (např.
mrazuvzdorností). Výsledky 2 ukázaly, že protein WCS120 je natolik citlivý, že lze na
základě míry jeho akumulace rozlišit i dva ozimy s různou úrovní mrazuvzdornosti. Podobně
jsou některé specifické mRNA pro DHN již využívány jako markery adaptace po působení
sucha 3. Tyto změny expresního profilu jsou u chladového stresu spojovány i se změnami a
senzory turgorové části vodního potenciálu buněk 4; 5.
Cílem této studie bylo ověřit, zda existuje vztah mezi stupněm mrazuvzdornosti, zjištěným
pomocí tzv. terčíkové metody, a akumulací specifických proteinů (DHN) otuženými listy tří
vybraných odrůd ozimé řepky.
Materiál a Metody
Rostliny tří kontrastních odrůd ozimé řepky (Brassica napus L.) cv. Benefit, Californium a
Navajo byly pěstovány v řízených podmínkách (20/15±1°C den/noc, fotoperioda 12 h,
světelná intenzita 400 µmol/m2/s) po dobu 4 týdnů, tj. do stádia čtvrtého listu (BBCH 14).
Rostliny byly poté otužovány při teplotě 4±1°C, při zachování světelné intenzity a
fotoperiody, po dobu 4 týdnů. Rostliny byly přihnojovány roztokem vícesložkového hnojiva
(Vegaflor) jednou za dva týdny. Vzorky nejmladšího plně vyvinutého listu byly odebírány
těsně před začátkem otužení (den 0) a vzorky listů v růstové fázi BBCH 18-19 (5. – 6. pravý
list) na konci chladového působení (den 28) v pěti technických a dvou biologických
opakováních. Aktuální mrazuvzdornost otužených rostlin byla stanovena na konci chladové
periody (den 28), a to dvakrát u každé odrůdy pomocí metody mrazově podmíněného výtoku
elektrolytů z terčíků u nejmladších plně vyvinutých listů v rozmezí teplot -3 až -30 °C (tzv.
přímý mrazový test; 6) Výsledky konduktometrického stanovení byly zpracovány
programem pro výpočet LT50 (lethal temperature; 7). Extrakce termostabilních proteinů ze
vzorků otužených listů, SDS-PAGE a následná hybridizace rozdělených proteinů s antidehydrin protilátkou na PVDF membráně proběhla dle 2. Koncentrace vzorku ve
vzorkovém pufru byla zvýšena 25× oproti postupu, uvedenému v 2. Kvantitativní analýza
vizualizovaných dehydrinů programem Quantity One 4.6.7 (Bio-Rad) následovala po
naskenování membrány kalibrovaným densitometrem (CO). Jednofaktorová ANOVA a
rozdíly mezi průměry podle Fisherova testu (LSD) byly vypočítány statistickým programem
Statistica 10.0 (StatSoft, Tulsa, OK, USA).
Výsledky a diskuze
Akumulaci dehydrinů u všech sledovaných odrůd znázorňuje obr. 1. U odrůd Navajo a
Californium bylo zjištěno pět dehydrinů s rozdílnou molekulovou hmotností (35, 37, 45, 47 a
91 kD). Ve srovnání s obilninami viz 2, pěstovanými ve stejných podmínkách, bylo celkové
množství DHN v proteinové frakci rozpustné po varu cca 100× menší (tj. jedná se zhruba o
množství, které lze detekovat v listech pšenice ozimé, pěstované při 20 °C). Tato nízká
akumulace DHN u odrůd řepky pravděpodobně souvisí s obecně nižší mrazuvzdorností ozimé
řepky oproti ozimým obilninám. Protože schopnost rostlin odolávat mrazu je založena
polygenně (nezávisí tedy jen na akumulaci DHN), tak mrazuvzdornost řepky není 100× nižší
16
„Úroda 12/2012, vědecká příloha časopisu“
(např. odrůda řepky Navajo = -14 °C, pšenice Mironovská 808 = -21°C 2). Další produkty
signálních a metabolických drah, kterými řepka odpovídá na chladový stres, mohou být
naopak výrazně navýšené, než je tomu u obilnin. V souladu s uvedenými výsledky byla
celková akumulace DHN u odrůdy Benefit (nejméně odolná odrůda, viz graf 1 a 2) statisticky
významně nižší než u ostatních odrůd. Zároveň byla zjištěna významná pozitivní korelace
(R=0,8756) mezi aktuální mrazuvzdorností (průměrné hodnoty LT50 odrůdy Navajo -14,01°C,
Californium -13,39°C a Benefit -11,5°C) a hladinou DHN v jednotlivých otužených odrůdách
(graf č. 3).
V grafu č. 2 jsou patrné jednotlivé proteinové oblasti DHN u vybraných tří odrůd Californium
(F); Benefit (B a Navajo (N). Číslo jedna se vyskytuje v oblasti molekulové hmotnosti cca 90
kD, číslo 2 a 3 tvoří součet dvou bandů (na membráně jde o dvě velmi blízce vizualizované
oblasti DHN). Tyto oblasti mají molekulovou hmotnost cca 47 kD a 37 kD. Z grafu č. 2 je
patrné, že nejvyšší predikční i vypovídací schopnost mají DHN o hmotnosti kolem 47 kD.
Tyto oblasti DHN dosahují nejvyšších akumulací jak během chladu, tak i při stresu suchem
(Urban, nepublikováno). Právě v této oblasti hmotnosti kolem 47 kD odrůda Benefit
akumuluje pouze jeden DHN (ostatní odrůdy dva). U této odrůdy byl tedy zjištěn kvalitativní
rozdíl v akumulaci DHN ve srovnání s ostatními dvěma odrůdami.
Obrázek
1.
Densita
(koncentrace)
dehydrinů (v kD), vizualizovaných na
PVDF membráně
Graf 1. Součet densit vizualizovaných
dehydrinů u jednotlivých odrůd ozimé
řepky
F – Californium; N – Navajo; B – Benefit; čísla 1
a 2 značí vzorek opakování (z různých rostlin)
Chybové úsečky jsou tvořeny hodnotou směrodatné
odchylky densit; písmena a, b označují homogenní
podskupiny (LSD; P = 0.05)
17
„Úroda 12/2012, vědecká příloha časopisu“
Graf 2. Density všech vizualizovaných dehydrinů u jednotlivých odrůd
Chybové úsečky jsou tvořeny hodnotou směrodatné odchylky densit, písmena a, b, c označují homogenní
podskupiny (LSD; P = 0.05)
Graf 3. Vztah LT50 všech odrůd k akumulaci DHN
18
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
Posledních deset let se setkáváme v odborné literatuře s velkým zájmem základního i
aplikovaného výzkumu, cíleným na sledování těch proteinů, které by mohly být markery
reakce jednotlivých pletiv či odrůd na stres nedostatku vody (týká se i chladu). Každá odrůda
může upřednostňovat odlišné signální dráhy a strategie akumulace protektivních látek.
Vybrané odrůdy řepky olejky korelovaly ve schopnosti akumulace DHN s jejich aktuální
mrazuvzdorností. Benefit navíc projevil i kvalitativní změny v akumulaci DHN. V dalších
experimentech by proto tato liniová odrůda mohla přispět k upřesnění podílu jednotlivých
dehydrinů na celkové odolnosti i u dalších genotypů ozimé řepky Dá se očekávat, že po
optimalizaci izolace a detekce dehydrinů u širšího spektra odrůd ozimé řepky (hybridních i
liniových) bude pomocí této metody možné primárně selektovat nové výchozí materiály
s dostatečnou úrovní mrazuvzdornosti. Aby toho bylo možné dosáhnout, bude třeba
optimalizovat i postupy stresového působení tak, aby nedocházelo ke stírání odrůdových
rozdílů a aby bylo možné výsledky akumulace DHN vztáhnout i ke skutečné zimovzdornosti
jednotlivých odrůd. Komplexní proteomický přístup (např. DIGE) zaměřený na analýzu a
kvantifikaci dalších proteinů ovlivňujících odolnost rostlin vůči abiotickým stresům může
identifikovat další markery odolnosti, a tím zpřesnit a zrychlit selekci odolných genotypů
významných plodin, jako je řepka olejka.
Dedikace
Práce byla podpořena projekty Mze QH82285 a QI111A075.
Použitá literatura
/1a/ Kosová, K. Vítámvás, P., Prášil, I. T. The role of dehydrins in plant response to cold.
Biologia Plantarum, 51 (4) 2007: 601-617.
/1b/ Ismail, A.M., Hall, A.E., Close, T.J.: Allelic variation of a dehydrin gene cosegregates
with chilling tolerance during seedling emergence. Proc. Nat. Acad. Sci. USA Vol. 96 (23),
1999: 13566 – 13570.
/2/ Vítámvás, P., Saalbach G., Prášil I. T., Čapková V., Opatrná J., Jahoor A.: WCS120
protein family and proteins soluble upon boiling in cold-acclimated winter wheat. Journal
of Plant Physiology Vol. 164 (9), 2007: 1197 – 1207.
/3/ Volaire, F.: Drought survival, summer dormancy and dehydrin accumulation in contrasting
cultivars of Dactylis glomerata. Physiol. Plant. Vol. 116 (1), 2002: 42 – 51.
/4/ Cellier, F., Conejero, G., Breitler, J.C., Casse, F.: Molecular and physiological response to
water deficit in drought-tolerant and drought-sensitive lines of sunflower. Plant Physiol.
Vol. 116 (1), 1998: 319 – 328.
/5/ Suprunova, T., Krugman, T., Fahima, T., Chen, G., Shams, I., Korol, A., Nevo, E.:
Differential expression of dehydrin genes in wild barley, Hordeum spontaneum, associated
with resistance to water deficit. Plant, Cell Environ. Vol. 27 (10), 2004: 1297 – 1308.
/6/ Prášil, I., Zámečník, J.: The use of a conductivity measurement method for assessing
freezing injury. I. Influence of leakage time, segment number, size and shape in a sample
on evaluation of the degree on injury, Environ.exp.Bot., 40, 1998:1-10.
/7/ Janáček, J., Prášil, I.: Quantification of plant frost injury by nonlinear fitting of an Sshaped function, Cryo-Letters. 12, 1991:47-52.
19
„Úroda 12/2012, vědecká příloha časopisu“
Kontaktní adresa:
Ing. Milan O. Urban, DiS.
Laboratoř molekulární stresové fyziologie
Katedra experimentální biologie rostlin
PřF UK, Viničná 5
Praha 2
e-mail: [email protected]
Brassica napus L.
20
„Úroda 12/2012, vědecká příloha časopisu“
ZKUŠENOSTI S VYUŽITÍM ČMELÁKA ZEMNÍHO (BOMBUS
TERRESTRIS L., APIDAE) VE ŠLECHTĚNÍ OZIMÉ ŘEPKY
(BRASSICA NAPUS L.)
Experience on using Bombus terrestris L. in breeding of winter oilseed rape
(Brassica napus L.)
Macháčková I.1, Ptáček V.2, Bučánková A.2
1
Selgen, a.s., Šlechtitelská stanice Chlumec nad Cidlinou, 503 51 Chlumec nad Cidlinou
2
Zemědělský výzkum spol. s r. o., Zahradní 1, 664 41 Troubsko
Abstrakt
Při hybridním šlechtění ozimé řepky způsobem T-cross v technické izolaci byli v letech 2010 a 2011
poprvé použiti čmeláci zemní (Bombus terrestris L.) k transferu pylu uvnitř souborů. V obou letech
sloužily tři soubory jako kontrola. V roce 2010 byli do jedné klece vpuštěni pouze samci. Zatímco
v izolátorech bez opylovatelů bylo v jednotlivých letech získáno v průměru 59,7 a 86,2 g na m2,
průměrné výnosy se čmeláky byly 326,0 a 349,0 g na m2. Podobně, průměrné množství semen na
rostlinu dosahovalo bez čmeláků hodnot 1,5 a 4,0 g zatímco se čmeláky 12,6 a 14,6 g. V kleci se
samci se hodnoty výnosů nacházely mezi oběma skupinami. Rostliny bez opylovatelů vykázaly
poněkud vyšší hmotnost tisíce semen. Využití čmeláků dovoluje získat více než čtyřnásobně vyšší
šlechtitelský zisk. Pokus rovněž ukazuje značnou potenci zvýšení výnosů semen přenosem pylu u
řepky obecně.
Klíčová slova:Brassica napus, Bombus terrestris, technická izolace, výnos semen, HTS
Abstract
Using T-cross arrangement in hybrid breeding of canola, bumble bee (Bombus terrestris L.) colonies
were used to enable pollen transfer among selected plants in enclosures. As the results showed,
without pollinators as an average 59.7 a 86.2 g of seeds per m2 were harvested, whereas with
bumblebees the average yield reached 326.0 and 349.0 g per m2, in the respective years 2010 and
2011. Similarly, the average seed yield per plant was 1.5 and 4.0 without pollinators, but 12.6 and 14.6
with them in the respective years. In the cage with males only the results were among the two
comparative groups. Somewhat higher mass of 1,000 seeds was found in the plants without
pollinators. As the trials showed, using of bumble bees enables more than to quadruple the breeding
gain. Also the enormous ability of canola to improve seed yield after proper pollination was
confirmed.
Key words: Brassica napus, Bombus terrestris, enclosures, seed yield, TSW
Úvod
Všechny aktuálně pěstované liniové odrůdy řepky olejky (Brassica napus) jsou převážně
samosprašné. Při tvorbě výkonných a uniformních odrůd hybridního typu je samosprašnost
naopak nežádoucí. Proto se využívají různé genetické bariéry, které samoopylení u řepky
znemožňují, jako jsou různé typy pylové sterility – cytoplazmatické (CMS) nebo genové
(GMS), případně autoinkompatibility (AIK). Při tvorbě hybridů v technické izolací je
nezbytné použít opylovatele, protože přenos pylu z fertilních otcovských na sterilní mateřské
rostliny v izolačních klecích pomocí větru minimální. Mezi nejčastěji používané opylovatele
patří včela medonosná, čmeláci, samotářské včely nebo mouchy (Ptáček, 1983, 1987, 2000;
Mesquida, Renard, Pierre, 1988; Soroka a kol. 2001; Drobná, Ptáček 2003; Steffan-Dewenter,
2003).
Výhodou použití čmeláků při opylování rostlin v technických izolátorech je zejména fakt, že
se v uzavřeném prostoru dobře orientují a po seznámení se s prostředím začínají okamžitě
pracovat. Oproti včelám medonosným létají už při teplotách 6–8°C a jsou aktivní i během
slabého deště. Do nedávné doby byly omezujícím faktorem pro využití čmeláků vysoké
21
„Úroda 12/2012, vědecká příloha časopisu“
náklady na pořízení hnízda, které byly ve srovnání s opylovacími „pakety“ včely medonosné
5-10x vyšší (Dušek a kol., 2010). Problematické bylo také načasování a získání dostatečného
množství hnízd v období nakvétání porostů. Tyto nedostatky byly odstraněny zavedením
hromadného celoročního odchovu čmeláka zemního domácí rasy v ZV Troubsko (Ptáček,
2010).
Cílem našich pokusů bylo zjistit, zda lze u souborů rostlin řepky olejky, určených k produkci
hybridní F1 generace v technických izolátorech, použitím čmeláka zemního, získat vyšší
výnos semen.
Materiál a Metody
Pokusy byly prováděny v letech 2010 a 2011 ve šlechtitelské stanici Chlumec nad Cidlinou,
firmy Selgen, a.s. Soubory řepky byly vyseté v řádném podzimním termínu na záhony o
velikosti 7,2 m2, přičemž výnos semene byl hodnocen na poloviční výměře. Zpočátku byly
rostliny pěstovány volně a v době tvorby poupat byly překryty izolátorem z průhledné netkané
textilie se zasíťovanými ventilačními otvory. Konstrukce pro textilní izolátory byly zhotoveny
z ocelové kulatiny, měly obloukovitý tvar se středovou výškou 180 cm, šířka 120 cm a délka
konstrukce byla 6m.
Soubory řepky v jednom izolátoru byly tvořeny z 1/2 fertilními opylovači a z 1/2
cytoplazmaticky sterilními rostlinami, u kterých byl vyhodnocen výnos semene jak na
rostlinu, tak na jednotku plochy. Schematicky byly rostliny ve 4 řádcích, na 2 řádky uprostřed
byly vysety sterilní opylované rostliny a 2 okrajové řádky byly z opylovačů.
Čmeláci byli umístěni do prostoru izolátoru v době asi 10% kvetení, aby mohli ihned získat
na květech potravu. Šlo o menší hnízda v úlcích s cca 20 dělnicemi a plodem, ze kterého se
líhli noví čmeláci přibližně dalších 14 dnů. Hnízda byla přikrmována cukerným roztokem,
aby neuhynula v případě, že řepka nutnou potravu neposkytne. V jednom případě byli do
izolátoru vpuštěni pouze samci s předpokladem, že jejich pátrání po nektaru v květech přinese
rovněž očekávaný opylovací efekt. Tito přikrmováni nebyli. Po odkvětu byla hnízda čmeláků
ponechána k dokončení života volně v přírodě, protože šlo o autochtonní populaci.
Po skončení opylování byly izolátory odstraněny a rostliny dokončily vývoj volně. Osivo bylo
sklizeno a zváženo zvlášť z jednotlivých opylených rostlin, pak bylo smícháno a ze směsi
byla stanovena HTS. Získané hodnoty byly zpracovány základními statistickými metodami.
Výsledky a diskuse
Výsledky dvouletých experimentů prokázaly pozitivní vliv dělnic čmeláků jako opylovatelů
při tvorbě hybridního osiva ozimé řepky v rámci sledovaných souborů. Detailní výsledky pro
oba roky jsou uvedeny v tabulce 1 a 2. Hodnoty dvou sledovaných charakteristik (průměrný
výnos na rostlinu a průměrný výnos na jednotku plochy izolátoru) byly v obou ročnících
výrazně vyšší v případě nasazení čmeláků. Vliv opylovatelů na výše zmíněné charakteristiky
byl potvrzen statistickými analýzami jako vysoce významný (t-test, P < 0,01). Např. v roce
2010 bylo dosaženo průměrných výnosů na rostlinu 12,6 g a 341,5 na m 2 v případě využití
čmeláků a pouze 1,5 g a 59,7 g v případě kontrol bez opylovatelů (Obrázek 1A a 1B).
V izolátorech s hnízdy s dělnicemi bylo roce 2010 získáno 8x více semen v průměru na
rostlinu a téměř 6x více semen na jednotku plochy než v klecích bez opylovatelů. Podobných
rozdílů bylo dosaženo i v následujícím roce (viz obrázek 1A a 1B). Opět byl prokázán
významný vliv opylovatelů na výnosy semen z rostliny i jednotky plochy, stejně jako i na
hodnotu hmotnosti tisíce semen (HTS) (t-test, P < 0,01). Hodnoty HTS však byly v negativní
korelaci s výnosovými charakteristikami (obrázek 1C). Tuto skutečnost lze vysvětlit
dokonalejší výživou menšího množství semen u rostlin s celkově hůře opylenými květy.
Poněkud horších výsledků bylo dosaženo při použití trubců místo kompletních rodin (tabulka
1, linie T22). Pozitivní vliv patrný, nelze ho však statisticky ověřit z důvodu nedostatečného
22
„Úroda 12/2012, vědecká příloha časopisu“
počtu opakování. Výsledek je však v souladu s předpokladem, že i samci by výnos zvýšili,
avšak pro dokonalé prokřížení genotypů v kleci je nutné, aby opylovatelé aktivně hledali pyl
pro výživu svého potomstva ve stadiu larev. Podobně, Kanaďané Soroka a kol. (2001),
dosáhli u produkce CMS hybridního osiva v klecích 30 – 40 násobné zvýšení pomocí
čalounic (Megachile rotundata F.) zatímco se čmeláky Bombus impatiens Cr. pouze 10
násobné ve srovnáním s výnosy bez opylovatelů. U pylově fertilní otcovské odrůdy, atraktivní
pro čmeláky, byly výnosy stejné bez ohledu na druh opylovatele. Že na druhu záleží, potvrzují
výsledky Mesquida, Bernard, Pierre (1988), kteří po opylování včelami medonosnými u
ozimé liniové odrůdy „Jet Neuf“ v izolačních klecích zaznamenali (statisticky neprůkazné)
zvýšení výnosu o 6 %. Včely medonosné se prakticky pro opylování v izolátorech nehodí. Na
druhé straně ve volné přírodě výnosy zvyšují. U nás více než o 50% (Kubišová, Nedbalová,
Plesnik, 1980; Kamler 1983). Kotowski (2005) však u nových kultivarů zaznamenal jen
neprůkazné zvýšení výnosů při volném opylení. V našich pokusech měl na stupeň proopylení
a následné nasazení semen významný vliv i průběh počasí během kvetení, jak vyplývá z
meziročních výsledků. V roce 2010 bylo v době kvetení rostlin, tj. v měsíci dubnu a květnu
naměřeno 140 a 181 % srážek oproti dlouhodobému normálu, měsíční teplotní průměry byly
naopak nižší až o 0,9°C. V roce 2011 srážky dosahovaly v dubnu a květnu jen 38 a 61%
dlouhodobého normálu, průměrná teplota byla v dubnu o 2,4°C vyšší než je dlouhodobý
průměr a taktéž v květnu byl o 0,4°C vyšší teplotní průměr.
Tab. 1. Vybrané výnosové charakteristiky pokusu v roce 2010
Původ
souboru
Čmeláci
CMS
rostlin
T1
AD8
ano
T2
AD16
ano
T4
AD50
ano
T7
AD102
ano
T8
AD105
ano
T9
AD106
ano
T13
c19xc20
ano
T16
c37xc38
ano
T17
c37xc38
ano
T20
AD8
ano
T22
AD50
ano*
T26
AD103
ne
T3
AD16
ne
T6
AD101
ne
Průměrný výnos při použití dělnic
Průměrný výnos bez opylovatelů
Označení
izolátoru
Počet
opylovaných
rostlin
Sklizňová
plocha
[m2]
82
109
106
125
83
78
55
102
73
138
74
168
124
130
3,6
3,6
3,6
3,6
3,6
3,6
3,6
3,6
3,6
3,6
3,6
3,6
3,6
3,6
*Pouze trubci; tyto výsledky nejsou zahrnuty do průměru
23
Výnos
[g]
izolátor
1435
1525
1490
1510
1505
665
620
1355
920
1270
615
240
215
190
rostlina
17,50
13,99
14,06
12,08
18,13
8,53
11,27
13,28
12,60
9,20
8,31
1,43
1,73
1,46
12,63
1,54
HTS
[g]
m2
398,6
423,6
413,9
419,4
418,1
184,7
172,2
376,4
255,6
352,8
170,8
66,7
59,7
52,8
341,5
59,7
4,74
5,32
4,98
4,92
5,14
6,48
5,09
5,46
5,54
6,04
6,04
6,28
6,01
6,18
5,43
6,16
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 2. Vybrané výnosové charakteristiky pokusu v roce 2011
Původ
Počet
souboru
Čmeláci opylovaných
CMS
rostlin
rostlin
T1
20
ano
122
T2
20
ano
153
T3
25
ano
101
T4
25
ano
130
T5
48
ano
120
T6
48
ano
125
T7
52
ano
110
T8
52
ano
115
T12
40
ano
85
T14
14
ano
55
T15
14
ano
83
T16
20
ano
95
T17
20
ano
110
T20
48
ano
90
T21
48
ano
87
T22
52
ano
105
T23
52
ano
55
T25
14
ano
99
T27
40
ano
60
T31
52
ano
74
T32
52
ano
102
T33
48
ano
102
T34
48
ano
74
T35
25
ano
83
T36
25
ano
53
T37
20
ano
68
T38
20
ano
64
T39
14
ano
77
T40
14
ano
68
T42
40
ano
82
T41
54
ne
95
T18
25
ne
61
T19
25
ne
78
Průměrný výnos při použití dělnic
Průměrný výnos bez opylovatelů
Označení
izolátoru
24
Sklizňová
plocha
[m2]
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
3,5
Výnos
[g]
izolátor
1280
1170
835
1040
940
995
840
1015
1160
1550
1620
1235
1475
1275
1120
1100
880
830
1235
1155
1415
1470
1450
1345
1200
1370
1200
1510
1485
1445
250
260
395
rostlina
10,49
7,65
8,27
8,00
7,83
7,96
7,64
8,83
13,65
28,18
19,52
13,00
13,41
14,17
12,87
10,48
16,00
8,38
20,58
15,61
13,87
14,41
19,59
16,20
22,64
20,15
18,75
19,61
21,84
17,62
2,63
4,26
5,06
14,57
3,99
HTS
[g]
m2
365,7
334,3
238,6
297,1
268,6
284,3
240,0
290,0
331,4
442,9
462,9
352,9
421,4
364,3
320,0
314,3
251,4
237,1
352,9
330,0
404,3
420,0
414,3
384,3
342,9
391,4
342,9
431,4
424,3
412,9
71,4
74,3
112,9
349,0
86,19
3,98
3,98
3,58
3,58
4,58
4,58
4,48
4,48
4,66
4,86
4,86
3,78
3,78
4,10
4,10
4,78
4,78
5,18
4,74
4,86
4,86
4,42
4,42
3,54
3,54
3,76
3,76
4,66
4,66
4,34
6,60
5,38
5,38
4,3
5,79
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 1. Vliv čmeláků na vybrané výnosové charakteristiky v letech 2010 a 2011
A – průměrný výnos na rostlinu, B – průměrný výnos na jednotku plochy izolátoru,
C – průměrná HTS. Chybové úsečky vyjadřují standardní chybu (SE) (průměr ± 0,95*SE)
A
B
C
Závěr
Z výsledků je nepochybný vysoce kladný vliv čmeláků jako přenašečů pylu uvnitř daných
souborů. V obou letech byla zjištěna poněkud vyšší HTS v klecích bez opylovatelů.
Vysvětlením je dokonalejší výživa menšího množství semen u sledovaných rostlin.
Významný vliv na stupeň proopylení a následné nasazení semen má i průběh počasí během
kvetení řepky ozimé, jak vyplývá z meziročních výsledků. Výraznější rozdíly mezi výnosy
s opylovateli a bez nich byly nalezeny v roce 2010, kdy po celou dobu kvetení bylo deštivo
doprovázené chladnějším počasím. Podobný průběh počasí je pro volné opylování nevhodný
a nezajistí dostatečné nasazení šešulí, což je klíčové při výrobě hybridního osiva.
Dedikace
Práce vznikla za podpory projektu NAZV QI111A075 Národní agentury pro zemědělský
výzkum a TA01020969 Technologické agentury České republiky.
Použitá literatura
Drobná J., Ptáček V., (2003): Experience in using bumblebees as pollinators in the
regeneration of the genetic resources of some forage legumes. J. Apic. Sci. 47(1): 31-36.
Dušek K., Krieg P., Dušková E. (2010): Metodika použití hmyzích opylovačů u
cizosprašných druhů zelenin, léčivých, aromatických a kořeninových rostlin pěstovaných v
technické izolaci. VÚRV v.v.i. ISBN: 978-80-7427-037-6.
25
„Úroda 12/2012, vědecká příloha časopisu“
Kamler F. (1983) - Reakce vybraných odrůd řepky ozimé na opylení včelou medonosnou
[The response of selected winter rape cultivars to the pollination by honeybees]. Rostlinná
výroba, 29 (56): 225-234.
Kotowski Z. (2005): The effect of pollinating insects on the yield of the winter rape seed
(Brassica napus L. var. napus f. biennis) cultivars. J. Apic. Sci. 49 (2): 29-41.
Kubišova S., Nedbalova V., Plesnik R. (1980) - Účinnost včely medonosné (Apis mellifera L.)
na řepce (Brassica napus L. var. napus) [The activity of honey bee (Apis mellifera L.) on
rape (Brassica napus L. var.napus)]. Pol’nohospodárstvo 26(8): 744-754.
Mesquida J., Renard M., Pierre J.S. (1988): Rapeseed (Brassica napus L.) productivity: The
effect of honeybees (Apis mellifera L.) and different pollination conditions in cage and
field tests. Apidologie 19: 51–72.
Ptáček V. (1983): Pollination of alfalfa in enclosures. Univ. Calif., Davis, Calif., Rep. of 28th
Alfalfa Improvement Conf. 67-68.
Ptáček V. (1987): Technická izolace ve výzkumu a šlechtění jetelovin.(Technical isolation in
research and breeding legumes.) Sbor. věd. prac. OSEVA, VŠÚP Troubsko (10): 117-128.
Ptáček V. (2000): Different bee species for pollination in enclosure. In: Insect pollination in
greenhouses. Proc. of the specialist's meeting, Soesterbeg, The Netherlands, 30 Sept.- 2
Oct. 1999. Utrecht, The Netherlands: Apimondia, ICPBR - Pollination Section, 2000: 133137
Ptáček V. (2010): Základy hromadného chovu čmeláka zemního (Bombus terrrestris L.) a
jeho využití k opylování. VÚP s.r.o., ZV, s.r.o. Troubsko, ISBN: 978-80-86908-23-6.
Soroka J.J., Goerzen D.W., Falk K.C., Bett K.E. (2001): Alfalfa leafcutting bee
(Hymenoptera: Megachilidae) pollination of oilseed rape (Brassica napus L.) under
isolation tents for hybrid seed production. Canad. J. Plant Sci., 81: 199–204.
Steffan-Dewenter I. (2003): Seed set of male-sterile and male-fertile oilseed rape (Brassica
napus) in relation to pollinator density. Apidologie 34: 227–235.
Kontaktní adresa:
Ing. Ivana Macháčková
Selgen, a.s.
Šlechtitelská stanice Chlumec nad Cidlinou
503 51 Chlumec nad Cidlinou
[email protected]
26
„Úroda 12/2012, vědecká příloha časopisu“
VZTAH RODIČOVSKÝCH GENOMŮ U MEZIDRUHOVÝCH
HYBRIDŮ TRIFOLIUM PRATENSE X TRIFOLIUM MEDIUM
Intergenomic relationships in interspecific hybrids
of Trifolium pratense x Trifolium medium
Řepková J.1, Simandlová J.1, Jakešová H.2, Nedělník J.3, Soldánová M.1,
Hajšlová J.4, Schulzová V. 4
1
Ústav experimentální biologie, Masarykova univerzita Brno
2
Ing. Hana Jakešová, CSc, šlechtění, Hladké Životice
3
Zemědělský výzkum, spol. s r.o., Troubsko
4
Vysoká škola chemicko-technologická v Praze
Abstrakt
Šlechtitelský materiál založený na hybridech Trifolium pratense x T. medium je vhodným zdrojem
genetické variability pro kulturní jetel luční (T. pratense). Tito hybridi byli hodnoceni na úrovni
cytologické prostřednictvím průtokové cytometrie a genomické in situ hybridizace. Rostliny ve dvou
školkách s 99 původy hybridů měly srovnatelné zastoupení, co se týče počtu chromozomů v pěti
hodnocených skupinách, to je 2n = 28 (76 a 66% rostlin), s méně než 28 chromozomy (8,5 a 6,4%
rostlin), 2n = 29 a 30 (15 a 26% rostlin), 2n = 31 až 40 (0,4 a 1,2% rostlin) a 2n = 41 až 46 (méně než
1% rostlin). Nepodařilo se prozatím identifikovat introdukované chromozomy nebo translokované
části. Hybridi obsahovali nižší množství fytoestrogenů než T. pratense, ale byl zaznamenán nárůst
formononetinu ve srovnání s T. medium. Pro identifikaci mezidruhové variability budou využity
genomické techniky založené na de novo sekvenování obou rodičovských genomů.
Klíčová slova: Genomická in situ hybridizace, Průtoková cytometrie, Trifolium medium, Trifolium
pratense
Abstract
Breeding material derived from hybrids Trifolium pratense x T. medium is a promising source of new
genetic variability for cultivated red clover (T. pratense). These hybrids were evaluated on the
cytological level via flow cytometry and genomic in situ hybridization. Plants of 99 sources in two
breeding nurseries had comparable chromosome numbers in five groups: 2n = 28 (76 and 66% of
plants), bellow of 28 chromosomes (8.5 and 6.4% of plants), 2n = 29, 30 (15 and 26% of plants), 2n =
31, 40 (0.4 and 1.2% of plants) and 2n = 41 to 46 (0.1 and 0.3% of plants). The identification of
introduced chromosomes or translocated parts was unsuccessful. Hybrids contained lover level of
phytoestrogens than T. pratense but increased amount of formononetin with comparison of T. medium
was evaluated. Interspecific variability will be identified by genomic procedures based on de novo
sequencing of the both parental genomes.
Key words: Flow cytometry, Genomic in situ hybridisation, Trifolium medium, Trifolium pratense
Úvod
Genetická rozmanitost kulturních druhů se zužuje vlivem šlechtění. Vhodným zdrojem pro
rozšíření jejich genetické variability jsou plané druhy, které prostřednictvím mezidruhové
hybridizace umožňují využití genofondu nad rámec druhu a mohou být zdrojem řady nových
znaků jako samčí sterilita, rezistence k chorobám, biotickým faktorům a podobně. Trifolium
pratense L. je vysoce kvalitní pícnina dávající vysoké výnosy, ale má nízkou vytrvalost, což
je možné překonat mezidruhovou hybridizací s druhy, které tvoří podzemní výběžky, např.
s T. medium L. Ve VÚP Troubsko byl získán originální rostlinný materiál mezidruhovou
hybridizací T. pratense (2n = 4x = 28) a T. medium (2n = 8x = 64) (Řepková et al. 1991;
Nedbálková et al. 1995). Volným sprášením hybridů F2 s T. pratense cv. Amos po pět
generací byla získána populace rostlin, která byla využita ke šlechtění, jehož součástí byly i
výběry rostlin s odlišným obsahem DNA ve srovnání s tetraploidním T. pratense. Bylo
27
„Úroda 12/2012, vědecká příloha časopisu“
získáno novošlechtění, které bylo přihlášené v r. 2010 do státních odrůdových zkoušek
ÚKZÚZ pod názvem Pramedi. Materiál se odlišuje od rodičovských druhů variabilitou v
morfologických a agronomických znacích (Řepková et al. 2011) a v současné době je
pozornost zaměřena na hodnocení znaků souvisejících s pozitivními agronomickými
vlastnostmi, jakými jsou hmotnost rostlin, počet lodyh a hlávek na rostlinu, a s vytrvalostí
rostlin.
Cílem současných analýz hybridní populace bylo studium jejich genomů za využití průtokové
cytometrie a stanovení koncentrace DNA ve vztahu k počtu chromozomů hybridů a k oběma
rodičovským druhům. Cytologické analýzy se zaměřily na metodu GISH (genomickou in situ
hybridizaci), která umožňuje identifikaci a vizualizaci chromozomů nebo jejich částí a detekci
introgrese genetické informace. Analýza znaků hybridních rostlin byla doplněna studiem
znaků kvalitativních – stanovení obsahu fytoestrogenů v zelené hmotě.
Materiál a metody
Do analýz byly zahrnuty rodičovské rostliny T. pratense (2n = 4x = 28) a T. medium (2n = 8x
= 64, klon 10/8) a rostliny hybridní populace T. pratense x T. medium, 18 původů v kmenové
školce JEH1V a 81 původů v kmenové školce JEH1F.
Průtoková cytometrie
Do misek s perlitem bylo z každého původu vyseto cca 30 semen. Ve stadiu prvních až třetích
pravých lístků bylo provedeno měření obsahu DNA u jednotlivých rostlin na průtokovém
cytometru Partec PA. DNA každé rostliny byla měřena ve směsném vzorku s diploidním
jetelem lučním (Start, 2n = 14). Celkem bylo hodnoceno 800 rostlin JEH1V a 753 rostlin
JEH1F.
Genomická in situ hybridizace (GISH)
Z 67 hybridních rostlin JEH1V a rostlin JEH1F T. pratense x T. medium byly odebrány
kořenové špičky, po odstřihnutí byly ponechány 24 hod. na ledu za účelem synchronizace
mitóz a pak byly fixovány v Carnoyově fixáži. Byla použita směs lytických enzymů celulázy,
pektolyázy a cytohelikázy pro narušení buněčné stěny. Dále byly připraveny hybridizační
sondy z DNA izolované metodou CTAB z rostlin T. pratense odrůdy Tatra a T. medium klonu
10/8. Bylo použito nepřímé značení sond - sondy pro odrůdy T. pratense byly značeny
digoxigeninem-11-dUTP (Roche) a DNA T. medium byla značena biotinem (Roche). Kvalita
sond po nick translaci byla kontrolována na 1% agarózovém gelu. Hybridizační směs
(Schubert et al. 1998) byla přidána k cytologickému preparátu (10µl/sklíčko). Pro denaturaci
chromozomů a sondy byla sklíčka umístěna na 2 min na varnou desku (80oC), a pak na 6 h ve
vlhkém boxu nebo přes noc při 37oC. Vizualizace preparátů byla provedena pomocí
fluorescenčního mikroskopu Olympus BX-51.
Kvalitativní znaky
Z 10 kmenů mezidruhových hybridů JEH a obou rodičovských druhů byly odebírány vzorky
zelené píce pro stanovení obsahu volných a celkových fytoestrogenních látek – isoflavonů
daidzeinu, genisteinu, glyciteinu, formononetinu, biochaninu A a equolu, pterokarpanů –
kumestrolu a jejich glykosidů. Pro stanovení celkového obsahu fytoestrogenů ve vzorcích
byly glykosidy hydrolyzovány pomocí HCl za tepla, stanovení bylo provedeno pomocí
kapalinové chromatografie a tandemovou hmotnostní spektrometrií. Stanovení volných
fytoestrogenů bylo provedeno extrakcí metanolem.
Výsledky a diskuze
Koncentrace DNA měřených hybridních rostlin se pohybovala v rozmezí odpovídajícímu 22
až 47 chromozomům. Na základě těchto počtů byly rostliny rozděleny do pěti skupin (Tab. 1).
Zastoupení rostlin v jednotlivých kategoriích bylo u obou školek srovnatelné. Na obr. 1 jsou
zastoupeny hybridní rostliny s různým počtem chromozomů. Obsah DNA u T. medium
28
„Úroda 12/2012, vědecká příloha časopisu“
odpovídal oktoploidu s 64 chromozomy. Rostliny neobsahovaly stejný podíl chromozomů od
obou rodičovských druhů. Podobné závěry byly zjištěny při studiu genomů odrůd založených
na mezirodové hybridizaci Lolium multiflorum a Festuca pratensis nebo F. arundinacea
(Kopecky et al. 2005). Úspěšná hybridizace mezi T. pratense a T. medium včetně hodnocení
intermediální morfologie listů byla popsána v práci Isobe et al. (2001). Introgrese znaků
mezidruhovou hybridizací je u rodu Trifolium vzácná a byla popsány spíše mezi druhy T.
ambiguum a T. hybridum pro tvorbu oddenků (Paplauskiene et al. 2004) nebo T. repens a T.
nigrescens pro odolnost k háďátkům (Hussain et al. 1997).
Jednotlivé druhy jetele se lišily jednak v obsahu, jednak v profilu fytoestrogenů. U T. medium
bylo po kyselé hydrolýze stanoveno celkově 6190 mg/kg fytoestrogenů, z čehož tvoří 66%
biochanin A (4061 mg/kg), 28% formononetin (1746 mg/kg), 5% genistein (323 mg/kg) a
<1% daidzein (56 mg/kg). T. pratense obsahuje 2471 mg/kg celkových isoflavonů
(stanovených rovněž po kyselé hydrolýze), s opačným zastoupením majoritních isoflavonů
než u T. medium. Fytoestrogeny jsou tvořeny z 56% formononetinem (1394 mg/kg), 39%
biochaninem A (968 mg/kg), 3,3% genisteinem (83 mg/kg) a z 1% daidzeinem (26 mg/kg).
Rostliny hybrida uvedených dvou rodičů obsahovaly nižší množství fytoestrogenů než T.
pratense, ale byl zaznamenán nárůst formononetinu ve srovnání s T. medium. Obsah
celkových fytoestrogenů je u hybridů 2149 mg/kg se 68% zastoupením formononetinu (1468
mg/kg), 27% biochaninu A (573 mg/kg), 3,9% genisteinu (84 mg/kg) a 1,1% daizeinu (23
mg/kg).
Tab. 1: Obsah DNA hybridních rostlin T. pratense x T. medium v populaci novošlechtění
měřený průtokovou cytometrií přepočítaný na počet chromozomů vzhledem ke
standardu 2n = 14.
Počet rostlin s chromozomy
2n = méně než
2n = 28*
2n = 29 až 30 2n = 31 až 40 2n = 41 až 47
28
JEH1V
68 (8,5%)
608 (76,0%)
120 (15,0%)
3 (0,4%)
1 (0,1%)
JEH1F
48 (6,4%)
495 (65,7%)
199 (26,4%)
9 (1,2%)
2 (0,3%)
*
počet chromozomů u mateřského genotypu T. pratense
Závěr
Charakterizace hybridů T. pratense x T. medium byla doplněna o kvalitativní parametry, jako
je obsah fytoestrogenů. Výsledky potvrdily mezidruhovou variabilitu, která bude dále
studována. Cytologická analýza hybridů ukázala variabilní obsah počtu chromozomů od 20
do 43 v korelaci s metodou průtokové cytometrie, což dokládá introgresi celých chromozomů
nebo jejich ztrátu. Introgrese metodou GISH nebyla zatím potvrzena. Probíhá hodnocení
introgrese znaku tvorby podzemních výběžků, charakter trsu, a jejich souvislost s vytrvalostí.
Pokračují práce s analýzou získaných celogenomových sekvencí obou rodičovských druhů T.
pratense a T. medium metodou Illumina. Práce je zaměřena na vypracování postupu využití
druhově specifických DNA markerů a DNA čipů jako prostředků selekce hybridních rostlin
na znaky kvalitativní i kvantitativní.
Dedikace
Výzkum je součástí projektu QI111A019 a QI111C016 Ministerstva zemědělství ČR.
29
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 1: Počty chromozomů u hybridních rostlin T. pratense x T. medium - C JEH 35/6
(27 chromozomů), D JEH 12/29 (28 chromozomů), E JEH 34/4 (30 chromozomů), F JEH
26/7 (43 chromozomů) ve srovnání s rodiči A T. pratense (28 chromozomů) a B T. medium
klon 10/8 (64 chromozomů).
Použitá literatura
Hussain S.W., Williams W.M., Mercer C.F., White D.W.R. (1997): Transfer of clover cysts
nematode resistance from Trifolium nigrescens Viv. to T. repens L. by interspecific
hybridisation. Tudor. Appl. Genet. 95: 1274–1281.
Isobe S., Sawai A., Yamaguchi H., Gau M., Uchiyama K. (2001): Breeding potential of the
backcross progenies of a hybrid between Trifolium medium x T. pratense to T. pratense.
Canad. J. of Plant Sci. 82: 395–399.
Kopecky D., Lukaszewski A.J., Doležel J. (2005): Genomic constitution of Festulolium
cultivars released in the Czech republic. Plant Breed. 124: 454–458.
Nedbalkova B., Repkova J., Bartosova L. (1995): Germplasm TBZP1, TBZP2, TBZP3,
TBZP4 of interspecific Trifolium hybrids. Scientific Studies Res. Inst. Fodder Plants 13:
129–131.
Paplauskiene V., Dabkeviciene G., Pasckinskiene I. (2004): Identification of interspecific
hybrids of T. ambiguum x T. hybridum by inter-SSR fingerprinting. Grassland Sci. Eur. 9:
398–400.
Řepková J., Nedbálková B., Holub J. (1991): Regeneration of plants from zygotic embryos
after interspecific hybridization within the genus Trifolium and electrophoretic evaluation
of hybrids. Scientific Studies Res. Inst. Fodder Plants 12: 7–14.
Řepková J., Nedělník J., Jakešová H., Hampel D., Hofbauer J. (2011): Mezidruhoví hybridi
Trifolium pratense x Trifolium medium jako zdroj nové diverzity. Úroda 12, vědecká
příloha časopisu, 21–24.
Schubert I., Shi F., Fuchs J., Endo T.R. (1998): An efficient screening for terminal deletions
and translocations of barley chromosomes added to common wheat. Plant J. 14: 489–495.
Kontaktní adresa:
Doc. RNDr. Jana Řepková, CSc.
Kampus Bohunice, Kamenice 5, 625 00 Brno, Česká republika
e-mail: [email protected]
30
„Úroda 12/2012, vědecká příloha časopisu“
NOVÉ SMĚRY VE ŠLECHTĚNÍ OLEJNÉHO LNU
New ways of linseed breeding
Pavelek, M., Tejklová, E., Bjelková, M.
AGRITEC, Plant Research, s.r.o., Šumperk
Abstrakt
Příspěvek reaguje na změny hospodářského typu u lnu setého Linum usitatissimum L. pěstovaného v
České republice. Pěstování a šlechtění přadného lnu bylo v České republice prakticky ukončeno a
veškerá pozornost se v současnosti zaměřuje na šlechtění a pěstování olejného lnu. Pro zvýšení
užitkovosti olejného lnu jsou v příspěvku prezentovány a diskutovány různé směry šlechtění s cílem
diferenciace konečného produktu pro vybranou cílovou skupinu uživatelů.
Klíčová slova: Len setý olejný, šlechtění, mastné kyseliny, lignany, kyanogenní glykosidy
Abstract
The contribution responds to the changes of the type of use in Linum usitatissimum L resulting to
linseed growing in the Czech Republic. Growing and breeding of flax practically stopped in the Czech
Republic and all attention is now focused on linseed breeding and growing. In order to increase
utilization of linseed various directions of linseed breeding are presented and discussed with the aim to
differ final product according to the requests for target group of final users.
Key words: Linum usitatissimum L., linseed, breeding, fatty acids, lignans, cyanogenic glycosides
Úvod
Až do nedávna se len setý Linum usitatissimum L. v České republice pěstoval jako dva
hospodářské typy, přadný len pro produkci vlákna pro textilní průmysl i netextilní aplikace a
olejný len pro produkci semene, v minulosti užívaný zejména v průmyslu barev. Semena
obsahují přibližně 35-45 % oleje bohatého na nenasycené mastné kyseliny. Standardní složení
mastných kyselin u komerčních přadných i olejných odrůd je cca 6 % kyseliny palmitové
(C16:0), 2 % kyseliny stearové (C18:0), 16-20 % kyseliny olejové (C18:1), 13-18 % kyseliny
linolové (C18:2) a 52-60 % kyseliny α linoleové. Hlavními šlechtitelskými cíli u olejného lnu
v České republice jsou: vysoký výnos oleje (výnos semene x obsah oleje v semeni), rezistence
proti nejzávažnějším houbovým patogenům (Fusarium oxysporum f. sp. lini, Alternaria
linicola, Colletotrichum lini, Rhizoctonia linicola, Oidium lini), odolnost proti poléhání a
obsah a složení mastných kyselin. Nově byly formulovány další šlechtitelské cíle zvyšující
užitkovost olejného lnu, vyšší obsah lignanů, zejména secoisolariciresinolu (SECO) jako
antioxidantu a nižší obsah kyanogenních glykosidů.
Materiál a metody
Záměrnou šlechtitelskou prací při využití mutageneze jsou vytvářeny genotypy s alternativní
skladbou mastných kyselin, vysoko linolenové (HLN), nízko linolenové (LLN) a se středním
obsahem kyseliny olejové (IOL)
hnědosemenné a žlutosemenné HLN typy (55-65 % C18:3),




hnědosemenné a žlutosemenné LLN typy (méně než 3 % C18:3),
hnědosemenné a žlutosemenné IOL a LLN typy (25-40 % C18:1, méně než 10 %
C18:3),
hnědosemenné a žlutosemenné HLN a LLN typy se zvýšeným obsahem SECO
31
„Úroda 12/2012, vědecká příloha časopisu“

hnědosemenné a žlutosemenné HLN a LLN typy se sníženým obsahem kyanogenních
glykosidů
Pro změnu skladby mastných kyselin byla použita indukovaná mutageneze
etylmetansulfonátem (EMS) za účelem snížení obsahu kyseliny linolenové a zvýšení obsahu
kyseliny olejové (TEJKLOVÁ, 1995). Nízkolinolenové typy byly detekovány testem
kyselinou thiobarbiturovou (BHATTY, ROWLAND, 1990), která s dvojnými vazbami
nenasycených mastných kyselin vytváří barevný komplex, přičemž intenzita zabarvení závisí
na počtu dvojných vazeb. Nejintenzivnější zbarvení je při běžném obsahu kyseliny
linolenové, zatímco při sníženém obsahu nebo velmi nízkém obsahu pod 3 % je zabarvení
velmi slabé, respektive žádné. Výsledky u detekovaných nízkolinolenových typů byly dále
prověřovány plynovou chromatografií.
Výsledky a diskuse
Mastné kyseliny
Cílená mutageneze pro změnu skladby mastných kyselin u lnu byla obecně použita
v australsko-kanadském šlechtitelském programu (MICKE et al., 1985, GREEN, 1986 a,b,
DRIBNENKI, GREEN, 1995). Ve společnosti AGRITEC s.r.o. Šumperk byla tato metoda
využívána od roku 1995 (TEJKLOVÁ, 1995). Byli detekováni mutanti s redukovanou
aktivitou desaturázy FAD2 a FAD3 pro denaturaci kyseliny olejové na linolovou a linolové na
linolenovou. Na základě toho byly nalezeny genotypy s různými hladinami C18:1, C18:2,
C18:3. Vzájemným křížením genotypů se sníženým obsahem kyseliny linolenové C18:3 byly
získány nesegregující nízkolinolenové genotypy s obsahem C18:3 nižším než 3 % a cca 70 %
obsahem C18:2. Při křížení LLN genotypů se standardními odrůdami Linum usitatissimum L.
s běžným poměrem mastných kyselin byly získány genotypy se středním obsahem 30-40 %
kyseliny linolové C18:2 i linolenové C18:3. Genotypy se zvýšeným obsahem kyseliny olejové
C18:1 byly získány buď indukovanou mutagenezí nebo jako spontánní mutanti vyskytující se
v kolekci genetických zdrojů společnosti AGRITEC s.r.o. Šumperk. Cílenou selekcí byli
získáni mutanti s obsahem C18:3 1-2 % a obsahem C18:1 do 35 %. Byly objeveny genotypy
dosahující obsahu kyseliny olejové C18:1 až 46 %, ovšem obsah kyseliny linolenové C18:3
dosáhl cca 33 %. Všechny tyto šlechtitelské aktivity byly pozitivně ovlivněny redukcí ploch
přadného lnu vyúsťující až do úplného ukončení pěstování přadného lnu v ČR v roce 2010,
což se promítlo i do změny odrůdové skladby olejného lnu. Po holandských odrůdách
Flanders s tradiční skladbou matných kyselin a nízkolinolenové odrůdě Lola (Limagrain
Advanta) byly do sortimentu zařazeny další nízkolinolenové, žlutosemenné odrůdy olejného
lnu Jantar (2006, Sempra Praha a.s., šlechtitelská stanice Slapy u Tábora) a Amon (2007,
AGRITEC s.r.o. Šumperk), (PAVELEK, TEJKLOVÁ, 2007). V roce 2010 získal právní
ochranu žlutosemenný materiál olejného lnu pod označením AGT 997/05 (Allan) a jako
perspektivní se jeví další nízkolinolenové šlechtitelské linie AGT 997/05 a AGT 987/02
prezentované v tabulce 1.
32
„Úroda 12/2012, vědecká příloha časopisu“
Tabulka 1. Charakteristika odrůd olejného lnu registrovaných v ČR a nových, perspektivních
linií ve zkouškách pro registraci 2009
Genotyp
Lola
Flanders
Amon
Jantar
AGT
997/05
VS
2,64
2,53
2,48
2,32
2,47
OO
43,2
45,9
45,0
44,3
42,8
VO
999,8
1016,8
971,6
901,4
931,4
C16:0
6,46
4,71
6,20
5,88
5,80
C18:0
2,63
3,66
3,66
3,94
3,79
C18:1
14,20
17,62
15,51
16,63
16,71
C18:2
71,54
15,29
71,26
70,23
40,09
C18:3
3,69
56,73
1,86
1,82
32,08
VD
131
129
132
133
131
AGT
2,49
44,4
958,6
6,21
3,59
17,58
69,22
1,97
129
981/05
AGT
2,45
41,5
868,8
6,16
3,84
18,21
64,43
5,87
130
987/02
LSD
0,32
3,00
132,0
0,10
0,19
1,05
1,39
1,23
2
0,05
Vysvětlivky: VS-výnos semene (t.ha-1), OO-obsah oleje (%), VO-výnos oleje (kg.ha-1), C16:0–kyselina
palmitová (%), C18:0-kyselina stearová (%), C18:1-kyselina olejová (%), C18:2-kyselina linolová (%), C18:3kyselina linoleová (%), VD-délka vegetační doby (dny od setí do zralosti)
Kyselina linolenová je žádoucí z potravinářského hlediska a i když je nestabilní a redukuje
trvanlivost oleje, je žádoucí pro produkci jedlého oleje.
Lignany – fytoestrogeny
Novým šlechtitelským cílem je zvýšení obsahu fytoestrogenů a snížení obsahu kyanogenních
glykosidů. Nejznámějším fytoestrogenem je sesoisolariciresinol (SECO), jehož
enzymatickým rozkladem vznikají lignany, které mají pozitivní antioxidační účinky v lidském
organismu (TOURÉ, XU, 2010). Nová šlechtitelská linie AGT 997/05 ukázala zvýšený obsah
SECO ve srovnání se standardní odrůdou Amon (graf 1).
Kyanogenní glykosidy
Vysoký obsah kyanogenních glykosidů (KG - linustatin, neolinustatin and linamarin) je
nežádoucí z důvodu jejich metabolické degradace na kyanovodík (HCN), který je pro
organismy toxický. Proto jsou odrůdy olejného lnu s nižším obsahem kyanogenních glykosidů
mnohem vhodnější pro použití v potravinářském průmyslu ve srovnání s tradičními odrůdami.
V grafu 2 je uveden obsah KG jako suma všech tří výše zmíněných KG u registrovaných
odrůd a šlechtitelských linií olejného lnu. Obě novošlechtění AGT 987/02 a AGT 997/05
prokázala nižší obsahy KG ve srovnání se standardními odrůdami.
Graf 1. Obsah SECO u registrovaných odrůd a novošlechtění olejného lnu
33
„Úroda 12/2012, vědecká příloha časopisu“
Graf 2. Obsah KG u registrovaných odrůd a novošlechtění olejného lnu
Kyselina olejová
Za účelem detekce genotypů se zvýšeným obsahem kyseliny olejové (C18:1) byl od roku
2007 prováděn průzkum kolekce genetických zdrojů olejného lnu. Výsledky prokázaly
vysokou variabilitu v obsahu C18:1 (tab. 3) a byly detekovány genotypy se zvýšeným
obsahem kyseliny olejové C18:1 (tab. 2,3). V rámci 19 detekovaných genotypů uvedených
v tab. 2, 3 obsah kyseliny olejové C18:1 kolísal v rozmezí 21,5 – 30 %.
Nově vyvinutá linie olejného lnu pod označením AGT 997/05 prokázala ve zkouškách
zvýšený obsah SECO, snížený obsah KG a současně jedinečnou skladbu mastných kyselin,
zejména střední obsah kyseliny linolové i linolenové. V roce 2011 byla registrována jako
nová odrůda s obchodním názvem Raciol (TEJKLOVÁ, BJELKOVÁ, PAVELEK, 2011)
Tabulka 2. Složení mastných kyselin u 15 genotypů vybraných z kolekce genetických zdrojů
lnu na vyšší obsah kyseliny olejové C18:1 – pokusná lokalita Šumperk
ECN
2-583
2—538
2-580
2-399
2-535
2-438
2-568
2-470
2-595
2-437
2-567
2-617
2-449
2-424
2-380
Název
Sziciliai
olajlen
I-9
Madéfalvai
kékvirágu
CI 1235
Vajžgantas
Rabat 019620
Omega
La Prevision
V-1-530
Rabat 01-1
Masličnyj
O/228
Rabat 03-2
CI 1235
LCSD-210
C16:0
6,5
Obsah mastných kyselin (%)
C18:0
C18:1
3,9
21,5
C18:2
16,8
C18:3
51,3
5,8
5,4
3,0
2,6
21,6
21,6
15,1
14,8
54,6
55,6
6,1
4,8
6,0
3,9
2,8
4,1
21,7
21,7
21,8
12,3
20,9
15,7
56,0
49,7
52,5
6,1
6,2
6,2
57
5,6
5,6
6,2
5,9
4,7
3,1
4,2
3,8
3,6
2,6
3,1
3,8
4,3
2,2
21,9
22,1
22,1
22,2
22,3
23,0
23,6
24,0
25,7
15,3
14,8
15,5
14,5
14,6
16,3
16,1
12,7
14,7
53,5
52,7
52,4
53,9
54,9
52,1
50,2
53,1
52,8
34
„Úroda 12/2012, vědecká příloha časopisu“
Tabulka 3. Složení mastných kyselin u 14 genotypů vybraných z kolekce genetických zdrojů
lnu na vyšší obsah kyseliny olejové C18:1 – pokusná lokalita Vikýřovice
ECN
2-601
2-610
2-919
2-605
2-540
2-617
2-399
2-670
2-657
2-616
2-676
2-471
2-474
2-470
Název
Maď. olejný
Minuano
Liflora
Attana
ZZOB
Udzan
O/228
CI 1235
P-255
Barradas
Benafin
O/226
VNIIL 6
Royal
Liral Crown
La Prevision
C16:0
5,5
6,0
4,7
5,4
Obsah mastných kyselin (%)
C18:0
C18:1
2,7
26,3
4,6
26,3
3,5
26,2
2,8
26,4
C18:2
12,6
13,4
13,9
16,2
C18:3
52,8
49,6
51,6
49,3
6,3
5,9
6,7
5,4
6,7
4,1
3,2
5,6
3,0
4,6
26,6
26,6
27,0
27,1
27,4
15,7
15,8
12,4
14,0
13,3
47,3
48,5
48,4
50,5
48,0
5,3
5,4
6,8
6,6
6,3
2,9
4,7
4,8
5,0
5,5
27,7
28,3
28,9
28,9
30,0
15,0
16,5
14,4
14,0
13,9
49,1
45,1
45,0
45,6
44,3
Závěr
Nedávno registrované české, žlutosemenné, nízkolinolenové odrůdy olejného lnu Jantar
(2006) a Amon (2007) jsou srovnatelné s hnědosemennou, nízkolinolenovou, holandskou
standardní odrůdou Lola. Všechny tyto odrůdy jsou primárně určeny k použití
v potravinářském a především pekárenském průmyslu k posypu do pečiva. Cílenou
šlechtitelskou prací se však podařilo zvýšit další využití olejného lnu vyšlechtěním odrůdy se
zcela jedinečnou, u lnu jako druhu Linum usitatissimum L., dosud neexistující kvalitou a to se
středním obsahem kyseliny linolové C18:2 (cca 40 %) a α linolenové C18:3 (cca 30 %).
Takovéto složení mastných kyselin opravňuje využití této nové linie zkoušené v pokusech pro
registraci v letech 2008 – 2010 pod označením AGT 997/05 a registrované v roce 2011 jako
nová odrůda olejného lnu s názvem Raciol především pro výrobu jedlého, stolního oleje.
Jedná se o odrůdu s níže uvedenými vlastnostmi:
RACIOL
 středně raná, modrokvětá, žlutosemenná odrůda
• rostliny nízké až středně vysoké, odolné k poléhání
 výnos semene a tuku vysoký
 obsah tuku středně vysoký
 obsah kyseliny linolové cca 40 %
 obsah kyseliny alfa-linolenové cca 30 %
 jodové číslo středně vysoké
 velmi nízký obsah antinutričních látek – kyanogenních glykosidů
 vyšší odolnost k chorobám kořenů a báze stonku
 odrůda k produkci semene na výrobu stolního oleje, pro využití v racionální výživě, v
pekárenském průmyslu na posyp pečiva, k přimíchávání do těst
Dedikace
Tento výzkum byl finančně podpořen granty MŠMT č. 2678424601 a 2B06087.
35
„Úroda 12/2012, vědecká příloha časopisu“
Použitá literatura
Bhatty Rs, Rowland Gg, 1990: Measurement of α-linolenic acid in the development of edible
oil flax. J. Am. Oil Chem. Soc. 67, 364-367.
Dribnenki, J. C. P., Green, A. G, 1995: Linola ((TM)) "497" low linolenic acid flax. Can. J.
Plant Sci., 75, 201-202.
Green, A. G, 1986 a: A mutant genotype of flax (Linum usitatissimum L.) containing very low
levels of linolenic acid in its seed oil. Can. J. Plant Sci. 66: 499-503.
Green, A. G, 1986 b: Genetic modification of seed fatty acid composition in Linum
usitatissimum L. Journal of Australian Institute of Agricultural Science 52 (3), 175-176.
Micke, A., Maluszynski, M., DoninI, B, 1985: Plant cultivars derived from mutation
induction or the use of induced mutants in cross breeding. FAO Mutation Breeding Review
3
Pavelek M., Tejklová E, 2007: New varieties, Linum usitatissimum L., linseed Amon, Nové
odrůdy, len setý, olejný Amon. Czech J. Genet. Plant Breed., 43, (4), 149–155.
Tejklová E, 1995: Induced mutagenesis in flax (Linum usitatissimum L.). In: Breeding for
fibre and oil quality, Proc. 3rd Meeting of the International Flax Breeding Research Group,
7-8 Nov., St. Valéry en Caux, France, 42-50.
Tejklová E., Bjelková M., Pavelek M, 2011: New varieties, Medium - linolenic linseed
(Linum usitatissimum L.) Raciol, Nové odrůdy, střednělinolenový olejný len Raciol. Czech
J. Genet. Plant Breed., 47, (3), 128 – 130.
Touré A, XU XM, 2010: Flaxseed lignans: source, biosynthesis, metabolism, antioxidant
activity, bio-active components, and health benefits. Compr. Rev. Food Sci. Food Saf. 9,
261-269.
Kontaktní adresa:
Ing. Martin Pavelek, CSc.
AGRITEC Plant Research s.r.o.
Zemědělská 16
787 01 Šumperk, Česká republika
36
„Úroda 12/2012, vědecká příloha časopisu“
STUDIUM ODOLNOSTI VYBRANÝCH GENOTYPŮ TUŘÍNU VŮČI
NÁDOROVITOSTI BRUKVOVITÝCH
Study of resistance of selected rutabaga genotypes to clubroot
Kopecký P., Cenklová V., Dušek K.
Výzkumný ústav rostlinné výroby, v.v.i., Olomouc
Abstrakt
Nádorovitost brukvovitých (Plasmodiophora brassicae Wor.; PB) je celosvětově rozšířená choroba
napadající rostliny čeledi Brassicaceae. Odolnost 12 vybraných položek tuřínu (Brassica napus var.
napobrassica (L.) Rchb.) vůči PB byla testována za kontrolovaných podmínek. Odrůdy Debra a
Marian se ukázaly jako nejodolnější vůči PB, naopak odrůdy Perfection a Croppa byly nejcitlivější.
Indexy napadení v průběhu jednotlivých opakování experimentů většinou vzájemně korelovaly.
Hodnoty výrazně kolísaly jen u tří odrůd, což mohlo být způsobeno heterogenitou použitých izolátů
PB odvozených z náhodně odebraných vzorků z infekčního pole. Další možnou příčinou variability
indexů napadení může být předpokládaná genetická heterogenita rostlinného materiálu v rámci
sledovaných odrůd tuřínu. Získané výsledky budou ověřeny v podmínkách infekčního pole.
Klíčová slova: Plasmodiophora brassicae Wor., Brassica napus var. napobrassica (L.) Rchb.,
odrůdy, index napadení
Abstract
Clubroot (Plasmodiophora brassicae Wor.; PB) is a worldwide distributed disease that affects plants
from the family Brassicaceae. Resistance of 12 chosen accessions of rutabaga (Brassica napus var.
napobrassica (L.) Rchb.) to PB was tested under controlled conditions. Varieties Debra and Marian
were demonstrated as the most resistant to PB, conversely varieties Perfection and Croppa were the
most susceptible. During separate sets of experiments recorded disease indexes were correlated, only
in three cultivars fluctuated markedly probably due to heterogeneity of the used PB isolates randomly
collected from the infested field. The next possible explanation for variation of recorded disease
indexes may be a genetic heterogeneity of plant material in the range of observed rutabaga varieties.
The obtained results will be verified under field conditions.
Key words: Plasmodiophora brassicae Wor., Brassica napus var. napobrassica (L.) Rchb., varieties,
disease index
Úvod
Nádorovka kapustová (Plasmodiophora brassicae (Wor.) - (dále PB) představuje biotrofního
vnitrobuněčného parazita většiny druhů a rodů rostlin z čeledi Brassicaceae. PB způsobuje
závažné onemocnění u hospodářsky významných i planých druhů nazývané nádorovitost
brukvovitých. PB je řazena do třídy Phytomyxea (plasmodiofory) podříše Rhizaria ze skupiny
Protista (Neuhauser et al. 2010; Hwang et al. 2012). Ve formě spor běžně přežívá v půdě až
desítky let a za vhodných podmínek napadá kořeny rostlin. Způsobuje jejich zbytnění, tvorbu
kořenových nádorů, postupný rozpad pletiv a tím omezené zásobení nadzemních částí rostlin
živinami a vodou (Hwang et al. 2012). V konečném důsledku dochází ke snižování výnosu
napadených rostlin a může docházet až k celkovému zničení porostů. Optimální podmínky
pro rozvoj choroby jsou 20 až 25 °C, pH 5,0 až 6,0 (Kasinathan 2012) a půdní vlhkost 70 až
90 % (Rod 2006), choroba se nevyskytuje jen na silně alkalických a vápenitých půdách
(Dixon 2009). Tím je předurčeno i její celosvětové rozšíření především do oblastí mírného
pásma Evropy, Asie, Ameriky a Austrálie, kde jsou zaznamenávány největší negativní dopady
na produkci zemědělsky významných brukvovitých plodin (Manzanares-Dauleux 2001,
Hatakeyama et al. 2004, Dobson et al. 1983, Strelkov et al. 2011, Donald et al. 2006).
37
„Úroda 12/2012, vědecká příloha časopisu“
B. napus je amfidiploid druhů B. oleracea a B. rapa, má nízkou vnitrodruhovou genetickou
variabilitu, která je pro jednotlivé taxony postupně rozšiřována o geny pocházející
z původních druhů (Diederichsen et al. 2009). Rezistence B. napus k PB je dána převážně
rasově specificky. Rezistence je kontrolována jednotlivými nezávislými dominantními geny a
částečně kvantitativně pomocí minoritních QTLs (lokusů kvantitativních znaků)
s epistatickým efektem (Werner et al. 2008).
Obtížnost kontroly rezistence brukvovitých vůči PB je dána také vysokou variabilitou
patogenity jednotlivých ras PB, jejich diverzitou a celosvětově jejich dosud málo objasněnou
distribucí (Manzanares-Dauleux et al. 2001). Rozšíření virulentních pathotypů PB bylo
obecně velmi nízké, okolo 3,5-10 % pozemků používaných k pěstování brukvovitých plodin
(Crete 1981), místy dosahovalo zamoření pozemků max. 20 % (Landry et al. 1992), jen
v Austrálii až 70 % (Donald et al. 2006). S rozšiřováním pěstování řepky olejky (B. napus
ssp. oleifera (DC.) Metzg. var. annum) dochází i přes doporučované střídání plodin ke stále
většímu zamořování pěstebních oblastí. Jako ochrana plodin na zamořených pozemcích může
sloužit nákladné chemické ošetření půd aplikací fungicidů, zavápnění (Howard et al. 2010;
Strelkov et al. 2011) či pěstování vychytávacích předplodin jako ředkev olejná (Raphanus
sativus var. oleifera), oves setý (Avena sativa L.) nebo jílek vytrvalý (Lolium perenne L.),
které stimulují vyklíčení trvalých spor PB bez jejich dalšího vývoje a jsou tak schopny
snižovat koncentraci spor PB v půdě (Chytilová and Dušek 2007). Přesto stále zůstává
nejefektivnějším způsobem kontroly pozemků zamořených PB a omezujícím ekonomické
ztráty při produkci brukvovitých plodin, pěstování rezistentních kultivarů (Diederichsen et al.
2009). Proto i pro pěstování tuřínu (Brassica napus var. napobrassica (L.) Rchb., vzrůstá
význam rezistentních odrůd, jejich výběr a šlechtění.
Cílem práce bylo otestovat odolnost 12 vybraných položek tuřínu za kontrolovaných
podmínek kultivační komory a následně doporučit vybrané rezistentní genotypy pěstitelům a
šlechtitelům k dalšímu šlechtění a využití.
Materiál a metody
Analýzy byly prováděny u souboru 12 vybraných genotypů tuřínu (Brassica napus var.
napobrassica (L.) Rchb.) z genofondové kolekce zelenin VÚRV, v.v.i., Centra aplikovaného
výzkumu zelenin a speciálních plodin Olomouc. Pasportní údaje položek jsou uvedeny
v databázi EVIGEZ (http://genbank.vurv.cz/genetic/resources/asp2/default_c.htm). Rostliny
byly pěstovány za standardních podmínek (14 h osvětlení/23 °C, 10 h tma/15 °C) v inertním
semisterilním materiálu (perlitu) a inokulovány závlahou "spodem" do misek roztokem
obsahující 107 spor PB v 1 ml. Inokulum bylo připraveno dle metodiky Chytilová a Dušek
(2007) ze směsného izolátu odvozeného z náhodně odebraných vzorků z infekčního pole.
Následně po 8 týdnech kultivace byla pro jednotlivé genotypy stanovena intenzita napadení
rostlin podle stupnice Buczacki et al. (1975) v rozsahu 0-3 a byl proveden výpočet indexu
napadení (DI) podle Chytilová a Dušek (2007). Jednotlivé genotypy byly testovány ve třech
nezávislých opakováních vyhodnocených: 1. (19.4.2011), 2. (1.7.2011), 3. (17.10.2011).
Celkem bylo hodnoceno 1285 rostlin, průměrně 33 rostlin na variantu a jedno opakování.
Jako kontrola byla použita univerzální citlivá odrůda pekingského zelí (Brassica rapa var.
pekinensis Hanelt) cv. Granaat (09H2700165).
Výsledky a diskuse
Předběžné výsledky studia odolnosti vybraných položek tuřínu vůči nádorovitosti
brukvovitých vykazovaly široké spektrum odolnosti od velmi rezistentních genotypů po
genotypy extrémně citlivé. Při srovnání průměrů procent napadení rostlin z jednotlivých
genotypů a indexů napadení (DI = disease indexes), se jako nejodolnější vůči PB a téměř bez
příznaků choroby ukázaly odrůdy Debra - evidenční č.: 09H2800006, pocházející z roku 1996
38
„Úroda 12/2012, vědecká příloha časopisu“
z USA a obě položky odrůdy Marian pocházející z různých zdrojů - 09H2800010 - z Anglie
od šlechtitele Hurst z r. 1981; 09H2800009 - od šlechtitele Charles Sharpe z r. 1985,
Unknown cultivar - 09H2800007, pocházející z roku 1996 z USA a Landrace (Terchová) 09H2800002, pocházející ze sběrové expedice Orava 1995 ze Slovenské republiky. Většina
těchto genotypů měla 100 % rostlin se stupněm napadení 0-1, pouze genotyp Landrace
(Terchová) měl jen 99 % rostlin se stupněm napadení 0-1. Průměrný index napadení rostlin
(DI) pro všechna tři opakování u jmenovaných genotypů byl 1 nebo nižší, jen Landrace
(Terchová) měl index napadení 4 (Tab. 1, Obr. 1, 2), což ve všech případech indikuje vysokou
odolnost vůči PB. Indexy napadení v průběhu jednotlivých opakování experimentů byly
většinou velmi podobné a vzájemně korelovaly.
Tab. 1: Srovnání odolnosti odrůd tuřínu k nádorovitosti brukvovitých (PB) podle
% stupně napadení a indexu napadení (DI) celkově a u jednotlivých nezávislých
opakování experimentu
evidenční
číslo
genotypu
09H2700165
09H2800001
09H2800002
09H2800003
09H2800004
09H2800005
09H2800006
09H2800007
09H2800008
09H2800009
09H2800010
09H2800011
09H2800012
název
genotypu
Granaat
Milevský
Landrace
(Terchová)
Perfection
Croppa
Apin
Debra
Unknown
cultivar
Laurentian
Marian
Marian
Hugry
Gap
Dalibor
celkové %
rostlin ve
stupni
napadení
1. a 2.
opakování
% rostlin ve
stupni
napadení
3. opakování
% rostlin ve
stupni
napadení
průměrný index
napadení celkem
index napadení
(DI)
DI
v průběhu
opakování číslo
0-1
2
92
2
35
2
3
63
6
0-1
0
98
2
23
2
3
77
0
0-1
6
84
2
54
2
3
40
14
87
8
1.
94
1
2.
91
4
3.
78
16
99
0
1
98
0
2
97
0
3
4
9
2
2
5
17
87
100
28
35
6
0
67
48
7
0
8
17
91
100
36
43
5
0
56
40
4
0
2
16
80
100
19
19
7
0
79
65
13
0
86
72
11
0
93
73
1
1
66
65
12
0
93
77
18
0
100
0
0
100
0
0
100
0
0
1
3
0
0
58
100
100
9
0
0
33
0
0
99
100
100
0
0
0
1
0
0
4
100
21
0
75
0
40
1
1
4
2
4
0
0
0
90
0
39
27
34
76
22
2
4
31
65
53
10
29
87
71
7
22
98
1
1
31
16
53
30
5
7
65
Jako pozitivní kontrola sloužila citlivá odrůda pekingského zelí (Granaat) - 09H2700165.
Hodnoty v průběhu 1. a 2. opakování experimentu indikovaly vysokou odolnost (zeleně),
zatímco v průběhu 3. Opakování vysokou citlivost (žlutě) u odrůd Laurentian, Hugry Gap a
Dalibor. Celkové hodnoty (modře).
Vysokou rezistenci vykazovaly rovněž genotyp Milevský - 09H2800001, registrovaná odrůda
v letech 1959-1998, zařazená do kolekce v roce 1980 od šlechtitele SEMPRA, Turnov, a
genotyp Apin - 09H2800005, pocházející z roku 1996 z USA, které měly 92 % a 87 % rostlin
vykazujících stupeň napadení 0-1 (Tab. 1, Obr. 1), 2 % a 6 % rostlin bylo hodnoceno také
stupněm napadení 2 a oba genotypy měli 6 % a 7 % rostlin hodnocených stupněm napadení 3
(Tab. 1). Všechny tyto citlivé rostliny se překvapivě objevily v rámci jednoho opakování
experimentu, kdy index napadení dosahoval 16 a 18. Průměrný index napadení pro odrůdu
Milevský byl 8 a pro odrůdu Apin 11 (Tab. 1, Obr. 2). Podobně překvapivý rozdíl v rámci
daného experimentu vykazovaly i odrůdy Dalibor - 09H2800012 - původem z České
republiky z roku 2006, HugryGap - 09H2800011 pocházející z roku 1985 od šlechtitele
39
„Úroda 12/2012, vědecká příloha časopisu“
Charles Sharpe, pravděpodobně z Anglie a Laurentian - 09H2800008 - pocházející z roku
1996 z USA. Všechny tři odrůdy se jevili ve dvou nezávislých opakováních jako odrůdy
vysoce rezistentní s převahou rostlin hodnocených stupněm napadení 0-1 (průměrně 98 %,
76 %, 99 %), stupeň napadení 2 byl průměrně u 1 %, 22 %, 0 % rostlin a stupeň napadení 3
byl u 1 %, 2 % a 1 % rostlin, index napadení u těchto genotypů byl 30, 53 a 40 (Tab. 1).
Naopak jedno opakování vykazovalo pouze 31 %, 4 % a 4 % rostlin hodnocených stupněm
napadení 0-1, 16 %, 31 % a 21 % rostlin se stupněm napadení 2 a 53 %, 65 % a 75 % rostlin
se stupněm napadení 3 (Tab. 1). Tento experiment rovněž vykazoval velmi vysoké hodnoty
indexu napadení, 65, 87, a 90, což odpovídá velmi vysoké citlivosti rostlin k PB. Průměrné
hodnoty ze všech tří opakování klasifikují odrůdu Dalibor jako částečně rezistentní
s průměrně 71 % rostlin hodnocených stupněm napadení 0-1 (Tab. 1, Obr. 1) a s indexem
napadení 30 (Tab. 1, Obr. 2) a odrůdy Hugry Gap a Laurentian s průměrně 39 % a 58 %
rostlin hodnocených stupněm napadení 0-1 a indexem napadení 53 a 40 (Tab. 1, Obr. 1, 2)
jako méně odolné, ale stále rezistentní genotypy. Tato vysoká variabilita v rámci různých
nezávislých experimentů mohla být způsobena heterogenitou použitých izolátů PB
odvozených z náhodně odebraných vzorků z infekčního pole, které pravděpodobně mohly
obsahovat směs různě agresivních a dosud neurčených ras patogena. Částečně mohla ke
zvýšení této variability přispět i předpokládaná genetická heterogenita rostlinného materiálu a
subjektivní pohled experimentátora v průběhu hodnocení rostlinného materiálu.
Obr. 1: Porovnání odolnosti genotypů tuřínu vůči nádorovitosti brukvovitých (PB)
podle procenta rostlin hodnocených stupněm napadení 0-1.
Jako nejcitlivější k napadení PB byly prokázány dvě odrůdy pocházející z roku 1996 z USA,
Croppa - 09H2800004 a Perfection - 09H2800003, které měly pouze 17 % a 5 % rostlin
hodnocených stupněm napadení 0-1 (Tab. 1, Obr. 1), zatímco 35 % a 28 % rostlin bylo
hodnoceno stupněm napadení 2 a 48 % a 67 % rostlin vykazovalo stupeň napadení 3 (Tab. 1).
Současně index napadení v jednotlivých nezávislých opakováních ve všech případech
většinou přesahoval 65, pro genotyp Croppa to bylo 73, 65 a 77 s průměrnou hodnotou 72
(Tab. 1, Obr. 2) a pro genotyp Perfection to představovalo hodnoty 93, 66, 93 z čehož dvě
hodnoty indexu napadení dokonce přesáhly 80, což představuje extrémní citlivost k napadení
PB. Průměrná hodnota indexu napadení byla pro genotyp Perfection 86, což je velmi blízké
výsledkům získaným pro kontrolní vysoce citlivou odrůdu pekingského zelí - Granaat
40
„Úroda 12/2012, vědecká příloha časopisu“
(09H2700165), kde průměrný index napadení byl 87 (Tab. 1, Obr. 2) a hodnoty pro jednotlivá
nezávislá opakování experimentu byly 94, 91 a 78. Zde podobně jako pro odrůdu Perfection,
bylo pouze několik rostlin hodnoceno stupněm napadení 0-1 (2%) - (Tab. 1, Obr. 1) a většina
rostlin byla hodnocena stupněm napadení 2 (35 % rostlin) a stupněm napadení 3 (63 %
rostlin) - (Tab. 1).
Obr. 2: Porovnání odolnosti genotypů tuřínu vůči nádorovitosti brukvovitých (PB)
podle průměrného indexu napadení (DI).
Pro šlechtitele má velký význam doporučení vhodných rezistentních odrůd. Aby bylo možné
spolehlivě charakterizovat a dále doporučit konkrétní odrůdu, je třeba naše předběžné
výsledky nejprve ověřit v podmínkách infekčního pole. Přestože kultivační komora umožňuje
stabilnější podmínky pěstování, teplotu, osvětlení a pravidelnou závlahu, je nezbytné pro
jednotlivé genotypy hodnotit výnosy konzumních částí jednotlivých rostlin na infekčním poli
ve srovnání s výnosem na nezamořeném pozemku na základě zjišťování koeficientu tolerance
(Kt). Teprve komplexní analýza chování rostlin jednotlivých genotypů za různých podmínek
kultivace a za různě intenzivního tlaku ze strany patogena může pomoci určit rezistentní
odrůdy vhodné pro další šlechtění a pěstování.
Závěr
Testování vybraných odrůd tuřínu vůči nádorovitosti brukvovitých v kontrolovaných
podmínkách v pěstební komoře VÚRV, v.v.i. v Olomouci vyhodnotilo jako nejodolnější
položky odrůdy Debra a Marian. Vysokou rezistenci vykazovaly rovněž genotypy Unknown
cultivar, Landrace (Terchová), Milevský a Apin. Jako nejcitlivější se ukázaly odrůdy Croppa
a Perfection. Aby bylo možné doporučit nejodolnějších položky k rezistenčnímu šlechtění,
budou výsledky nejprve ověřeny v polních podmínkách, rostliny budou otestovány na
rezistenci k PB na infekčním poli udržovaném na pozemcích VÚRV, v.v.i. v Olomouci.
Dedikace
Výsledky vznikly s podporou výzkumného záměru MZe ČR 0002700604, grantu
ED0007/01/01 Centrum regionu Haná pro biotechnologický a zemědělský výzkum.
41
„Úroda 12/2012, vědecká příloha časopisu“
Použitá literatura
Buczacki S.T., Toxopeus H., Mattusch P., Johnston T.D., Dixon, G.R. Hobolth, G.R.: Study
of physiological specialization in Plasmodiophora brassicae: proposals for attempted
rationalisation through an international approach. Transaction of the British Mycological
Society, 65:295–303, 1975.
Crete R: Worldwide importance of clubroot. Clubroot Newsl 11:6–7, 1981
Diederichsen E., Frauen M., Enrico C., Linders G.A., Hatakeyama K., Hirai M.: Status and
perspectives of clubroot resistance breeding in crucifer crops, J. Plant Growth Regul.,
28:265–281, 2009.
Dixon G.R.: Plasmodiophora brassicae in its Environment, J. Plant Growth Regul., 28: 212228, 2009.
Dobson R.L., Robak J., Gabrielson R.L.: Pathotypes of Plasmodiophora brassicae in
Washington, Oregon and California. Plant Dis., 67/3: 269-271, 1983.
Donald E.C., Cross S.J., Lawrence J.M., Porter I.J.: Pathotypes of Plasmodiophora brassicae,
the cause of clubroot, in Australia. Ann. Appl. Biol. 148:239–244, 2006.
Hatakeyama K., Fujimura M., Ishida M., Suzuki T.: New classification method for
Plasmodiophora brassicae field isolates in Japan based on resistance of F1 cultivars of
chinese cabbage (Brassica rapa) to clubroot. Breed. Sci., 54:197-201, 2004.
Howard R.J., Strelkov S.E., Harding M.W.: Clubroot of cruciferous crops – new perspectives
on an old disease. Can. J. Plant Pathol., 32/1: 43-57, 2010.
Hwang S.F., Strelkov S.E., Feng J.: Plasmodiophora brassicae: a review of an emerging
pathogen of the Canadian canola (B. napus) crop. Mol. Plant Path., 13/2: 105-113, 2012.
Chytilová V., Dušek K.: Metodika testování odolnosti brukvovitých plodin k nádorovitosti.
Metodika pro praxi, Výzkumný ústav rostlinné výroby, v.v.i., pp.19, 2007.
Kasinathan H.: Influence of pH, temperature, and biofungicides on clubroot of canola. MSc.
Thesis, Guelph, Ontario, Canada: pp. 156, 2012.
Landry B.S., Hubert N., Crete R., Chiang M.S., Lincoln S.E., Etoh T.: A genetic map for
Brassica oleracea based on RFLP markers detected with expressed DNA sequences and
mapping of resistance genes to race 2 of Plasmodiophora brassicae (Woronin). Genome
35:409–420, 1992.
Manzanares-Dauleux M.J., Divaret I., Baron F., Thomas G.: Assessment of biological and
molecular variability between and within field isolates of Plasmodiophora brassicae RAPD. Plant Pathol., 50:165-173, 2001.
Neuhauser S., Bulman S., Kirchmair M.: Chapter 3 Plasmodiophorids: The challengeto
understand soil-borne, obligate biotrophs with a multiphasic life cycle. In: Gherbawy Y.,
Voigt K. (Eds.), Molecular Identification of Fungi, pp. 51-79, 2010.
Rod J.: Plasmodiophora brassicae – původce nádorovitosti brukvovitých. In: Lebeda A.,
Mazáková J., Táborský V. (eds): Protozoa a Chromista. Taxonomie, biologie a
hospodářský význam. Č. Fytopatol. Spol., Praha: 92, 2006.
Strelkov S.E., Hwang S.E., Howard R.J., Haartman M., Turkington T.K.: Progress towards
the sustainable management of clubroot (Plasmodiophora brassicae) of canola on the
Canadian prairies. Prairie Soils & Crops Journal, 4:114-121, 2011.
Werner S., Diedrichsen E., Frauen M., Schondelmaier J., Jung C.: Genetic mapping of
clubroot resistance genes in oilseed rape. Theor. Appl. Genet., 116: 363-372, 2008.
Kontaktní adresa:
Bc. Pavel Kopecký
Centrum regionu Haná pro biotechnologický a zemědělský výzkum, Oddělení genetických
zdrojů zelenin, léčivých rostlin a speciálních plodin, Výzkumný ústav rostlinné výroby, v.v.i.,
Šlechtitelů 11, 783 71 Olomouc, e-mail: [email protected]
42
„Úroda 12/2012, vědecká příloha časopisu“
REZISTENCE ŠKODLIVÝCH ORGANISMŮ VŮČI PESTICIDŮM
Resistance of harmful organisms to pesticides
Kolařík P., Rotrekl J.
Zemědělský výzkum, spol. s r.o. Troubsko
Abstrakt
Opakovaným používáním insekticidních přípravků dochází v populaci hmyzích škůdců polních plodin
k vyselektování méně citlivých jedinců proti registrovaným přípravkům. Dle dostupných informací
můžeme potvrdit rezistentní populace u blýskáčka řepkového, mandelinky bramborové či obaleče
jablečného. Ke zmírnění tohoto negativního jevu je nutné dodržovat předem stanovená doporučení v
rámci antirezistentní strategie. Jedná se zejména o aplikaci pesticidů pouze na základě monitoringu
výskytu škůdce a jeho překročení prahu škodlivosti, střídání přípravků s různým typem účinné látky v
jednom roce, ale i mezi roky na větších plochách.
Klíčová slova: rezistence; hmyzí škůdci; insekticidy; ozimá řepka; blýskáček řepkový;
Abstract
Repeated use of insecticides occurs in the population of insect pests of field crops selected by the less
sensitive individuals against the insecticides. According to information available, we can confirm
resistant pollen beetle populations in OSR, potato beetles, and codling moth. To mitigate this negative
effect can be recommended adherence to predetermined recommendations of the strategy
antiresistence, application of pesticides only on the basis of monitoring and crossing the threshold of
harm, as well as alternating products with different active substance, and in one year and between
years on larger surfaces.
Keyword: resistence; insect pests; insecticides; OSR; pollen beetles;
Rezistence (odolnost) je vlastnost všech živých organismů, od jednobuněčných až po savce.
Dle definice Světové zdravotnické organizace (WHO) je to schopnost členovců přežívat
dávky insekticidů, které působí hynutí většiny jedinců normální populace. Existuje též
rezistence na antibiotika, ostatní léky atd., obecně je to schopnost organismu nereagovat na
působení dané látky. Je možné kvantifikovat rezistenci populace z poměru hodnot: LD50 pro
sledovanou rezistentní populaci a LD50 pro kontrolní populaci. Jedná se o množství látky, po
které uhynulo 50 % testovaných živočichů za 24 hodin po expozici. Zkratka je z anglického
Lethal Dose, 50 % (HRUDOVÁ, 2008). Rezistence je dědičná a představuje fyziologické
přizpůsobení populace vlivem selekce. Rezistence vzniká mutací genů, nebo následkem
rekombinací genů pod selekčním tlakem tzn. dlouhodobá aplikace stejného typu účinných
látek (STARÁ a KOCOUREK, 2009). Také může být dědičná. Rychlost vzniku rezistence je
závislá na mnoha faktorech. Při trvalém selekčním tlaku rezistentní populace vzniká již ve 12
generaci. V roce 1980 byla zjištěna rezistence u 428 druhů hmyzu, z čehož necelá polovina
představovala zdravotní rizika. Ze známých druhů nejčastěji vykazují rezistenci moucha
domácí, rus domácí a vši dětské. Obecně ty druhy, které mají krátký generační cyklus a tedy
rychlou reprodukci. (HRUDOVÁ, 2008). Protože nové vlastnosti a obranné mechanismy
nejsou vždy zcela specifické jen pro jednu látku, může se rezistence projevovat i vůči jiným
přípravkům nebo dokonce vůči jiné skupině účinných látek. Tento jev je označován jako
zkřížená rezistence.
Objevem insekticidů DDT (dichlor-difenyl-trichlorethan) a HCH (hexachlorcyclohexan) ve
čtyřicátých letech minulého století se zdálo, že boj s hmyzem je natrvalo vyřešen. Nízká cena,
jednoduchá výroba a levné a jednoduché aplikační metody předpokládaly masové využívání
těchto přípravků v zemědělství. Uplatňovaly se i při používání v boji s komáry přenášející
malárii, ale i dalšími vektory – mouchy tse-tse přenášející spavou nemoc a celou řadou
43
„Úroda 12/2012, vědecká příloha časopisu“
dalších chorob, včetně vší a blech v mírných pásech světa. Tyto přípravky se používaly i přes
vedlejší negativní účinky jejich působení na necílové organismy. I u těchto přípravků se
začaly projevovat příznaky resistence proti jejich účinku v místech opakovaného používání.
Zjistilo se, že všechny tyto insekticidy ovlivňují nejenom hmyz, ale dochází ke kumulaci v
orgánech a jsou tak velmi nebezpečná pro člověka i zvířata (SKUHRAVÝ, 2008). Proto se
začaly vyvíjet insekticidy mající jiné chemické složení (karbamáty, organofosfáty a
pyrethroidy), přípravky mající dlouho či krátkodobou účinnost nebo specifické vůči jednomu
druhu či skupině, avšak tolerantní vůči ostatním druhům a užitečné entomofauně a zároveň
neškodné pro včely.
V souvislosti se ztrátou citlivosti hmyzích škůdců vůči pyretroidům se považují za důležité
především dva mechanismy rezistence. Ztráta citlivosti cílového místa (kdr) a metabolická
rezistence. Ve vývoji metabolické rezistence hrají zásadní roli enzymatické skupiny, pro které
je typický široký rozsah substrátové specifity cytochrom P450 monooxygenázy,
karboxylesterázy a (GST) glutation-S-transferázy (SEIDENGLANZ et al., 2010). Rezistentní
kmeny (populace) vykazují sníženou citlivost neuronů k pyrethroidům, pyretrinům a DDT jde
o tzv. knock-down resistance (kdr). Pokusy prokázaly existenci super-kdr, která má vyšší
úroveň než předchozí. Dalším mechanismem rezistence je snížení permeability (propustnosti)
kutikuly. Insekticid není propouštěn, jelikož v buněčných membránách, kutikule hmyzu a v
tukovém tělese je tzv. P - glykoprotein. Ten tvoří póry ve dvojvrstvě lipidů, ATP jimi
transportuje některé škodliviny (i pesticidy) ven z buněk. Rezistentní populace mají Pglykoproteinu v několikanásobné koncentrace. Mezi další typy rezistencí můžeme zařadit
cross – rezistenci, kdy po selekci jedním přípravkem je rezistentní populace méně citlivá i
k přípravkům, se kterými dosud nepřišla do styku – obvykle se vyskytuje společně u
organofosfátů a pyretroidů. Kombinovaná rezistence znamená, že dva nebo více mechanismů
působí proti jedné účinné látce. Dále můžeme uvést behaviorální rezistenci. To je rezistence
podmíněná chováním. Živočich vyvinul mechanismus umožňující vyhnout se kontaktu s
toxickou látkou (HRUDOVÁ, 2008).
Rezistence vůči insekticidům jako projev je obvykle výsledkem kombinace několika
mechanizmů rezistence a není jednoduché odlišit obzvláště na fenotypové úrovni (při
hodnocení projevu různým dávkám insekticidům) vlivy jednotlivých podílejících se
mechanismů v kvantitativním smyslu (SEIDEGLANZ, POSLUŠNÁ, 2009 b). V souvislosti
s rezistencí hmyzích škůdců vůči pyrethroidům se považují za důležité především dva
mechanismy rezistence – ztráta citlivosti cílového místa a metabolická rezistence (SCOTT,
1991).
Pokud zasažení jedinci přežívají i po přímém kontaktu nebo i přítomnosti pesticidu v jejich
těle, označuje se taková rezistence jako fyziologická. Jednoduchá rezistence se vztahuje
k jedinému mechanismu rezistence, který obvykle chrání organismus před selekční látkou (či
látkami příbuznými) a který je odpovědný za specifické spektrum resistence, přičemž povaha
spektra závisí na mechanismu rezistence a měla by být nezávislá na použitém selekčním
agens. Rezistence podmíněná chováním je změna chování škůdce, kterým se snižuje
pravděpodobnost jejich kontaktu s pesticidem. Kombinovaná rezistence – podílí se dva nebo
více mechanismů na společné ochraně vůči pesticidu. Křížová (cross) nebo také spřažená
rezistence, představuje jev, k němuž dochází pokud vývoj fyziologické rezistence vůči dané
látce má za následek nutnost v rezistentní populaci zvyšovat dávky ve srovnání s dávkami
postačujícími pro úmrtnost populace (LOKAJ, 2007). Jedním z důvodů vývoje rezistence vůči
pyrethroidům může být i nařízení Evropské unie o přípravcích na ochranu rostlin, kde se
počet účinných látek použitelných pro minimalizaci škod způsobených hmyzími škůdci
neustále snižuje.
K využívaným metodám diagnostiky rezistence patří biologické, genetické a metabolické
metody. U kontaktních biologických metod využíváme např. topikální, tarsální, ponořovací
44
„Úroda 12/2012, vědecká příloha časopisu“
test a dále požerový test. Mezi genetické metody řadíme detekci bodových mutací genů
metodou PCR. Detekce enzymů a jejich aktivity jsou využívány u metabolických metod,
jedná se o tzv. proteomickou metodu (STARÁ a KOCOUREK, 2010).
Metoda topikalní aplikace insekticidů se využívá především na housenkách. Pro testy se
používají insekticidy rozpustné ve vodě, dále účinné látky rozpuštěné v acetonu nebo
tetrahydrofuranu, podle rozpustnosti dané látky. Insekticidní jícha se aplikuje dávkovačem
nebo mikropipetou o objemu 1µl. Před aplikací insekticidní jíchy je třeba místo aplikace potřít
štětečkem navlhčeným v acetonu, aby byla umožněna penetrace přípravku přes kutikulu.
Každá koncentrace je testována na 20 – 25 housenkách. Po aplikaci jsou housenky umístěny
do plastových misek s ruličkami vlnité lepenky. Každá miska představuje jednu variantu.
Inkubace se provádí v klimatizovaném boxu při teplotě 25 °C a fotoperiodě 16L:8D.
vyhodnocení mortality se provádí po vylíhnutí motýlů v kontrolní neošetřené variantě
(STARÁ a KOCOUREK, 2007).
Tato metoda je méně vodná pro testování blýskáčků z důvodu velké aktivity imag. Je totiž
důležité tyto insekticidy aplikovat na konkrétní část těla. Vhodná metoda testování blýskáčků
je podle metody č. 11 (dle IRAC) – tzv. lavičkový test. Při této metodě testovaní dospělci
přicházejí do styku s účinnou látkou, která je nanášena na povrh testovacích lahviček ve
předem stanovených koncentracích. Vlastní vyhodnocení je prováděno v předem stanovených
časových intervalech, přičemž vyhodnocení jedinců je prováděno do skupin dle jejich
životních projevů (živí, postižení a mrtví).
Rezistence blýskáčka proti pyrethroidům se stává velkým problémem v západní Evropě,
zejména Francii a Německu (ACKERMANN et al., 2008). Od roku 2009 se začíná
významněji projevovat také v ČR rezistence dospělců blýskáčka proti insekticidům
(SEIDEGLANZ, POSLUŠNÁ, 2009 b). V České republice jsou používány proti blýskáčkům
více jak 20 let pyretroidy typu II. - lambda-cyhalothrin, deltamethrin, alphacypermethrin,
zeta-cypermethrin, cypermethrin, esfenvalerate (ŠKUTOVÁ et al., 2009). Obsahují alfakyano 3-fenoxybenzyl skupinu, reverzibilně blokují sodíkové kanály nervových vláken a
navíc ovlivňují GABA receptory v nervových vláknech. Dále jsou známé pyrethroidy typu I.
– neobsahují alfa-kyano skupinu, např. permethrin. Reverzibilně blokují sodíkové kanály
nervových vláken.
Pyrethroidy jsou syntetické chemické sloučeniny podobné přírodním látkám pyretrinům
produkovaným květinami (http://cs.wikipedia.org, 2010). Pyretrin je extrakt z květů
chryzantémy starčkolisté (Chrysanthemum cinerariaefolium), proti hmyzu byl poprvé použit
kolem roku 1850 (PROKINOVÁ, 2010). Pyrethroidy jsou běžnou složkou komerčních
výrobků, například domácích insekticidů a repelentů. V koncentracích používaných v těchto
produktech jsou obecně pro člověka neškodné. Pyrethroidy jsou axonovými jedy, účinkují
blokací sodíkových kanálů neuronových membrán hmyzu v otevřeném stavu. Sodíkový kanál
je malý otvor, kterým mohou sodíkové ionty vstupovat do axonu a způsobovat excitaci.
Protože se nervy nemohou odexcitovat, je hmyz paralyzován. Pyrethroidy se obvykle
kombinují s piperonylbutoxidem, známým inhibitorem klíčových mikrosomálních
oxidázových enzymů. To zabraňuje těmto enzymům odstraňovat pyrethroidy z těla hmyzu a
zajišťuje, že účinek pyrethroidů bude smrtelný a ne pouze paralytický (http://cs.wikipedia.org,
2010).
Lambda-cyhalothrin je insekticid registrovaný US Environmental Protection Agency (EPA) v
roce 1988. Je podobný pyrethroidu cyhalothrinu (http://npic.orst.edu, 2001). Jedná se o
nesystémový pyrethroid. Usmrcuje hmyz jako dotykový a požerový jed. Působí zejména proti
žravým škůdcům - Lepidoptera, Coleoptera jako kontaktní jed s výraznou účinností. Dále má
velmi dobrou účinnost na savý hmyz - Homoptera.
Výsledkem rezistence hmyzu k insekticidům je snížená účinnost používaných přípravků,
ztráty na produkci a zvýšené náklady na ochranu při opakovaných aplikacích (STARÁ a
45
„Úroda 12/2012, vědecká příloha časopisu“
KOCOUREK, 2009). K prevenci vzniku rezistence patří střídání přípravků s různými
účinnými látkami, omezení četnosti aplikací přípravků. Používání přípravků s nižší
perzistencí v prostředí, monitoring úrovně rezistence a zachování refugií pro citlivé populace
(HRUDOVÁ, 2008).
Příčiny, které způsobují zvýšené riziko vzniku rezistentních populací blýskáčka řepkového
jsou vysoká intenzita chemické ochrany proti hmyzím škůdcům na řepce, omezené spektrum
účinných látek insekticidů aplikovaných do řepky. Dále mezi ně můžeme zařadit zvýšení
ploch osevů ozimou řepkou (vysoký podíl v osevních postupech), koncentrace pěstování
řepky v regionu a teplotně příznivější roky. Dospělci i larvy blýskáčka jsou vystaveni
selekčnímu tlaku insekticidů po celou dobu květu řepky a nejenom jí. Dospělci blýskáčků se
vyskytují i na dalších plodinách (mák, slunečnice, hořčice, jarní řepka, jetele aj.) kde se živí
pylem a kde jsou aplikovány další insekticidní přípravky proti dalším významným škůdcům.
Selekční tlak na vznik rezistentních populací blýskáčka řepkového se tak i v období poklesu
jeho škodlivosti paradoxně zvyšuje (STARÁ a KOCOUREK, 2009).
Co se týče konkrétně případu blýskáčka řepkového (Meligethes aeneus F.) a pyrethroidů,
vyplývá z posledních studií, že hlavní podíl na rezistenci je zde možné přičítat mechanismu
metabolické rezistence a to konkrétně důsledkům zvýšení hladin monooxygenáz u méně
citlivých (či až zcela necitlivých) jedinců. Někteří jedinci se tak díky své lepší enzymatické
výbavě dokáží s insekticidem vypořádat, odbourat ho (SEIDENGLANZ et al., 2010).
V roce 1999 byly k dispozici první zprávy o snížené účinnosti insekticidů – pyrethroidů, při
používání k ochraně proti blýskáčku řepkovému (Meligethes aeneus) v severovýchodní
Francii. V následujících sedmi letech došlo k rychlému šíření rezistentních populací
k pyrethroidům v mnoha oblastech Evropy. Selhání syntetických pyrethroidů v ochraně proti
blýskáčku řepkovému bylo potvrzeno jako specifický rezistentní mechanismus. Monitoring
ukázal, že se rezistentní populace rozšířila v několika evropských zemích, jako je Francie,
Německo a Polsko. Populace z Velké Británie a Rakouska zůstávají především citlivé
k pyrethroidům (SLATER a NAUEN, 2007). Podle výsledků byly populace zařazeny do pěti
skupin citlivosti: vysoce citlivé, citlivé, středně odolné, odolné a vysoce odolné populace
(IRAC, 2008).
V roce 2007 odpovědělo osm evropských zemí, že problémy s rezistencí blýskáčků proti
insekticidům dosud nezaznamenalo. K těmto zemím patřila i Česká republika (dále:
Rakousko, Estonsko, Maďarsko, Irsko, Lucembursko, Slovensko a Slovinsko). V Rakousku
však ještě v roce 2007 výskyt rezistentních blýskáčků potvrdili. Mezi státy, které v anketě
odpověděly, že rezistenci zaznamenaly, patří: Polsko, Francie, Lotyšsko, Dánsko, Švédsko,
Belgie, Švýcarsko, Německo, Nizozemsko, Norsko, Chorvatsko a Velká Británie
(SEIDENGLANZ a POSLUŠNÁ, 2009 b). V současné době již Česká republika patří
k zemím, kde je snížená citlivost blýskáčka řepkového k pyrethroidům potvrzena.
U mandelinky bramborové byla prokázána rezistence k celé řadě typů účinných látek. V roce
1988 byla publikována zpráva o rezistenci k několika látkám (carbofuran, endosulfan a další)
v Kanadě. V USA byla rezistence zaznamenána v roce 1995 a v posledních letech byla
zjištěna také v Evropě. V Rumunsku byla potvrzena rezistence mandelinky bramborové
k alpha-cypermethrinu a v Polsku se objevila rezistence k některým pyrethroidům. V roce
1972 byly získány první data potvrzující rezistenci k organofosfátům a karbamátům. Zároveň
byla potvrzena rezistence mandelinky bramborové i na několika lokalitách v Srbsku
(NAĎOVÁ et al, 2006).
V Československu byla rezistence zaznamenána k lindanu (BHC) a k DDT. Od té doby se
situací k tomuto škůdci v České republice nikdo nezabýval. Dle posledních studií byla
zjištěna snížená citlivost mandelinky k acetamipridu, kdy mortalita testovaných vzorků
46
„Úroda 12/2012, vědecká příloha časopisu“
dosahovala pouze 2 %. Přípravek Nurelle D nebyl v doporučené dávce dostatečně účinný na
většinu testovaných vzorků.
V řadě evropských zemí byla v 90. letech zjištěna rezistence u obaleče jablečného k širokému
spektru přípravků, zahrnujících vedle organofosfátů, pyrethroidů a karbamátů i inhibitory
syntézy chitinu a juvenoidy. V Itálii byla zjištěna rezistence k diflubenzuronu (Dimilin) a
dalším účinným látkám, jako je indoxacarb (Steward) a tebufenozid (Mimic) v roce 1993. V
roce 1996 se rezistence obaleče jablečného k diflubenzuronu vyskytla také ve Švýcarsku a
byla potvrzena rovněž rezistence k tebufenozidu, fenoxycarbu (Insegar), deltamethrinu
(Decis) a phosalonu (Zolone). V roce 1998 byl zjištěn nárůst rezistence obaleče k
diflubenzuronu, deltametrinu a phosalonu také ve Francii. Cross-rezistence byla zaznamenána
i vůči dalším účinným látkám, jako je teflubenzuron (Nomolt), tebufenozid, bifenthrin
(Talstar) a lambda-cyhalothrin (Karate). V České republice nebyla vzhledem k relativně nízké
intenzitě chemické ochrany rezistence k insekticidům tak závažným problémem, jako
například v USA a v zemích západní Evropy. V posledních letech však přibývají v ČR zprávy
o snížené účinnosti některých insekticidů proti obaleči jablečnému, což působí pěstitelům
ztráty.
V současné době je riziko výskytu rezistentních populací obaleče jablečného u nás naštěstí
poněkud sníženo díky registraci nových insekticidů (Integro, Steward) a pomocných
prostředků ochrany rostlin (Isomate C plus). Přesto nás zkušenosti ze zahraničí varují, že
rezistence obaleče může vzniknout i k látkám, u kterých se s podobným rizikem nepočítalo.
Důkazem je vznik rezistence obaleče jablečného v Německu k přípravku na bázi viru
granulózy, který byl dosud považován z hlediska možné rezistence za bezrizikový. Je tedy
třeba s podobnými riziky počítat a včas je eliminovat pomocí řady opatření, kterým říkáme
antirezistentní strategie.
Základem je dodržování pravidel integrované ochrany, tj. aplikace pesticidů pouze na základě
monitoringu výskytu obaleče a překročení prahu škodlivosti, střídání přípravků s různým
typem účinné látky jednom roce, ale i mezi roky na větších plochách. Důležitá je zásada
použití přípravků z jedné skupiny účinných látek maximálně dvakrát za sezónu. Preventivní
metodou pro zabránění nástupu rezistence je metoda dezorientace založená na narušení
sexuální komunikace obaleče plošnou aplikací syntetického feromonu (u nás registrován
Isomate C plus). Tato metoda je z hlediska rizika nástupu rezistence bezpečná, protože dosud
nebyla prokázána rezistence obaleče k feromonu. Další perspektivou jsou přípravky na bázi
viru granulózy obaleče jablečného, jejichž registrace v ČR se v současné době připravuje.
Jelikož již byla prokázána rezistence obaleče jablečného k viru granulózy, je tedy třeba s
těmito preparáty zacházet obdobně jako s chemickými přípravky a dodržovat střídání s jiným
prostředky ochrany. Nepřímo má vliv na zabránění výskytu rezistence také používání
přípravků selektivních pro přirozené nepřátele škůdců. Podpora přirozených regulačních
mechanismů umožňuje snížit potřebu použití chemických prostředků ochrany a v konečném
důsledku tedy vede ke snížení rizika nástupu rezistence.
Dedikace
Výsledek byl získán za institucionální podpory na dlouhodobý koncepční rozvoj výzkumné
organizace.
Literatura
Ackermann, P. et al.: Metodická příručka ochrany rostlin proti chorobám, škůdcům a
plevelům. 1. vyd. Praha: Česká společnost rostlinolékařská, 2008. 503 s. ISBN 978-80-0202087-5.
Hrudová, E.: Epidemiologie a gradologie: Prognóza vzniku rezistence škůdců vůči zoocidům.
Výukové texty pro obor Rostlinolékařství. MZLU Brno, 2008
47
„Úroda 12/2012, vědecká příloha časopisu“
IRAC, Controlling pollen beetle and combating insecticide resistance in oilseed rape.
[online].
2007.
[4.3.2010].
Dostupné
z:
http://www.irac-online.org/wpcontent/uploads/2009/09/Pollen-Beetle-Control-UK-advice-from-HGCA.pdf
IRAC, IRAC Pollen Beetle Working GroupPollen Beetle Resistance Monitoring 2008.
[online].
2009.
[4.3.2010].
Dostupné
z:
http://www.irac-online.org/wpcontent/uploads/2009/09/Pollen-Beetle-Monitoring-Poster-2008-V2.2.pdf
IRAC, IRAC Pollen Beetle Working GroupPollen Beetle Resistance Monitoring 2007.
[online]. 2008. [5.3.2010]. Dostupné z: http://www.irac-online.org
Lokaj, Z. (2007): Taháky z fytofarmacie IV. Rostlinolékař, Praha 32 -33 ISSN 1211-3565
Prokinová, E.: Pesticid je…Úroda, 2010, Vol. LVIII, č. 1, s. 53 – 55. ISSN 0139-6013
Seidenglanz, M., Poslušná, J.: Posuny v citlivosti blýskáčka na insekticidy. Úroda, 2009 a,
Vol. LVII, č. 8, s. 34 – 38. ISSN 0139-6013
Seidenglanz, M., Poslušná, J.: Výskyt reistence blýskáčka řepkového proti insekticidům
v Evropě. Rostlinolékař, 2009 b, č. 1, s. 12 – 15. ISSN 1211-3565
Seidenglanz, M., Šmirous, P., Rotrekl, J., Havel, J., Hrudová, E., Poslušná, J., Kolařík, P.,
Kolaříková, E., Mlýnská, J., Škutová, J.: Jak přeměnit antirezistentní strategii na
antirezistentní postup v případě blýskáčka na řepce. Ochrana rostlin v pojetí nových
předpisů Evropské unie. Soubor referátů přednesených na semináři pořádaném Českou
společností rostlinolékařskou ve dnech 2. a 3. března 2010 v Praze
Slater, R., Nauen, R.: The development and nature of pyrethroid resistance in the pollen
beetle (Meligethes aeneus) in Europe. EPPO Workshop on insekticide resistence of
Meligethes spp. (pollen beetle) on oilseed rape, Berlin. [online]. 2007. [6.2.2010].
Dostupné.z:
http://archives.eppo.org/MEETINGS/2007_meetings/meligethes/Brochure_Meligethes.pdf
Stará, J., Kocourek, F.: Metodika hodnocení rezistence obaleče jablečného k insekticidům a
návrhy antirezistentních strategií, s. 13. ISBN: 978-80-87011-30-0. [online]. 2007.
[12.3.2010].
Stará, J., Kocourek, F. Rizika výskytu rezistentních populací blýskáčka řepkového v ČR.
[online]. 2009. [25.1.2010]. Dostupné z:: http://www.vurv.cz/files/RD09_Stara.pdf
Škutová., J. Kolaříková, E., Mlýnská, J., Hrudová, E., Seidenglanz, M., Poslušná, J.,
Kolařík, P.: Rezistence blýskáčka řepkového k pyrethroidům v okolí Brna.
[online].2009.[20.2.2010].Dostupné.z:
http://web2.mendelu.cz/af_291_mendelnet/mendelnet09agro/files/articles/fyto_skutova.pdf
Kontaktní adresa:
Ing. Pavel Kolařík
Agriculture Research , Ltd. Troubsko
664 41 Troubsko, Zahradní 1
[email protected]
48
„Úroda 12/2012, vědecká příloha časopisu“
ALGINURE – PROSTŘEDEK PRO ZVÝŠENÍ ODOLNOSTI ROSTLIN
K HOUBOVÝM CHOROBÁM A JEHO VYUŽITÍ PROTI PŮVODCI
STRUPOVITOSTI JABLONĚ (VENTURIA INAEQUALIS)
Plant resistence improver Alginure and its use against Venturia inaequalis
Bagar M., Psota V.
BIOCONT LABORATORY, Brno
Abstrakt
Pomocný prostředek pro zvyšování odolnosti rostlin vůči chorobám Alginure byl testován pro využití
proti původci strupovitosti jabloně Venturia inaequalis v ČR jako vhodný doplněk ochrany zejména
v systému ekologického a nízkoreziduálního pěstování. Testována byla solo aplikace
v maloparcelkovém pokuse v roce 2010, kde bylo dosaženo účinnosti 71% při dávce 3 l/ha a 87 % při
dávce 5 l/ha. V letech 2011 a 2012 byl v poloprovozních pokusech testován efekt kombinace
prostředku Alginure s kontaktními fungicidy na účinnost systému ochrany proti strupovitosti. 3-5
aplikací Alginure v dávce 4 l/ha výrazně zvyšuje efekt fungicidní ochrany oproti běžnému
fungicidnímu systému. Výsledky z roku 2012 naznačují možnost snižování dávky.
Klíčová slova: strupovitost, ochrana, ekologické pěstování, jabloně, ovoce
Abstract
Plant resistance improver Alginure was tested for use in apple scab (Venturia inaequalis) control in
Czech Republic as a component of ecological and low residues apple production. Solo application was
tested in small plot trial in 2010. The efficacy was 71% with 3 l/ha and 87% with 5 l/ha respectively.
A combination of Alginure with chemical fungicides for effect on scab was tested in semifield trials in
years 2011 and 2012. 3-5 applications in dosage 4 l/ha significantly improves the effect of the scab
control comparing to the standard fungicide control. The results from 2012 show that reduction of
dosage is possible.
Key words: apple scab, control, ecological, apple, fruit
Úvod
Původce strupovitosti jabloně, houba Venturia inaequalis je nejvýznamnější patogen na
jabloních v podmínkách České republiky. Problémů v ochraně proti tomuto patogenu je
několik. Jednak došlo k prolomení genu rezistence Vf, takže odrůdy nesoucí tento gen se
v současnosti neobejdou bez přímé fungicidní ochrany (Vávra a Boček, 2009). Často také
nastávají situace, kdy i přes intenzivní fungicidní ochranu dochází k významnějšímu
poškození. Příčin může být více. Například to, že nepříznivé počasí znemožní včasné
provedení ochrany. V řadě případů se díky selekci rezistentních ras patogena potvrzuje nižší
účinnost některých fungicidů (Kloutvorová a kol., 2009). Do budoucna může hrát roli i tlak na
snižování obsahu reziduí pesticidů ve sklizeném ovoci.
Výrazné zlepšení účinnosti systémů ochrany proti patogenu Venturia inaequalis mohou
přinést přípravky zvyšující obranyschopnost rostliny (PRI – plant resistence improvers). Tyto
přípravky mají na rozdíl od běžných fungicidů jiný mechanismus účinku. Nepůsobí přímo
proti patogenu. Po jejich aplikaci dochází v rostlině k aktivaci obranných mechanizmů a
tvorbě obranných látek. Takovouto rostlinu pak patogen nenapadá nebo jen velmi těžko.
Přípravky typu PRI je tedy potřeba aplikovat v dostatečném předstihu před vznikem infekce.
V rámci našeho výzkumu jsme sledovali účinnost aplikace přípravku typu PRI – Alginure
proti původci strupovitosti jabloně patogenu Venturia inaequalis v letech 2010 – 2012.
Přípravek Alginure jsme hodnotili ve dvou různých situacích. Jednak jako solo-aplikaci
v rámci maloparcelkového pokusu. Pak jako součást systému integrované ochrany.
49
„Úroda 12/2012, vědecká příloha časopisu“
Materiál a metody
Výzkum probíhal v produkčních výsadbách jabloní v letech 2010 až 2012. Vliv a účinnost
byla ověřována u přípravku Alginure, který obsahuje 24 % extraktu z mořských řas, 7 %
rostlinných aminokyselin a 20 % fosfonátů. Výrobcem je německá firma Tilco Biochemie
GmbH.
V roce 2010 byl na lokalitě Nosislav proveden maloparcelkový pokus u odrůdy Idared ve
sponu 3 × 4,5 m. V rámci tohoto pokusu bylo zkoušeno 5 variant: Alginure 3 l/ha, Alginure 5
l/ha, Sulikol K 6 kg/ha (50% síra), Polisenio 8 l/ha (27% polysulfid vápenatý) a VitiSan 5
kg/ha (hydrogenuhličitan draselný). Každá varianta měla 3 opakování po 4 stromech.
Aplikace byla provedena pomocí motorového zádového rosiče. Celkem bylo provedeno 16
ošetření ve dnech 16., 22. a 27. dubna, 3., 6., 11., 15., 19., 24., 28., a 31. května, 7., 17. a 25.
června a 19. a 29. července. Hodnocení bylo provedeno dne 11. června a 2. srpna. Napadení
bylo hodnoceno na plodech. V rámci každého opakování vždy 100 náhodně vybraných plodů,
kde bylo stanoveno, zda mají příznaky napadení či ne.
V letech 2011 a 2012 byly provedeny 4 poloprovozní pokusy v rámci systému integrované
ochrany. Vybrané lokality byly Určice, Stošíkovice a Bašnice. Na každé lokalitě probíhal
poloprovozní pokus na ploše 3 – 4 ha, přičemž jedna část plochy byla ošetřována sledem
fungicidních přípravků v rámci integrované ochrany. Druhá část plochy byla ošetřována
totožně, avšak do systému byl přidán 3 – 5 × přípravek Alginure (tab 1. a 2.) v dávce 4 l/ha.
V roce 2012 byly ověřovány kombinace poloviční dávky fungicidů s přípravkem Alginure a
naopak snížená dávka přípravku Alginure (3 l/ha) se standardní dávkou fungicidu. Na
jednotlivých lokalitách byly použity tyto fungicidní přípravky: Champion 50 WP (Hydroxid
měďnatý, Agro CS), Novozir MN 80 New (Mankozeb, Dow AgroSciences), Kumulus WG
(síra, BASF SE), Funguran-OH 50 WP (hydroxid měďnatý, Spiess-Urania Chemicals),
Thiram Granulfo (thiram, AGRO CS), Polyram WG (Metiram, BASF SE), Delan 700 WDG
(Dithianon, BASF SE), Mythos 30 SC (Pyrimethanil, BASF SE), Captan 80 WG (Captan,
Arysta LifeSciences), Discus (Kresoxim-methyl, BASF SE), Zato 50 WG (Trifloxystrobin,
Bayer CropSciences), Score 250 EC (Difenokonazol, Syngenta Crop Protection), Syllit 65
WP (Dodin, Agriphar), Tercel (Dithianon, Pyraklostrobin, BASF SE), Dithane DG Neotec
(Mankozeb, Dow AgroSciences), Merpan 80 WG (Kaptan) a Flint (Kaptan, Trifloxystrobin,
AGRO CS), Chorus 50 WG (Cyprodinil, Syngenta Crop Protection AG), Merpan 80 WG
(Kaptan, Makhteshim Agan Industries) a Talent (Myklobutanil, Dow AgroSciences).
Hodnocení bylo provedeno na lokalitách Určice a Stošíkovice třikrát a na lokalitě Bašnice
dvakrát. V roce 2012 proběhly dvě hodnocení na lokalitě Stošíkovice. Napadení listů bylo
hodnoceno podle stupnice 0 – 4 a stupeň napadení byl stanoven dle Townsend-Heubergerova
vzorce (Townsend, Heuberger, 1943). Získaná data byla zhodnocena analýzou variance a byl
proveden Fischerův LSD test na úrovni α 0,05.
50
„Úroda 12/2012, vědecká příloha časopisu“
Tabulka 1. Sled ošetření na pokusných lokalitách v roce 2011
DATUM
LOKALITA
Bašnice
31. 3.
4. 5.
7. 4.
11. 4.
19. 4.
21. 4.
22. 4.
28. 4.
Určice
Stošíkovice
Champion
Novozir, Kumulus
Fuguran
Thiram Granuflo, Kumulus
Kumulus, Alginure 4
l/ha
Polyram
Delan, Mythos, Alginure 4 l/ha
Dithane,
l/ha
Alginure
4 Mythos
29. 4.
4. 5.
Captan, Kumulus, Alginure 4
l/ha
Captan, Alginure 4 l/ha
Delan, Alginure 4 l/ha
6. 5.
Discus,
Delan,
Alginure 4 l/ha
Polyram, Alginure Zato, Score, Alginure 4 l/ha
4 l/ha
13. 5.
16. 5.
19. 5.
26. 5.
30. 5.
31. 5.
2. 6.
7. 6.
11. 6.
13. 6.
14. 6.
21. 6.
22. 6.
23. 6.
29. 6.
8. 7.
13. 7.
14. 7.
26. 7.
27. 7.
4. 8.
11. 8.
Delan, Alginure 4 l/ha
Tercel, Alginure 4
l/ha
Syllit
Novozir, Dithane, Kumulus
Merpan, Score
Syllit
Tercel, Alginure 4 l/ha
Polyram
Syllit
Kumulus
Score, Delan
Syllit
Kumulus
Delan, Kumulus WG
Polyram
Kumulus
Captan, Kumulus
Delan
Delan
Thiram
granuflo,
Alginure 2 l/ha
Captan
Discus
Flint
51
Kumulus,
„Úroda 12/2012, vědecká příloha časopisu“
Tabulka 2. Sled ošetření na pokusné lokalitě Stošíkovice v roce 2012
DATUM
VARIANTA
dávka Alginure 4 l/ha
nižší
Alginure
Delan 0,7 kg/ha,
Alginure 3 l/ha
Chorus 0,45 kg/ha;
Alginure 3 l/ha
3.7.
11.7.
½
dávka
fungicidu
Delan 0,35 kg/ha;
Alginure 4 l/ha
Chorus
0,225
kg/ha, Alginure 4
l/ha
Merpan
0,75
kg/ha; Talent 0,22
l/ha Alginure 4
l/ha
Delan 0,35 kg/ha;
Discus 0,1 kg/ha,
Alginure 4 l/ha
Score 0,2 l/ha
Talent 0,45 l/ha
Kumulus
4,5
kg/ha
Kumulus 4 kg/ha
Merpan 1,5 kg/ha
30.7.
Polisenio 7 l/ha
Polisenio 7 l/ha
17.4.
25.4.
4.5.
11.5.
22.5.
6.6.
14.6.
Merpan 1,5 kg/ha;
Talent 0,45 l/ha
Alginure 3 l/ha
Delan 0,7 kg/ha;
Discus 0,2 kg/ha,
Alginure 3 l/ha
Score 0,2 l/ha
Talent 0,45 l/ha
Kumulus 4,5 kg/ha
Kumulus 4 kg/ha
Merpan 1,5 kg/ha
Delan 0,7 kg/ha,
Alginure 4 l/ha
Chorus
0,45
kg/ha; Alginure
4 l/ha
Merpan
1,5
kg/ha;
Talent
0,45
l/ha
Alginure 4 l/ha
Delan 0,7 kg/ha;
Discus 0,2 kg/ha,
Alginure 4 l/ha
Score 0,2 l/ha,
Talent 0,45 l/ha
Kumulus
4,5
kg/ha
Kumulus 4 kg/ha
Merpan
1,5
kg/ha
Polisenio 7 l/ha
standard
Delan 0,7 kg/ha
Chorus 0,45 kg/ha
Merpan 1,5 kg/ha;
Talent 0,45 l/ha
Delan 0,7 kg/ha;
Discus 0,2 kg/ha
Score 0,2 l/ha
Talent 0,45 l/ha
Kumulus 4,5 kg/ha
Kumulus 4 kg/ha
Merpan 1,5 kg/ha
Polisenio 7 l/ha
Výsledky a diskuze
V maloparcelkovém pokuse v roce 2010 nebyl v případě přípravku Alginure při hodnocení
dne 11. 7. zjištěn statisticky významný rozdíl od neošetřené kontroly, ačkoli v dávce 5 l/ha
byla zaznamenána účinnost 80 % (ANOVA: F 25,15; p 0,0003). Naopak při hodnocení 2. 8.
se již obě dvě dávky přípravku Alginure statisticky průkazně lišily od neošetřované kontrolní
varianty (ANOVA F 30,73; p 0,0001). Souhrn výsledků je uveden v tab. 3. Podobných
výsledků dosáhl Ruemer (2009), který ve svých pokusech srovnával Alginure s jinými
prostředky použitelnými v ekologickém pěstování a dosáhl účinnosti 65 % při hodnocení
plodů a 95 % při hodnocení listů.
Tabulka 3. Napadení plodů strupovitostí jabloně a účinnost jednotlivých variant v roce
2010 na lokalitě Nosislav.
Varianta
11. června
2. srpna
napadení %
účinnost %
napadení %
účinnost %
Polisenio
1,00B
85,01
2,00B
80,64
Sulikol K
5,00A
25,04
4,00B
61,28
VitiSan
3,66A
45,13
5,33A
48,40
40,03
3,00B
70,96
Alginure 3 l/ha 4,00A
80,00
1,33B
87,12
Alginure 5 l/ha 1,33A
kontrola
6,67A
10,33A
V roce 2011 bylo na lokalitě Bašnice dne 23. 6. zjištěno v průměru 50,2% snížení stupně
napadení na variantě s přípravkem Alginure oproti variantě s běžnými fungicidy. Dne 15 září
činil tento rozdíl 27,8 %. Avšak ani v jednom termínu nebyly rozdíly statisticky významné.
52
„Úroda 12/2012, vědecká příloha časopisu“
Na lokalitách Stošíkovice a Určice byly mezi variantami již statistické rozdíly zjištěny.
Snížení stupně napadení bylo ve Stošíkovicích zjištěno následující: 6. 6. – 92 %, 27. 7. – 66,3
% a 8. 9. – 65, 8 %. V Určicích bylo snížení 7. 6. – 36,8 %, 28. 7. – 44,9 % a 13. 9. – 57,1 %.
Souhrnné výsledky jsou uvedeny v tabulkách 4, 5 a 6.
Tabulka 4. Stupeň napadení strupovitostí jabloně na listech na lokalitě Bašnice v roce
2011. (ANOVA: F 0,003; p 0,997)
Odrůda
Varianta
Idared
Alginure + fungicidy
pouze fungicidy
Alginure + fungicidy
pouze fungicidy
Alginure + fungicidy
pouze fungicidy
Golden
delicious
Jonagold
datum hodnocení
23. 6.
15. 9.
4,2A
7,3A
8,5A
11,3A
1A
1,3A
2A
1,8A
1A
9,8A
2A
12,3A
Tabulka 5. Stupeň napadení strupovitostí jabloně na listech na lokalitě Stošíkovice
v roce 2011. (ANOVA: F 1;433 p 0,239)
Odrůda
Varianta
Gala
Golden delicious
6. 6.
0A
2,8A
1A
6,3B
Alginure + fungicidy
pouze fungicidy
Alginure + fungicidy
pouze fungicidy
datum hodnocení
27. 7.
8. 9.
2,5A
2A
7B
7,5B
2A
4,3A
6,3A
10,3B
Tabulka 6. Stupeň napadení strupovitostí jabloně na listech na lokalitě Stošíkovice
v roce 2011. (ANOVA: F 2,610 p 0,017)
Odrůda
Varianta
Golden
delicious
Alginure + fungicidy
pouze fungicidy
datum hodnocení
28. 7.
13.9.
6,5A
4,5A
11,8B
10,5A
7. 6.
6A
9,5B
Tato zjištění odpovídají výsledkům pokusů, které prováděli výzkumníci v KOB Bavendorf a
OVB Jork, jak je pretentoval Welte (2009) a to, že při kombinaci kontaktních fungicidů a
pomocného prostředku Alginure dojde k výraznému snížení napadení oproti chemickému
ošetření bez použití Alginure. Zároveň bylo zjištěno, že použití více než 5 aplikací Alginure
v kombinaci s fungicidy přestává být ekonomicky přínosné, ačkoli stále přináší snížení
napadení. Jiné pokusy v OVB Jork ukazují, že aplikace Alginure má významný stop efekt při
použití po začátku infekce.
V roce 2012 dne 19. 6. bylo na lokalitě Stošíkovice na variantě kombinace nižší dávky
přípravku Alginure s fungicidy zjištěn nulový stupeň napadení. Na variantě se standardní
dávkou Alginure a fungicidy byl zjištěn stupeň napadení 1,0. Statisticky významný rozdíl
mezi těmito variantami není, naopak obě dvě se průkazně liší od standardních fungicidů.
Souhrn výsledků je uveden v tabulce 7.
53
„Úroda 12/2012, vědecká příloha časopisu“
Tabulka 7. Stupeň napadení strupovitostí jabloně na listech na lokalitě Stošíkovice
v roce 2011. (ANOVA 7. 6.: F 14,997; p 0,0001; ANOVA 31. 8.: F 40,807, p 0,000001)
Odrůda
Gala
datum hodnocení
7. 6.
1,3A
1,0B
0,0B
3,0A
Varianta
½ fungicidy + Alginure 4 l/ha
fungicidy + Alginure 4 l/ha
fungicidy + Alginure 3 l/ha
pouze fungicidy
31.8.
1,8B
1,8B
1,0B
7,8A
Závěr
Prostředek pro zvýšení odolnosti rostlin vůči houbovým chorobám na bázi výtažků
z mořských řas a fosfonátů Alginure má významný vliv na napadení jabloní původcem
strupovitosti Venturia inaequalis. Je možno jej použít jak samostatně, což je využitelné
zejména v ekologickém pěstování. Zároveň se však příznivě projevuje v kombinaci
s preventivně působícími fungicidy, kdy při použití v době intenzivního infekčního tlaku při
3-5 aplikacích dojde k významnému snížení napadení. Tento efekt se projevuje dlouhodobě,
což může mít využití zejména v systémech produkce s nízkým obsahem reziduí.
Pro další praktické využití kombinací fungicidních přípravků s Alginure je třeba testovat
možnosti snížení dávek jak prostředku Alginure, tak chemických přípravků, případně
rozšíření aplikačních intervalů. Výsledky z roku 2012 naznačují, že tato cesta by mohla vést
k reálným výsledkům. To by vedlo ke snížení nákladů na ochranu proti strupovitosti a zátěže
pro životní prostředí. To bude předmětem dalšího výzkumu.
Dedikace
Touto cestou bychom chtěli poděkovat zejména pěstitelům, kteří svou spoluprací a
poskytnutím pěstebních ploch umožnili provedení pokusů, tj. Agro Stošíkovice, ZD Určice,
ZD Bašnice, Sady Velké Němčice.
Výzkum byl podpořen z projektu NAZV QJ1210209.
Použitá literatura
Kloutvorová, J., Lánský, M., Kupková, R., Vávra, R., Svoboda, A., Boček, S., 2009:
Monitoring citlivosti populací houby Venturia inaequalis k vybraným pesticidům. Vědecké
práce ovocnářské, 21: 37-46.
Ruemer T.: Bekaempfung vor Schorf und Regneflecken mit Pflanzenstarkungsmitteln,
Výzkumná zpráva Landwirtschaftliches Versuchszentrum Graz-Heidegg 2009
Townsend, G. R., Heuberger, J. W., 1943: Methods for estimating losses cased by diseases in
fungicide experimetns. Plant disease reporter, 27(17): 340-343.
Vávra, R., Boček, S., 2009: Symptomy strupovitosti jabloní na odrůdách a genotypech
nesoucí různé geny rezistence. Vědecké práce ovocnářské, 21: 71-78.
Welte, H.: Frutogard – Pflantenstaerkungsmittel auf Algenbasis, seminář KOB Bavendorf a
Spiess-urania, Bavendorf, 12.12.2009
Kontaktní adresa:
Ing. Martin Bagar, Ph.D.
BIOCONT LABORATORY
Šmahova 66
627 00 Brno
[email protected]
54
„Úroda 12/2012, vědecká příloha časopisu“
PŘEVLÁDAJÍCÍ DRUHY STONKOVÝCH KRYTONOSCŮ
NA LOKALITÁCH TROUBSKO, LEDNICE A ŠUMPERK
Dominant species of stem weevils in Troubsko, Lednice and Šumperk
Hrudová E.1, Seidenglanz M.3, Kolařík P.2, Tóth P.1, Rotrekl J.2, Poslušná J.3
1
2
Mendelova univerzita v Brně
Zemědělský výzkum, spol. s r.o. Troubsko
3
Agritec Plant Research Šumperk
Abstrakt
Na lokalitách Troubsko a Šumperk (2009-2012) a dále Lednice (2010-2012) byl monitorován výskyt
krytonosců v řepce olejce. Zjišťována byla dominance jednotlivých druhů. Eudominantními druhy byli
Ceutorrhynchus pallidactylus, Marsham, 1802 a C.obstrictus Marsham, 1802 na všech lokalitách. V
Troubsku a Lednici byl eudominantní C. napi, Gyllenhal, 1837, zatímco v Šumperku byl tento druh ve
všech letech subdominantní.
Klíčová slova: Ceutorrhynchus napi, C. pallidactylus, dominance, krytonosci, řepka olejka
Abstract
The occurrences of curculionid weevils in oilseed rape were observed. The dominance of individual
species was determined. Ceutorrhynchus pallidactylus, Marsham, 1802 and C.obstrictus Marsham,
1802 were eudominant at all of localities. In Troubsko and Lednice Ceutorrhynchus napi, Gyllenhal,
1837 was also eudominant but in Šumperk was subdominant during the whole period of observation.
Key words: Ceutorrhynchus napi, C. pallidactylus, dominance, curculionid weevils in oil-seed rape
Úvod
Krytonosec řepkový (Ceutorrhynchus napi, Gyllenhal, 1837) a krytonosec čtyřzubý (C.
pallidactylus, Marsham, 1802) jsou jedněmi z nejvýznamnějších škůdců řepky. V Evropě se
vyskytují oba druhy, přičemž krytonosec řepkový se vyskytuje zejména ve střední a západní
Evropě a krytonosec čtyřzubý na celém území Evropy, včetně evropské části Ruska a
evropské části Turecka (Juran, et al. 2011). Oba působí značné škody na stonku řepky a
zapříčiňují významné ztráty na výnosu. Jak uvádí (Gotlin Čuljak, et al. 2010) působí
v Chorvatsku ztrátu až 800 kg semen/ha.
Kromě nich se v porostu řepky vyskytují ještě další druhy krytonosců. Významnými jsou
krytonosec šešulový (Ceutorhynchus obstrictus Marsham, 1802, syn. C.assimilis) jako škůdce
šešulí a krytonosec zelný (C. pleurostigma Marsham 1802). Kromě těchto druhů byly při
monitoringu zjištěny ještě další druhy krytonosců a to krytonosec brukvový (Ceutorhynchus
sulcicolis, Paykull 1800), krytonosec černý (C. picitarsis Gyllenhal 1837) a krytonosci z rodu
Baris. Pravidelně, i když jde o relativně velmi nízké výskyty, se lze při monitoringu v řepce
setkat ještě i s dalšími druhy: C. sulcatus C. Brisout de Barneville, 1869, C. floralis syn. C.
typhae (Herbst, 1795) a C. erysimi (Fabricius, 1787).
Krytonosec řepkový (C. napi) je největším druhem rodu Ceutorhynchus škodícím na řepce.
Jeho tělo je dlouhé 3-4 mm, oválné, na šedých krovkách má rýhování, přičemž každá rýha je
pokryta třemi podélnými řadami světle šedých chloupků. Vajíčka krytonosce řepkového jsou
oválná, zelenobílá, 0,7-0,8 mm dlouhá, 0,4-0,5 mm široká. Dorostlé larvy měří 8 mm (Juran,
et al. 2011).
Krytonosec čtyřzubý (C. pallidactylus) je oválný, dlouhý asi 3,5 mm, samečci jsou výrazně
menší než samičky. Tělo je pokryto šedými a rezavohnědými šupinkami, na rýhách krovek
jsou bělavé chloupky. Tarsy a tibie jsou rezavě - červené. Vajíčka jsou bílá, oválná, dlouhá až
0,6 mm. Dorostlé larvy jsou velké až 8 mm (Juran, et al. 2011).
55
„Úroda 12/2012, vědecká příloha časopisu“
Oba druhy krytonosců mají podobnou bionomii a ekologické nároky. Ročně mají jednu
generaci. Dospělci krytonosce řepkového přezimují v půdě v okolí rostlin, kde se vyvíjely
jeho larvy. Dospělci krytonosce čtyřzubého přezimují mělce v půdě nebo v opadu rostlin
v blízkosti porostů řepky, nebo jiných brukvovitých rostlin, na nichž se vyvíjely larvy. Na jaře
odtud přelétají na nové porosty řepky.
Krytonosec šešulový (C. obstrictus) má oválné tělo pokryté hustými šedými chloupky,
výrazné jsou hrbolky na štítu. Velký je 2,5-3 mm. Larvy se vyvíjejí v šešulích, dorostlé jsou
velké 3-4,5 mm. Kuklí se v půdě, kde následně přezimují i dospělci.
Krytonosec zelný (C. pleurostigma) je velký 2,3-3 mm, má černé, téměř lesklé tělo a na štítu
podélnou rýhu. Dorostlá larva měří 4-5 mm a jako škůdce kořenů se podílí se na vyzimování
řepky.
Krytonosec brukvový (C. sulcicollis) je 2,7-3,2 mm velký, tělo má oválné, s kovově modrým
leskem. Larvy žijí ve stoncích různých brukvovitých rostlin.
Krytonosec černý (C. picitarsis) je velký 2,4-3,5 mm, oválný, černě lesklý, tarsy
má rezavohnědé. Larva žije v srdéčcích brukvovitých rostlin, dorostlá je dlouhá 4-5 mm.
C. floralis je velký asi 1 mm, šedý s řídkými, jemnými, chloupky a nápadným bílým pruhem
na švu krovek. Vývojem je vázán na kokošku pastuší tobolku.
Krytonosci Baris sp. Mají podlouhlé tělo, kovově modře nebo kovově zelenavě zbarvené,
výrazně lesklé, bez šupin. V porostech řepky se vyskytují krytonosec modravý (Baris
coerulescens Scopoli, 1763) a krytonosec dřeňový (B. chlorizans Germar, 1824). Přesto, že
jsou svým larválním vývojem vázáni na řepku, či jiné brukvovité rostliny, jejich výskyt je
ojedinělý a škodlivost mizivá.
Které hostitelské rostliny přitahují do porostů řepky druhy C. sulcatus C. Brisout de
Barneville, 1869 a C. erysimi (Fabricius, 1787) a jaký je jejich vztah k samotné řepce se neví
téměř nic.
Materiál a metody
V letech 2008-2012 byl monitorován výskyt a početnost stonkových krytonosců C. napi a C.
pallidactylus. Výskyt byl prováděn na lokalitách Troubsko 49°10'11.579"N, 16°29'59.488"E,
Lednice 48°49'45.558"N, 16°48'39.688"E a Šumperk 49°58'54.645"N, 17°0'12.901"E.
Sledování proběhlo dle metodiky doporučované pro běžnou zemědělskou praxi. Bylo použito
žlutých misek. Ty byly umístěny na teleskopických držácích umožňujících vertikální posun
misek tak, aby byly vždy v úrovni vrcholů rostlin. Jako smrticí medium sloužila voda
s přídavkem tenzidu pro snížení jejího povrchového napětí. Misky byly do porostu umístěny
před počátkem předpokládaného náletu brouků, sledovány ve třídenních intervalech a
odstraněny po skončení náletu brouků.
Sběry byly dále zpracovány v laboratoři, pro determinaci jednotlivých druhů bylo využito
morfologických znaků.
Ze získaných dat byl vypočítán index dominance jednotlivých druhů na sledovaných
lokalitách, který vyjadřuje jejich zastoupení (Losos 1985)v celkovém počtu jedinců
jednotlivých druhů v biocenóze. Pro jeho výpočet byl použit vzorec:
D  nni 100 %
kde ni je hodnota významnosti druhu tj. počet jedinců sledovaného druhu, a n je součet hodnot
významnosti všech druhů tj. celkový počet odchycených jedinců, 100 je koeficient (Losos
1985) (Losos et al., 1985). Jednotlivé druhy jsou řazeny do pěti tříd dominance dle
procentického zastoupení: Eudominantní > 10,1 %, dominantní 5,1-10 %, subdominantní
2,1-5 %, recedentní 1,1-2 % a subrecedentní < 1 %, jak tyto třídy uvádí (Losos 1985).
56
„Úroda 12/2012, vědecká příloha časopisu“
Výsledky a diskuze
Jak ukazují grafy 1-4, bylo zjištěno, že v roce 2009 byl v Troubsku eudominantním druhem
krytonosec řepkový (CEUTNA). K. čtyřzubý (CEUTQU) byl eudominantním jak v Troubsku,
tak v Šumperku. Dalším eudominantním druhem byl v tomto roce na obou lokalitách k.
šešulový (CEUTAS). V Šumperku byl dominantním druhem k. zelný (CEUTPL), v Troubsku
krytonosec C.typhae (CEUTFL). Ten byl v Šumperku subdominantní. V roce 2010 byl
CEUTNA dominantní v Troubsku, subdominantní v Šumperku a recedentní v Lednici.
CEUTQU a CEUTAS byli eudominantní na všech sledovaných lokalitách. CEUTFL
byl
dominantní v Lednici. V roce 2011byl CEUTNA eudominantní v Troubsku, v Šumperku šlo
o subrecedentní druh. CEUTQU a CEUTAS byli eudominantní na všech sledovaných
lokalitách. CEUTFL byl subdominantním v Lednici. V roce 2012 byl CEUTNA eudominantní
v Troubsku a Lednici, subdominantní v Šumperku. CEUTQU byl eudominantním druhem na
všech sledovaných lokalitách, CEUTAS v Šumperku, zatímco v Troubsku subdominantní.
Ostatní zjištěné druhy byly vyhodnoceny jako recedentní nebo subrecedentní.
Graf 1. Dominance krytonosců v r. 2009 na lokalitách Troubsko a Šumperk
57
„Úroda 12/2012, vědecká příloha časopisu“
Graf 2. Dominance krytonosců v r. 2010 na lokalitách Troubsko, Lednice a Šumperk
Graf 3. Dominance krytonosců v r. 2011 na lokalitách Troubsko, Lednice a Šumperk
58
„Úroda 12/2012, vědecká příloha časopisu“
Graf 4. Dominance krytonosců v r. 2012 na lokalitách Troubsko, Lednice a Šumperk
Ve studii prováděné (Marczali et al. 2007) v Maďarsku bylo zjištěno, že ve sběrech převažují
druhy C. pallidactylus a C. obstrictus, v menším počtu se vyskytují C. napi a C. pleurostigma.
Také z některých německých prací vyplývá, že zastoupení zejména časně jarních druhů, C.
pallidactylus a C. napi, může být v různých regionech dlouhodobě odlišné (Büchs,1998).
Také další autoři se zabývali druhovým složením krytonosců v porostech řepky, zpravidla
však na jedné lokalitě (Čuljak, et al. 2010, Rotrekl 2008)
Závěr
Jak vyplývá ze sledování, má převahu na jižní Moravě C. napi, zatímco v Šumperku (severní
Morava) je jeho početnost nižší. C. pallidactylus je hojně zastoupen na jižní i severní Moravě.
Lze se tedy domnívat, že v severní části území bude tento druh převažovat a z hlediska
škodlivosti bude významnější a naopak význam C. napi, obecně považovaného za
nebezpečnějšího škůdce, zde bude výrazně nižší. To by se mělo odrazit i v odlišném přístupu
k ochraně porostů řepky proti stonky poškozujícím krytonoscům v těchto oblastech.
Dedikace
Výsledky publikované v tomto příspěvku byly získány při řešení projektů č.QH 81218 a č.
QJ2120051 podporovaných NAZV (MZe ČR).
Použitá literatura
Büchs, W. (1998): Strategies to control the cabbage stem weevil (Ceutorhynchus
pallidactylus) and the oilseed rape stem weevil (Ceutorhynchus napi) by a reduced input of
insecticides. IOBC Bulletin, 21 : 205 – 220.
Čuljak, T. G.,I. Juran,D. Grubišić,S. Slovic and S. Jelovčan. 2010. Proljetne pipe - važni
štetnici uljane repice. In B. Cvjetković, (Ed.): Sažeci 54. Seminara bilnje zaštite., pp. 5051, Opatija, Chorvatsko.
Gotlin Čuljak, T.,I. Juran,D. Grubišić,S. Slovic and S. Jelovčan. 2010. Proljetne pipe - važni
štetnici uljane repice. In B. Cvjetković, (Ed.): Seminara bilnje zaštite, Opatija, Chorvatsko.
59
„Úroda 12/2012, vědecká příloha časopisu“
Juran, I.,T. GotlinČuljak and D. Grubišić. 2011. Rape stem weevil (Ceutorhynchus napi Gyll.
1837) and cabbage stem weevil (Ceutorhynchus pallidactylus Marsh. 1802) (Coleoptera:
Curculionidae) - important oilseed rape pests. Agriculturae Conspectus Scientificus 76:93100.
Losos, B., Maget, J., Ryšavý J. 1985. Ekologie živočichů, 1 ed. Státní pedagogické
nakladatelství, Praha.
Marczali, Z.,M. Nádasy,F. Simon and S. Keszthelyi. 2007. Incidence and life cycle of
ceutorhynchus species on rape. VI. Alps-Adria Scientific Workshop. Cereal Research
Communications 35:745-748.
Rotrekl, J. 2008. Škůdci ozimé řepky v jarním období. pp. 1-6. VUP Troubsko
Kontaktní adresa:
Ing. Eva Hrudová, Ph.D.
Ústav pěstování, šlechtění rostlin a rostlinolékařství
Agronomická fakulta, Mendelova univerzita v Brně
[email protected]
60
„Úroda 12/2012, vědecká příloha časopisu“
HODNOCENÍ VLIVU ODRŮDOVÝCH ROZDÍLŮ
TERMOSTABILNÍCH PROTEINŮ HLÍZ BRAMBORU (SOLANUM
TUBEROSUM L.) NA INHIBICI RŮSTU VYBRANÝCH DRUHŮ
FYTOPATOGENNÍCH HUB
The variety assessments of thermostable proteins gained from different
potato tuber cultivars (Solanum tuberosum L.) and their influence on
growth inhibition of selected phytopathogenic fungi
Kamenová A., Bárta J., Bártová V.
Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta
Abstrakt
Příspěvek se zabýval hodnocením rozdílů antifungálních vlastností dvou odrůd bramboru hlíznatého
(Solanum tuberosum L.) Fabia a Laura lišící se užitkovým směrem a délkou vegetační doby a
porovnáním antimikrobiálních aktivit u dvou teplotních variant hlízové šťávy. Izolace proteinů
probíhala za podmínek sníženého pH a působení vysoké teploty (80˚C) a pro porovnání pouze za
podmínek sníženého pH. Izolované termostabilní proteiny byly detekovány analýzou SDS-PAGE na
peptidovém gelu v oblasti 6 a 14 kDa a u tepelně nezpracované hlízové šťávy od 17 do 26 kDa.
Testované vzorky byly aplikovány v různých koncentracích ke čtyřem druhům fytopatogenních hub
Fusarium graminearum, Fusarium oxysporum, Fusarium solani a Rhizoctonia solani. Největší inhibice
růstu mycelia bylo dosaženo při koncentraci 10 mg/ml, v průměru měla vyšší antifungální účinnost
odrůda Laura, všeobecně byly k těmto termostabilním proteinům citlivější houbové kultury F.
graminearum a R. solani, antifungální aktivita však nebyla zaznamenána u směsi proteinů tepelně
nezpracované hlízové šťávy
Klíčová slova: hlízová šťáva, Solanum tuberosum L., antifungální aktivita, termostabilní proteiny,
odrůdové rozdíly
Abstract
The contribution deals with the variety assessments of antifungal potential of two potato cultivars
(Solanum tuberosum L.) Fabia and Laura differing in the market and maturity and comparison of two
potato fruit juice alternatives differing in processing temperature. Combination of pH adjustment and
high temperature (80°C) or pH adjustment only was used for protein isolation. Isolated thermostable
proteins were detected in the SDS-PAGE analysis on peptide gel in range of 6 and 14 kDa and in
range from 17 to 26 kDa in the sample of the thermally untreated potato fruit juice. Different protein
concentrations were applied to four different phytopathogenic fungi Fusarium graminearum, Fusarium
oxysporum, Fusarium solani and Rhizoctonia solani. The greatest inhibition of mycelial growth was
achieved at a concentration of 10 mg/ml, Laura variety had greater antifungal effect in average,
phytopathogenic fungi F. graminearum and R. solani were more sensitive to the thermostable proteins
in general but inhibition effect of thermally untreated substance was not registered.
Key words: potato fruit juice, Solanum tuberosum L., antifungal activity, thermostable proteins,
cultivar variability
Úvod
Majoritní složkou termostabilních proteinů jsou skupiny inhibitorů proteas, které jsou
variabilní skupinou proteinů a hrají důležitou roli i v obraně proti predátorům a patogenům.
Inhibitory proteas jsou charakterizovány molekulovou hmotností v rozmezí od 3 do 25 kDa a
tvoří v hlízách bramboru velmi významnou, převážně konstitutivně syntetizovanou složku
hlízových proteinů představující asi 50 % všech proteinů v hlízové šťávě (Pouvreau 2004).
Studie, které se do současnosti zabývaly antimikrobiální aktivitou hlízových bílkovin
brambor, pracovaly pouze s jednou odrůdou bramboru hlíznatého (Kim et al. 2005; 2006;
Speranskaya et al. 2006, Jin et al. 2009, Ohh et al. 2009) nebo byla, jako zdroj proteinů,
61
„Úroda 12/2012, vědecká příloha časopisu“
použita hlízová voda z průmyslového zpracování brambor na škrob, která je směsí odrůd
druhu Solanum tuberosum L. (Kamenová et al. 2011, Bárta et al. 2012) a vzájemné porovnání
antimikrobiálních vlastností odrůd mezi sebou publikováno nebylo.
Antimikrobiální vlastnosti byly dosud popsány pouze u některých kultur fytopatogenních hub
- Kim et al. (2005) ve své práci popsal antimikrobiální aktivitu bramborového inhibitoru
proteas I (PI-1) proti fytopatogenní houbě Rhizoctonia solani, Mendieta et al. (2006) a
Seliternnikoff (2001) potvrdili pozitivní antifungální účinek hlízových proteinů na druh
Fusarium solani, Speranskaya et al. (2006) potvrdili ve své práci vliv hlízových inhibitorů
Kunitzova typu na růst a vývoj fytopatogenní houby Fusarium culmorum.
Cílem příspěvku bylo vzájemné porovnání antimikrobiální aktivity proteinů izolovaných z
hlízové šťávy dvou odrůd brambor připravené ve dvou teplotních variantách-před tepelnou
koagulací a po tepelné koagulaci při 80˚C. Antimikrobiální aktivita byla testována na čtyřech
kmenech fytopatogenních hub Fusarium graminearum, Fusarium oxysporum, Fusarium solani
a Rhizoctonia solani.
Materiál a metody
Rostlinným materiálem pro zdroj proteinů byla hlízová šťáva připravená ze dvou odrůd
bramboru hlíznatého (Solanum tuberosum L.). Obě odrůdy brambor byly vypěstovány za
přesně definovaných podmínek v roce 2011 formou maloparcelkových pokusů na stanovišti v
Českých Budějovicích (380 m n. m.). Odrůda Fabia je raná a používá se pro zpracování na
škrob, Laura je poloraná a je odrůdou konzumní. Z hlíz brambor každé odrůdy byly
odšťavněním na kuchyňském odšťavňovači připraveny hlízové šťávy, které byly centrifugací
(4500 rpm, 30 minut) a filtrací zbaveny škrobu, vlákniny a dalších ve vodě nerozpustných
látek. U takto získaných šťáv byla upravena reakce na pH 5 a následně byl materiál rozdělen
na hlízovou šťávu, která nebyla tepelně zpracována (tzv. varianta 0) a na šťávu, u které se
provedla deproteinizace tepelnou koagulací (oddělení majoritních, termolabilních proteinů)
vytemperováním vzorku ve vodní lázni na 80˚C. U získaného supernatantu obou variant se
provedla dialýza (3,5 K MWCO, Pierce SnakeSkin Dialysis Tubing, Thermo Scientific) a
vzorek se zakoncentroval lyofilizací. Získaná směs proteinů a peptidů byla rozpuštěna v ultra
čisté vodě, roztok byl sterilizován bakteriálním filtrem (0,22 µm, Millex Filter Units,
Millipore) a aplikován v objemu 30 µl do každé z jamek, které byly přesně umístěny na okraj
rostoucího mycelia. Jako kontrola byla, u každé varianty pokusu, aplikována sterilní,
destilovaná voda. Antifungální testy byly prováděny na fytopatogenních kmenech hub
Fusarium graminearum, Fusarium oxysporum, Fusarium solani a Rhizoctonia solani.
Testované kmeny byly získány z České sbírky mikroorganismů v Brně. Izolované směsi
proteinů byly aplikovány v koncentracích 1 mg/ml, 5 mg/ml a 10 mg/ml a byl sledován vliv
na růst mikroskopických hub. Antifungální aktivita byla hodnocena po 24 hodinách kultivace
při 26˚C (Hunth et al. 1996). Inhibice růstu mycelia byla vyhodnocována na digitálních
fotografiích pomocí počítačového software metodou měření ploch inhibičních zón u
jednotlivých opakování. Izolované peptidy a proteiny byly analyzovány pomocí SDS-PAGE
na 16% peptidovém gelu.
Výsledky a diskuze
Proteiny tepelně nezpracované hlízové šťávy byly detekovány v oblasti 14 kDa a další
výrazná zóna bandů byla v oblasti od 17 do 26 kDa u obou odrůd (obrázek 1). Antifungální
aktivita izolovaných proteinů byla testována na čtyřech fytopatogenních kmenech hub
(Fusarium graminearum F-683, Fusarium oxysporum F-65, Fusarium solani 8079 a
Rhizoctonia solani F-1). U žádného z testovaných kmenů nebyla pozorována inhibice růstu
mycelia po 24 hodinách kultivace při aplikaci proteinového izolátu odrůdy Fabia a Laura v
koncentracích 1; 5 a 10 mg/ml účinné látky (obrázky 2 a 3).
62
„Úroda 12/2012, vědecká příloha časopisu“
Obrázek 1: Detekce proteinů pomocí SDSPAGE na peptidovém gelu. (HM hmotnostní marker)
Obrázek 2: Ukázka účinku tepelně
nezpracované hlízové šťávy z odrůdy Laura
v koncentracích účinné látky 1; 5; 10 mg/ml
a 0 značící kontrolu na houbové kultuře
Rhizoctonia solani.
Obrázek 3: Ukázka účinku tepelně
nezpracované hlízové šťávy z odrůdy Fabia
v koncentracích účinné látky 1; 5; 10 mg/ml
a 0 značící kontrolu na houbové kultuře
Fusarium solani.
Termostabilní proteiny byly detekovány pomocí SDS-PAGE na 16% peptidovém gelu
v oblasti kolem 6 kDa a 14 kDa a ve dvou výrazných zónách s vyšší intenzitou bandů
u odrůdy Fabia a méně intenzivní bandy byly detekovány v oblasti 26 kDa u obou odrůd
(obrázek 1). V práci Kim et al. (2005) byly detekovány termostabilní antimikrobiální peptidy
o molekulové hmotnosti 5,6 kDa. Antifungální aktivita izolovaných proteinů byla testována
na stejných čtyřech výše uvedených fytopatogenních kmenech hub. Inhibice růstu mycelia
byla pozorována u všech testovaných houbových kultur, koncentrací a odrůd po 24 hodinách
kultivace (obrázky 4-7).
63
„Úroda 12/2012, vědecká příloha časopisu“
Obrázek 4: Ukázka účinku tepelně
zpracované hlízové šťávy při 80˚C z odrůdy
Fabia v koncentracích účinné látky 1; 5; 10
mg/ml a 0 značící kontrolu na houbové
kultuře Fusarium graminearum.
Obrázek 5: Ukázka účinku tepelně
zpracované hlízové šťávy při 80˚C z odrůdy
Laura v koncentracích účinné látky 1; 5; 10
mg/ml a 0 značící kontrolu na houbové
kultuře Fusarium graminearum.
Obrázek 6: Ukázka účinku tepelně
zpracované hlízové šťávy při 80˚C z odrůdy
Fabia v koncentracích účinné látky 1; 5; 10
mg/ml a 0 značící kontrolu, na houbové
kultuře Rhizoctonia solani.
Obrázek 7: Ukázka účinku tepelně
zpracované hlízové šťávy při 80˚C z odrůdy
Laura v koncentracích účinné látky 1; 5; 10
mg/ml a 0 značící kontrolu, na houbové
kultuře Fusarium oxysporum.
Digitální fotografie s testovanými kulturami byly vyhodnoceny citlivým počítačovým
software a to tak, že byla měřena velikost plochy inhibičních zón u jednotlivých opakování a
koncentrací, průměry měření těchto opakování jsou zaznamenány v tabulce 1. Největší
antifungální účinek se projevil při koncentraci účinné látky 10 mg/ml u obou testovaných
odrůd, větší plochy inhibičních zón byly u odrůdy Laura. K izolátům proteinů byla výrazně
nejcitlivější kultura F. graminearum (obrázky 4 a 5), naopak nejméně citlivou kulturou bylo
F. solani. Při koncentraci 5 a 10 mg/ml měla větší antifungální účinek odrůda Laura
s výjimkou účinku na F. solani při koncentraci účinné látky 10 mg/ml (rozdíl mezi odrůdami
2,9 mm2).
Tabulka 1: Plocha inhibičních zón u testovaných houbových kultur při aplikaci termostabilních
proteinů odrůd Fabia a Laura v koncentracích 1; 5 a 10 mg/ml.
Odrůda
tuberosum L.
Solanum
Houbová kultura
Fusarium graminearum F-683
Fusarium oxysporum F-65
Fusarium solani 8079
Rhizoctonia solani F-1
Fabia
1mg/ml
Laura
1mg/ml
Fabia
5mg/ml
Laura
5mg/ml
Fabia
10mg/ml
Laura
10mg/ml
73,0bc
40,5efg
29,8fgh
49,1def
62,9bcd
29,2fgh
54,3cde
74,9bc
106,7a
67,1bcd
51,4de
83,47ab
plocha inhibiční zóny [mm2]
17,1hi
7,6i
4,0i
8,1i
17,1hi
17,8hi
5,5i
6,5i
64
54,9cde
20,5ghi
22,6ghi
34,4efgh
„Úroda 12/2012, vědecká příloha časopisu“
Poznámka: Písmena indikují statistickou průkaznost na hladině významnosti P<0,05 (Fisher LSD test). Písmena
jsou seřazena v abecedním pořádku podle snižující se hodnoty plochy inhibiční zóny.
Z výsledků vyplývá, že širší spektrum proteinů izolovaných z tepelně nezpracované hlízové
šťávy nemá prokazatelný antifungální účinek v testovaných koncentracích na rozdíl od
termostabilních frakcí proteinů odrůd Fabia a Laura, u kterých byly sledovány výrazné
antifungální vlastnosti. Největší inhibice růstu mycelia bylo dosaženo při koncentraci 10
mg/ml, v průměru má vyšší antifungální účinnost odrůda Laura, všeobecně jsou k těmto
termostabilním proteinům citlivější houbové kultury F. graminearum a R. solani.
Závěr
Příspěvek se zabýval hodnocením rozdílů antifungálních vlastností proteinů hlíz bramboru
(Solanum tuberosum L.) získaných z hlízové šťávy odrůd Fabia a Laura získaných pomocí
tepelné koagulace (při 80˚C). Izolované termostabilní proteiny byly detekovány analýzou
SDS-PAGE na peptidovém gelu v oblasti 6 a 14 kDa a od 17 do 26 kDa u tepelně
nezpracované hlízové šťávy. Při termokoagulaci a následné centrifugaci došlo k izolaci a
zakoncentrování termostabilních proteinů, které si i přes expozici teplotě 80˚C uchovaly svou
antifungální aktivitu, která byla prokázána na fytopatogenních druzích hub Fusarium
graminearum, Fusarium oxysporum, Fusarium solani a Rhizoctonia solani inhibicí růstu
mycelia při aplikaci testované látky v koncentracích 1; 5 a 10 mg/ml po kultivaci 24 hodin při
teplotě 26˚C. V průměru měla větší inhibiční aktivitu odrůda Laura u všech testovaných
koncentrací, nejcitlivější byla z testovaných fytopatogenů kultura Fusarium graminearum u
které byla zaznamenána největší inhibice růstu při aplikaci testované látky odrůdy Laura v
koncentraci 10 mg/ml. Ze získaných výsledků vyplývá, že antifungální vlastnosti hlízové
šťávy jsou závislé na tepelném zpracování, izolaci a následném zakoncentrování proteinů
s těmito vlastnostmi. Bylo zjištěno, že se od sebe odrůdy ve svých antifungálních vlastnostech
liší a to přímo úměrně s rostoucím množstvím účinné látky v testovaném vzorku. Závěry
naznačují, že je do budoucna vhodné cíleně využívat k výzkumu a následným
biotechnologickým aplikacím konkrétní odrůdy bramboru, které se vyznačují větším
množstvím termostabilních inhibitorů proteas s vykazujícími antimikrobiálními vlastnostmi.
Dedikace
Výsledky byly získány v rámci řešení výzkumných projektů GAJU 030/2012/Z a GAČR
522/09/1693.
Použitá literatura
Bárta, J., Bártová V., Kamenová A., Zdráhal Z., Brabcová A., Čurn V. Jihočeská univerzita v
Českých Budějovicích Zemědělská fakulta. Izolát proteinů z brambor s antimikrobiální
účinností. Česká republika. Užitný vzor, CZ 23983 U1. Zapsáno 18. 6. 2012. Dostupné z:
http://spisy.upv.cz/UtilityModels/FullDocuments/FDUM0023/uv023983.pdf [online 21. 8.
2012]
Huynth Q. K., Borgmeyer J. R., Smith C. E., Bell L. D., Shah D. M (1996): Isolation and
characterization of a 30 kDa protein with antifungal activity from leaves of Engelmannia
pinnatifida. Biochemical Journal, 316: 723-727.
Jin Z., Shinde P. L., Yang Y. X., Choi J. Y., Yoon S. Y., Hahn T.-W., Lim H. T., Park Y. K.,
Hahm K. S., Joo J. W., Chae P. J. (2009): Use of refined potato (Solanum tuberosum L. cv.
Gogu valley) protein as an alternative to antibiotics in weanling pigs. Livestock Science,
124: 26-32.
Kamenová A., Bártová V., Bárta J. (2011): Antifungální potenciál nízkomolekulárních
proteinů a peptidů hlíz bramboru (Solanum tuberosum L.). Úroda, 12: 213-216.
65
„Úroda 12/2012, vědecká příloha časopisu“
Kim J.-Y., Park S.-C., Kim M.-H., Lim H.-T., Park Y., Hahm K.-S. (2005): Antimicrobial
activity studies on a trypsin-chymotrypsin protease inhibitor obtained from potato.
Biochemical and Biophysical Research Communications, 330: 921-927.
Kim M.-H., Park S.-C., Kim J.-Y., Lee S. Y., Lim H.-T., Cheong H., Hahm K.-S., Park Y
(2006): Purification and characterization of a heat-stable serine protease inhibitor from the
tubers of new potato variety “Golden Valley”. Biochemical and Biophysical Research
Communications, 346: 681-686.
Mendieta J. R., Pagano M. R., Muñoz F. F., Daleo G. R., Guevara M. G. (2006):
Antimicrobial activity of potato aspartic proteases (StAPs) involves membrane
permeabilization. Microbiology, 1052: 2039-2047.
Ohh S. H., Shinde P. L., Jin Z., Choi J. Y., Hahn T.-W., Lim H. T., Kim G. Y., Park Y.,
Hahm K.-S., Chae B. J. (2009): Potato (Solanum tuberosum L. cv. Gogu valley) protein as
an antimicrobial agent in the diets of broilers. Poultry Science, 88: 1227-1234.
Pouvreau L. (2004): Occurrence and physic-chemical properties of protease inhibitors from
potato tuber (Solanum tuberosum). Ph.D. thesis, Wageningen University, The Netherlands,
157.
Selitrennikoff C. P (2001): Antifungal Proteins. Applied and Environmental Microbiology,
67: 288-2894.
Speranskaya A. S., Krinitsina A. A., Revina T. A., Gerasimova N. G., Keruchenko Y. A. S.,
Shevelev A. B., Valueva T. A. (2006): Heterologous xpression, purification, and properties
of a potato protein inhibitor of serine proteinases. Biochemisty (Moscow), 11: 1176-1182.
Kontaktní adresa:
Ing. Andrea Kamenová
Oddělení pěstování rostlin
Katedra rostlinné výroby a agroekologie
Zemědělská fakulta
Jihočeská univerzita v Českých Budějovicích
Studentská 13
370 05 České Budějovice
e-mail: [email protected]
66
„Úroda 12/2012, vědecká příloha časopisu“
VLIV RŮZNÝCH SYSTÉMŮ ZPRACOVÁNÍ PŮDY NA PŮDNÍ
VLASTNOSTI A ŽIVOTNÍ PROSTŘEDÍ
The influence of various tillage systems on soil characteristics
and the environment
Šarapatka B., Čáp L., Netopil P.
Přírodovědecká fakulta Univerzity Palackého v Olomouci
Abstrakt
V posledních letech jsou diskutovány otázky vlivu různých zemědělských systémů na kvalitu půdy s
důrazem na udržitelné hospodaření. V našem výzkumu jsme se zaměřili na vliv agrotechnických
opatření na půdní vlastnosti a erozní procesy. V první části práce se jedná o vliv tří forem zpracování
půdy (orba, podrývání, minimalizační technologie) na vybrané vlastnosti půdy. Ze čtyřletého
sledování je patrné, že různé způsoby zpracování půdy ovlivnily aktivitu většiny půdních enzymů a
některé další charakteristiky půdy. Půdoochranným technologiím se věnujeme i ve druhé části
příspěvku, a to z pohledu protierozní ochrany. Na konkrétním příkladu dokládáme, že pro účinnou
ochranu půdy je nutný návrh kombinace protierozních opatření, v nichž mohou tyto technologie hrát
pouze omezenou roli.
Klíčová slova: půdoochranné technologie, orba, podrývání, minimalizace, charakteristiky, eroze,
GAEC
Abstract
In recent years there has been much debate on the influence of various agricultural systems on soil
quality with emphasis on sustainable management. In our research we have focused on various tillage
systems and their influence on soil characteristics and on erosion processes. In the first part this deals
with the influence of three forms of soil tillage (ploughing, subsoiling and reduced tillage) on selected
soil characteristics. From four years of observation it is apparent that various ways of working the soil
affected the activity of most soil enzymes and some other soil characteristics. Soil protection
technology is also dealt with in the second part of our submission from the point of view of protection
against erosion. On the basis of specific example we state that, for effective soil protection, it is
essential to propose a combination of anti-erosion measures in which these technologies play only a
partial role.
Key words: soil protection, ploughing, subsoiling, reduced tillage, characteristics, erosion, GAEC
Úvod
Kvalita půdy, její ochrana a udržitelné hospodaření nabývají s ohledem na vývoj půdního
fondu v posledních letech stále více na významu. Ve spojitosti s ovlivňováním půdních
vlastností a životního prostředí jsou odbornou veřejností diskutovány i půdoochranné
technologie. Ty s ohledem na půdní prostředí můžeme studovat pomocí indikátorů, mezi něž
zařazujeme fyzikální, chemické i biologické vlastnosti půdy. Fyzikální stav má přímé i
nepřímé vlivy na produkci rostlin a další charakteristiky. Strukturní půdy vykazují optimální
poměry mezi půdním vzduchem a vodou s vlivy na koloběhy živin, růst kořenů atd. Změny
těchto charakteristik se často odrážejí i u dalších procesů probíhajících v půdním prostředí,
např. s charakteristikami souvisejícími s půdní organickou hmotou či s přijatelnými prvky
nutnými pro růst rostlin. Kritéria fyzikálních a chemických charakteristik ve vztahu ke kvalitě
půdy byla diskutována např. v roce 1992 Ashadem a Coenem. Ke klíčovému faktoru kvality
půdy patří její organická hmota, která je nejen zdrojem živin, ale vykazuje i řadu dalších
funkcí souvisejících s vodou v půdě, omezováním eroze, je potravním zdrojem edafonu atd.
Organická hmota a biologická aktivita má vliv na koloběhy prvků v půdním prostředí. Jelikož
v půdním prostředí probíhá řada velmi složitých biologických procesů, jsou velmi důležité i
charakteristiky biologické a biochemické. Jedná se například o aktivitu půdních enzymů, které
67
„Úroda 12/2012, vědecká příloha časopisu“
jsou součástí biologických procesů v půdě, mají význam v dekompozici organických látek,
mineralizaci a v kolobězích živin. Aktivita půdních enzymů může být citlivým indikátorem
narušení biologických funkcí půdy. Vedle pH, kvality půdní organické hmoty, obsahu živin,
vlhkostních poměrů, vegetačního krytu atd. může být aktivita enzymů výrazně ovlivněna
zpracováním půdy a hnojením (Melero et al., 2006). Z dalších biologických charakteristik,
které jsme do sledování rovněž zahrnuli, patří procesy v koloběhu dusíku – amonifikace a
nitrifikace a dále respirace půdy, která napovídá o biologické aktivitě půdy.
V první popisované části výzkumu jsme se zaměřili na studium změn půdního systému při
obhospodařování půdy třemi agrotechnickými způsoby, a to s využitím orby, podrývání a
redukovaného zpracování půdy.
Druhá část našeho výzkumu se zabývala využitím půdoochranných technologií při plánování
protierozní ochrany v silně erozně ohrožených lokalitách. Tímto problémem se detailněji
zabýváme proto, že eroze půdy je celosvětově nejzávažnějším degradačním faktorem a
ohrožuje kvalitu půdy a produkci plodin na ní pěstovaných. Oldeman (1994) uvádí, že eroze
se podílí 82 % na degradaci půdy antropogenním vlivem. V evropském prostoru představuje
člověkem ovlivněná degradace půdy erozí 114,5 milionů hektarů. Je to vážný problém i
v rámci České republiky, neboť ohrožuje zhruba polovinu ploch orné půdy (Šarapatka a kol.,
2002) s tím, že v posledních letech se její intenzita v důsledku změn využívání krajiny a
způsobu pěstování plodin ještě zvýšila. Šetrné využívání půdního fondu včetně správně
navržené protierozní ochrany napomáhá těmto škodlivým vlivům předcházet. O způsobu
návrhů protierozní ochrany je rozsáhlá odborná literatura, protierozních opatření v naší
krajině je však velmi málo. V posledních letech musí zemědělci žádající o dotace splňovat
Podmínky dobrého zemědělského a environmentálního stavu (GAEC), které vycházejí
z Nařízení Rady (ES) 73/2009 a zahrnují rovněž erozi půdy. V publikovaných podmínkách je
zejména nepěstování širokořádkových plodin na silně erozně ohrožených pozemcích a
využívání půdoochranných technologií na určitých plochách u vybraných plodin. Na srovnání
protierozní účinnosti podle těchto požadavků zahrnujících rovněž půdoochranné technologie
s klasicky navrhovanou protierozní ochranou využívající organizační, agrotechnická i
technická opatření jsme se zaměřili v našem výzkumu.
Materiál a metody
První částí výzkumu je sledování vlivu různých způsobů zpracování půdy na půdní
charakteristiky, které jsme studovali v letech 2007 – 2011, a to na třech lokalitách v různých
výrobních podmínkách s rozdílnými půdními typy. Jednalo se o lokality Unčovice (okres
Olomouc), 227 m n. m., půdní typ černozem luvická, Hrušovany nad Jevišovkou (okres
Znojmo), 210 m n. m., půdní typ černozem modální, Lesonice (okres Třebíč), 510 m n. m.,
půdní typ luvizem modální.
V rámci osevního postupu se stejnými plodinami na všech lokalitách byly studovány půdní
vlastnosti u tří způsobů agrotechniky, a to u klasického zpracování půdy s orbou do 0,22 m, u
redukovaného zpracování půdy (minimalizace) do hloubky 0,15 m a u podrývání do hloubky
0,35 – 0,40 m. Vzorky půdy byly odebírány minimálně 2 x ročně z ploch 30 x 100 m. Po
studiu literatury o hodnocení kvality půdy a s ohledem na zaměření ve výzkumu zúčastněných
laboratoří jsme zvolili následující fyzikální a chemické charakteristiky - pH/KCl, K, Ca, Mg,
P, K, Ca, kationtová výměnná kapacita, Corg., obsah humusu, suma huminových kyselin a
fulvokyselin a jejich poměr, mikroagregáty, objemová hmotnost redukovaná, momentální
obsah vody, vodostálost agregátů a kompakce půdy - s využitím metodik Zbíral a kol. (1995 –
1997). Zvolili jsme i charakteristiky půdně biologické, v rámci nichž jsme studovali aktivitu
vybraných půdních enzymů (dehydrogenáza, kyselá a alkalická fosfatáza, ureáza, proteáza,
nitrát reduktáza, celuláza) a dále amonifikaci, nitrifikaci a půdní respiraci s využitím metodik
68
„Úroda 12/2012, vědecká příloha časopisu“
publikovaných pod editorstvím Schinner et al. (1995). Pro statistické hodnocení a zjišťování
korelací byl využit Kruskal-Wallisův test s využitím softwaru STATISTICA.
Druhý výzkum jsme prováděli na zemědělské půdě ve vybraných oblastech jižní Moravy
(katastry obcí Archlebov, Velké Hostěrádky), a dále ve vyšších nadmořských výškách (Sasov,
Rychtářov). V těchto lokalitách byla po vyhodnocení potenciální eroze navržena protierozní
ochrana (PEO) a zároveň byla hodnocena účinnost opatření podle Standardů dobrého
zemědělského a environmentálního stavu (GAEC). Jednotlivé návrhy PEO, které posloužily
jako možná alternativa ke koncepci GAEC, vycházely ze čtyř kategorií, jež kombinovaly
opatření agrotechnického a technického charakteru - orná půda bez opatření, orná půda
s protierozními opatřeními, trvalý travní porost a liniová opatření. Ta zahrnovala zasakovací
pásy, svodné a záchytné průlehy a stabilizaci drah soustředěného odtoku. Pro zhodnocení
původního stavu bez půdoochranného managementu byla využita pro minimalizaci ztráty
půdy a návrh PEO rovnice USLE. Stav bez protierozního managementu byl srovnáván s
opatřeními GAEC (WMS sever VÚMOP). Pro srovnávací analýzu byla využita digitální data
a programové prostředí ArcGIS 9.3 (ESRI), kde rastrové vrstvy GAEC byly prolnuty
s polygonovou vrstvou půdních bloků zájmových území, a to pro potřeby získání informace o
výskytu kategorie silně a mírně erozně ohrožené půdy. Ty byly dále pomocí geostatistických
nástrojů vyhodnoceny.
Výsledky a Diskuze
V našem výzkumu různých systémů zpracování půdy jsme se soustředili zejména na to, jak se
se změnou hospodaření mění půdní vlastnosti, a to do hloubky 5 cm a ve vrstvě 0-20 cm.
Následující tabulka 1 ukazuje, které z charakteristik se statisticky významně odlišovaly při
různém managementu.
Tab. 1 Statisticky významné rozdíly půdních charakteristik v závislosti na způsobu
hospodaření v horizontu 0-20 cm.
Charakteristiky / zpracování
půdy
Aktivita celulázy
Aktivita proteázy
Aktivita nitrát reduktázy
Aktivita kyselé fosfatázy
Aktivita alkalické fosfatázy
Σ huminových kyselin
Mikroagregáty 2-0.5 mm
Mikroagregáty < 0,1 mm
Objemová hmotnost
Vodostálost agregátů
orba
podrývání
minimalizace
↓
↓
↓
↓
↓
↓
↓
↑
↓
↓
Ø
Ø
↑
↑
↑
↑
Ø
Ø
↑
↑
↑
↑
↑
↑
↑
↑
↑
↓
Ø
↑
↓ - nižší hodnoty půdních charakteristik, ↑ - vyšší hodnoty charakteristik, Ø - hodnoty
zasahovaly jak do skupiny ↓, tak ↑.
Ze statistického zpracování výsledků za 4 roky sledování vyplývá u variant s minimalizačními
zpracováním půdy a u podrývání řada korelací a změn u aktivity půdních enzymů, což
odpovídá i literárním údajům. Statisticky jsme sice za dobu výzkumu neprokázali vyšší obsah
uhlíku, což odpovídá rovněž řadě výsledků krátkodobějších výzkumů (např. Green et al.,
2007), z publikovaných dat více výzkumů je ale možné říci, že půdoochranné technologie
obecně zvyšují obsah půdní organické hmoty v povrchové vrstvě půdy. Větší množství
posklizňových zbytků v této vrstvě tak mohlo ovlivnit aktivitu půdních enzymů, které podle
výzkumů signifikantně korelují s půdní organickou hmotou (Acosta-Martinez et al., 2003).
Aktivita vybraných půdních enzymů se tak v našem sledování jevila jako dobrý indikátor
kvality půdy, neboť mj. citlivě reaguje na změny managementu a tyto změny byly
69
„Úroda 12/2012, vědecká příloha časopisu“
zaznamenatelné dříve než je tomu u jiných půdních vlastností. Těmi byly např. chemické
vlastnosti, u nichž nebyly během doby výzkumu zaznamenány statisticky průkazné rozdíly, s
výjimkou Mg a výměnného Mg. Statisticky průkazné změny však byly zaznamenány u
některých fyzikálních charakteristik, a to u objemové hmotnosti, mikroagregátů a jejich
stability. U objemové hmotnosti, jako u základní fyzikální charakteristiky, popisují výsledky
některých experimentů vyšší hodnoty u minimalizačních technologií, další výzkumy rozdíly
mezi systémy nepotvrzují (např. Ferreras et al., 2000). Naše výsledky ukazují v horizontu 020 cm na nižší hodnoty objemové hmotnosti u orby, což odpovídá výše uvedeným pracím,
v povrchové vrstvě do 5 cm však nebyly tyto rozdíly zaznamenány. I další charakteristika
týkající se půdních agregátů je ovlivňována managementem a může být více stabilní u
půdoochranných technologií (např. Pagliai et al., 2004). Obdobná zjištění jsme zaznamenali i
v našem výzkumu pro mikroagregáty 2-0.5 mm, u mikroagregátů < 0.1 mm byly výsledky ve
prospěch varianty s orbou. Z literatury je možné konstatovat, že stabilita agregátů je silně
ovlivňována obsahem a dodávkou organické hmoty (Haynes et al., 1996) a je předpoklad
jejich vyšší stability v povrchových vrstvách minimalizačních technologií.v dlouhodobější
perspektivě Výsledky po čtyřech letech výzkumu tomu nasvědčují. Pozitivně může na půdní
vlastnosti rovněž působit podle našich i v literatuře publikovaných výsledků podrývání, kdy
může eliminovat utužení po mnoha letech hospodaření.
Druhá část příspěvku se týká protierozní ochrany, včetně využití půdoochranných technologií
v rámci směrnice GAEC, kde jejich účinnost nemusí být dostačující. Po vyhodnocení
erozního smyvu na modelových farmách je zřejmá vysoká erozní ohroženost, zejména
v intenzivně obhospodařovaných územích černozemních oblastí jižní Moravy. V těchto
lokalitách je nutná náročnější protierozní ochrana a účinnost opatření GAEC se jeví jako
nedostatečná. Jako příklad uvedeme katastr Velkých Hostěrádek, který lze považovat za velmi
ohrožené území vodní erozí.
Průměrný erozní smyv je zde 20,3 t.ha-1 za rok a celková ztráta půdy v řešeném území je 11
145 t za rok. Komplexním návrhem protierozních opatření může dojít ke snížení průměrné
hodnoty erozního smyvu na 5,4 t.ha-1 za rok a ke snížení celkové ztráty půdy na 2 965 t za
rok, to je snížení o 73,4 %. Podle požadovaného managementu standardů Dobrého
zemědělského a environmentálního stavu (GAEC) s využitím půdoochranných technologií
dochází ke snížení průměrné hodnoty erozního smyvu na 11,6 t.ha-1 za rok a ke snížení
celkové ztráty půdy v řešeném území na 6 368 t za rok, tj. snížení hodnot erozního smyvu o
42,9 %. Průměrný smyv tedy zůstává nad povoleným limitem a v katastru se stále vyskytují
extrémně erozně ohrožené lokality (Obr. 1 a 2).
Pro efektivní ochranu půdního fondu formou různých agrotechnických i vyloženě technických
prvků je nezbytně nutná znalost místních podmínek v měřítku okresu, katastru, povodí či
konkrétní farmy. Vliv rozdílných agrotechnických postupů, i v rámci malých farem (povodí),
je na ztrátu půdy a základních živin zcela zásadní (Bechmann et al., 2009). Tím se dá účinně
předcházet environmentálním a ekonomickým škodám. Striktně daná pravidla vyplácení
zemědělské podpory vycházející z jednotné evropské zemědělské politiky, ze které čerpá i
strategie tzv. Dobrého zemědělského a environmentálního stavu (GAEC), mohou zásadně
ovlivňovat nejen míru ochrany zemědělské půdy před erozí. Míra účinnosti však také záleží
na náročnosti nastavení pravidel protierozní ochrany a jejich důsledném dodržování v praxi.
Budoucí diskuze vztahující se k efektivitě půdoochranných technologií s využitím znalostí o
měnících se vlastnostech půdy musí tedy být nezbytnou součástí účinné a v praxi fungující
protierozní ochrany.
70
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 1 a 2: Erozní smyv ve vybraném území bez provedení protierozní ochrany a
po zavedení pravidel GAEC
Závěr
V následujících dekádách bude muset rostlinná produkce zásobovat stále větší populaci na
omezenějších plochách. Z důvodů produkčních, environmentálních, ale i ekonomických jsou
propracovávány různé produkční systémy i způsoby zpracování půdy. Mezi ně patří i systémy
s minimalizovaným zpracováním půdy a využití podrývání, to jsou technologie, kterými jsme
se zabývali v našem výzkumu. Naše výsledky, z nichž některé jsou uvedeny v tomto článku,
ukazují na zvyšující se biologickou aktivitu vyjádřenou aktivitou půdních enzymů u variant
s omezeným zpracováním půdy a s podrýváním ve srovnání s klasickým zpracováním půdy
s využitím orby. Další průkazné rozdíly se týkají i některých fyzikálních charakteristik. Vedle
popsaných rozdílů mezi jednotlivými variantami agrotechniky, které byly zaznamenány v
průběhu čtyřletého sledování, je důležité zjištění týkající se aktivity půdních enzymů. Tyto
charakteristiky citlivě reagovaly na změny v půdním prostředí a potvrdila se jejich
využitelnost při sledování kvality půdy, což zapadá i do koncepce indikátorů kvality půdy.
Půdoochranné technologie jsou zaváděny i jako součást GAEC. Z našich sledování jasně
vyplývá, že tato opatření se mohou stát součástí protierozní ochrany, důležitý je ale
komplexní přístup. V něm je klíčové klást větší důraz na místní podmínky a snažit se o
navržení kombinace optimálních protierozních opatření organizačního, agrotechnického i
technického typu, čímž se podstatně zvyšuje míra ochrany zemědělské půdy. Půdoochranné
technologie jsou tedy jedním a ne jediným opatřením. Důležitým faktorem pro úspěšné
zavedení takovéhoto přístupu k protierozní ochraně do praxe musí být samozřejmě i náležitý
kontakt a komunikace s jednotlivými zemědělci a s dalšími zúčastněnými stranami (např.
zástupci obcí). Z dlouhodobého hlediska by totiž neměla být stimulem (cílem) pouze finanční
motivace v podobě dotačních plateb, ale i posun v uvažování při ochraně a udržitelném
využívání zemědělského půdního fondu, který je nutné brát v i delším časovém horizontu jako
neobnovitelný přírodní zdroj.
71
„Úroda 12/2012, vědecká příloha časopisu“
Poděkování
Autoři článku děkují Národní agentuře pro zemědělský výzkum, která umožnila studium
půdních vlastností při různých způsobech zpracování půdy a řešení problematiky eroze. Tento
výzkum byl podpořen granty QH 72039 a QJ 1230066. Děkujeme rovněž spoluřešitelům
úkolu z Výzkumného ústavu pícninářského v Troubsku a z Mendelovy univerzity v Brně za
poskytnutí některých dat.
Použitá literatura
Acosta-Martinez, V., Zobeck, T.M., Gill, T.E., Kennedy, A.C., 2003. Enzyme activities and
microbial community structure in semiarid agricultural soils. Biology and Fertility of Soils
38/4, 216-227.
Ashad, M.A., Coen, G.M., 1992. Characterization of soil quality: physical and chemical
criteria. Am. J. Altern. Agric. 7, 25-31.
Bechmann, M., Stalnacke, P., Kvoerno, S., Eggestad, H. O., Oygarden, L., 2009. Integrated
tool for risk assessment in agricultural management of soil erosion and losses of
phosphorus and nitrogen. Sci. Total Environ. 407(2), 749-759
Ferreras, L.A., Costa, J.L., Garcia, F.O., Pecorari, C., 2000. Effect of no-tillage on some soil
physical properties of a structural degraded petrocalcic paleudoll of the south “pampa” of
Argentina. Soil Till. Res. 54(1-2), 31-39.
Green, V.S., Stott, D.E., Cruz, J.C., Curi, N., 2007. Tillage impacts on soil biological activity
and aggregation in a Brazilian Cerrado Oxisol. Soil Till Res 92, 114 – 121.
Haynes, R.J., Beare, M.H., 1995. Aggregation and organic matter storage in meso-thermal
humid soils. In: Structure and Organic Matter Storage in Agricultural Soils, (ed. Carter
MR., Stewart BA.), CRC Press/Lewis Publications,Boca Raton, 213-262.
Melero, S., Porras, J.C.R., Herencia, J.F., Madejon, E., 2006. Chemical and biochemical
properties in a silty loam under conventional and organic management. Soil Tillage Res.
90 (1-2), 162-170.
Oldeman, L. R., 1994. An international methodology for an assessment of soil degradation,
land georeferenced soils and terrain data base. In: The collection and analysis of land
degradation data. FAO-RAPA Publication 1994/3, Bangkok, 35 – 60.
Pagliai, M., Vignozzi, N., Pellegrini, S., 2004. Soil structure and the effect of management
practices. Soil Tillage Res. 79, 131 – 143.
Schinner, F., Öhlinger, R., Kandeler, E., Margesin, R., eds., 1995. Methods in soil biology.
Springer, 426 p.
Šarapatka, B., Dlapa, P., Bedrna, Z., 2002. Kvalita a degradace půdy. (Soil quality and
degradation). Palacký University Press, 346 p. (in Czech).
Zbiral, J., ed., 1995 – 1997. Methods of soil analysis. Central institute for supervising and
testing in agriculture Brno. 3 parts.
Kontaktní adresa:
Prof. Dr. Ing. Bořivoj Šarapatka, CSc.,
Přírodovědecká fakulta Univerzity Palackého v Olomouci
tř. Svobody 26, 771 46 Olomouc
e-mail: [email protected]
72
„Úroda 12/2012, vědecká příloha časopisu“
VLIV HNOJENÍ A SPONU VÝSADBY NA VÝNOS NADZEMNÍ
BIOMASY A HLÍZ TOPINAMBURU
Effect of fertilization and planting density on the yield of above-ground
biomass and tubers of Jerusalem artichoke
Čížek M., Svobodová A., Čepl J.
Výzkumný ústav bramborářský Havlíčkův Brod
Abstrakt
Topinambur (Helianthus tuberosus) nepatří mezi široce pěstované plodiny. Je univerzálně použitelný,
v lidské stravě (zdroj inulinu), pro krmení hospodářských zvířat a jako energetická plodina. V polních
pokusech prováděných ve Výzkumné stanici Valečov při VÚB Havlíčkův Brod, v průběhu 2008 2011 byl sledován vliv genotypu a pěstebních technologií topinamburu. Souhrnně bylo použito 10
klonů. Sklizeň nadzemní hmoty byla provedena na podzim, hlízy byly sklizeny na jaře. V závislosti na
roce a klonu, výnosy nadzemní části dosáhly 15,3 - 71,9 t čerstvé hmoty/ha (5,4 - 24,7 t
sušiny/ha).Výnos na jaře sklizených hlíz se pohyboval mezi 17,0 a 63,8 t/ha (4,4 - 7,9 t sušiny/ha).
Byly ověřeny pěstební technologie topinamburu ve vztahu k optimalizaci porostů pro získání
vysokých výnosů. Nejúčinnější variantou hnojení bylo 100 kg N/ha a foliární aplikace močoviny, mezi
spony výsadby (hustotou porostu) nebyly zaznamenány statisticky významné rozdíly ve výnosu
nadzemní biomasy a hlíz topinamburu.
Klíčová slova: topinambur; hlízy; klony; hnojení; spony výsadby
Abstract
Jerusalem artichoke (Helianthus tuberosus) is a not widely grown crop. It is universally usable, in
human diet (source of inulin), for livestock feeding and as an energy crop. In field trials performed in
Valecov Research Station belonging to PRI Havlickuv Brod, during 2008 – 2011 an effect of genotype
and growing technology was studied on Jerusalem artichoke production characteristics. Totally, 10
clones were used. The harvest of aboveground mass was done in autumn, tubers were harvested in
spring (though deep soil freezing, the tubers are not frost-killed). In dependence on year and clone,
yields of aboveground part reached 15,3 – 71,9 t FW/ha (5,4 – 24,7 t DW/ha). The yield of springharvested tubers ranged between 17,0 and 63,3 t/ha (4,4 – 7,9 t DW/ha). Growing technologies for
Jerusalem artichoke were verified, in relation to optimization of cultural practices for obtaining high
yields. The most effective fertilization variant was 100 kg N/ha and foliar application of urea, between
planting densities no significant differences were recorded for yields.
Key words: Jerusalem artichoke; tubers; clone; fertilization; planting densities
Úvod
Topinambur hlíznatý (Helianthus tuberosus L.) pochází ze Severní Ameriky, do Evropy byl
dovezen v 16 století z Mexika. Topinambur je všestranně využitelný a to jak k lidské výživě a
ke krmení hospodářských zvířat i jako energetická plodina (Čepl, 1997). V malém rozsahu je
pěstován prakticky na celém světě včetně České republiky, větším pěstitelem je Francie.
Topinambur je mohutná rostlina z čeledi hvězdnicovité (Asteraceae), vysoká přes dva metry.
Nekoření hluboko, ale má mohutnou síť kořenů, které velmi dobře resorbují vodu a živiny
z půdy. Listy má vstřícné, podlouhle vejčité, drsné, žluté květy jsou v malých úborech.
Topinambur je rostlina krátkého dne, rozkvétá pozdě na podzim (říjen, listopad), takže plody
(nažky) dozrávají jen v teplých oblastech. Hlízy jsou nepravidelné, podlouhlé, s hlubokými
očky, bílé, žluté nebo červené. Topinambur je druh nenáročný na prostředí, je velmi plastický.
Snáší vlhké i suché polohy, hlízy v půdě nejsou poškozovány ani silnými mrazy. Je vhodný
pro pěstování v horských i podhorských oblastech (Moudrý, 1996).
Nejvíce publikovaných výzkumných prací se týká využití topinamburu pro potravinářské
účely. Z hlíz topinamburu se získává polysacharid inulin, složený převážně z molekul
fruktózy (Moudrý, 1996). Inulin u rostlin z čeledi hvězdnicovitých a zvonkovitých nahrazuje
73
„Úroda 12/2012, vědecká příloha časopisu“
škrob jako zásobní látku. Inulin je cenná látka, zejména pro diabetiky. Neštěpí v tenkém
střevě, není resorbován a využíván. Jeho kalorická hodnota je velmi nízká až nulová,
nezvyšuje hladinu krevního cukru. Zároveň je sladký, dá se proto použít jako náhrada cukru
nebo jako náhrada tuku (pro nízkotučné výrobky). Odrůdy/klony topinamburu nejsou
v Evropě příliš centrem zájmu výzkumu. Je to zejména proto, že Evropský společný katalog
odrůd druhů zemědělských rostlin odrůdy topinamburu oficiálně neuvádí. V podmínkách Asie
jsou známy odrůdy, které rozdílně reagují na vodní stres (Xiuyan, Yulin), jak uvádí Zhang, et
al. (2011). Gao et al. (2011) sledoval vliv závlahy a dusíkatého hnojení na výnos biomasy
nadzemní i podzemní části rostlin topinamburu. Zaměřil se i na sledování vztahů mezi kořeny,
stonky, hlízami a listy. Průkazné rozdíly byly zjištěny pouze v podmínkách závlahy. Zatímco
Losavio et al. (1997) uvádí, že výnos hlíz topinamburu nebyl statisticky ovlivněn hnojením N,
Rodrigues et al. tvrdí, že hnojení N průkazně zvýšilo výnos hlíz topinamburu. Denoroy (1991)
uvádí jako hlavní fenologickou fází, která má vliv na výnos a kvalitu hlíz topinamburu
počátek kvetení. V České republice mají výzkumné práce týkající se topinamburu tradici.
Nejprve se jim ve větší míře zabýval Votoupal (1986), později Moudrý et al. (1996) a Čepl
(1997). V současné době jsou ve VÚB práce v rámci výzkumného projektu zaměřeny na polní
pokusy s klony a spony výsadby topinamburu, jednoleté i víceleté pěstování topinamburu a
rovněž na krmivářské využití.
Materiál a metody
Polní pokus s odrůdami a klony topinamburu a s dvěma variantami sponu výsadby byl
založen na pozemku VÚB Havlíčkův Brod ve výzkumné stanici Valečov.
Nadmořská výška: 460 m
Zemědělská výrobní oblast: bramborářská (BVT)
Průměrná roční teplota vzduchu: 7,0°C
Průměrná teplota vzduchu za vegetační období: 13,2°C
Průměrná roční suma srážek: 652 mm
Průměrná suma srážek za vegetační období: 426 mm
Odrůdy (klony) zařazené do pokusu:
Běloslupké, Reka, Refla, K 24, C63, Karina, Úrodný, Völkenroder Spindel, Lola a Gigant.
Agrotechnické zásahy byly prováděny jednotně ve všech pokusných letech. Celá pokusná
plocha byla pohnojena minerálními hnojivy. Aplikováno bylo: 2,18 q močoviny a 4,0 q
patentkali, čímž bylo dodáno 100 kg N, 120 kg K2O a 40 kg MgO na ha. Porost byl
preemergentně ošetřen herbicidem Afalon 45 SC v dávce 1,0 l/ha. Během vegetace již nebyly
provedeny žádné další agrotechnické zásahy ani nebyly aplikovány žádné další pesticidy.
Zároveň byl založen polní pokus s dvěma variantami sponů výsadby (750 x 350 mm a 750 x
700 mm). Při sponu výsadby 750 x 350 mm je počítáno 38 095 rostlin na jeden hektar; při
sponu 750 x 700 mm je počítáno 19 047 rostlin na jeden hektar. Dále byla srovnávána dávka
N 100 kg/ha se zvýšenou dávkou 200 kg N/ha a s foliární aplikací N během vegetace. Foliární
aplikace N byla provedena 9% roztokem močoviny v dávce 400 l/ha (16,56 kg N/ha) ve dvou
termínech. Pro tento pokus byla použita odrůda Karina (výnosově dlouhodobě stabilní,
příznivý tvar hlíz pro univerzální použití).
Sklizeň pokusu s odrůdami a klony topinamburu, stejně jako se spony výsadby a variantami
hnojení N byla vždy provedena na jaře následujícího roku (duben).
Pro hodnocení produkce nadzemní hmoty topinamburu byly každým rokem provedeny
odběry v listopadu před zmrznutím natě.
74
„Úroda 12/2012, vědecká příloha časopisu“
Výsledky a diskuze
Výnosová úroveň hlíz (tab. 1) jednotlivých klonů se výrazně lišila v jednotlivých ročnících
pokusu. Nejvyššího výnosu hlíz (54,3 t/ha v průměru odrůd) bylo dosaženo v roce 2008.
Rovněž v roce 2011 bylo dosaženo vysoké výnosové úrovně (47,8 t/ha v průměru odrůd).
V obou těchto letech byly pro růst a vývoj topinamburu příznivé povětrnostní podmínky.
Vývoj porostu byl ve vegetaci vyrovnaný a zejména v podzimním období (září, říjen) došlo
k vysokému nárůstu hlíz. Naproti tomu v roce 2009 byl pro vývoj porostu topinamburu méně
příznivý již začátek vegetačního období, který navíc způsobil i opožděný termín výsadby
pokusů. V roce 2010 růst výrazně ovlivnilo velmi suché období června a července (potvrzeny
závěry Gao et al. (2011) o potřebě vody pro růst topinamburu). Rovněž podzim 2010 se
vyznačoval poměrně časným nástupem minimálních nočních a ranních teplot vzduchu
s častými přízemními mrazíky, které ukončily nárůst hlíz.
Výnos hlíz jednotlivých klonů se v průměru sledovaných let pohyboval od 33,4 t/ha (Reka),
do 47, 5 t/ha (Urodny). Průměrný výnos hlíz u tohoto klonu byl statisticky průkazně vyšší ve
srovnání s ostatními sledovanými klony a rovněž u něho byl dosažen absolutně nejvyšší výnos
hlíz za sledované období - 63,8 t/ha v roce 2011. Výnos hlíz vyšší než průměr sledovaných
klonů byl dále zjištěn u klonů Gigant (43,8 t/ha), Völkenroder Spindel (43,7 t/ha) a původní
české odrůdy Běloslupké (42,3 t/ha). Naopak nejnižší průměrný výnos hlíz byl zjištěn u klonu
Reka. Tento klon se z pohledu výnosu hlíz jeví jako nestabilní, neboť ve třech ze čtyř
pokusných let (2009 a 2010) dosáhl druhého nejnižšího výnosu, v roce 2011 byl výnos jeho
hlíz nejnižší ze sledovaných klonů, zatímco v roce 2008 výnosově převyšoval průměr klonů.
Tab. 1: Vliv klonů na výnosové ukazatele topinamburu – hlízy (2008 – 2011)
Výnos hlíz
2011
Klon
2008
2009
2010
Průměr let
t/ha
t/ha
t/ha
t/ha
t/ha
51,83 abcd 42,31 a
57,74 a
28,53 cd
31,13 ab
Běloslupká
34,87 e
33,36 a
56,02 a
23,48 d
19,05 bc
Reka
52,60 abc
38,05 a
55,81 a
21,79 d
21,99 bc
Refla
36,88 e
38,35 a
59,10 a
37,36 ab
20,07 bc
K 24
52,36 abcd 37,03 a
44,91 a
33,83 abc
17,01 c
C 63
38,15 de
38,76 a
53,98 a
38,09 a
24,83 bc
Karina
63,85 a
47,49 b
48,76 a
38,27 a
39,07 a
Urodny
47,11 bcde 43,71 a
61,67 a
36,17 abc
29,88 ab
Völken. Spindel
40,92 cde
36,65 a
53,50 a
29,24 bcd
22,96 bc
Lola
59,59 ab
43,78 a
51,60 a
36,39 abc
27,52 abc
Gigant
47,82
39,95
Průměr klonů
54,31
32,32
25,35
Výnos nadzemní hmoty byl statisticky ovlivněn pěstovanými klony na hladině významnosti α
= 0,05 (obr. 1). Mezi nejvýnosnější patří klon Karina, který dosáhl v průměru let výnosu 63,8
t/ha čerstvé hmoty (20,3 t/ha sušiny). Dále se vysokou produkcí nadzemní biomasy
vyznačovaly klony K 24 a Lola, u nichž výnos čerstvé natě přesahoval 50 t/ha. Mezi
odrůdami byly značné rozdíly mezi obsahem sušiny natě v době odběru. Sušina se
pohybovala od 30,9 % (Karina) až po 68,9 % (Urodny) – tento klon spolu s klonem
označeným C 63 měly nejnižší produkci nadzemní hmoty v čerstvém stavu i její sušiny.
75
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 1 Vliv klonů na výnos nadzemní části topinamburu (a) a sušiny (b)
Současný efekt: F(9, 30)=5,8587, p=,00011
Dekompozice efektivní hypotézy
Vertikální sloupce označují 0,95 intervaly spolehlivosti
90
80
70
60
t/ha
50
40
30
20
10
0
-10
-20
Běloslupká
Refla
Reka
C63
K24
Urodny
Lola
Völken. spindel
Karina
Gigant
Odrůda
Současný efekt: F(9, 30)=4,7486, p=,00056
Dekompozice efektivní hypotézy
Vertikální sloupce označují 0,95 intervaly spolehlivosti
30
25
20
t/ha
15
10
5
0
-5
Běloslupká
Refla
Reka
C63
K24
Urodny
Lola
Völken. spindel
Karina
Gigant
Odrůda
Tab. 2 Vliv hnojení dusíkem na výnos hlíz topinamburu v průměru let 2008 – 2010
Varianty hnojení
Výnos (t/ha)
N 100
38,6 a
N 200
37,7 a
N100 + foliární apl.
39,7 a
F
p
0,227
0,978
Sledované dávky dusíku neovlivnily výnos hlíz natolik, aby byla zjištěna statistická
průkaznost (tab. 2). Základní dávka dusíku 100 kg/ha se projevila jako dostačující.
Zdvojnásobením dávky na 200 kg nebylo v podmínkách pokusu dosaženo zvýšení výnosu
hlíz. Tendenčně vyšší výnos hlíz byl každoročně zaznamenán při foliární aplikaci dusíku,
která doplňovala základní dávku 100 kg N/ha před sázením. Toto zvýšení výnosu se v
průměru pokusných let pohybovalo na úrovni 3 % bez výraznějších ročníkových výkyvů.
76
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 2 Vliv sponu výsadby na výnos hlíz topinamburu v průměru let 2008 – 2010
Krabicový graf :
Výnos hlíz
46
44
42
40
38
36
34
Výnos (t/ha)
32
30
28
26
Průměr
Průměr±SmCh
Průměr±1,96*SmCh
24
75x35
75x70
Spon
Spon výsadby ovlivnil výnos hlíz výrazně, ačkoliv průměrné výsledky za sledované období
nebyly statisticky průkazné.
Hustší spon výsadby (750 x 350 mm tj. 38 095 jedinců na ha) přinesl podstatně vyšší výnos
hlíz (v průměru variant o 7, 5 t hlíz /ha). I když lze u řidšího sponu výsadby (750 x 700 mm,
tj, 19 047 jedinců na ha) kalkulovat s polovičními náklady na sadbové hlízy, tento výnosový
rozdíl úsporu předčí. Na základě výsledků však lze konstatovat, že u sponu výsadby 750 x
350 mm není využit výnosový potenciál zařazené odrůdy topinamburu, protože průměrný
výnos hlíz z jedné rostliny byl 1,0 kg, zatímco u sponu 750 x 700 mm bylo z jedné rostliny
sklizeno 1,6 kg hlíz. Pro optimalizaci výnosu hlíz z plochy se optimální hodnota počtu rostlin
na hektar (spon výsadby) pohybuje mezi stanovenými variantami.
Závěr
Nejvyšší výnosová úroveň hlíz topinamburu byla zaznamenána u klonů Völkenroder Spindel,
Urodny a původního českého klonu Běloslupké. Nelze však konstatovat, že výnosy u těchto
tří klonů byly stabilně vysoké ve všech letech pokusu, ale z hlediska požadavků na tvorbu
biomasy hlíz je možné tyto klony doporučit jako produkčně nejvyšší.
Hmotnost nadzemní části byla nejvyšší u klonu Karina, dále Lola a K 24, z tohoto hlediska je
možné tyto klony doporučit pro energetické využití. Požadavky na univerzální využitelnost
pro produkci hlíz i nadzemní části splňují klony Karina, která má průměrný výnos hlíz, navíc
stabilní ve všech sledovaných letech. Dále klon Völkenroder Spindel, který má vysoce
nadprůměrnou produkci hlíz i vysokou produkci nadzemní biomasy.
Sledované dávky dusíku neměly vliv na výnos hlíz. Dávka dusíku 100 kg/ha se projevila jako
dostačující, zdvojnásobením dávky na 200 kg nebylo dosaženo žádného efektu. Foliární
aplikací dusíku v průběhu vegetace bylo docíleno tendenční zvýšení výnosu hlíz na úrovni 3
%.
Sponem výsadby (počtem rostlin na plochu) lze ovlivnit výnos hlíz. Ve výsledcích však
nebylo dosaženo statistické průkaznosti.
77
„Úroda 12/2012, vědecká příloha časopisu“
Dedikace
Výsledky byly získány v rámci řešení projektu NAZV QH 82075 podporovaného Mze ČR.
Použitá literatura
Conde, J.R., Tenorio, J.L., Rodriguez-maribona, B., Ayerbet, L., 1991: Tuber yields of
Jerusalem artichoke (Helianthus Tuberosus L.) in relation to water stress. Biomass and
Bioenergy, 1, 3, 137 – 142.
Čepl, J., Vacek, J., Bouma, J., 1997: Technologie pěstování a užití topinamburu. Metodiky
pro zemědělskou praxi, ÚZPI Praha 2, 20 s. ISBN 80-86153-08-8.
Denoroy, P., 1996: The crop physiology of Helianthus tuberosus L.: A model oriented view.
Biomass and Bioenergy, 11, 1, 11 – 32.
Gao K., Zhu T.X., Han G.D, 2011: Water and nitrogen interactively increased the biomass
production of Jerusalem artichoke (Helianthus tuberosus L.) in semi-arid area. African J.
Biotech. 10: 6466-6472.
Losavio, N., Lamascese, N., Vonella, A.V., 1996: Water requirements and nitrogen
fertilization in Jerusalem artichoke (Helianthus tuberosus L.) grown under Mediterranean
conditions. In Second International Symposium on Irrigation of Horticultural Crops, Vols
1 and 2, Acta Horticulturae, 449, 205 – 209, part 1 and 2.
Moudrý, J., Strašil, Z., 1996: Alternativní plodiny. JČU České Budějovice, 90 s.
Rodrigues, M.A., Sousa, L., Cabanas, J.E., Arrobas, M., 2007: Tuber yield and leaf mineral
composition of Jerusalem artichoke (Helianthus tuberosus L.) grown under different
cropping practises. Spanish Journal of Agricultural Research, 5, 4, 545 – 553.
Votoupal, B., 1986: Topinambur (Helianthus tuberosus L.). In: Špaldon E. et al.: Rostlinná
výroba. Statni zemedelske nakladatelstvi Praha, s. 568-570.
Zhang M.D., Chen Q.A., Shen S.H., 2011: Physiological responses of two Jerusalem
artichoke cultivars to drought stress induced by polyethylene glycol. Acta Physiologia
Plantarum 33: 313-318.
Kontaktní adresa:
Ing. Milan Čížek, Ph.D.
Výzkumný ústav bramborářský Havlíčkův Brod, s.r.o.
Dobrovského 2366, 580 01 Havlíčkův Brod
E-mail: [email protected]
78
„Úroda 12/2012, vědecká příloha časopisu“
DISTRIBUCE KOŘENŮ PLODIN V PŮDNÍM PROFILU A
VYUŽITELNÁ ZÁSOBA DUSÍKU A VODY
The distribution of roots in soil profile and available supply of nitrogen
and water
Haberle J., Svoboda P.
Výzkumný ústav rostlinné výroby, v.v.i., Praha
Abstrakt
V polním pokusu s ozimou pšenicí bylo určeno využití vody a minerálního dusíku z vrstev půdního
profilu do hloubky 130 cm. Byla použita bilanční metoda, odběr vody a dusíku byl vypočítán z
rozdílu zásoby na počátku jarní vegetace s nejvyšším obsahem uvedených zdrojů a obsahu ve zrání.
Byla určena hustota kořenů. Výsledky prokázaly, že v případě nedostatku dusíku nebo vody je porost
pšenice schopen využívat zásobu v hlubších vrstvách podorničí, kde je nízká hustota kořenů, pod 1
cm/cm3 půdy. Bilanční využití dostupné vody z vrstvy 10-90 cm se pohybovalo mezi 72-80%, u
dusíku to bylo 68-92%. Ve vrstvách 90-110 cm a 110-130 cm to bylo u vody 56% a 39%, u dusíku
73% a 28%. Využití dostupné zásoby obou zdrojů z podorničí bylo podobné (r > +0,94).
Klíčová slova: hustota kořenů, podorničí, minerální dusík, pšenice, efektivnost
Abstract
The utilization of nitrogen and water from layers of a soil profile to depth 130 cm was determined in
field experiment with winter wheat. The apparent depletion of water and nitrogen was calculated with
balance method, as the difference between content at the start of spring growth, with the highest
supply of the sources, and the content at the period of grain filling. Rooting depth at grain filling was
determined. The results of experiment proved that wheat crop is able to utilise supply of water and
nitrogen in deep subsoil layers with a low rooting density under 1 cm/cm3 of soil. Apparent depletion
of water from 10-90 cm layer was between 72-80%, the utilisation of nitrogen was 68-92%. The
utilisation of available water in layers 90-110 cm a 110-130 cm was 56% a 39%, and 73% a 28% of
mineral nitrogen supply at spring. The utilization of available supply of both sources from subsoil
layers was similar (r > +0,94).
Key words: root density, subsoil, mineral nitrogen, wheat, effectiveness
Úvod
Dostupnost vody a živin, především dusíku, je limitujícím faktorem výnosu plodin. Větší či
menší nedostatek vody se projevuje nepravidelně, ale často, ve většině zemědělských oblastí
České republiky, naposledy v roce 2012. Kromě specifických podmínek závlahového
hospodaření nelze množství dostupné vody pro plodiny přímo ovlivnit. Proto je nutné
studovat vliv dalších faktorů, které ovlivňují příjem a využití zásoby půdní vody kořenovým
systémem. To například umožní přesněji odhadnout nástup vodního stresu a zaměřit
agrotechniku na vhodná opatření pro šetření vodou a efektivní využití půdní zásoby. Podobně,
co největší využití minerálního dusíku z kořenové zóny zvyšuje efektivnost hnojení a snižuje
náklady na hnojení, současně snižuje obsah reziduálního N v půdě po sklizni a tím riziko jeho
vyplavení mimo dosah kořenů. Při hodnocení dostupnosti dusíku a vody v hlubších vrstvách
podorničí se často zásoba těchto zdrojů ve vrstvách s nízkou hustotou kořenů považuje za
prakticky nevyužitelnou.
Cílem této práce bylo určit schopnost porostu pšenice využívat zásobu dusíku a vody
v podorničí a určit distribuci hustoty kořenů ve vrstvách půdního profilu.
79
„Úroda 12/2012, vědecká příloha časopisu“
Materiál a metody
Polní pokus probíhal v letech 2007-2012 v Praze – Ruzyni (334 m n.m., teplá, mírně suchá
oblast, hlinito-jílovitá půda na spraši). Podrobné meteorologické údaje jsou dostupné na
http://www.vurv.cz/meteo/. Nedostatek vody byl indukován pomocí mobilního krytu (pokus
měl dále variantu s optimální dodávkou vody a kontrolu závislou pouze na srážkách). Kryt
byl používán podle potřeby, s cílem dosáhnout od počátku kvetení a dále úrovně 140-160
mm vody ve vrstvě 0-90 cm.Vlhkost půdy byla řízena na základě údajů o vlhkosti půdy,
referenční evapotranspiraci a odběru vody porostem pšenice v minulých letech. V pokusných
letech bylo sledováno více odrůd ozimé pšenice (Triticum aestivum L.), kromě roku 2007 byl
stres indukován vždy u dvou odrůd. Pro hodnocení byly použity průměrné údaje z obou
odrůd. Pšenice byla hnojena 30 kg/ha (N1) a 140 kg/ha (N2). Pokus měl čtyři opakování
(parcelky 5,5 x 6 m), u stresované varianty byla dvě opakování byla tvořena rozdělením
zakrývané plochy o velikosti 44 m2.
Obsah minerálního dusíku (Nmin= N-NO3 + N-NH4) byl určován v průběhu růstu ve vrstvě 010 cm a dále po vrstvách 20 cm do hloubky 130 cm. Fravimetrická vlhkost půdy byla
přepočtena na objemovou vlhkost na základě objemové hmotnosti půdy. Byla určena
distribuce kořenů ve fází nalévání zrna do hloubky nejméně 130 cm, kořeny se vyplavovaly
na sadě sít a po dočištění se měřila délka kořenů, hustota byla vypočtena z objemu vzorku.V
pokusech byla uplatněna běžná agrotechnika, podrobnější údaje o pokusu jsou uvedeny v
publikacích Raimanová a Haberle (2010), Haberle a Svoboda (2011) a Haberle (2010).
Práce vycházela z předpokladu, že nedostatek vody nebo dusíku, kdy není naplněn požadavek
rostlin na daný zdroj, stimuluje využití v celé kořenové zóně a indikuje tak jeho maximální
využití. Bylo vypočteno využití vody a dusíku z vrstev půdního profilu do hloubky 130 cm
bilanční metodou. Odběr vody a dusíku byl vypočítán z rozdílu zásoby na počátku jarní
vegetace, kdy je v daných podmínkách ve většině let nejvyšší obsah uvedených zdrojů a
obsahu v době nalévání zrna, kdy kořeny dosahují největší hloubky a celkové hustoty.
Maximální dostupná zásoba vody v jednotlivých vrstvách byla vypočtena jako rozdíl nejvyšší
(na jaře) a nejnižší (ve zrání) vlhkosti v dané vrstvě zaznamenané v pokusném období.
Výsledky a diskuze
Využití dusíku z půdního profilu
Obsah minerálního N (Nmin) na jaře na daném pozemku se v jednotlivých letech výrazně lišil,
jak z hlediska distribuce v půdním profilu tak celkového množství (obr.1). Podle podmínek
pro posun nitrátového N do hloubky v meziporostním období byl v některých letech největší
podíl Nmin v povrchových vrstvách a mělkém podorničí do hloubky 50 nebo 70 cm (2007-8,
2012), naopak v letech 2009-10 a 2011 byl větší podíl v hlubších vrstvách pod 50 cm. V
hlubokých vrstvách 90-110 a především 110-130 cm však byl obsah Nmin ve srovnání se
zónou do 90 cm nízký.
Obr.1 Nejnižší (Min) a nejvyšší (Max) obsah Nmin na počátku jarní vegetace (vlevo) a
průměrný obsah na jaře v době zrání (vpravo) ve vrstvách půdy v letech 2007-2012
kg N/ha
kg N/ha
0
20
40
60
80
0
10
20
30
40
50
Vrstva (cm)
0 -10
10 -30
30 -50
50 -70
70 -90
90-110
Jaro
Min
Zrání N1
Max
Zrání N2
110-130
80
60
„Úroda 12/2012, vědecká příloha časopisu“
Nejvyšší úbytek (na základě bilance), který hodnotíme jako N odebraný rostlinami, byl v zóně
30-90 m, což odpovídá vysokým hodnotám obsahu na jaře před počátkem hlavního období
růstu (obr.1 a 2). Relativní vyjádření, jako podíl ze zásoby Nmin na jaře, ukázal využití 6892% z vrstvy 10-90 cm, ve vrstvách 90-110 cm a 110-130 cm to bylo 73% a 28% (obr.2).
Menší využití v ornice, v povrchové vrstvě 10 cm a částečně i ve vrstvě 10-30 cm, odpovídá
pozorovanému zvyšování obsahu Nmin v průběhu zrání ve většině let, v důsledku mineralizace
a vysychání, které zhoršuje funkce kořenů a příjem. Nižší příjem v hlubších vrstvách
odpovídá nízké hustotě kořenů, kratší době po kterou kořeny v dané vrstvě rostou a klesající
potřebě porostu. Je také patrné, že v případě dodávky N hnojením byl požadavek porostu na
příjem z podorničí menší a tedy i výsledné využití zásoby Nmin (obr.1 a 2).
Obr.2 Průměrné využití (odběr) dusíku z celkového množství minerálního N na jaře v
kg N/ha (vlevo) a využití v % z této zásoby na jaře (vpravo). Standardní odchylky jsou
vypočteny z průměrných hodnot pokusných let
kg N/ha
Vrstva (cm)
0
0 -10
10 -30
30 -50
50 -70
70 -90
90-110
110-130
10
20
%
30
N1
40
50 -20
N2
0
20
40
60
80
100
N1
N2
Dynamika minerálního dusíku v půdě je, kromě příjmu rostlinami, více či méně ovlivněna
dalšími faktory, jako je mineralizace, imobilizace, denitrifikace, transport profilem a
vyplavení. V hlubších vrstvách podorničí v daných podmínkách a v krátkém období tvorby
zrna pšenice lze předpokládat, že uvedené faktory mají na bilanci N jen malý nebo žádný vliv,
a rozhodující roli hraje příjem rostlinami (např. Kuhlman et al. 1989). Např. intenzivní odběr
vody porostem vylučuje ve většině let posun (nitrátového) dusíku do hloubky.
Využití vody z půdního profilu
Rozdíly mezi ročníky v objemové vlhkosti vrstev půdy na počátku jarního růstu (obr. 3 a 4)
nebyly tak výrazné jako u minerálního dusíku. Obsah dosahoval ve většině vrstev hodnot
okolo 32%. Podobné hodnoty v ornici a podorničí jsou v souladu s podobným zrnitostním
složením vrstev půdy pokusného pozemku. Hodnoty vlhkosti půdy na jaře (v případě
dostatečných srážek) se doporučuje používat jako ukazatel polní vodní kapacity, tedy
množství vody, které je půda schopna dlouhodobě zadržet. Poněkud nižší hodnoty v
povrchové vrstvě a v hlubokém podorničí v některých letech (2007, 2010) byly důsledkem
nižších podzimních a zimních srážek, vysychání povrchu půdy na jaře a počátku odběru vody
rostlinami. Je potřeba uvést, že laboratorně určené hodnoty sacího tlaku neporušených vzorků
půdy odpovídaly vyšším hodnotám polní vodní kapacity. Vzorky byly odebírány na tomto
pozemku v roce 2000, důvod vyšších hodnot vodní kapacity je neznámý, ale rozpor mezi
laboratorními a empiricky určenými hodnotami je zmiňován i dalšími autory.
81
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 3 Nejvyšší (Max) a nejnižší (Min) hodnoty obsahu vody ve vrstvách půdního
profilu na počátku jarní vegetace zaznamenané v letech 2007-2012
% obj.
0
10
20
30
40
50
0-10
Vrstva (cm)
10-30
30-50
Min
Max
50-70
70-90
90-110
110-130
Míru vyčerpání dostupné vody ukazuje obrázek 4. Ročníková variabilita byla zřejmě
způsobena odlišným požadavkem porostu na vodu a zásobou vody v hlubších vrstvách (pod
90 cm). To dokumentují nízké hodnoty v suchém a nadprůměrně teplém ročníku 2007
(neprezentováno).
Vysoký požadavek porostu na vodu, který stimuloval maximální využití zásoby v kořenové
zóně, byl výsledkem nedostatku vody v horních vrstvách půdy, indukovaný pomocí zakrývání
porostu mobilním krytem. Průměrná vlhkost půdy na jaře a v době zrání v letech 2007-2012
ukazuje podobné odčerpání vody ve vrstvách do hloubky 90 cm, 72-80% (obr.5). Nižší
využití zásoby vody bylo ve vrstvě 90-110 cm a především 110-130 cm. Přesto i v těchto
vrstvách průměrné bilanční využití vody činí 56% a 39% z dostupné zásoby (počítané jako
rozdíl nejvyšší a nejnižší vlhkosti zaznamenané v dané vrstvě v pokusném období).
Využití zásoby vody a dusíku v podorničních vrstvách půdního profilu bylo podobné, jak
ukazuje vysoká hodnota lineární korelace odpovídajících hodnot v jednotlivých vrstvách
(r>0,94) (obr.6). Pouze v povrchové vrstvě na variantě hnojené dusíkatými hnojivy byl obsah
N v době zrání vyšší než na jaře, zřejmě jako důsledek mineralizace a nevyčerpání N z hnojiv
(obr.1 a 2).
Obr. 4 Průměrný obsah vody na počátku jarní vegetace (jaro) a v době zrání (léto) v
pokusných letech. Standardní odchylky jsou vypočteny z průměrných hodnot
pokusných let
% obj.
0
5
10
15
20
25
30
35
40
Vrstva (cm)
0-10
10-30
30-50
50-70
70-90
90-110
Jaro
110-130
Léto
Uvedené údaje představují potenciální využití vody a N z kořenové zóny v případě
nedostatku, tedy za podmínek, kdy již dochází k redukci výnosu. Tyto údaje umožňují
zpřesnit nastavení hnojení dusíkem a zvýšit efektivnost jeho využití z půdní zásoby. Z
hlediska využití vody jsou výsledky použitelné pro zpřesnění dostupné zásoby vody a
predikci nástupu nedostatku vody.
82
„Úroda 12/2012, vědecká příloha časopisu“
Obr.5 Průměrné využití (odběr) vody z celkového množství vody na jaře v mm a v % z
této zásoby na jaře (vlevo) a průměrné využití z dostupné zásoby (počítané jako rozdíl
nejvyšší a nejnižší vlhkosti v dané vrstvě v pokusném období) (vpravo). Standardní
odchylky jsou vypočteny z průměrných hodnot pokusných let
mm., %
0
10
20
% obj., %
30
40
50
60
0
20
40
60
80
100
0-10
Vrstva (cm)
10-30
30-50
50-70
70-90
90-110
mm
110-130
%
% obj.
%
Obr. 6 Vztah relativního využití dostupné zásoby dusíku a vody z vrstev půdního profilu
(regresní křivky jsou vypočteny bez údajů pro ornici)
60,0
využití vody (%)
y = 0,5785x + 8,5769
R2 = 0,9669
40,0
N1
N2
ornice N1
ornice N2
20,0
y = 0,3765x + 10,163
R2 = 0,8866
0,0
-20,0
0,0
20,0
40,0
60,0
80,0
100,0
využití dusíku (%)
Distribuce a hustota kořenů v půdním profilu
Rozdělení kořenů ozimé pšenice v půdním profilu mělo obvyklý tvar, vysoká hustota kořenů
v ornici a postupný pokles s hloubkou (Svoboda, Haberle 2006). Ročníkovou variabilitu
ukazuje obrázek 7, i přes tyto rozdíly mezi roky byl uvedený tvar distribuce kořenů vždy
podobný. Vztah mezi rozdíly v distribuci kořenů a využitím vody a dusíku v jednotlivých
letech nebyl průkazný. To ukazuje, že odběr z podorničí v období tvorby zrna je výsledkem
více faktorů, podmínek ve vegetativní fázi, hustoty kořenů, růstu nadzemních částí a potřeby
dusíku a vody, který závisí na dalších podmínkách. Distribuce kořenů, s průměrnou hustotou
pod 1cm/cm3 půdy ve vrstvách pod 100 cm odpovídá obecně menšímu využití vody a dusíku
z těchto hlubokých vrstev. Současně zde působí časový a prostorový faktor, kořeny se
dostávají do nejhlubších vrstev pozdě, až v průběhu zrání, kdy už je požadavek na zdroje
nižší. Jde také o nejmladší kořeny, které nejsou rozvětvené nebo jen v omezené míře, což
redukuje schopnost plně využít zdroje. Kořeny také v těchto vrstvách často využívají pro růst
biopóry, s menším odporem k pronikání, kde může být zhoršený kontakt s okolní půdou.
Na druhou stranu se uplatňuje i difúze vody i nitrátových iontů ke kořenům z hlubších vrstev.
Rychlost difúze je vysoká při strmém gradientu koncentrace nebo sacího tlaku, proto je v
83
„Úroda 12/2012, vědecká příloha časopisu“
daných podmínkách význam tohoto jevu (na rozdíl například od situace s vysokou hladinou
spodní vody) pravděpodobně malý.
Závěr
Výsledky sledování potvrdily, že bilanční odběr vody a dusíku z hlubokých vrstev podorničí
odpovídá distribuci kořenů a porost pšenice využívá, v případě nedostatku, tyto zdroje i z
vrstev s nízkou hustotou kořenů, pod 1cm/cm3 půdy.
Obr. 7 Distribuce kořenů ozimé pšenice. Průměrné, nejmenší (Min) a nejvyšší (Max)
hodnoty hustoty kořenů zaznamenané v letech 2007-2012
cm/cm3
0,0
2,0
4,0
6,0
8,0
10,0
12,0
Min
Max
14,0
16,0
0-10
Vrstva (cm)
10-20
20-30
30-40
40-50
Průměr
50-60
60-70
70-80
80-90
90-100
100-110
110-120
120-130
Dedikace: Příspěvek byl připraven s podporou projektu NAZV QI111C080 a Výzkumného
záměru VÚRV MZE0002700604.
Použitá literatura
Raimanová I., Haberle J. (2010): The effects of differentiated water supply after anthesis and
nitrogen fertilization on δ15N of wheat grain. Rapid Commun. Mass Spectrom, 24: 261–
266.
Haberle J. (2010): Simulace vlivu diferencované zásoby vody po kvetení na výnos zrna ozimé
pšenic. In: „Bioklima 2010, Bioklíma 2010“, Praha 7. až 9. 9. 2010, 85-90 (CD). (ISBN:
978-80-213-2097-0).
Haberle J., Svoboda P. (2011): Observed and simulated depletion of mineral nitrogen by
winter wheat from soil profile. In: Škarpa, P. (ed.) Soil, Plant and Food Interactions
Mendelova univerzita v Brně, Brno, 2011, 131 – 135.
Kuhlman H., Barraclough P.B., Weir A.H. (1989): Utilization of mineral nitrogen in the
subsoil by winter wheat. Z. Pflanzenernaehr. Bodenk., 152: 291-295.
Svoboda P., Haberle J. (2006): The effect of nitrogen fertilization on root distribution of
winter wheat. Plant, Soil and Environment, 52: 308-313.
Kontaktní adresa:
Ing. Jan Haberle, CSc., Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507, 161 06 Praha 6 - Ruzyně
[email protected]
84
„Úroda 12/2012, vědecká příloha časopisu“
ZLEPŠENÍ PŮDNÍCH VLASTNOSTÍ POMOCÍ
APLIKACE PODPŮRNÉHO PŘÍPRAVKU
Badalíková B.
Zemědělský výzkum spol. s r.o. Troubsko
Abstrakt
V letech 2011–2012 byl sledován vliv pomocného půdního přípravku na bázi organického materiálu a
přídavných živin na půdní prostředí. Z výsledků bylo zjištěno, že přípravek měl pozitivní vliv na
snížení utužení půdy, zvýšení půdní vlhkosti, lepší strukturotvornosti a zvýšení obsahu humusu
v půdě. Také výnosy byly vyšší u variant s aplikací tohoto přípravku.
Klíčová slova: půdní přípravek, fyzikální vlastnosti půdy, vlhkost půdy, půdní struktura, obsah
humusu v půdě, výnosy kukuřice na zrno
Absract
During year 2011–2012 was followed influence of subsidiary soil preparation on the soil environment.
This preparation is on the base of organic matter and additional nutrient. It was found from results that
preparation have positive effect on decrease of soil compaction, increase of soil moisture, better
structure formation and increase of humus content in soil. Also the yields were higher in variants with
application of this preparation.
Key words: soil preparation, physical soil properties, soil moisture, soil structure, humus content in
soil, grain maize yields
Úvod
Mechanizmy degradace půd jsou v podstatě dvojí: přirozené, související s půdotvornými
procesy a s vlivem nejrůznějších faktorů prostředí na půdy a jejich vývoj, např. pozvolné
změny půdní textury i struktury, vymývání látek a přesuny koloidů v půdním profilu, změny v
množství půdních organismů a struktuře jejich společenstev a mechanizmy spjaté s činností
člověka. Zatímco přirozené mechanizmy degradace půd může člověk většinou ovlivnit jen
málo nebo vůbec, člověkem vyvolané mechanizmy degradace půd jsou (alespoň teoreticky) v
rukou člověka – může je potlačit nebo naopak zesílit (Vopravil a kol., 2010). Tak jako půdy
nejsou jen kvalitní nebo nekvalitní, také degradace půdy nabývá různého stupně.
Zjednodušeně však lze říci, že vše, co snižuje kvalitu půdy, je degradací půdy. Z definice
kvality půdy (např. Doran, Safley, 1997) vyplývá, že aby půda mohla být označena za
„kvalitní“, musí plnit své přirozené funkce. Salvati, Carlucci (2009) ve své práci ilustrují
proceduru dvoustupňového principu měření půdní degradace z pohledu rizika pro
zemědělství, která odhaduje potenciální náklady spojené s půdní degradací. Jednou z příčin
degradace půdy je její utužení nebo-li zhutnění. Jak uvádí Wang a kol. (2010) stupeň utužení
půdy je ovlivněn mnoha faktory, k nimž patří zejména půdní druh, vlhkost půdy, obsah a
kvalita organické hmoty a stupeň prokořenění. Pedokompakci můžeme omezovat správnou
strukturou plodin v osevních postupech, dostatečným organickým hnojením a vápněním.
Dobrým zásobováním organickou hmotou se rozvíjí mikrobiální život v půdě, který ovlivňuje
velikost utužení půdy (Novosádová a kol., 2010). Cílem je zachování, resp. zvyšování obsahu
humusu v půdě. Tam, kde se nedostává organického materiálu z posklizňových zbytků nebo
z nedostatku hnoje nastupuje pomocný půdní přípravek PRP SOL, který může nahradit
zmíněné nedostatky (Václavík, Petrtýl, 2009).
Materiál a metody
V rámci sledování vlivu pomocného půdního přípravku na bázi organického materiálu a
přídavných živin (PRP SOL) na půdní prostředí byl založen v roce 2011 poloprovozní pokus
na pozemcích Agrocentra v Hrušovanech nad Jevišovkou v katastru obce Litobratřice.
85
„Úroda 12/2012, vědecká příloha časopisu“
Hodnocené výsledky byly získány během let 2011 a 2012. Odběry vzorků půd byly
realizovány vždy na začátku a na konci vegetačního období. V rámci hodnocení vlivu
aplikace a dávek PRP SOL na půdní prostředí byly založeny čtyři pokusné varianty:
A Varianta kontrolní – bez PRP SOL pouze minerální hnojení N na široko, P pod patu
B Varianta N + 100 kg přípravku PRP SOL, aplikace pod patu, bez P a K
C Varianta N + 150 kg přípravku PRP SOL, aplikace pod patu, bez P a K
D Varianta N + 150 kg přípravku PRP SOL, aplikace na široko, bez P a K
Na pokusném pozemku byla opakovaně pěstována kukuřice na zrno.
U každé varianty byly sledovány fyzikální vlastnosti půdy pomocí válečků dle Kopeckého z
hloubek 0-0,10, 0,10-0,20 a 0,20-0,30 m v pěti opakováních, dále půdní struktura, která byla
stanovena prosíváním suché zeminy na sítech o otvorech 0,25, 0,5, 2, 5, 10, 20 mm ze dvou
hloubek 0-0,15 a 0,15-0,30 m ve třech opakováních, kde pro vlastní hodnocení byl vypočítán
koeficient strukturnosti, který vyjadřuje vztah mezi agronomicky hodnotnými (0,25-10 mm) a
méně hodnotnými strukturními elementy (>10 a <0,25 mm), hmotnostní vlhkost půdy
zjišťována gravimetrickou metodou, obsah humusu, resp. Cox, byl stanoven metodou
upravenou dle Nováka a výnosy kukuřice přepočtené na standardní vlhkost 14%.
Charakteristika stanoviště
Klimatické podmínky: stanoviště se nachází v kukuřičné výrobní oblasti, v nadmořské výšce
210 m a patří do klimatické oblasti T4 - nejteplejší. Uplatňuje se zde srážkový stín
Českomoravské vrchoviny. Srážky se pohybují v průměru kolem 461 mm, z toho během
vegetace 302,3 mm. Průměrná roční teplota činí 8,9 °C, z toho ve vegetačním období 15,3°C.
Půdní podmínky: černozem modální na spraši, středně těžká až těžká, zrnitostně hlinitá až
jílovitohlinitá půda, orniční horizont sahá do 40 cm.
V grafech 1 a 2 je grafické znázornění průběhu počasí v oblasti stanoviště v Litobratřicích
během sledovaných let.
Graf 1: Průměrné měsíční teploty
Graf 2: Průměrný měsíční úhrn srážek
160
140
120
100
mm
0C
Litobratřice 2011-2012
24
22
20
18
16
14
12
10
8
6
4
2
0
-2
-4
2011
2012
80
60
2011
40
2012
20
0
I
II
III
IV
V
VI
VII
VIII
I
IX
II
III
IV
V
VI VII VIII IX
Měsíce
Měsíce
Výsledky a diskuze
Z hlediska zachování kvality půdy bylo v pokusu sledováno působení půdního přípravku PRP
SOL, který je směsí vápenatých a hořečnatých uhličitanů, vyváženého poměru mikroprvků a
rostlinného pojiva. Současně je známo, že rozšíření biologické diverzity a nárůst mikrobiální
aktivity pomáhá zlepšit činnost mikro a makrofauny, transformační cykly organické hmoty,
geochemické cykly prvků (uhlík, dusík, fosfor…), strukturu půdy a v neposlední řadě rozvoj
vegetace (Václavík, Petrtýl, 2009).
86
„Úroda 12/2012, vědecká příloha časopisu“
Hodnoty fyzikálních vlastností půdy jsou uvedeny v tabulkách 1 a 2. Výchozí hodnoty v roce
2011 korespondují se založenými variantami. Z hodnot lze usoudit, že varianty se
zapraveným přípravkem byly méně utužené, což dokazují hodnoty objemové hmotnosti
redukované (OHr). U varianty A byla hodnota OHr nejvyšší a nejnižší pórovitost. To se
projevilo i na minimální vzdušné kapacitě, která byla nejnižší a momentálním objemu
vzduchu. Nejlepší vlastnosti vykazovala varianta C s vyšší dávkou zapraveného přípravku do
půdy.
Tab. 1: Fyzikální vlastnosti půdy - Litobratřice 2011
(m)
Objemová
hmotnost red.
-3
(g.cm )
Celková
pórovitost
(%)
0 - 0,1
0,1 - 0,2
0,2 - 0,3
0 - 0,3
0 - 0,1
0,1 - 0,2
0,2 - 0,3
0 - 0,3
0 - 0,1
0,1 - 0,2
0,2 - 0,3
0 - 0,3
0 - 0,1
0,1 - 0,2
0,2 - 0,3
0 - 0,3
1,37
1,57
1,54
1,50
1,33
1,42
1,36
1,37
1,27
1,39
1,39
1,35
1,20
1,33
1,43
1,32
48,70
41,05
42,89
44,21
49,98
46,94
48,70
48,54
52,40
48,11
47,71
49,41
54,93
50,18
46,26
50,46
Hloubka
varianta
A
B
C
D
Momentální obsah
vody
31,00
29,02
25,48
28,50
31,38
28,06
24,34
27,93
31,91
35,68
33,84
33,81
28,60
25,10
25,70
26,47
vzduchu
%obj.
17,70
12,03
17,41
15,71
18,60
18,87
24,36
20,61
20,49
12,43
13,88
15,60
26,34
25,08
20,56
23,99
Max.kapilár.
kapacita
Min.vzduš.
kapacita
%obj.
33,97
33,00
32,47
33,15
36,87
35,52
34,96
35,79
39,41
33,55
35,10
36,02
39,34
33,74
33,85
35,65
14,73
8,05
10,41
11,07
13,11
11,41
13,74
12,75
13,00
14,56
12,61
13,39
15,60
16,44
12,41
14,81
V roce 2012 (tab. 2) byla opět nejvyšší OHr u varianty A a nejnižší u varianty C, což
korelovalo s ostatními sledovanými veličinami fyzikálních vlastností půdy. Obsah celkové
pórovitosti, momentální objem vody i min. vzdušná kapacita byla nejlepší u varianty C.
Největší rozdíly OHr byly zaznamenány mezi orniční vrstvou a podorničím. Z hodnot je
patrné, že půdní přípravek působí pozitivně na provzdušněnosti a nižší utuženost orniční
vrstvy. To potvrdili i Straková a kol. (2010), kteří ve své práci popisují zlepšení půdních
vlastností pomocí aplikace půdních kondicionérů a dalších pomocných látek. Limit u
hlinitých půd podle Lhotského (2000) 1,45 g.cm-3 byl překročen v podorničí u varianty A, a to
v obou letech.
Tab. 2: Fyzikální vlastnosti půdy - Litobratřice 2012
varianta
A
B
C
D
Hloubka
půdy
(m)
Objemová
hmotnost red.
(g.cm-3)
Celková
pórovitost
(%)
0 - 0,1
0,1 - 0,2
0,2 - 0,3
0 - 0,3
0 - 0,1
0,1 - 0,2
0,2 - 0,3
0 - 0,3
0 - 0,1
0,1 - 0,2
0,2 - 0,3
0 - 0,3
0 - 0,1
0,1 - 0,2
0,2 - 0,3
0 - 0,3
1,29
1,49
1,57
1,45
1,20
1,37
1,48
1,35
1,19
1,37
1,47
1,34
1,32
1,49
1,43
1,42
51,67
44,13
40,93
45,58
55,08
48,76
45,12
49,65
55,26
48,52
44,92
49,57
50,24
44,08
46,07
46,79
87
Momentální obsah
vody
10,75
20,94
24,92
18,87
16,37
21,80
23,38
20,52
16,20
21,98
23,94
20,71
18,69
24,47
21,94
21,70
vzduchu
%obj.
40,92
23,19
16,01
26,71
38,72
26,96
21,74
29,14
39,05
26,54
20,98
28,86
31,55
19,60
24,13
25,09
Max.kapilár.
kapacita
Min.vzduš.
kapacita
%obj.
36,98
34,84
34,65
35,49
42,23
37,16
35,40
38,26
40,55
35,12
33,88
36,52
39,34
35,54
36,60
37,16
14,69
9,28
6,28
10,08
12,85
11,60
9,72
11,39
14,71
13,40
11,04
13,05
10,89
8,54
9,47
9,63
„Úroda 12/2012, vědecká příloha časopisu“
V grafu 3 jsou znázorněny hodnoty koeficientu strukturnosti zjištěného z hodnot půdní
struktury na jednotlivých sítech. V roce 2012 byly zjištěny mírně zvýšené hodnoty koeficientu
strukturnosti u variant A, B, C. U varianty D došlo k mírnému poklesu koeficientu,
pravděpodobně kvůli odlišné aplikaci pomocného přípravku (aplikace na široko), což
v suchém roce 2012 ke zlepšení půdní struktury nepřispělo. Zlepšení struktury bylo
zaznamenáno u variant B a C oproti roku 2011 vzhledem k zapravení přípravku do půdy. Je
tedy patrné, že půdní přípravek zapravený do ornice pozitivně ovlivňuje strukturotvornost. Co
se týče půdního profilu, vyšší koeficient strukturnosti byl zaznamenán ve svrchní vrstvě půdy
u všech variant mimo variantu A (kontrolní).
koeficient strukturnosti
Graf. 3: Koeficient strukturnosti – Litobratřice, 2011- 2012
2,50
2,25
2,00
1,75
1,50
1,25
1,00
0,75
0,50
0,25
0,00
2011
2012
A
B
C
D
Varianty
Graf 4 představuje průměrné hodnoty vlhkosti půdy v hmotnostních procentech, které byly
měřené na začátku a na konci vegetace u jednotlivých variant. Vlhkost půdy hmotností
koreluje s vlhkostí objemovou (viz tab. 1, 2), kde jsou vypočteny skutečné obsahy půdní
vody. Z grafu je patrná nižší vlhkost půdy v roce 2012 oproti roku 2011 v důsledku nižšího
úhrnu srážek v tomto roce, což se následně projevilo na ostatních půdních vlastnostech i na
výnosech. Varianty se zapraveným půdním prostředkem vykazují vyšší nárůst vlhkosti
v orničním profilu.
Graf 4: Vlhkosti půdy - Litobratřice, 2011-2012
26,00
24,00
% hmot.
22,00
20,00
2011
18,00
2012
16,00
14,00
12,00
10,00
A
B
C
D
Varianty
88
„Úroda 12/2012, vědecká příloha časopisu“
V grafu 5 jsou znázorněny výnosy kukuřice na zrno. Z výsledků vyplývá, že u variant
s vyšším podílem půdního přípravku (var. C, D) byly výnosy vyšší oproti kontrole (var. A). Z
grafu je také patrné, že výnosy v roce 2012 byly nižší ve srovnání s rokem 2011, vzhledem
k vývoji počasí od počátku vegetace. Rok 2012 se vyznačoval nedostatkem vodních srážek již
při vzcházení, prudkým snížením teplot od poloviny dubna a v polovině května a nástupem
vysokých teplot v průběhu dalších měsíců. Přesto se pozitivně projevil půdní přípravek ve
výši výnosů, a to u varianty B o 6 %, u varianty C o 33 % a u varianty D o 27 %. Snížení
výnosů bylo způsobeno nejen nevyrovnaností a nízkými vodními srážkami, ale především
snižováním obsahu vzduchu v kořenové zóně, což se potvrdilo u varianty A bez podpůrného
přípravku. Byla také potvrzena spojitost s maximální kapilární kapacitou a absolutní
vzdušností, které ovlivňovaly celkovou pórovitost. Na základě toho lze konstatovat, že
zhoršení fyzikálních vlastností změnou distribuce pórů vede k poklesu výnosů (Pokorný,
2011).
Graf 5: Výnosy kukuřice na zrno
Tab. 3: Obsah humusu
Litobratřice, 2011-2012
varianta
hloubka
(m)
0 - 0,15
A
Varianty
D
C
2011
3,0
4,0
5,0
6,0
7,0
8,0
9,0 10,0 11,0 12,0 13,0
t.ha-1
1,69
1,37
1,53
1,67
1,39
1,53
0 - 0,15
0,15 - 0,30
průměr
1,64
1,45
1,74
1,51
1,55
1,63
C
0 - 0,15
0,15 - 0,30
průměr
1,38
0,92
1,88
1,45
1,15
1,67
D
0 - 0,15
0,15 - 0,30
průměr
1,57
1,38
1,62
1,55
1,48
1,59
A
2,0
2012
B
2012
B
0,15 - 0,30
průměr
2011
V tabulce 3 jsou uvedeny hodnoty obsahu humusu (přepočteného Cox). Během dvou let se
významně změnil obsah humusu u variant s vyšší dávkou zapraveného půdního přípravku
(var. C). Půdní přípravek PRP SOL může zlepšit rozklad a využití živin z organických hnojiv,
která pak mohou do jisté míry nahradit produkci statkových hnojiv z živočišné výroby,
kterých značně ubývá. Při použití přípravku PRP SOL jako pomocné látky je důležité stanovit
nejen množství, ale i způsob aplikace v zájmu řízení nákladů na plodinové zastoupení.
Závěr
Z dvouletého hodnocení aplikace podpůrného půdního přípravku bylo zjištěno, že došlo
k poklesu objemové hmotnosti v ornici a mírně i v podorničí, pórovitost byla vyšší u variant
se zapraveným půdním přípravkem, objem vody a vzduchu koreloval s pórovitostí, struktura
půdy dle zjištěného koeficientu strukturnosti se v druhém roce nepatrně zvýšila hlavně u
variant se zapraveným přípravkem, vlhkost půdy se zvyšovala se zvýšenou aplikací přípravku,
výnosy byly nižší v roce 2012 v důsledku špatných klimatických podmínek, současně však
byly vyšší v obou letech u variant s aplikací podpůrného přípravku. Také byl zjištěn kladný
vztah mezi výnosem, podpůrným přípravkem a počasím. Obsah humusu byl prokázán vyšší u
variant s aplikací vyšší dávky podpůrného přípravku.
Z výsledků je tedy patrné, že podpůrný půdní přípravek působí pozitivně na provzdušněnost
půdy a snižování jejího utužení, na zvyšování organické hmoty v půdě a na vyšší výnosy zrna
kukuřice.
89
„Úroda 12/2012, vědecká příloha časopisu“
Dedikace
Výsledky byly získány za (částečné) institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace a v rámci mezinárodního projektu pro „Porovnání různých dávek a
způsobů aplikace přípravku PRP SOL“
Použitá literatura
Doran, J.W. and Safley, M., 1997: Defining and assessing soil health and
sustainableproductivity. In: Pankhurst, C. et al. (eds.). Biological indicators of soil
health.Wallingford, UK: CAB International. p. 1–28.
Lhotský, J., 2000: Zhutnění půd a opatření proti němu. Studijní zpráva UZPI Praha , 61s.
Novosádová, I., Záhora, J., Sinoga, J.D.R., 2010: Mikrobiální přeměny dusíku v degradované
půdě semiaridního klimatu. In Brtnický, M., Brtnická, H., Foukalová, J., Kynický, J.,
Micková, Ž. Degradace a regenerace krajiny a dílčích krajinných sfér. Mendelova
univerzita v Brně, 1. vyd., s. 27. ISBN 978-80-7375-456-3
Pokorný, E., Střalková R., Brtnický, M., Foukalová, J., Denešová O., Podešvová, J., 2011:
Monografie „Analýza dlouhodobých srážkových a teplotních řad a hodnocení jejich
dopadu na změny vlastností půd vybraného agroekosystému“, Mendelova univerzita
v Brně, 1. vyd., 118 s. ISBN 978-80-7375-584-3
Salvati, L., Carlucci, :M., 2009: Estimating land degradation risk for agriculture in Italy using
an indirect approach. Ecological Economics 69, Issue 3, s. 511-518
Straková, M., Salaš, P., Kohut, M., Pekař, M., Ševčíková, M., Pelikán, J., 2010. Studium
problematiky biologické degradace půdy v podmínkách aridního klimatu. Úroda 12,,
Vědecká příloha „Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování
produktů,“ s. 545-548, ISSN 0139-6013
Václavík, F., Petrtýl, I., 2009: Alternativní zdroje živin a dopad na půdní vlastnosti. Úroda
12, Vědecká příloha „Aktuální poznatky v pěstování, šlechtění, ochraně rostlin
a zpracování produktů,“ s. 501-508, ISSN: 0139–6013
Vopravil, J., Vrabcová, T., Khel, T., Novotný, I., Manýrová, J., 2010: Vývoj a degradace půd
v podmínkách očekávaných změn klimatu. Rožnovský, J., Litschmann, T. (ed): Voda
v Krajině, s. 24, ISBN 978-80-86690-79-7
Wang, J., He, T., Chunyan, Lv., Yonggi, Ch., Wu, J., 2010: Mapping soil organic matter
based on land degradation spectral response units using Hyperion images. International
Journal of Applien Earth Observation and Geoinformation 12, Supplement 2, s. 171-180
Kontaktní adresa:
Ing. Barbora Badalíková
Zemědělský výzkum, spol. s r. o.
Zahradní 1, 664 41 Troubsko
e-mail: [email protected]
90
„Úroda 12/2012, vědecká příloha časopisu“
VĚTRNÁ EROZE NA JIŽNÍ MORAVĚ – POTENCIÁL, MONITORING,
ÚČINNOST BIOTECHNICKÝCH OPATŘENÍ
Wind erosion in South Moravia – potential, monitoring, the effectiveness of
biotechnical measures
Středová H.1, Středa T. 1, Podhrázská J.2
1
2
Mendelova univerzita v Brně,
Výzkumný ústav meliorací a ochrany půdy
Abstrakt
Na základě aktuálních půdních a klimatických podmínek byla pro území jižní Moravy definována
potenciální ohroženost půd větrnou erozí. Nejrizikovějšími oblastmi jsou lokality s lehkými písčitými
půdami v teplých a suchých oblastech. Pro relativní kvantifikaci množství unášených půdních částic a
jejich analýzu bylo modifikováno a otestováno zařízení – deflametr. Deflametrické záznamy byly
následně vyhodnoceny digitální analýzou obrazu a byla provedena analýza velikostního spektra
zachycených erodovaných částic. V polních podmínkách byla hodnocena protierozní účinnost
biotechnických opatření. Hodnocení účinnosti větrolamů bylo založeno vztahu mezi jejich optickou
porozitou a redukcí větru na návětrné a závětrné straně větrolamu.
Klíčová slova: větrná eroze, deflametr, větrolam, optická porozita
Abstract
Soil wind erosion risk in South Moravia was defined based on actual soil and climatic conditions. Soil
type plays a big part in assessing the susceptibility to erosion. As the most vulnerable soils are
considered light, drying soils with low amount of clay particles in dry and warm territories. A relative
quantification of discharged soil particles and their analysis was assessed by deflameter – the
equipment for the soil particles capturing. The effectiveness of biotechnical erosion control measures
was evaluated by direct measurement of wind parameters in field conditions. Determination of
aerodynamic parameters of windbreak was based on their optical porosity.
Key words: Wind erosion, deflameter, windreak, optical porosity
Úvod
Větrná eroze nepředstavuje plošně tak velké riziko jako eroze vodní, avšak celosvětově je jí
alespoň částečně poškozeno asi 500 milionů hektarů. K oblastem nejvíce postihovaným
větrnou erozí patří aridní a semiaridní části severní Afriky; Blízký východ; části východní,
střední a jižní Asie; severovýchodní Čína; Austrálie; jih jižní Ameriky i Severní Amerika. Jen
v USA je větrnou erozí ohroženo 30 milionů hektarů (Toy et al., 2002) V České republice je
větrnou erozí ohroženo téměř 29 % zemědělské půdy, přičemž na Moravě je to asi 40 % a
v Čechách 23 % (Pasák, 1984). Větrná eroze se vyskytuje především v území, kde je počasí
charakterizováno nízkými a proměnlivými srážkami, proměnlivou a vysokou rychlostí větru,
častým výskytem sucha, rychlými a extrémními změnami teploty a vysokým výparem. Větrná
eroze obnažuje podorničí s nízkou přirozenou úrodností a vyšší kyselostí, způsobuje škody
nejen v zemědělství odnosem ornice, hnojiv, osiv a poškozováním zemědělských plodin a
půdy, ale zanášením komunikací a vodních recipientů, podílí se také na eutrofizaci vod a na
znečištění ovzduší. Přenášený prach přispívá k riziku vzniku respiračních onemocnění
(Riksen et al., 2001). Dlouhodobým působením eroze se mění kvantitativní i kvalitativní
vlastnosti půd.
K nejúčinnějším opatřením proti větrné erozi patří ochranné lesní pásy – větrolamy, které
vytvářejí trvalou ochranu půdy proti větrné erozi. Obecně se jedná o různě široké pásy stromů
a keřů orientované kolmo na převládající směr větru s protierozní a půdoochrannou funkcí.
Účinnost větrolamů na snížení rychlosti větru silně závisí na jejich skladbě, především na
jejich propustnosti. Za nejlepší větrolamy jsou někde považovány ty, kde převažují jehličnany
91
„Úroda 12/2012, vědecká příloha časopisu“
(Mercer, 2009). Důvodem je jejich protierozní účinnost i v mimovegetačním období.
Větrolamy nepůsobí pouze na omezení erozních procesů, ale ovlivňují také mikroklima
blízkého okolí - teplotu a vlhkost vzduchu, evapotranspiraci, teplotu půdy apod. (Litschmann
a Rožnovský, 2005; Cleugh, 2002). Aktuální forma křivky rychlosti větru u větrolamu je dána
vztahem systému proudění vzduchu – větrolam. Roli v tomto systému hrají charakteristiky
příchozího proudění, jako je rychlost větru, směr větru, intenzita turbulence a atmosférická
stabilita a vnější vlastnosti větrolamu jako je tvar větrolamu, šířka a délka (Vigiak, 2003).
Průběžný monitoring míry větrné eroze v terénu je poměrně náročný, protože doposud nejsou
vyvinuty funkční rigorózní metody a měřící zařízení. Dílčí možnosti uvádí např. Funk et al.
(2004), kteří kvantifikovali větrnou erozi na základě transportu půdních částic přímo na poli a
množství částic ukládaných na okraji pozemku. Zjišťovali hmotnost zachycených částic i
rychlost a směr větru. Ohrožení území větrnou erozí je však zpravidla kvantifikováno pouze
jako potenciální riziko prostřednictvím výpočtů na bázi půdních, klimatických, vegetačních a
charakter pozemku specifikujících podmínek (zatíženo vysokou mírou nejistoty a zobecnění).
Případně jsou polní podmínky s následným hodnocením intenzity eroze simulovány v
aerodynamickém tunelu (vysoké náklady, nemožnost dokonalého nasimulování podmínek).
Pro maloparcelové experimentální účely bylo v zahraničí (Polsko) v minulosti například
vyvinuto a použito zařízení integrující funkci aerodynamického tunelu a cyklónového
odlučovače (vysoké náklady na konstrukci, provoz a omezená manipulace). V zahraničí jsou
pro monitoring unášených částic také dále sporadicky provozována zařízení rozmanitých
konstrukcí s různou mírou přesnosti (deflametry, samplery – „dust samplers“, lapače –
„interceptors“, pasti – „dust traps“ nebo „sand traps“). I v ČR bylo v 80. a 90. letech 20.
století testováno jednoduché zařízení na záchyt půdních částic unášených větrem v podobě
soustavy vertikálně situovaných záchytných boxů. Ideální konstrukce deflametru umožňuje
nejen kvantifikovat množství deflátů za určité období, ale specifikovat jejich množství v čase
s ohledem na aktuální meteorologické podmínky. Jistým řešením by byl deflametr s
kontinuálním monitoringem hmotnosti zachycených částic (nevýhodou je vysoká cena).
V roce 2012 byl Úřadem pro průmyslové vlastnictví zaregistrován užitný vzor „Deflametr s
aktivním lapačem půdních částic a časovým záznamem„ autorů Středová, Středa, Podhrázská.
Jedinečnost řešení zařízení spočívá v přesném určení termínu transportu, možnosti relativně
kvantifikovat množství a pomocí následné digitální analýzy obrazu zachycených částic
stanovit velikost, tvar a další parametry deflátů. V kombinaci s meteorologickým měřením
(rychlost větru, vlhkost půdy, teplota půdy, stav povrchu půdy atd.) je potom dále možné
striktně specifikovat podmínky v době epizody.
Materiál a metody
Vymezení oblastí potenciálně náchylných k větrné erozi
Teritoriální vymezení oblastí potenciálně náchylných k větrné erozi je primárně založeno na
analýze klíčových meteorologických veličin resp. klimatologických faktorů. Tyto údaje spolu
s pedologickými informacemi umožňují definovat oblasti potenciálně náchylné k větrné erozi.
Souhrnně lze tyto zásadní klimatologické a pedologické údaje získat rozklíčováním dílčích
pozic kódu bonitovaných půdně ekologických jednotek BPEJ (resp. 1. až 3. pozice tj.
klimatický region – KR a hlavní půdní jednotka – HPJ). Podle metodiky vymezování a
mapování BPEJ (Mašát a kol., 2002) byly pro jižní Moravu nejprve stanoveny či vypočteny
následující klimatické charakteristiky určující KR v ČR:
 Průměrná roční teplota vzduchu ve °C
 Průměrný roční úhrn srážek v mm
 Suma průměrných denních teplot rovných nebo vyšších než 10º C (TS10)
 Vláhová jistota
 Pravděpodobnost suchých vegetačních období
92
„Úroda 12/2012, vědecká příloha časopisu“
Původní vymezení KR bylo provedeno pro období 1901 až 1950. Pro vymezení aktuálního
stavu byly pro účely vymezení oblastí náchylných k větrné erozi mapově vyjádřeny
modifikované KR na základě dat z období 1961 až 2000 (Obr. 1).
Náchylnost půdy k větrné erozi je velmi úzce závislá na zrnitostním složení. Za nejvíce
náchylné jsou považovány lehké písčité půdy s nízkým obsahem jílnatých částic. V České
republice je popsáno 78 HPJ na základě jejichž charakteristik může být určena náchylnost k
erozi. Náchylnost půdy k erozi dána půdními podmínkami je na Obr. 2 vyjádřena jako stupeň
náchylnosti půdy k erozi.
Obr. 1 Mapa modifikovaných KR na jižní Moravě pro období 1961 až 2000 (vlevo)
Obr. 2 Stupeň náchylnosti půdy k erozi dle pedologických podkladů (vpravo)
Stupeň
náchylnosti
půdy k erozi
Monitoring a měření větrné eroze
Podstata použitého lapače odnášených půdních částic – deflametru spočívá v jednoduchém
zařízení, umožňujícím zachycování půdních částic erodovaných větrem pomocí aktivního
nasávání vzduchu na pomalu se otáčející lepovou pásku s časovou osou. Zařízení se skládá z
otočné hlavice, v níž je zabudován hodinový strojek otáčející bubínkem, na němž je uchycena
speciální páska z průhledného materiálu, opatřená lepovou vrstvou. Bubínek je umístěn oproti
nasávacímu otvoru – štěrbině vyfrézované v těle hlavice. Hlavice je umístěna na stojanu, v
němž je ventilátor, vytvářející v otočné hlavici podtlak. Hlavice je opatřena směrovkou, která
ji natáčí štěrbinou proti větru. Hodinový strojek otáčí bubínkem jednou za 25 hodin.
Působením podtlaku vyvolaného ventilátorem jsou větrem unášené částice nasávány štěrbinou
a zachyceny v lepové vrstvě. Po ukončení měření se páska s lepovou vrstvou sejme z bubínku
a vyhodnotí mikroskopicky, popřípadě pomocí digitální analýzy obrazu. Napájení ventilátoru
je zajištěno 12 V bezúdržbovým trakčním akumulátorem, tolerujícím i hluboké vybití.
Vyhodnocení účinnosti větrolamů na základě jejich optické porozity OP
Údaje o vlivu větrolamů na pole větru byly získány přímým měřením rychlostí větru u čtyř
větrolamů (na jižní Moravě v katastrech obcí Micmanice – MC, Suchá Loz – SL, Dolní
Dunajovice – DD a Blatnice pod Svatým Antonínkem – BS) a jejich snímkováním. Výška
jednotlivých větrolamů se pohybuje od 12 do 25 m, šířka od 12 do 20 m. Detailní popis
jednotlivých větrolamů je uveden v práci Litschmann et al. (2007). Od roku 2006 byla u
modelových větrolamů prováděna profilová měření rychlostí větru ve výšce 2 m nad
povrchem půdy. Použito bylo šest souprav, měřících ve vzdálenostech 150 a 50 metrů od
větrolamu na návětrné straně a 50, 100, 150 a 200 m od větrolamu na straně závětrné. Pro
měření byly voleny termíny, kdy vítr vanul kolmo k linii větrolamu a jeho průměrná rychlost
převyšovala 2 m.s-1. Z monitoringu v letech 2006 až 2010 bylo pro stanovení OP analyzováno
30 fotografií z různých fází vegetace větrolamu. Výsledné snímky byly převedeny do
93
„Úroda 12/2012, vědecká příloha časopisu“
černobílého spektra, rozčleněny na 9 – 11 svislých sloupců a 7 – 9 vodorovných řad.
Výsledná hodnota OP pro každý snímek pak byla stanovena jako aritmetický průměr všech
čtverců.
Výsledky a diskuze
Potenciální ohrožení půdy větrnou erozí bylo definováno na základě kombinace klimatických
a půdních podmínek. Jako KR náchylné k erozi jsou považovány pouze teplé a suché oblasti
tj., KR 0 až 4. Půdy byly na základě obsahu jílnatých částic klasifikovány stupněm
náchylnosti k erozi (0 – neohrožené, 2 – středně ohrožené, 4 – ohrožené, 6 – silně ohrožené).
Kombinace KR a HPJ náchylných k větrné erozi byly klasifikovány jednotlivými stupni
potenciálního ohrožení půd větrnou erozí (1 až 6), přičemž vyšší číslo znamená vyšší
náchylnost k erozi (Obr. 3).
Obr. 3 Stupeň potenciálního ohrožení půd větrnou erozí
Monitoring erozního působení větru v reálných polních podmínkách byl prováděn pomocí
deflametru. Jedná se o deflametr se směrovkou aktivním nasáváním vzduchu. Pomocí tohoto
zářízení, které je vybaveno i anemometrem je možné anylyzovat velikostní spektrum
erodovanych částic i jeho ralativní množství v souvislosti s měřeným směrem a rychlostí
větru. Deflametr podle technického řešení byl v roce 2011 v praxi úspěšně ověřen při měření
v lokalitě Malešovice (Brno-venkov) a Žabčice (Brno-venkov), jak ukazuje následující Tab. 1
a Histogram četností velikostních kategorií zachycených částic (Obr. 4).
Tab. 1 Údaje získané na základě měření deflametrem
Max. náraz
Délka měření
Lokalita
Datum
větru (m.s-1)
(min)
Množství částic
Velikost
(ks)
částic (μm)
Malešovice
12.4.
13,5
100
452
11 – 821
Žabčice
28.3.
11,3
120
115
3 – 265
94
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 4 Histogram četností spektra půdních částic zachycených 12.4.2011 (Malešovice)
28
26
N = 452; AVG = 104; Sm. odch. = 89; Max = 821; Min = 11
24
22
Počet pozorování
20
18
16
14
12
10
8
6
4
2
0
0
100
50
200
150
300
250
400
350
500
450
600
550
700
650
800
750
900
850
Velikost částic [µm]
Jako jedny z nejúčinnějších opatření proti větrné erozi se používají biotechnická protierozní
opatření. Nejvýznamnější z nich jsou ochranné lesní pásy – větrolamy. Na Obr. 5 je zjištěná
účinnost větrolamů vyjádřena jako redukce rychlosti větru v různých vzdálenostech od
větrolamu v závislosti na hodnotě OP větrolamu. Redukce rychlosti větru na základě OP a
vzdálenosti od větrolamu. Obr. 5 naznačuje nejvyšší redukci rychlosti větru ve vzdálenosti
cca 50 – 60 m za větrolamem. Při průměrné výšce hodnocených větrolamů byla nejklidovější
zóna zjištěna v oblasti okolo čtyřnásobku výšky (4H) větrolamu. S rostoucí porozitou efekt
větrolamu klesá. Výsledky tak zcela korespondují s výsledky jiných autorů.
Obr. 5 Úroveň redukce rychlosti větru (v %) v různých vzdálenostech od větrolamu
v závislosti na OP (Surfer)
50
56
52
Optical porosity (%)
45
48
44
40
40
36
32
35
28
24
20
30
16
12
25
8
4
20
-150
0
-100
-50
0
50
100
150
200
Windbreak distance (m)
Závěr
Míra potenciálního ohrožení půd větrnou erozí je závislá na aktuálních půdních a
klimatických podmínkách. Obecně se za půdy náchylná k erozi označují lehké písčité půdy v
suchých a teplých oblastech. Tyto oblasti byly vymezeny na základě kombinace
95
„Úroda 12/2012, vědecká příloha časopisu“
modifikovaných KR pro období 1961-2000 a zrnitostního složení půd. Vznikla tak syntetická
mapa udávající stupeň náchylnosti půd k větrné erozi.
Navržený deflametr s aktivním lapačem půdních částic a časovým záznamem umožňuje
monitorovat kvalitativní i kvantitativní vlastnosti včetně časového záznamu výskytu
makroskopických i mikroskopických půdních částic unášených větrem. Lze jej využít pro
přímé měření v terénu v rámci studií, které vyžadují údaje o množství a spektrálním složení
unášených částic, typicky erozní účinky větru, studie účinnosti větrolamů apod.
Hodnocení účinnosti větrolamů bylo vyjádřeno pomocí redukce rychlosti proudění. Na
základě vztahů mezi optickou porozitou větrolamu a zeslabením rychlosti větru v různých
vzdálenostech za větrolamem je možno konstatovat, že vliv větrolamu se uplatňuje při plném
olistění ještě ve vzdálenosti 200 – 250 m. U neolistěného větrolamu je tato vzdálenost jen
kolem 50 m.
Dedikace
Příspěvek vznikl s podporou projektu NAZV QH82099 Kriteria rozvoje větrné eroze na
těžkých půdách a možnosti jejího omezení biotechnickými opatřeními.
Použitá literatura
Pasák V. a kol., 1984: Ochrana půdy před erozí. Praha. Státní zemědělské nakladatelství.
Toy, T. J., Foster, G. R., Renard, K. G., 2002: Soil erosion: processes, predicition,
measurement, and control. New York: John Wiley & Sons, c2002, 338 s. ISBN 0-47138369-4.
Mercer, G.N., 2009: Modelling to determine the optimal porosity of shelterbelts for the
capture of agricultural spray drift. Environmental Modelling and Software.1349-1352.
dostupné z: http://dx.doi.org/10.1016/j.envsoft.2009.05.018 (citováno 13.8.2012).
Riksen, M.J.P.M., De Graaff, J., 2001: On-site and off-site effects of wind erosion on
European light soils. Land Degradation & Development 12 (1), 1 –11.)
Litschmann, T., Rožnovský, J., 2005: Optická hustota (porosita) větrolamu a její vliv na
charakter proudění. In: Rožnovský, J., Litschmann, T. (ed): „Bioklimatologie současnosti a
budoucnosti“, Křtiny 12. – 14.9.2005, ISBN 80-86 690–31-08.
Funk, E.L., Skidmore, L.J. Hagen, 2004: Comparison of wind erosion measurements in
Germany with simulated soil losses by WEPS, Environmental Modelling and Software 19
(2), pp. 177–183.
Vigiak, O. et al., 2003: Spatial modeling of wind speed around windbreaks. Catena, vol 52, p.
273-288.
Cleugh, H. A., 2002: Field measurements of windbreak effects on airflow, turbulent
exchanges and microclimates. Australian-Journal-of-Experimental-Agriculture. 42 (6):
665-677.
Mašát, K. et al., 2002: Metodika vymezování a mapování bonitovaných půdně ekologických
jednotek. 3. přepracované vydání. VÚMOP Praha, 113 s. ISBN 80-238-9095-6.
Kontaktní adresa:
Ing. Hana Středová, Ph.D.
Mendelova univerzita v Brně, Ústav aplikované a krajinné ekologie
Zemědělská 1, 613 00 Brno
e-mail: [email protected]
96
„Úroda 12/2012, vědecká příloha časopisu“
PĚSTOVÁNÍ OZDOBNICE (MISCANTHUS X GIGANTEUS) URČENÉ
PRO ENERGETICKÉ VYUŽITÍ
Growing of Miscanthus (Miscanthus × giganteus) determined
for energy utilization
Strašil Z.
Výzkumný ústav rostlinné výroby, v.v.i. Praha – Ruzyně
Abstrakt
Polní pokusy s ozdobnicí (Miscanthus x giganteus) probíhaly v letech 2001-2011 na dvou odlišných
stanovištích. V pokusech byly sledovány tři úrovně hnojení dusíkem (0, 50, 100 kg.ha-1.rok-1) a dva
termíny sklizně (na podzim a na jaře). Byl hodnocen vliv stanoviště a hnojení dusíkem na produkci
biomasy a další sledované ukazatele (počet a délka stébel) a dále vliv termínů sklizně na obsah vody a
základních živin ve sklizeném materiálu, ztráty fytomasy přes zimní období. Průměrný výnos sušiny
fytomasy ozdobnice za sledované období byl v Ruzyni 21,02 t.ha-1, v Lukavci 17,81 t.ha-1. Ztráty
fytomasy za zimní období byly v průměru 33,6 %. Dávka 100 kg.ha-1 N zvyšovala v průměru výnosy
přepočtené na sušinu o 2,67 t.ha-1 (12,8 %) oproti nehnojeným parcelám.
Klíčová slova: ozdobnice, výnosy fytomasy, hnojení N, termíny sklizně
Abstract
In the period 2001-2011 the field experiments with Miscanthus x giganteus were performed at two
different sites with three levels of nitrogen fertilization (0, 50, 100 kg.ha -1.year-1) and two terms of
harvest (in autumn and in spring). The effect of nitrogen fertilization and site conditions on above
ground biomass production was determined. For overall evaluation the influence of the harvest terms
on water content in harvested material, on losses of phytomass during the winter period and on the
content of main nutrients in plants was determined. Other evaluated parameters were number of stems
and plant length. The average yield of dry matter of Miscanthus over monitored period was 21.02 t.ha1
at Ruzyně and 17.81 t.ha-1 at Lukavec. The average loss of phytomass of Miscanthus during winter
period was 33.6 %. Used dose of nitrogen (100 kg.ha-1) increased yield about 2.67 t.ha-1 (12.8 %) in
average as compared to non fertilized plots.
Key words: Miscanthus, phytomass yields, N-fertilization, terms of harvest
Úvod
Jednou z rostlin, na kterou byla zaměřena pozornost z hlediska nepotravinového a
energetického využití, je ozdobnice (Miscanthus). Rod Miscanthus je přirozeně rozšířen
převážně v tropických a mírných oblastech. Zahrnuje celkem 33 taxonů. Ozdobnice je
vytrvalá rostlina typu přeměny uhlíku C4. Botanicky se ozdobnice (Miscanthus) řadí do třídy
jednoděložné (Monoxyledonae), čeleď lipnicovité (Poaceae), tribus vousatkovité
(Andropogoneae).
Ozdobnici lze obecně charakterizovat jako vytrvalou vysokovzrůstnou trávu dosahující za
příznivých podmínek přes 30 tun výnosu sušiny, která dobře využívá sluneční energii, vodu,
živiny, jež je značně odolná proti chorobám a škůdcům.
Při jejím pěstování je možno využívat mnoha výhod, jako je po plném zapojení porostu
dosahování každoročních vysokých výnosů sušiny fytomasy, sklizeň běžně používanými
sklizňovými mechanizmy apod.
Materiál a metody
Polní pokusy s ozdobnicí (kultivar “Giganteus”) uvažovanou pro energetické využití
(spalování) byly založeny pomocí oddenků 7 až 10 cm dlouhých na dvou stanovištích, v roce
2001 v Lukavci u Pacova a následně v roce 2003 v Praze-Ruzyni při výsadbě 1 rostliny na 1
m2. Charakteristika jednotlivých stanovišť je uvedena v tab. 1. K porostům bylo na
97
„Úroda 12/2012, vědecká příloha časopisu“
vybraných parcelách aplikováno každoročně na jaře před vzcházením rostlin jednorázově
pouze hnojení N ledkem amonným s vápencem. Použité dávky N byly následující: N0 - bez
hnojení, N1 - 50 kg.ha-1, N2 - 100 kg.ha-1. Porosty byly sklízeny ve dvou termínech a to na
podzim (koncem listopadu) a na jaře (začátkem března). Sledoval se vliv stanoviště, hnojení
N na výnosy nadzemní fytomasy a další sledované ukazatele (délka rostlin, počet stébel).
Dále se sledoval vliv termínu sklizně na obsah vody ve sklizeném materiálu, ztráty fytomasy
přes zimní období, obsah základních živin ve sklízené fytomase.
Do statistického hodnocení bylo započteno prvních 9 let od výsadby rostlin na jednotlivých
stanovištích. K výpočtům byl použit test minimální průkazné diference balíčku UNISTAT
5.1.
Tab. 1. Stanovištní podmínky pokusných míst
Ukazatel
Zeměpisná šířka
Zeměpisná délka
Nadmořská výška (m n.m.)
Půdní druh
Půdní typ
Průměrná roční teplota vzduchu (oC)
Průměrný roční úhrn srážek (mm)
Agrochemické vlastnosti půdy:
Obsah humusu (%)
pH (KCl)
Obsah P (Mehlich III, mg.kg-1 půdy)
Obsah K (Mehlich III, mg.kg-1 půdy)
Praha-Ruzyně
50o04´
14o26´
350
jílovito-hlinitá
hnědozem
8,2
477
Lukavec u Pacova
49o37´
15o03´
620
písčito-hlinitá
kambizem
7,4
666
3,04
6,22
124,9
362,0
3,32
5,89
141,0
246,8
Výsledky a diskuse
Stav porostu během sledování
Porosty nově založené z rhizomů v Lukavci v roce 2001 a v Ruzyni v roce 2003 dobře vzešly
(vzcházivost byla na obou stanovištích vyšší než 95 %) a ani přes první zimní období jsme
nezaznamenali průkazný úhyn rostlin. Z průběhu počasí v obou zimních obdobích 2000/2001
a 2003/2004 lze konstatovat, že nemohlo prověřit zimovzdornost sledovaného klonu
ozdobnice, neboť tato zimní období byla v porovnání s dlouhodobým průměrem teplotně a
srážkově mírně nadnormální a přes zimní období bylo relativně dostatek sněhu. V literatuře
jsou uváděny případy, kdy nově založené porosty ozdobnice během první zimy mohou být
v některých nepříznivých letech značně poškozeny. Např. Eppel-Hotz a kol. (1998) uvádí, že
během zimy 1995/96 došlo ke ztrátám mladých jednoletých rostlinek až 40 %, zatímco
pětiletý porost na stejném stanovišti přezimoval beze ztrát. Po celou dobu našeho pokusu
s ozdobnicí nebyl zaznamenán silnější výskyt chorob nebo škůdců.
Výnosy a další sledované ukazatele
Prvním rokem bylo dosaženo na podzim výnosu ozdobnice v průměru za stanoviště pouze
1,187 t.ha-1 (tab. 3). Z uvedených výsledků je patrné, že výnosy fytomasy ozdobnice rostly od
roku výsadby až do třetího roku v Ruzyni, resp. čtvrtého roku v Lukavci, kdy výnosy sušiny
přesáhly většinou 20 tun. V následném období výnosy fytomasy kolísaly v závislosti na
počasí v jednotlivých letech a nejvyšších hodnot zatím dosáhly v devátém roce, kdy v tomto
roce přesáhly na obou stanovištích hodnotu 30 t.ha-1 sušiny (tab. 3). V průměru za sledované
devítileté období bylo dosaženo v Ruzyni 21,02 t.ha-1, v Lukavci 17,81 t.ha-1 výnosu sušiny
(tab. 3).
Pro porovnání podle Clifton-Brown a kol. (2001) byly průměrné výnosy v prvém roce
v několika zemích kolem 2 t.ha-1 sušiny. Výnosy dále rostly a v druhém roce byly 9 t.ha-1 a
98
„Úroda 12/2012, vědecká příloha časopisu“
ve třetím roce 18 t.ha-1 sušiny. Největší výnosy ve třetím roce byly dosaženy ve Švédsku 24,7
t.ha-1, Dánsku 18,2 t.ha-1, Anglii 18,7 t.ha-1 a Německu 29,1 t.ha-1 sušiny (Clifton-Brown a
kol., 2001). Nejvýnosnější genotypy ozdobnice pěstované v Dánsku a Švédsku patřily mezi
nejméně výnosné v Portugalsku a Německu, což poukazuje na silné interakce mezi genotypy
a prostředím.
V polních pokusech v Rakousku (Schwarz a kol., 1994) bylo dosaženo v druhém roce po
výsadbě výnosu 8 t.ha-1 sušiny fytomasy, ve třetím roce 22 t.ha-1. Výnosy byly největší
v srpnu a potom neustále klesaly až do února v důsledku opadu listů.
V pokusech byl také sledován počet vytvořených stébel a délka rostlin. Obdobně jako výnosy
byly sledované ukazatele ovlivněny hlavně počasím v jednotlivých letech (tab. 2). Obecně se
dá konstatovat, že na stanovišti v Lukavci byly v průměru zjištěny vyšší počet stébel i délka
rostlin v porovnání se stanovištěm Ruzyně (tab. 2). Vyšší počet stébel a větší délka rostlin
byly v Lukavci zjišťovány od čtvrtého roku od založení porostu. Použité hnojení dusíkem
nemělo průkazný vliv na délku rostlin ani na počet stébel (tab. 4).
Tab. 2. Průměrné hodnoty počtu stébel (ks na rostlinu) a výšky rostlin (cm) za sledované
období na jednotlivých stanovištích
Počet stébel
Ruzyně
Lukavec
Průměr
Výška rostlin
Ruzyně
Lukavec
Průměr
1. rok
9,2
8,5
8,8
2. rok
25,5
25,8
25,7
3. rok
44,0
20,2
32,1
4. rok
41,8
51,3
46,6
5. rok
46,2
51,2
48,7
6. rok
37,7
65,2
51,4
7. rok
42,5
68,0
55,3
8. rok
39,5
78,0
58,7
9. rok
56,5
60,1
58,3
Průměr
38,1
47,6
42,8
100,5
96,2
98,4
184,0
163,7
173,8
275,5
176,7
226,1
244,5
159,7
202,1
201,7
354,0
277,8
215,2
318,0
266,6
236,0
300,8
268,4
240,3
310,0
275,1
332,7
331,0
331,8
225,6
245,6
235,6
Vliv hnojení N na výnosy a další sledované ukazatele
Výsledky vykazující vliv použitého hnojení N na výnosy sušiny ozdobnice
z maloparcelkových polních pokusů jsou uvedeny v tab. 3. Výnosy jsou uvedeny
v jednotlivých letech i jako průměr za 9-ti leté období. Každoroční přihnojení N na jaře
v dávce 50 kg.ha-1 resp. 100 kg.ha-1 zvyšovalo v průměru stanovišť výnosy fytomasy o 4,9 %
resp. o 12,8 % v porovnání s nehnojenými variantami (tab. 3). Použité dávky dusíku neměly
průkazný vliv na výnosy fytomasy (tab. 4).
Z našich obdobných pokusů lze konstatovat, že na úrodnějších půdách obecně postačí
k ozdobnici každoroční přihnojení 50 kg.ha-1 N na méně úrodných půdách kolem 80 kg.ha-1 N
(Strašil, 1999; Strašil, 2009). Také zahraniční prameny (Pignatelli a kol., 1998) udávají, že
při vyšších dávkách N (nad 100 kg.ha-1) již nedochází k podstatnému nárůstu fytomasy.
Vliv hnojení N na výnosy ozdobnice hodnotí také např. (Schwarz a kol., 1994). Konstatuje, že
stupňované každoroční dávky minerálního dusíku aplikované vždy na začátku dubna od 0, 60,
90, 120 až 180 kg.ha-1 neměly průkazný vliv na výnosy.
Vliv termínu sklizně na výnosy a další ukazatele
Porovnání výnosů ozdobnice sklízené na podzim a na jaře je uveden v tab. 5. Z výsledků
vyplývá, že v průměru za sledované období a stanoviště došlo k poklesu výnosu na jaře asi o
třetinu ( o 6,59 t.ha-1, tj. 33,6 %). Vyšší ztráty přes zimní období byly zaznamenány na
stanovišti v Lukavci 37,3 % oproti Ruzyni 31,1 %. Toto lze přičíst nepříznivějším
podmínkám v zimním období v Lukavci, hlavně silnějším větrům a mrazům, které zapřičiňují
vyšší opad listů a lámavost stonků.
99
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 3. Vliv hnojení N v jednotlivých letech na výnosy fytomasy ozdobnice při
podzimním termínu sklizně přepočtené na sušinu (t.ha-1) na daných stanovištích –
průměrné hodnoty
Hnojení
N
N0
N1
N2
Stanoviště
1. rok
2. rok
3. rok
4. rok
5. rok
6. rok
7. rok
8. rok
9. rok
Průměr
Ruzyně
Lukavec
Průměr
Ruzyně
Lukavec
Průměr
Ruzyně
Lukavec
Průměr
1,08
1,15
1,12
1,08
1,15
1,12
1,51
1,15
1,33
1,19
8,59
4,04
6,31
10,29
4,44
7,37
11,07
5,21
8,14
7,27
17,79
4,83
11,31
18,51
6,42
12,46
20,55
6,89
13,72
12,50
22,00
24,08
23,40
23,12
25,80
24,46
25,33
26,60
25,97
24,61
18,04
24,44
21,24
19,77
24,18
21,97
22,05
25,99
24,02
22,41
30,07
15,93
23,00
30,46
24,17
27,32
30,88
27,34
29,11
26,48
23,58
21,35
22,46
24,33
22,93
23,63
31,06
19,24
25,15
23,75
19,82
22,50
21,16
27,40
24,75
26,07
26,59
26,95
26,77
24,67
36,25
31,57
33,91
28,56
27,37
27,96
37,77
29,70
33,74
31,87
19,69
16,73
18,21
20,39
17,91
19,15
22,98
18,79
20,88
19,42
Průměr
N
Legenda: N0=0, N1=50, N2=100 kg.ha-1 N
Tab. 4. Statistické zhodnocení použitého hnojení N na sledované ukazatele – Minimální
průkazná diference (MD)
Skupina
N0
N1
N2
MD
Příp.
36
36
36
Výnosy
Průměr
18,212
19,151
20,884
4,891
Počet stébel
Průměr
43,0
44,6
48,6
9,83
Délka rostlin
Průměr
246,7
247,0
249,9
34,24
Legenda: N0=0, N1=50, N2=100 kg.ha-1 N
Pro jižní Evropu jsou uváděny ztráty fytomasy ozdobnice při jarní sklizni 30 až 50 %
v porovnání se sklizní na podzim (Lewandowski a kol., 2000). Bischoff, Emmerling (1995)
udávají ztráty 33 %. Třicetiprocentní ztráty přes zimu opadem udává také Himken a kol.
(1997).
V našich dřívějších pokusech v polních podmínkách jsme zjistili ztráty fytomasy ozdobnice
(M. x giganteus) přes zimní období v rozmezí 24 až 36 % (Strašil, 1999).
Pro uskladnění a následné zpracování fytomasy pro energetické využití je třeba, aby obsah
vody ve sklízeném materiálu byl pokud možno nízký. Z tohoto důvodu se doporučuje, aby
porosty ozdobnice zůstaly na poli přes zimu. Proto převažuje sklizeň po zimě (únor, březen),
neboť tak odpadnou problémy s případným dosoušením. Podle našich sledování měla
fytomasa ozdobnice v průměru za sledované období a stanoviště sklízená na podzim 51,9 %
sušiny, na jaře 79,5 % sušiny.
Schwarz (1994) udává vlhkost fytomasy ozdobnice při sklizni v září mezi 55 až 60 %. Na
konci února činila vlhkost v druhém roce po vysazení kolem 42%, ve třetím roce 30 %, ve
čtvrtém roce 25 %, v pátém roce 30 %.
Tab. 5. Porovnání výnosů přepočtených na sušinu (t.ha-1) na podzim a na jaře na
daných stanovištích (průměrné hodnoty)
Období
Podzim
Jaro
Stanoviště
Ruzyně
Lukavec
Průměr
Ruzyně
Lukavec
1. rok
1,22
1,15
1,19
0,51
0,65
2. rok
9,98
4,57
7,27
7,20
3,13
3. rok
18,95
6,04
12,00
13,09
3,59
4. rok
23,48
25,73
24,61
11,31
7,52
100
5. rok
19,95
24,87
22,41
14,67
12,82
6. rok
30,47
22,48
26,12
24,93
20,82
7. rok
26,32
21,17
23,75
20,43
10,94
8. rok
24,60
24,73
24,67
18,83
18,82
9. rok
34,20
29,55
31,87
19,33
22,30
Průměr
21,02
17,81
19,42
14,48
11,18
„Úroda 12/2012, vědecká příloha časopisu“
Průměr
0,58
5,16
8,34
9,42
13,75
22,87
15,68
18,83
20,82
12,83
Obsah prvků v rostlinách je dalším z důležitých faktorů jednak pro stanovení odběru živin
výnosy, jednak z hlediska spalování fytomasy. Pro spalování je výhodné pokud obsah N ve
fytomase je co nejmenší (tvoří se méně Nox), pokud je malý obsah S a Cl (snižuje se možnost
koroze spalovacího zařízení) a pokud je také nízký obsah K, Mg apod. (ovlivňuje teplotu
tavení popele).
U ozdobnice se snižoval s oddálením termínu sklizně obsah prvků ve fytomase (tab. 6). Obsah
dusíku a dalších sledovaných prvků v rostlinách ozdobnice klesal se stářím rostliny a
termínem sklizně, což je také výhodné pro samotný proces spalování a tvorbu emisí.
Tab. 6. Obsah prvků v rostlinách ozdobnice v různých termínech sklizně – průměrné
hodnoty
Termín
sklizně
Podzim
Jaro
Průměr
N
0,876
0,829
0,853
P
0,086
0,079
0,083
Obsah prvků v % sušiny
K
Ca
0,631
0,358
0,292
0,228
0,462
0,293
Mg
0,103
0,086
0,095
Závěr
Vysokých výnosů fytomasy ozdobnice dosahuje od 3 roku po založení porostu. Výnosový
potenciál ozdobnice předstihuje možnosti většiny domácích druhů, včetně rychle rostoucích
dřevin.
Ozdobnice se jeví jako perspektivní rostlina pro energetické využití. Při jejím pěstování je
možno využívat mnoha výhod jako je dosahování vysokých výnosů sušiny fytomasy, vysoce
efektivní využívání vody při tvorbě fytomasy, sklizeň běžně používanými sklizňovými
mechanizmy apod. Velkou výhodou při pěstování ozdobnice je také relativně nízký nárok na
hnojení a pesticidy.
Snížení výnosů fytomasy na jaře v porovnání s podzimním termínem sklizně je vyváženo
zvýšenou kvalitou paliva (z hlediska technického a tvorby emisí). Při jarním termínu sklizně
odpadne také dosoušení, které je ekonomicky nákladné. Kvalita fytopaliva ozdobnice je
srovnatelná s fytomasou dřevin.
Z výsledků lze konstatovat, že ozdobnici je třeba považovat za významný zdroj obnovitelných
surovin pro průmyslové a energetické využití.
Dedikace
Tento příspěvek byl finančně podpořen výzkumným projektem MZe ČR č. QJ1210008.
Použitá literatura
Bischoff R., Emmerling, R. 1995. Demands and performance of Miscanthus sinensis - fiveyear results at a dry site. Kongressband 1995 Garmisch-Partenkirchen. Vortrage zum
Generalthema des 107. VDLUFA-Kongresses vom 18.-23.9.1994 in GarmischPartenkirchen: Grunland als Produktionsstandort und Landschaftselement. 1995: 241-244.
Clifton-Brown J. C., Lewandowski I., Andersson, B., Basch G., Christian D. G., Kjeldsen J.
B., Jørgensen U., Mortensen J. V., Riche A. B., Schwarz K. U., Tayebi K., Teixeira F.
2001. Performance of 15 Miscanthus genotypes at five sites in Europe. Agronomy Journal.
93, 5: 1013-1019.
Eppel-Hotz A., Jodl S., Kuhn W. 1998. Miscanthus: New cultivars and results of research
experiments for improving the establishment rate. In: Sustainable agriculture for food,
energy and industry. Proceedings of the International Conference. Braunschweig,
Germany: 178-183.
101
„Úroda 12/2012, vědecká příloha časopisu“
Himken M., Lammel J., Neukirchen D., Czypionka-Krause U., Olfs H. W. 1997. Cultivation
of Miscanthus under West European conditions: seasonal changes in dry matter
production, nutrient uptake and remobilization. Plant and Soil. 189, 1: 117-126.
Lewandowski I., Clifton-Brown, J. C., Scurlock, J. M. O., Huisman, W. 2000. Miscanthus:
European experience with a novel energy crop. Biomass and Bioenergy. 19, 4: 209-227.
Pignatelli V., Piscioneri I., Fogacci G. 1998. Miscanthus x gigantheus productivity over
different fertiliser treatment under Italian conditions. In: Sustainable agriculture for food,
energy and industry. Proceedings of the International Conference. Braunschweig,
Germany: 743-747.
Schwarz H. 1994. Fertilization effect on production of miscanthus sinensis gigantheus. “. In:
European conference on biomass for energy, environment, agriculture and indiustry. Book
of Abstracts from International Conference. Viena-Austria, October 1994: 180-181.
Schwarz H., Liebhard P., Ehrendorfer K., Ruckenbauer P. 1994. The effect of fertilization on
yield and quality of Miscanthus sinensis 'Giganteus'. Industrial-Crops-and-Products. 2: 3,
153-159.
Strašil Z. 1999. Production of aboveground biomass in Miscanthus sinensis under field
conditions. (Produkce nadzemní fytomasy ozdobnice čínské (Miscanthus sinensis)
v polních podmínkách). Rostl. Výr. 45, (12): 539-543.
Strašil Z. 2009. Základy pěstování a možnosti využití ozdobnice (Miscanthus). Uplatněná
metodika pro zemědělskou praxi. Ed.: VÚZT Praha, 2009, 48 s.
Miscanthus sinensis
Kontaktní adresa:
Ing. Zdeněk Strašil, CSc.
Výzkumný ústav rostlinné výroby Praha - Ruzyně, v.v.i.,
Drnovská 507, 161 06 Praha 6 - Ruzyně
e-mail: [email protected]
102
„Úroda 12/2012, vědecká příloha časopisu“
MOŽNOSTI VYUŽITÍ TECHNOLOGIÍ PRO ZÍSKÁNÍ ENERGETICKÉ
ŠTĚPKY Z VINIC
The possibilities for utilizing of technologies for harvesting of energy wood
chips from grape cane
Zemánek P., Burg P.
Zahradnická fakulta, Mendelova univerzita v Brně
Abstrakt
Práce shrnuje výsledky provozních sledování strojních souprav u technologií pro získání energetické
štěpky z réví vinic. Z výsledků sledování bylo provedeno hodnocení provozních nákladů u 2 variant
technologických postupů využívajících drtič se zásobníkem a svinovací lis. Pro jednotlivé varianty
byly modelovány provozní náklady v závislosti na výkonnosti a dopravní vzdálenosti při odvozu
štěpky nebo balíků.
Klíčová slova: vinohradnictví, odpadní dřevní hmota, dřevní štěpka, balíky dřevní hmoty
Abstract
This paper is focused on procedure proposal for implementation of technologies for utilization of
waste vine cane from vineyards for the energy purposes, including an assessment of their
effectiveness. Evaluated were 2 variants of technological procedures with using the shredder with
container and the vine cane baler. For the individual variants were modeled operating costs,
depending on the extent of the annual use that reflects the size of the vineyard.
Key words: viticulture, waste wood, wood chips, wood roll
Úvod
V posledních letech roste snaha po využívání všech obnovitelných zdrojů energie a odpadní
dřevo ve formě réví z vinic mezi ně právem patří (WALG, 2007). Réví z vinic a dřevo
z ovocných výsadeb představují stabilní zdroj dřevní hmoty. Rozvoj technologií jeho
zpracování pro energetické účely je v tradičních vinařských zemích patrný a odráží se
zejména ve vývoji moderních strojních systémů a návazně také vhodných spalovacích
zařízení MAGA a kol. (2008).
Plocha produkčních porostů vinic v ČR činí 18 000 ha. Výnos odpadního réví je výrazně
ovlivněn sponem výsadby (počet keřů na 1 ha), odrůdou, vedením apod. a pohybuje se od
1,8–2,5 t.ha-1 (HERZÁN, 1993, ŽUFÁNEK, 1998). Využití tohoto energetického potenciálu
závisí především na dostupnosti a efektivitě používaných technologií. Stávající technologie se
donedávna vyznačovaly vysokou pracností. BURG (2007) naznačuje, na základě sledování
nasazení vinohradnické techniky v moravských vinohradnických regionech, v posledních 4
letech narůst zájmu o pořizování strojů pro zpracování réví.
Cílem práce je posouzení možností zavedení dvou variant technologií pro využití odpadního
réví z vinic k energetický účelům a zhodnocení jejich provozních nákladů, stanovení bilance
množství získané štěpky nebo balíků a energetického potenciálu včetně výkonu kotle.
Materiál a metody
Při návrhu zavedení technologií musí uživatel posuzovat řadu technických i ekonomických
podkladů, na základě kterých provede rozhodnutí o použité technologii a technice.
Bilance množství odpadního dřeva a energetického potenciálu
Součástí návrhu musí být stanovení bilance množství získané štěpky nebo balíků,
energetického potenciálu a výkonu kotle.
103
„Úroda 12/2012, vědecká příloha časopisu“
a) stanovení produkce odpadního dřeva
Při stanovení produkce odpadního dřeva je nutné vycházet z počtu keřů na pěstební ploše a z
průměrného množství dřeva získaného z keře.
Produkce odpadního dřeva je pak dána vztahem
n
G   S i Qi
(t)
i 1
kde:
Si – pěstitelská plocha (ha)
Qi – výnos odpadního dřeva (t.ha-1)
n – počet pozemků s trvalými porosty (-)
b) stanovení energetického potenciálu z produkce odpadního dřeva, výkonu kotle
Z celkové produkce odpadního dřeva lze na základě výhřevnosti určit energetický potenciál
(EP).
Ep  G  H
(GJ)
kde:
G – produkce odpadního dřeva (t)
H – výhřevnost štěpky nebo balíků (GJ.t-1)
Výhřevnost odpadního dřeva je stanovena pro surovinu s vlhkostí 10–15 %. Její hodnoty pro
vybrané produkty uvádí Tab.1.
Tab.1: Výhřevnost, objemová hmotnost a nároky na skladovací prostor u dřevní štěpky
a balíků réví
Palivo
Dřevní štěpka
Réví – balíky
Réví – štěpka
Dřevo – brikety,
pelety
10
14
14
Objemová
hmotnost
(kg.m-3)
180–410
350–400
400–450
Energetický
obsah
(GJ.m-3)
2,95
4,90
5,80
Energetický
obsah
(MWh.m-3)
0,82
1,36
1,63
Skladovací
prostor
(m3.GJ-1)
0,34
0,20
0,17
Skladovací
prostor
(m3.MWh-1)
1,22
0,73
0,61
21
600–1100
17,85
4,96
0,06
0,20
Výhřevnost
(MJ.kg-1)
c) stanovení možného výkonu kotle
Za předpokladu využití celého množství odpadního dřeva pro vytápění stavebního objektu lze
také stanovit maximální výkon kotle pro toto množství podle vztahu:
E .106
(kW)
P P
d .h.3600
kde:
Ep – energetický potenciál získaného odpadního dřeva (GJ)
d – počet dnů topné sezony v roce, běžně 200–230, při celoročním vytápění 365
h – počet hodin plného provozu kotle v průběhu dne, běžně 10–12 h
Z výše uvedeného vztahu lze také určit minimální pěstitelskou plochu pro požadovaný výkon
kotle:
d .h.3600.P
S
(ha)
Q.H .106
104
„Úroda 12/2012, vědecká příloha časopisu“
kde:
d – počet dnů topné sezony v roce (-)
h – počet hodin plného provozu kotle v průběhu dne, běžně 10–12 (-)
P – požadovaný výkon kotle (kW)
Q – průměrný výnos odpadního dřeva (t.ha-1)
H – výhřevnost štěpky nebo balíků (GJ.t-1)
Návrh technického zajištění zvolené technologie
V současné době se jako nejvýhodnější jeví především tyto technologické postupy:
Technologický postup drcení réví do zásobníku s odvozem, při kterém se využívá
nesených drtičů se zásobníkem o objemu 1,0–2,5 m3. Do zásobníku je ukládána vznikající
dřevní štěpka, jeho vyprázdnění do transportního prostředku, nejčastěji traktorového přívěsu,
nebo návěsu s klecovou nástavbou, se provádí na okraji pozemku.
Technologický postup se sběrem a lisováním réví do balíků využívá svinovacích lisů pro
sběr a svinování réví. Vznikají tak válcové balíky o průměru 0,40 m a délce 0,60 m
s hmotností 30 kg. Ty jsou následně odváženy traktorem a přívěsem s klecovou nástavbou.
Výhodou je zde nižší energetická náročnost operace, protože není nutné materiál drtit.
Při výběru technologie a použitých strojů se vychází z obecných zásad tvorby strojních linek,
kdy nejdůležitějším článkem linky bude drtič nebo lis. Součástí návrhu linky je také řešení
dopravy získávaného produktu. Pro balíky lisovaného dřeva je nutno řešit také nakládku, u
drtičů se zásobníkem se volba dopravního prostředku řídí výsypnou výškou zásobníku.
Ekonomické hodnocení technologií
Ekonomické hodnocení navržených technologií je zaměřeno především na stanovení
provozních nákladů používaných souprav. Pro modelování nákladů bylo využito programu
AGROTEKIS. Výsledkem jsou hodnoty provozních nákladů strojních souprav vyjádřené
v Kč na 1 hodinu nasazení a na 1 hektar operace. Součástí ekonomického hodnocení je i
stanovení nákladů na dopravu, které je provedeno pro dopravní vzdálenosti 3 km; 5 km a 8
km.
Výsledky a diskuse
Technicko-ekonomické údaje a vypočítané provozní náklady pro 2 sledované technologie
jsou uvedeny v Tab.2 a Tab.3.
Tab.2: Provozní náklady pracovních operací pro variantu I - drcení do zásobníku s
odvozem
Technické prostředky
Výkonnost stroje nebo
pro zabezpečení
strojní soupravy
Spotřeba paliva
Provozní náklady
operace
(W04)
Varianta B
ha.h-1
t.h-1
l.h-1
l.ha-1
Kč.h-1
Kč.ha-1
NEW HOLLAND TN
0,6
1,5
8,0
13,3
1210
2020
75V + drtič se
0,8
2,0
8,6
10,7
1290
1610
sběrným košem
PERUZZO – COBRA
1,0
2,5
9,2
9,2
1330
1330
1200
105
„Úroda 12/2012, vědecká příloha časopisu“
Osobní náklady
obsluhy - řidič
NEW
HOLLAND
TN55V +
traktorový
přívěs 5-10 t
3 km
0,6
0,8
1,0
136
136
136
226
170
136
3,0
7,5
5,0
1,7
520
172
5 km
2,0
5,0
5,0
2,5
520
260
8 km
1,4
3,5
5,0
3,6
520
370
136
136
136
45
68
97
Osobní náklady
obsluhy - řidič
3,0
2,0
1,4
Tab.3: Provozní náklady pracovních operací pro variantu II - Technologický postup se
sběrem a lisováním réví do balíků včetně odvozu
Technické prostředky
Výkonnost stroje
pro zabezpečení
nebo strojní
Spotřeba paliva
Provozní náklady
operace
soupravy (W04)
Varianta C
ha.h-1
t.h-1
l.h-1
l.ha-1
Kč.h-1
Kč.ha-1
NEW HOLLAND TN
0,5
1,25
5,5
11,0
1305
2610
55V
0,6
1,5
5,8
9,7
1290
2150
lis CAEB MP 400/S 0,7
1,75
6,2
8,9
1275
1821
1230
Osobní náklady
obsluhy - řidič
NEW
HOLLAND
TN55V +
traktorový
přívěs 5-10 t
0,5
0,6
0,7
136
136
136
272
226
194
3 km
5 km
1,5
1,3
3,75
3,3
5,5
5,5
3,7
4,2
520
520
345
400
8 km
1,1
2,9
5,5
5,0
520
470
Osobní náklady
obsluhy – řidič + 2
pracovníci pro
nakládání (1 h)
1,5
1,3
3,75
3,3
336
336
224
258
1,1
2,9
336
305
Výpočet nákladů na dopravu štěpky a balíků byl proveden pro každou variantu následovně:
Varianta I:
Výkonnost dopravní soupravy je stanovena z doby dvou cyklů: dovoz prázdného přívěsu a
jízda zpět, odvoz plného přívěsu. Z doby dopravního cyklu a z nosnosti použitého ložného
prostředku je pak stanovena výkonnost dopravní soupravy. Např. pro vzdálenost 3 km je
potřebu času 40 minut, při nosnosti 5,0 t je výkonnost dopravní soupravy 7,50 t.h-1, při
106
„Úroda 12/2012, vědecká příloha časopisu“
výnosu 2,5 t réví z 1 ha to znamená výkonnost 3,0 ha.h-1. Není zde logicky započítána doba
plnění přívěsu (traktor je využit jinde).
Varianta II:
Náklady na dopravu jsou vyčísleny podle výnosu réví z 1 ha, pro 2,5 t.ha-1 a hmotnosti balíku
30 kg je to cca 80 ks.ha-1 , přívěs o nosnosti 5 t pojme cca 160 kusů balíků. Nakládání
traktorového přívěsu dvěma pracovníky – 60 minut, přeprava na zadanou dopravní vzdálenost
3km; 5km a 8 km,, vyprazdňování přívěsu, zpětná jízda. Např. pro vzdálenost 8 km je
potřebu času 104 minut, při nosnosti 5,0 t je výkonnost dopravní soupravy 2,90 t.h-1, při
výnosu 2,5 t réví z 1 ha to znamená výkonnost 1,1 ha.h-1.
Z údajů uvedených v Tab.2 a Tab.3 byly stanoveny celkové náklady v závislosti na
výkonnosti a dopravní vzdálenosti. Porovnání těchto nákladů ukazuje Graf 1.
Graf 1: Celkové náklady - Varianta I
Varianta II
Varianta I
3000
3500
2247
2108
1997
2000
1683
4000
2713
2574
2463
1794
celkové náklady Kč/ha
celkové náklady Kč/ha
2500
Varianta II
1933
výkonnost 0,6 ha/h
výkonnost 0,8 ha/h
1500
výkonnost 1 ha/h
1000
500
3000
3757
3540
3451
3151
3034
2945
2584
2673
2790
2500
výkonnost 0,5 ha/h
výkonnost 0,6 ha/h
2000
výkonnost 0,7 ha/h
1500
1000
500
0
0
3 km
5 km
3 km
8 km
5 km
8 km
dopravní vzdálenost
dopravní vzdálenost
Při výpočtech nákladů pro jednotlivé soupravy byla rozdílnost pěstitelských podmínek
vyjadřována různou výkonností. Soupravy pro drcení nebo lisování réví dosahují, podobně
jako ostatní stroje ve vinohradnictví, různou výkonnost zejména podle délky řad, podmínek
pro otáčení a najíždění a podle svažitosti terénu. Krátké řady a horší terénní podmínky snižují
výkonnost až o 20–30 % (ZEMÁNEK, BURG, MICHÁLEK, 2010).
Z porovnání celkové výše nákladů u hodnocených variant je zřejmé, že při stejných
dopravních vzdálenostech jsou nižší celkové náklady u varianty I. S ohledem na pořizovací
ceny drtiče je však nutné zajistit jeho efektivní roční nasazení alespoň 100–150 hodin ročně.
Při volbě typu drtiče je často diskutován objem zásobníku. Standardní modely s objemem
1,0–1,5 m3 poskytují při délce meziřadí 200–300 m velmi dobré možnosti naplnění jedním
průjezdem (BURG, 2007). Objem zásobníku zde ovlivňuje provozní náklady pouze nepatrně,
navíc modely s větším objemem (2,0–4,0 m3) vyžadují agregaci s traktory vyšších
výkonových tříd. Obtížné otáčení a najíždění do meziřadí snižuje výhodu úspory pracovního
času při vyprazdňování koše. Pro větší délky meziřadí a při vyšší produkci réví je pak nutno
uvažovat s využitím drtičů s výfukovým hrdlem, umožňujících plnění štěpky do přívěsu
jedoucího ve vedlejším meziřadí (WALG, 2007).
Celkové náklady jsou ovlivněny i hodnotou dopravních nákladů, která bude dána použitým
dopravním prostředkem a dopravní vzdáleností (SOUČEK, 2007). U sledovaných technologií
byly dopravní náklady na úrovni 300–450 Kč.t-1 při dopravních vzdálenostech 5–8 km.
Efektivita sledovaných souprav bude záviset především na tržní ceně štěpky jako hlavního
získávaného produktu. Z předběžných propočtů, při ceně štěpky v rozmezí 900–1500 Kč.t-1,
lze usuzovat na možnost efektivního nasazení sledovaného drtiče již od 40 ha sklízené plochy,
u lisu podle jeho pořizovací ceny asi od 50 ha sklízené plochy ročně.
107
„Úroda 12/2012, vědecká příloha časopisu“
Výsledky práce naznačují, že uvedené technologie mohou být dostupné i pro stávající střední
a velké vinohradnické podniky v ČR.
Závěr
Práce se zabývá nejdůležitějšími aspekty návrhu dvou technologií pro získání energetické
štěpky z réví vinic. Součástí práce bylo hodnocení provozních nákladů u 2 variant
technologických postupů využívajících drtič se zásobníkem a svinovací lis. Pro jednotlivé
varianty byly modelovány provozní náklady v závislosti na výkonnosti a dopravní vzdálenosti
při odvozu štěpky nebo balíků. Výsledky jsou významným podkladem pro všechny uživatele
popsaných technologií a umožňují jim posoudit investiční záměr směřující k zavedení
popsaných nebo obdobných technologií.
Dedikace
Příspěvek vychází z řešení výzkumného projektu NAZV č. QH 82242 „Technické prostředky
pro sklizeň a zpracování odpadního dřeva z vinic“
Použitá literatura
Burg, P., 2007: Perspektivní mechanizační prostředky ve vinohradnictví a jejich vliv na
ekonomiku a kvalitu produkce. Habilitační práce. MZLU v Brně, 205 s.
Herzán, Z., 1987: Využití dřevního odpadu v zahradnické výrobě pro energetické účely.
Diplomová práce. Brno: ZF VŠZ Brno, 77 s.
Maga, J. a kol., 2008: Komplexný model využitia biomasy na energetické účely. Nitra: SPÚ
v Nitra. 1. vydání. 183 s. ISBN 978-80-552-0029-3
Souček, J., 2007: Zpracování rostlinného materiálu štěpkovači a drtiči. Komunální technika.
Praha: Profi Press. Roč. 1, č. 9, s. 44–47. ISSN 1802-2391
Souček, J., 2010: Doprava jako součást logistiky energetických surovin v zemědělství.
Biom.cz
[online].
2010-01-13
[cit.
2011-02-03].
Dostupné
z
WWW:
<http://biom.cz/cz/odborne-clanky/doprava-jako-soucast-logistiky-energetickych-surovinv-zemedelstvi>. ISSN: 1801-2655
Walg, O., 2007: Taschenbuch der Weinbautechnik. 2. vyd. Kaiserslautern: Rohr–Druck. 620
s. ISBN 978-3-921156-78-0
Zemánek, P., Burg, P., Michálek, M., 2010: Hodnocení technologických postupů využívaných
při zpracování réví pro energetické účely. Společnost pro techniku prostředí. Konference
alternetivní zdroje energie 2010, Kroměříž 13-15.7.2010. s. 323–328. sb. celkem 379 s.
ISBN 978-80-02-02241-1
Žufánek, J., 1998: Bilance zdrojů biologických odpadů ve vinohradnictví a ovocnictví.
Sborník z mezinárodní konference "Ekologické aspekty výzkumu, vývoje a provozu
zahradnické techniky", konané u příležitosti setkání kateder a ústavů VŠ a výzkumných
pracovišť v Lednici 23. a 24. 4. 1998, s. 203–208
Kontaktní adresa:
Doc. Ing. Pavel Zemánek, Ph.D.
Ústav zahradnické techniky, Zahradnická fakulta, Mendelova univerzita v Brně
Valtická 337, 691 44 Lednice, Česká republika
e-mail: [email protected]
108
„Úroda 12/2012, vědecká příloha časopisu“
KRAJOVÉ ODRŮDY ROSTLIN JAKO KULTURNÍ DĚDICTVÍ
NÁRODA
Plant landraces as a national cultural herritage
Holubec V.1, Paprštein F.2, Řezníček V.3, Dušek K.1
Výzkumný ústav rostlinné výroby, v. v. i., Praha a Olomouc
Výzkumný a šlechtitelský ústav ovocnářský Holovousy s. r. o.
3
Mendelova univerzita v Brně
1
2
Abstrakt
Krajové odrůdy jsou ceněny jako místní specialita a vyjadřují národní identitu země a identitu regionu.
Území České republiky se významnou měrou podílelo na vzniku řady odrůd. Ovocné stromy se sázely
jako aleje podél silnic, na mezích polí nebo jako sady v extravilánu vesnic a vytvářely typický ráz
české krajiny. Za účelem inventarizace krajových materiálů a starých odrůd je přepracovávána
databáze z listin povolených odrůd 1941-2000. Inventarizace historického výskytu a pěstování
krajových odrůd ovoce v ČR byla prováděna v terénu v oblasti Podkrkonoší, Polabí Orlických hor a
Tišnovska. Při porovnání starých fotografií se současným stavem byl zjištěn 90 až 100 % úbytek sadů
z extravilánu obcí. Na základě prováděné inventarizace a posouzení v terénu dojde navržení in situ
konzervace nejcennějších sadů, alejí a roztroušených výsadeb a převedení vybraných genotypů do ex
situ výsadeb.
Klíčová slova: krajové formy, staré odrůdy, konzervace, krajové zvláštnosti, národní identita
Abstract
Landraces are valuable as local specialities representing national identity of a county or region. The
territory of the Czech Republic has a significant influence on creation of many landraces/cultivars.
Fruit trees have been planted often along roads in the country, between fields and as orchards around
villages forming typical Czech rural landscape. The inventory database of landraces and obsolete
cultivars colatetd in 90ties from Lists of registered cultivars 1941-2000 was updated and analysed.
Historical and present occurrence and growing of fruit landraces was verified in the field in the region
of Podkrkonoší, Polabí, Orlické Mts. and Tišnov region. Comparing of old photographs with present
air mapping revealed a decrease of orchards around villages by 90 to 100 %. On the basis of our
inventory and field research, proposals for in situ conservation of the most valuable orchards and other
plantations will be elaborated and selected genotypes will be taken to ex situ plantations.
Key words: landraces, obsolete cultivars, conservation, regional specialities, national identity
Úvod
Krajové formy vznikaly od počátku zemědělství výběrem z planých ekotypů a jejich
pěstováním farmáři v jejich domácím regionu. Farmáři opakovali pozitivní i negativní výběr
vědomě i neuvědoměle, až se ustálily krajové formy, a ty si navzájem vyměňovali. Staré
tradiční odrůdy naopak vznikaly na profesionální bázi, zprvu cíleným výběrem a později
záměrným křížením šlechtiteli. Hranice mezi těmito farmářskými a šlechtitelskými materiály
je nejasná. Pravých krajových materiálů se dochovalo málo a je o nich mnohem méně
informací než o starých šlechtěných odrůdách. Všechny tyto materiály vzniklé na historickém
území českých zemí představují objekty naší kulturní identity. Mnohé krajové odrůdy jsou
svázány s jejich tradičním využitím a s technologiemi zpracování. Krajové odrůdy jsou
ceněny jako místní specialita (Kühn 1974) a vyjadřují národní identitu země a identitu
regionu. Pamětníci dodnes vzpomínají na pšenici dvouzrnku, která byla v Bílých Karpatech
užívána do jelit a prejtu a není nahrazena ekvivalentním materiálem.
Zatímco polní plodiny vymizely postupně z kultury, ovocné dřeviny se nacházejí v krajině do
dnes. Z dalších plodin se v kultuře dochovaly kořeninové a léčivé druhy a některé minoritní
zeleniny v zahradách. Těmto skupinám plodin je věnována v příspěvku hlavní pozornost.
109
„Úroda 12/2012, vědecká příloha časopisu“
Ovocné stromy se v české a moravské krajině uplatňovaly velmi významně již od 7. století
(Říha, 1919). Slivoňové, ořechové, jabloňové aleje vtiskly mnohým regionům typický ráz. V
minulosti byly ovocné aleje právě jednou z forem ovocnářských produkčních výsadeb. Dnes
je jejich hospodářský význam méně akcentovaný a jsou považovány především za krajinný
element (Salašová, 2000). Staré sady jsou významné z hlediska zachování genofondu
kulturních odrůd ovocných dřevin (Tetera, 2003). Tyto dřeviny jsou znakem autenticity místa.
Návrat původních druhů do krajinných prostor, ze kterých byly lidskou činností vytlačeny,
znamená podstatné zvýšení druhové, fytocenologické diverzity a obnovu, případně záchranu
genofondu autochtonní flóry (Salašová, 2000).
K historicky pěstovaným rostlinám na našem území patří také zeleniny a kořeninové plodiny.
V nálezech zuhelnatělých semen v Mikulčicích byly nalezeny okurky. Významnou úlohu
v rozšiřování a pěstování plodin měly klášterní a zámecké zahrady. Ze sedleckého kláštera u
Kutné Hory se již ve 12. století zavádělo specializované pěstování křenu v Malíně, z kláštera
v Moravském Krumlově pěstování chřestu v Ivančicích (Moravec, 2001). U nás probíhala
etapa vzniku krajových odrůd zelenin převážně v průběhu 19. století, jejich využívání trvalo
až do poloviny 20. století. Koření a léčivé rostliny byly získávány sběrem v přírodě, mnohé
dosud. Počátky šlechtění vyvolala větší spotřeba druhů, zvláště jejich průmyslové zpracování.
V předválečném Československu se ročně spotřebovalo na 400 tun suchých léčivek s největší
poptávkou po 14 druzích koření (Moravec, 2001).
Po druhé světové válce došlo k velkým změnám v zemědělství, industrializace vyžadovala
nové kultivary pěstovaných plodin. Začátkem druhé poloviny 20. století pocítila krajina vliv
socializace venkova. Nastal proces scelování, likvidace mezí, meliorace a jiné pozemkové
úpravy. Na polích vznikaly monokultury, došlo k úbytku selských sadů, ovocných stromořadí
a rozptýlené krajinné zeleně vůbec (Tetera a kol, 2006).
V současné době se změnou zemědělských priorit se však trh pro zajímavé krajové odrůdy
otevírá, zejména ve spojení s organickým a ekologickým zemědělstvím, rozšiřujícím se
vegetariánstvím a požadavkem na diversifikaci druhů a plodin.
Materiál a metody
V počáteční fázi řešení projektu bylo nezbytné shromáždit informace o starých odrůdách
z historických pramenů, zejména katalogů zahradnických firem, listin povolených odrůd, a
obecně materiálů v regionálních archivech a dále od pracovníků Správ národních parků a
chráněných krajinných oblastí. Databáze starých odrůd byla následně porovnána
s Almanachem šlechtění (Němec et al. 2000). Výskyt starých odrůd ovocných dřevin byl
prověřován v terénu na mnoha místech České republiky a bylo prováděno určování odrůd.
Jednotlivé stromy byly zaměřeny kvalitním přístrojem GPS a vymapovány do programu
Geobáze Mapa ČR 1:100 000.
Na základě zkušeností s regenerací materiálu v genofondových výsadbách jsou zpracovány
metodiky přípravy rostlinného materiálu pro výsadby do on farm sadů, ošetření materiálu ve
školce a následná nezbytná ošetření po výsadbě.
Výsledky a diskuze
1.
Inventarizace krajových a starých šlechtěných odrůd o počátků šlechtění v ČR
z písemných zdrojů
Údaje o historickém materiálu krajových forem a šlechtěných odrůd od počátku šlechtění na
našem území (Československa a České republiky) do roku 2000 byly shromážděny,
převedeny do formy databáze a zkontrolovány řešiteli specializovaných kolekcí. Databáze
byla analyzována z hlediska podílu odrůd, plodin a skupin plodin, životnosti odrůd (délka
registrace). Průměrná životnost odrůdy byla spočítána na 8,1 let. Rozložení životnosti
110
„Úroda 12/2012, vědecká příloha časopisu“
jednotlivých odrůd podle skupin plodin ukazuje graf 1. Výsledky jsou zatíženy chybou
absence exaktní informace v databázi před rokem 1941. Řada materiálů byla uvedena
v listinách jen jednou a to v letech 1941, 1948 nebo výjimečně pozdějších (658 odrůd). Tyto
odrůdy lze považovat za nejstarší krajové a mohly mít naopak životnost dlouhou, 30-50 let
před publikací první Listiny. Němec et al. (2000) uvádí registraci nejstarších odrůd obilnin od
roku 1922 a luskovin od roku 1928. Některé odrůdy se udržely v sortimentu po celou
sledovanou dobu do roku 2000, tj 45 let, jedná se zejména o minoritní druhy koření např.
mateřídouška tymián ´Krajový´, lékořice ´Hladkoplodá krajová´, pelyněk kozalec ´Krajový´.
Krajové odrůdy ovocných dřevin a révy však mohou mít skutečnou životnost 150-300 let, ale
neexistují odpovídající záznamy
Graf 1. Rozložení životnosti jednotlivých odrůd podle skupin plodin v přehledu
povolených odrůd z let 1941-2000
V rámci tohoto projektu představují hlavní objekt zájmu ovocné dřeviny, jakožto podstatný
faktor v krajině. Ovocné dřeviny v nejrůznějších typech výsadeb (sady, aleje, roztroušená
zeleň a staré solitérní stromy) tvořily po staletí typický ráz české vesnické krajiny. Z přehledu
povolených odrůd od roku 1941 je patrné, že převažují jabloně, hrušně a slivoně. Teplomilné
ovocné druhy se v sortimentu odrůd uplatňují později, zejména v 80. a 90. letech.
2.
Inventarizace historického výskytu a pěstování krajových odrůd ovoce v ČR.
Území České republiky se již od středověku významnou měrou podílelo na vzniku řady odrůd
ovocných dřevin. Dokládá to značný počet krajových odrůd, které se v hojné míře pěstovaly
ještě na přelomu 18 a 19 století. Na základě studia starých dobových fotografií pořízených při
leteckém snímkování těsně před druhou světovou válkou (1938) byl zjištěn četný výskyt
extenzivních sadů v nezastavěných částech obcí – extravilánu až po vnější hranici jejich
katastrálního území. Tyto sady tvořily často souvislé pásy kolem intravilánu obcí. Při
porovnání těchto fotografií se současným stavem (letecké snímky pořízené po roce 2000) byl
zjištěn 90 až 100 % úbytek tohoto důležitého environmentálního prvku z české kulturní
111
„Úroda 12/2012, vědecká příloha časopisu“
krajiny. Je patrné, že remízky, roztroušená zeleň a extenzivní sady byly od 50 let postupně
nahrazovány rozsáhlými lány polí s monokulturami obilnin a olejnin.
Bylo analyzováno rozšíření a historické pěstování ovocných plodin ve vybraných regionech
ČR. Získávání informací bylo v roce 2011 zaměřeno na oblasti v Čechách: Podkrkonoší (obr.
1), Polabí a Orlické hory. Při terénním průzkumu byly zapsány výskyty stromů, v době
plodnosti určeny odrůdy, zapsána charakteristika stromu a zdravotní stav. Některé odrůdy
ovocných plodin jsou významně spjaty s národnostními menšinami na území ČR (zejména
německá). Z oblastí Podkrkonoší a Orlických hor se jedná například o odrůdy jabloně
´Řehtáč soudkovitý´ (´Prinzenapfel´), ´Landsberská reneta´ (´Renette Landsberger´) a
´Vilémovo´ (´Wilhelmapfel´) nalézané v oblastech osídlených německou menšinou.
Výskyt starých odrůd ovocných dřevin na Moravě byl prověřován na Tišnovsku (obr. 2).
V katastrálním území 14 obcí byla vizualizována lokalizace stromů s využitím ortofotomap
z Google. Staré výsadby zahrnovaly sady, aleje, soukromé zahrady v intravilánu vesnic,
roztroušenou zeleň a solitérní stromy. Vzorky plodů byly sebrány pro potvrzení určení do
odrůd a byla pořízena fotodokumentace.
3.
Charakteristika vybraných lokálních odrůd, které byly nalezeny v oblastech
Podkrkonoší, Polabí, Orlických hor a Tišnovska.
Třešně: ´Ladeho pozdní´. Velmi stará česká odrůda, červená chrupka neznámého původu
zrající v 9 týdnu po odrůdě Van. Jedná se o nejpozději zrající odrůdu třešně. Plody jsou
středně velké až menší průměrné chuti.
´Buketova´. Velmi stará lokální česká odrůda třešně, která nese na jedné stopce většinou 2 až
3 plody. Zraje asi 5 dní před odrůdou Van. Plody jsou malé (kolem 3 g). Chuť dužniny je
průměrná, navinule sladká. Šťáva barví velmi dobře.
Višně: ´Vackova´. Původ východní Čechy, nahodilý semenáč višně ´Ostheimské´ z roku
1893. Zraje několik dní před odrůdou třešní Napoleon. Plody jsou středně velké až větší (5 – 6
g), barvy tmavě červené. Dužnina je měkčí, chuti navinulé, příjemně kořenité, velmi dobré.
Strom roste středně silně až silněji, vytváří typické kulovité koruny, silně zahušťuje. Plodnost
je velmi raná, bohatá. Cizosprašná odrůda.
Jabloně: ´Smiřické vzácné´. Česká lokální odrůda z konce 19. století rozšířena především
v severovýchodních Čechách. Plody jsou větší (140 – 180 g). Tvar ploše kulovitý, pravidelný.
Dužnina je bílá, šťavnatá. Chuť má sladce navinulou. Konzumně zraje v prosinci, vydrží do
března. Tvar koruny je ploše kulovitý, roste bujně.
´Míšeňské´. Velmi stará odrůda neznámého původu. Pěstovala se v Čechách již začátkem 15.
století. Dužninu má bělavou, tuhou, chuti navinule sladkou, dobrou. Zraje v listopadu, vydrží
do dubna. Vytváří hustší kulovité koruny. Roste bujně. Velmi odolná k poškození mrazem.
´Malinové holovouské´. Místní odrůda objevena majitelem panství Františkem Josefem
z Leveneuru a Grünwallu v Holovousích na sklonku 18. století. Na zemské říšské výstavě ve
Vídni v r. 1888 získala nejvyšší ocenění. Jak se v historických záznamech uvádí i císař
František Josef II. ji za výbornou uznal a rázem dobyla zvučného jména a rozšíření. Plody
jsou středně velké až větší (140 - 170 g), kulovitého tvaru. Dužnina je navinule sladká
s malinovou příchutí, vynikající. Konzumní zralost říjen až listopad.
Hrušně: ´Špinka´. Velmi stará odrůda, která se pěstuje v Čechách nejméně 400 let. Plody
jsou menší, kratšího kuželovitého tvaru, vynikají velmi dobrou chutí. Typickým znakem je
velký otevřený kalich. Zraje postupně od poloviny srpna do začátku září. Stromy rostou velmi
bujně a vytvářejí mohutné, široce jehlancovité koruny. Stromy dosahují vysokého stáří, 150 a
více let.
´Jakubka´ Plod je baňatý, pravidelný, přechod do stopky výrazně zhrbolacený, barva slupky
jasně zelená až žlutá, na sluneční straně načervenalá. Stopka středně dlouhá, kalich povrchový
112
„Úroda 12/2012, vědecká příloha časopisu“
s výskytem drobných úštů. Dužnina nažloutlá, šťavnatá, sladká „hniličí“. Ovoce po sklizni
rychle dozrává. Nachází se ve starých zahradách.
´Knížatka´ Plody jsou protáhlého lahvicového tvaru, slupka světlezelené barvy s výrazným
tečkováním., na sluneční straně plodu se nachází jasně červené líčko. Stopka je dlouhá, tenká.
Kalich povrchový pootevřený. Úšty jsou tenké drobné. Dužnina je bělavá, velmi šťavnatá,
chutná, po dozrání „hniličí“. Vysazovala se do zahrad v blízkosti domu, (obr. 3).
4.
Inventarizace pěstování kořeninových a léčivých plodin a minoritních zelenin
Při studiu literárních pramenů je uváděno pěstování a využívání krajových odrůd zelenin a
LAKR (léčivých, aromatických a kořeninových rostlin) na území celé republiky až do období
devadesátých let minulého století. Terénní průzkum v letech 2000-2011 prováděný ve
vybraných oblastech tradičně zaměřených na pěstovánízelenin a LAKR (Prostějovsko,
Olomoucko a Polabí) ukázal, že velká část těchto materiálů je v současné době nahrazena
komerčně dodávanými osivy a sadbou, tradiční odrůdy úplně vymizely a jsou nenávratně
ztraceny.
Pro potřeby konzervace a záchrany původních krajových materiálů se podařilo získat šalotku
(Allium ascalonicum L.) z lokality Lešany (okres Prostějov), česnek kuchyňský (Allium
sativum L.) z lokality Zákřov (okres Olomouc) agenotypy křenu z Lysé nad Labem (okres
Nymburk) a Tupadly (okres Mělník).
Na záchranu genofondu krajových odrůd je třeba nahlížet v širších souvislostech.
Z celosvětového hlediska jde o povinnost každého národa postarat se o výsledky práce
předchozích generací farmářů a šlechtitelů jako kulturní dědictví daného regionu a národa.
Maxted et al. (2008) charakterizují současné nutné směrování vývoje na Zemi jednou větou:
"Pro zachování dynamického environmenálního světa se stále zvyšující se populací a
omezenými zdroji musíme konzervovat veškerou genetickou diversitu pro naši vlastní
existenci, zabezpečení jídla a životního prostoru". Podobně Ceccarelli (2012) konstatuje, že
globální potravinová bezpečnost je ohrožena vlivem klesající agrobiodiversity v kombinaci
s klimatickými změnami. Nyní je ve světě pěstováno méně než 15 druhů, přičemž většina
lidstva je potravinově závislá pouze na 12 plodinách. Tudíž různorodost genofondu se stává
žhavým tématem dnešní doby.
Závěry
Analyzovaná databáze českého krajového a vyšlechtěného genofondu bude podkladem pro
následnou konzervaci a vyhledávání nezvěstného a ztraceného materiálu. Terénní průzkum
zajistil regionálně cenný materiál krajových odrůd ovoce, prověřil existenci a odrůdové
složení vybraných sadů, alejí a roztroušených výsadeb. Přenos vybraných materiálů do ex situ
výsadeb bude pojistkou pro navrhovanou in situ konzervaci - pro uchování národního dědictví
starých odrůd.
Dedikace
Tato práce vznikla při řešení projektu Ministerstva kultury č. DF11P01OVV006.
Použitá literatura
Ceccarelli S. 2012. 15. Landraces: Importance and use in breeding and environmentally
friendly agronomic systems. In: Maxted N., DullooM.E., Ford-Lloyd B.V., Freese L.,
Iriondo J., Carvalho M.A.A.P. Agrobiodiversity Conservation, CABI UK, pp. 103-117.
Kühn F. 1974. Genové zdroje místních plodin v Československu. In: Getické zdroje ve
šlechtění rostlin. Sbor. Věd. Prací Celost. Konf. Praha p. 685-694.
113
„Úroda 12/2012, vědecká příloha časopisu“
Maxted N., Iriondo J.M., and Dulloo M.E. 2008. Introduction: the integration of PGR
conservation with protected area management. In: IriondoJ.M., Maxted N., and Dulloo M.
E. (eds) Conserving plant genetic diversity in protected areas: Population management of
crop wild relatives. CABI, Wallingsford, pp. 1-22.
Moravec J. 2001. Historie genetických zdrojů zelenin. In: Historie a současný stav práce
s genofondy v ČR. Genetické zdroje 86, VÚRV Praha s. 13-19.
Němec V., Bouma J., Amler P., Damborský F., Palán D., Tyler F., Lužný J., Zadina J., Světlík
V., Moravec J. Křehlík L. 2000. Almanach českého a moravského šlechtění rostlin.
Českomoravská šlechtitelská a semenářská asociace, 220 s.
Řiha J., 1919. Česke ovoce. Praha.
Salašová, A 2000. Koncepcia krajinného plánovania. In: Koncepce uceleného krajinného
plánování. Česká společnost krajinných inženýrů, s. 33.
Tetera V. 2003. Záchrana starých a krajových odrůd ovocných dřevin. Metodika ČSOP č. 4.
Veselí nad Moravou
TeteraV., Boček S., Jongepierová I., Krška B., Němec J., Pešek R., Řezníček V., Tomčala L.
2006. Ovoce Bílých Karpat. ČSOP Bílé Karpaty ve Veselí nad Moravou. s. 309, ISBN 80903444-5-3
Obr. 1. Mapování krajových odrůd ovocných a planých genetických zdrojů v oblasti
Krkonoš
Obr. 2. Nejstarší jabloň Velník, obec Křížovice
Obr. 3. Krajová odrůda hrušně Knížatka
Kontaktní adresa:
Ing. Vojtěch Holubec, CSc.
Genová banka, Výzkumný ústav rostlinné výroby v. v. i.
161 06 Praha 6 Ruzyně 507
e-mail: [email protected]
114
„Úroda 12/2012, vědecká příloha časopisu“
KOŘENOVÝ SYSTÉM - SKRYTÁ POLOVINA ROSTLINY
Plant roots – the plant hidden half
Středa T., Hajzler M., Chloupek O.
Mendelova univerzita v Brně
Abstrakt
Na Ústavu pěstování, šlechtění rostlin a rostlinolékařství Mendelovy univerzity v Brně je prováděn
dlouhodobý výzkum kořenového systému ve vazbě na odolnost k suchu, tvorbu výnosu a kvalitu
polních plodin. V příspěvku jsou uvedeny nejvýznamnější výsledky hodnocení u pšenice, ječmene,
řepky a hořčice bílé. U některých plodin byl zjištěn průkazný vztah mezi velikostí kořenového
systému, výnosem zrna a kvalitou zrna. V suchém roce 2007 byla velikost kořenového systému
pšenice seté průkazně korelována s výnosem odrůd (r2 = 0.285*) a s výnosem škrobu (r2 = 0.248*).
Odrůdy ječmene s větším kořenovým systémem poskytly ve výrazně suchém roce průkazně vyšší
výnos zrna. S využitím metody analýzy obrazu byla zjištěna průkazná negativní korelace (r = -0,46*)
mezi hmotností nadzemní biomasy a prokořeněním v hloubce do 10 cm u hořčice bílé. U řepky nebyl
zjištěn statisticky průkazný vztah mezi elektrickou kapacitou kořenů a výnosem semen.
Klíčová slova: kořenový systém, výnos, kvalita, sucho, prostředí
Abstract
A long-term research of the root system parameters in connection with drought tolerance is carried out
at Mendel University in Brno, Department of Crop Science, Breeding and Plant Medicine. The paper
summarizes the most important founding of this research for wheat, barley, oil rape and white
mustard. A statistical significant relationship between root system size (RSS) of several crops, yield
and quality of grains was found out. RSS of the wheat significantly correlated with grain yield (r 2 =
0.285*) and with starch yield (r2 = 0.248*) in dry year 2007. Barley – a crop with larger root system
size provide much higher yield of grain in dry years when the RSS is larger. Significant negative
correlation of aboveground biomass yield of white mustard and amount of root to 10 cm depth was
found out (r=-0.46*). In case of oil rape any statistically significant relationship between RSS and
yield was not fond out.
Key words: root system, yield, quality, drought, environment
Úvod
Primárním selekčním znakem při šlechtění polních plodin je výnos a kvalita produkce.
Selekční zisk se však může zvýšit využitím sekundárního selekčního kritéria. Hodnotu
takového selekčního kritéria lze zjistit stanovením korelace (mezi výnosem za stresu a jeho
úrovní) a heritability mezi potomstvy určité populace. Preferovat je třeba sekundární kritéria,
která vedou spíše k vyššímu výnosu, než k lepšímu přežití stresu (Středa et al., 2009).
Na Ústavu pěstování, šlechtění rostlin a rostlinolékařství Mendelovy univerzity v Brně je ve
spolupráci se šlechtitelskými podniky využívána jako sekundární selekční kritérium velikost
kořenového systému. Hodnocení a selekce odrůd se uplatňuje při šlechtění ozimé pšenice,
jarního ječmene i ozimé řepky. Hodnotí se odrůdy jako potenciální rodiče (i nové linie) a
vybrané se rekombinují pro získání štěpící populace a výběr rostlin s heterózí v tomto znaku.
Větší kořenový systém je faktorem výnosové stability, protože během suchých období může
zajišťovat dostupnost vody z hlubších vrstev půdy, pokud se tam vyskytuje (Chloupek et al,
2010; Středa et al., 2012). Současně ovšem není větší velikost kořenového systému výhodou
ve všech případech - pokud sucho nenastane, je zbytečnou investicí rostliny na úkor jiné
translokace produktů fotosyntézy. Lze předpokládat, že význam kořenů jako osvojovacího
aparátu poroste v budoucnu s rostoucí teplotou prostředí a současnou změnou distribuce
srážek v průběhu roku, tak jak předpokládají klimatické modely. Větší kořenový systém
115
„Úroda 12/2012, vědecká příloha časopisu“
umožňuje lepší využití živin a menší kontaminaci prostředí živinami, hlavně dusíkem a
fosforem. Také z těchto důvodů, v souvislosti s nitrátovou směrnicí a možným vyplavováním
živin do spodních vod, jsou parametry kořenového systému předmětem zájmu i u meziplodin
(Hajzler et al., 2012).
Materiál a metody
Kořenový systém je hodnocen na základě měření jeho elektrické kapacity (Chloupek, 1972;
Bodner et al., 2008) přístrojem ELC-131D. Jednoduchá, levná a nedestruktivní metoda
umožňuje změřit velikost kořenů u tisíců jedinců během jednoho dne in situ, tj. v místě růstu
rostlin. Na rostlinu je připevněna jedna elektroda (kleště nebo jehla) a druhá elektroda je
zasunuta asi v polovině sponu do půdy. V obvodu, kde prochází střídavý proud o frekvenci 1
kHz mezi kořenovým systémem a půdou se měří elektrická paralelní kapacita. Jednu desku
představuje povrch kořenového systému a druhou tvoří substrát, v němž kořeny rostou.
Hodnocena je tak pouze živá část kořene, která vykazuje určitou elektrickou aktivitu na
membránách, protože dochází k polarizaci živých membrán nebo živých buněk.
Pro sledování architektury kořenového systému a jeho případného vlivu na tvorbu výnosu v
různých podmínkách je ve spolupráci s Universität für Bodenkultur Wien používána a
vylepšována metoda měření kořenového systému prostřednictvím analýzy obrazu
vyplavených a naskenovaných kořenů (Dostál et al., 2008). Metoda umožňuje hodnocení
kořenových charakteristik jako je délka, povrch, průměr nebo počet kořenových špiček
pomocí software WinRHIZO (Régent Instruments Inc., Quebec, Kanada). Vzorky kořenů se
odebírají z rostlin v různých fázích růstu (dle plodiny) během vegetace přímo na poli nebo z
nádobových pokusů a z různých hloubek půdního profilu. Speciální vzorkovací tyč má
průměr 63 mm a odběr byl prováděn do hloubky 60 cm. Takto získaný půdní blok byl
rozdělen na 6 dílů o délce 10 cm, zamražen při teplotě -20°C a uchován k dalšímu zpracování.
Po rozmražení byl blok plaven přes soustavu sít o průměru ok 1,6 a 0,6 mm. Před vlastní
analýzou pomocí skeneru musí dojít k obarvení kořenů methylenovou modří. Po naskenování
jsou kořeny analyzovány programem WinRHIZO a identifikovány podle intenzity zbarvení.
Zjištěné údaje o celkové délce a ploše kořenového systému byly využity pro výpočet RLD
(Root Lenght Density), RSD (Root Surface Density), SRL (Specific Root Lenght) (Gregory,
2006). RLD a RSD hodnotí hustotu prokořenění na jednotku objemu půdy, SRL specifikuje
délku kořenového systému na jednotku jeho hmotnosti. U všech vzorků kořenového systému
byla zjištěna hmotnost sušiny. Data byla statisticky zpracována ANOVA and post hoc LSD
test in program Statistica version 9 (StatSoft Inc., Tulsa, UK). Korelační koeficienty byly
spočítány dle Chloupek (1996), který uvádí jako nejvhodnější korelační koeficient r zbytek (rz).
Tento koeficient vznikl z jednotlivých údajů po odstranění efektů odrůd a prostředí.
V průběhu celé vegetace je na pokusných plochách monitorována vlhkost půdy
elektromagnetickými TDT senzory VIRRIB s dataloggerem. Čidla registrují objemovou
vlhkost půdy a umožňují přesně kvantifikovat nástup a intenzitu případného půdního sucha
(vyjádřeno jako bod snížené dostupnosti vody pro rostliny – 60 % využitelné vodní kapacity a
méně).
Výsledky a diskuze
Hodnocení parametrů kořenového systému pšenice seté
Velikost kořenového systému odrůd pšenice ozimé (20, 20, 20 a 18 odrůd v letech 2007,
2008, 2009 a 2010) byla hodnocena metodou měření elektrické kapacity. Výsledky byly
korelovány s výnosem a kvalitou zrna z pokusů na stanicích ÚKZÚZ (20, 22, 23 a 23 stanic
v letech 2007, 2008, 2009 a 2010). Pro srovnání byly použity výsledky z low i high input
vyrianty ÚKZÚZ a také výnosové a kvalitativní výsledky z varianty pozdního setí a
s použitím různých předplodin. Velikost kořenového systému byla nejvíce ovlivněna lokalitou
116
„Úroda 12/2012, vědecká příloha časopisu“
– její vliv činil 2,6 – 15,6 % proměnlivosti velikosti kořenového systému. V suchém roce
2007 byla velikost kořenového systému průkazně korelována s výnosem odrůd (r2 = 0.285*) a
s výnosem škrobu (r2 = 0.248*) na všech stanicích. V roce 2008 byla negativní korelace (r = 0.459*) mezi velikostí kořenového systému a výnosem zrna na třech stanicích s nejnižší
nadmořskou výškou a s nejvyšší teplotou. V roce 2009 byla velikost kořenového systému a
výnos zrna statisticky průkazně korelována (r2 = 0.391**) na pěti stanicích s výskytem sucha.
Ve vlhkém roce 2010 nebyl zjištěn průkazný vztah v žádné variantě. Tři odrůdy s největší
velikostí kořenového systému měly v průměru o 21 % větší kořenový systém než tři odrůdy
s nejmenším kořenovým systémem. Výnos zrna byl v roce 2007 u těchto odrůd s velkým
kořenovým systémem o 420 kg.ha-1 vyšší.
Tab. 1 Vztah mezi průměrnou velikostí kořenového systému skupin odrůd a výnosem a
kvalitou z dvaceti lokalit ÚKZÚZ v roce 2007
Skupina/Počet
odrůd
I/7
II/6
III/7
Vel. koř. syst. (nF)
Rozpětí
Průměr
1.34 - 1.67
1.54
1.68 - 1.74
1.71
1.75 - 2.05
1.86
Výnos zrna
(t.ha-1)
8.11
8.37
8.53
Obsah (%)
N-látek Škrobu
13.6
69.4
13.4
69.7
13.2
69.9
Výnos (t.ha-1)
N-látek
Škrobu
1.10
5.63
1.12
5.80
1.13
5.96
Hodnocení parametrů kořenového systému ječmene setého
Vztah mezi velikostí kořenového systému, výnosem zrna, kvalitou zrna v souvislosti
s tolerancí odrůd k suchu byl hodnocen v letech 2005 – 2008. Velikost kořenového systému
byla měřena u 10 – 22 odrůd jarního ječmene na dvou lokalitách. Ke srovnání s výnosovými a
kvalitativními parametry zrna byly použity výsledky ÚKZÚZ ze 7 – 19 stanic. Odrůdy
s větším kořenovým systémem poskytly ve výrazně suchém roce 2007 průkazně vyšší výnos
zrna. Sladovnické odrůdy s větším kořenovým systémem měly průkazně vyšší obsah škrobu,
sladového extraktu a vyšší výnos bílkovin. Je tak možno říci, že menší kořenový systém
odrůd ječmene může v suchých letech způsobovat menší výnos zrna a nižší sladovnickou
kvalitu.
Skupina/Počet
odrůd
Vel. koř. syst. (nF)
Rozpětí
Průměr
I/5
4,64 – 5,02
4,78
II/6
5,04 – 5,18
5,12
III/5
5,19 – 5,50
5,28
Korelace s velikostí kořen. systému
Obsah (%)
Výnos zrna
(t.ha-1)
Bílkoviny
Škrob
5,31
5,63
5,79
0,822**
11,72
11,38
11,34
-0,475
63,5
64,2
64,1
0,635**
Sladový
extrakt
81,7
82,2
82,5
0,503*
Hodnocení parametrů kořenového systému hořčice bílé
V pokusu byla hodnocena velikost kořenového systému osmi odrůd hořčice bílé (Sinapis alba
L.). Dvouletý pokus (2010 a 2011) byl realizován na dvou agroekologicky výrazně odlišných
lokalitách: Troubsko – řepařská výrobní oblast a Horní Třešňovec – obilnářská výrobní oblast.
Nebyl zjištěn statisticky průkazný vztah mezi velikostí kořenového systému a množstvím
nadzemní biomasy. Sledován byl také vztah mezi velikostí kořenového systému a obsahem
NO3- a NH4+ iontů v půdě po sklizni. Byla zjištěna negativní závislost RSS na množství
odebraného nitrátového dusíku z půdy. Tato závislost však nebyla statisticky průkazná. Při
hodnocení napříč lokalitami byla pozorována korelace hmotnosti nadzemní biomasy s
množstvím zůstatkových nitrátových iontů (r = 0,54). V Troubsku byla pozorována průkazná
negativní korelace RSS s obsahem amonných iontů (r = -0,81*).
S využitím metody analýzy obrazu byla zjištěna průkazná negativní korelace (r = -0,46*)
mezi hmotností nadzemní biomasy a prokořeněním (RLD) v hloubce do 10 cm. Možný je vliv
117
„Úroda 12/2012, vědecká příloha časopisu“
strategie investice do morfologických struktur, které zajistí lepší přístup k omezeně
přístupnému růstovému faktoru (teorie Wilson, 1988). Hořčice v úrodné půdě produkovala
více nadzemní biomasy na úkor kořenového systému. Zjištěna byla vysoce průkazná
negativní korelace (r = -0,632**) mezi SRL a nadzemní biomasou. Vysoce průkazný byl
korelační koeficient mezi SRL a RLD (v hloubce 0-20 cm), (r= 0,524**). Lze tak usuzovat na
pozitivní vztah mezi hustotou prokořenění a jemností kořenového systému.
Hodnocení parametrů kořenového systému řepky olejné
Pokusy s odrůdami řepky ozimé byly založeny v roce 2008/2009 u Opavy v řepařské výrobní
oblasti, na středně těžké hlinité půdě v nadmořské výšce 273 m n. m. Bylo hodnoceno devět
odrůd ve třech opakováních. Sledované odrůdy byly pěstovány v odrůdových pokusech v
systému s nižší intenzitou vstupů (bez fungicidního ošetření). Rostliny řepky ozimé byly
měřeny třikrát během vegetace. První měření bylo na podzim ve fázi listové růžice, druhé
měření během butonizace a třetí v plném květu. Z výsledků měření byly zjištěny odrůdové
rozdíly ve velikosti kořenového systému ve všech třech termínech měření. Byly zjištěny
průkazné korelace mezi termíny měření. Mezi prvním a druhým termínem byla korelace
statisticky nevýznamná r = 0,106. První a třetí termín byl statisticky významně korelován r =
0,455* (21 % z celkové proměnlivosti), mezi druhým a třetím termínem byla zjištěna
významná korelace r = 0,412* (17 % proměnlivosti). Zjištěn byl negativní vztah elektrické
kapacity kořenů a výnosu řepky, což naznačují i korelační koeficienty pro jednotlivé termíny
měření -0,175; -0,183 a -0,085. Koeficienty jsou velmi nízké a nejsou statisticky průkazné. Z
dosažených (jednoletých) výsledků lze usuzovat, že na úrodnějších půdách anebo v období,
kdy rostliny nejsou stresovány suchem je velký kořenový systém nevýhodou a spotřebovává
asimiláty, které mohou být využity pro tvorbu výnosu. Výsledky hodnocení velikosti
kořenového systému u řepky mohou být ovlivněny charakterem kořenu řepky (kůlový kořen
s tendencí k dřevnatění). Pro řepku je tak tato metoda pouze omezeně použitelná.
Závěr
Uvedené výsledky prokázaly, že vhodným selekčním kritériem u obilnin pro suché podmínky
byla velikost kořenového systému, měřená podle jeho elektrické kapacity. Odrůdy s větší
velikostí kořenového systému poskytly vyšší výnos a obsahovaly více fotosyntátů a méně
dusíkatých látek, jak tomu bývá při závlaze v suchých podmínkách. Je pravděpodobné, že
selekce na větší velikost kořenového systému by mohla v nehumidním prostředí ročníků a
lokalit zvýšit výnos extraktu a škrobu a byla by tedy vhodná např. pro šlechtění na produkci
bioethanolu. Každé nové selekční kritérium zpočátku rychle zvětšuje proměnlivost a proto je
také ohlas na selekci na nové selekční kritérium poměrně (ve srovnání s jinými selekčními
kritérii) rychlý.
Metoda digitální analýzy obrazu poskytuje relevantní údaje o intenzitě prokořenění v
jednotlivých vrstvách půdy. Při hodnocení hustoty prokořenění obilnin bylo nalezeno
průměrně 70 % kořenového systému rostlin ve vrstvě 0 – 20 cm, což odpovídá výsledkům
studií prováděných jinými autory. Ojediněle – na některých lokalitách a letech byla
zaznamenána změna distribuce kořenů ve vertikálním profilu s vyšším podílem biomasy v
nejhlubších vrstvách půdy. Lze se domnívat, že kořenový systém takto pružně reaguje na
změny v půdních horizontech nebo na systém zpracování půdy.
Konfrontací dvou metod měření velikosti kořenového systému – metodami měření elektrické
kapacity a digitální analýzy obrazu (v zahraničí zpravidla referenční metoda), byla zjištěna
dobrá shoda výsledků. Metodu měření elektrické kapacity tak lze doporučit jako rychlou a
levnou metodu stanovení meziodrůdových diferencí velikosti kořenového systému.
118
„Úroda 12/2012, vědecká příloha časopisu“
Dedikace
Práce vznikla s podporou projektu NAZV QI111C080 „Zpřesnění dostupné zásoby vody v
půdním profilu na základě modelu kořenového systému plodin pro efektivní hospodaření s
vodou a dusíkem“.
Použitá literatura
Bodner, G., Středa, T., Dostál, V., Chloupek, O., Kaul, H. Bestimmung der
Wurzelsystemgröße von Winterweizen: Anwendung und Interpretation einer elektrischen
in-situ Methode. In ALVA Tagung, Ernähren uns in der Zukunft Energiepflanzen?
Raumberg-Gumpenstein: ALVA (Hrsg.), 2008, s. 81-83.
Dostál, V., Středa, T., Chloupek, O., Bodner, G. Metody pro hodnocení velikosti kořenového
systému u ječmene jarního (Hordeum vulgare L.). In 16. Posterový deň s medzinárodnou
účasťou a Deň otvorených dverí na ÚH SAV "Transport vody, chemikálií a energie v
systéme pôda-rastlina-atmosféra". Bratislava: ÚH a GFÚ SAV, Bratislava, 2008, s. 106110, CD ROM.
Gregory, P. J. Plant roots, growth, activity and interaction with soils. 2006, Blackwell
Publishing, Oxford, p. 318.
Hajzler, M., Klimešová, J., Středa, T. Biomass production of white mustard (Sinapis alba L.)
varieties in relation to the root system size. In 62. Tagung der Vereinigung der
Pflanzenzüchter und Saatgutkaufleute Österreichs. Raumberg-Gumpenstein: Lehr- und
Forschungszentrum für Landwirtschaft, 2012, s. 105-108.
Chloupek, O. The relationship between electric capacitance and some other parameters of
plant roots. Biologia Plantarum, 1972, 14, 227-230.
Chloupek, O.: Zemědělský výzkum. Praha: Academia, 1996. 188 s.
Chloupek, O., Dostál, V., Středa, T., Psota, V., Dvořáčková, O. Drought tolerance of barley
varieties in relation to their root system size. Plant breeding. 2010. sv. 129, č. 6, s. 630636.
Středa, T., Dostál, V., Chloupek, O., Bodner, G. Šlechtění a výběr odrůd obilnin s větší
tolerancí k suchu. Úroda. 2009. sv. LVII, č. 5, s. 10-12.
Středa, T., Dostál, V., Horáková, V., Chloupek, O. Effective use of water by wheat varieties
with different root system sizes in rain-fed experiments in Central Europe. Agricultural
Water Management. 2012. sv. 104, č. 2, s. 203-209.
Wilson, J. B. A review of evidence on the control of shoot:root ratio, in relation to models.
Annals of Botany. Vol. 61. 1998. p. 433–449.
Kontaktní adresa:
Ing. Tomáš Středa, Ph.D.
Mendelova univerzita v Brně, Ústav pěstování, šlechtění rostlin a rostlinolékařství
Zemědělská 1, 613 00, Brno
e-mail: [email protected]
119
„Úroda 12/2012, vědecká příloha časopisu“
120
„Úroda 12/2012, vědecká příloha časopisu“
HODNOCENÍ ÚČINNOSTI SEPARAČNÍHO ZAŘÍZENÍ PRO
SEPARACI JADER Z HROZNŮ
The Classification of Efficiency by Separator for Seeds Separation from
Grape Pomace
Burg P., Zemánek P.
Ústav zahradnické techniky, Zahradnická fakulta, Mendelova univerzita v Brně
Abstrakt
Příspěvek se zabývá návrhem a ověřením účinnosti separačního zařízení s pasivními poloválcovými
síty při separaci vinných jader potřebných pro lisování vinného oleje. Pro úvodní experiment byly
navrženy 3 varianty sít s otvory o rozdílného tvaru a velikosti. Dílčí výsledky získané při ověřování
účinnosti separačního zařízení nelze v současné fázi považovat za uspokojivé. V jádrech
odseparovaných na sítech s rozdílným tvarem i velikosti otvorů byl ve všech případech poměrně
vysoký podíl nečistot (slupek). Vysoké byly rovněž ztráty jader, které během separace nebyly
odloučeny.
Klíčová slova: vinařství, semena révy vinné, separace jader
Abstract
The contribution deals with the design and verification of the effectiveness of separation the
equipment with passive semi cylindrical sieves. The equipment was monitored during the grape seeds
separation for pressing grape seed oil. For the initial experiment were designed three variants of sieves
with apertures of different shapes and sizes. Partial results obtained during verifying of the
effectiveness of separation equipment can´t be, at this stage, regarded as satisfactory. In the obtained
material (seeds) separated on sieves with different shape and size of holes was in all cases relatively
high proportion of impurities (grape skins). Also seeds losses were relatively high, lot of seeds weren´t
separated.
Key words: viniculture, grape seed, seed separation
Úvod
V souladu s nejnovějšími principy odpadového hospodářství uplatňovaného v rámci EU jsou
prioritně hledány nové bezodpadové technologie. Pozornost je tak v několika posledních
letech zaměřena také na možnosti efektivního využití matolin. Z pohledu odpadového
hospodářství představuje matolina druhotný biotický odpad produkovaný v sektoru FDM
(Food–Drink–Milk).
Matolina je tvořena zbytky dužnin, slupek, jader, popř. i třapin, které společně představují
přibližně čtvrtinu hmoty vinných hroznů (Arvanitoyannis a kol., 2006). Také Schieber a kol.
(2001), Baydar a kol. (2007) uvádějí, že z celkového množství zpracovávaných hroznů činí
podíl matolin v závislosti na odrůdě, stupni zralosti, použitém lisovacím zařízení, počtu
lisovacích cyklů aj. 15–25 % o objemové hmotnosti 400–800 kg.m-3. Matoliny jsou
významným zdrojem bioaktivních látech, obsahujících mimo jiné polyfenolické látky nebo
vitamin E s bohatým zastoupením tokotrienolů Anastasiadi et al. (2010).
Matolinu je možné zpracovávat kompostováním, extrakcí na olej, nebo ji lze využít pro
oddělení vinných jader s jejich následným lisováním na olej (Zemánek, 2009, Russ a kol.,
2004). Poslední z jmenovaných technologií není doposud v podmínkách ČR uplatňována,
výzkum směřuje hledání možností technického zajištění tohoto procesu, protože na trhu
vzrůstá poptávka po oleji z vinných jader i ostatních produktech vyrobených z pokrutin, které
představují odpadní produkt po lisování např. mouka, hořčice, těstoviny, palivové peletky aj.
Trainor (2005).
121
„Úroda 12/2012, vědecká příloha časopisu“
Olej z vinných jader má vysoký obsah esenciálních mastných kyselin a tetrafenolů. Pro své
dietetické hodnoty je zajímavou surovinou využívanou v gastonomii i farmacii. Protože je
svým charakterem polovysýchavý, je o něj zájem i v kosmetice a při výrobě alkydových
pryskyřic, do barev a fermeží (Žufánek, 1998, Rubio a kol., 2009).
Většímu využití této netradiční suroviny brání skutečnost, že matolina představuje odpad
vinařského průmyslu, který pro další zpracování (lisování vinných jader) vyžaduje úpravu
(separaci, sušení) prováděnou pokud možno přímo ve vinařských podnicích, které však pro
tuto činnost nejsou vybaveny potřebnými zařízeními ani potřebnou výrobní kapacitou
(Boulton a kol., 1999).
Cílem práce byl návrh a ověření účinnosti separačního zařízení s pasivními poloválcovými
síty při separaci vinných jader potřebných pro lisování vinného oleje.
Materiál a metody
Výběr stroje pro realizaci úpravy
Na základě studia dostupných zařízení, s ohledem na rozsah experimentálních prací a na
požadavky výkonnosti byl vybrán pro realizaci úprav mlýnkoodstopkovač typ ARNO-15
(celkové rozměry 1200x600x850 mm; elektropohon 220 V/1,4 kW). Zařízení je tvořeno
násypkou doplněnou ve spodní části o šnekový dopravník, který umožňuje snadnější transport
zpracovávaného produktu. Přístup do pracovního prostoru je řešen tak, že umožňuje výměnu
sít a instalaci záchytného zařízení pro podsítnou frakci. Toto konstrukční řešení umožňuje
rychlé a snadné čištění sít, to znamená výhodu při realizaci plánovaných experimentů.
Návrh úpravy – 3 varianty sít
Pro experiment byly navrženy 3 varianty sít s otvory o rozdílného tvaru a velikosti (var.A –
otvory štěrbinové 4 x 12 mm, var.B – otvory kruhového tvaru o průměru 5 mm kolmé
k podélné ose síta, var.C – otvory kruhového tvaru o průměru 5 mm souběžné s podélnou osou
síta), které byly odvozeny z dosavadních zkušeností a úvodních měření (granulometrická
měření, experimentální síta aj.). Síta byla zadána do výroby v měsíci VII., úprava se
realizovala v měsíci IX.
Nad poloválcovým sítem je umístněna rotující hřídel opatřená rozšířenými lopatkami
rozmístněnými ve šroubovici. Počet otáček hřídele činí 500 za minutu. Lopatky se pohybují
těsně po vnitřním povrchu síta a napomáhají posouvání separovaného produktu event.
protláčení vinných jader přes otvory v sítě. Nadsítná frakce odchází po povrchu síta a
vypadává v jeho zadní části, podsítná frakce je soustředěna ve spodní části odstopkovače do
záchytné vany.
Ověření variant
Experiment navázal na separaci semen odrůdy Frankovka a byl v termínu od 20.10.–25.10.
2011 zaměřen na separaci semen z odrůdy Zweigeltrebe s objemovou hmotností 510 kg.m-3 a
vlhkostí 36 %, která byla získána po vylisování hroznů v pneumatickém lisu VASLIN při
maximálním pracovním tlaku 1,6 baru.
Pro potřeby separace bylo odváženo 50 kg matolin pro každé z opakování. Účinnost separace
byla ověřována u obou typů sít celkem ve třech opakováních (3 x 50 kg). Po provedení
separačního zásahu bylo provedeno vyhodnocení podílu podsítné frakce (tvořena
odseparovanými semeny s podílem zbytků slupek) granulometricky.
Podíl jader a slupek ve sledovaném vzorku matolin (odrůda Zweigeltrebe) byl u kontrolního
vzorku stanoven rozborem na vibračních laboratorních sítech s průměrem ok 6–2 mm. To
122
„Úroda 12/2012, vědecká příloha časopisu“
umožnilo vyčíslit podíl jader pro 100 % čistotu separace. S touto hodnotou byly poté
porovnávány výsledky ostatních vzorků.
Z podsítné frakce byly odebrány směsné vzorky o hmotnosti 250 g, u kterých byla na
vibračních laboratorních sítech s průměrem ok 6–2 mm hodnocena hmotnost jader a slupek.
Výsledky a diskuze
Proces ověřování účinnosti separačního zařízení s pasivními poloválcovými síty při separaci
vinných jader byl realizován ve 3 opakováních a získané výsledky v každé variantě jsou
zpracovány v Tab. 1 a Tab. 2.
Tab. 1: Výsledky měření
Varianta - síto
Hmotnost jader
(g)
Čistota
(%)
separace
Kontrolní
vzorek
74,1
100
(granulometricky)
A
54,3
73
1. opakování
B
40,0
54
C
53,9
73
A
55,4
75
2. opakování
B
41,5
56
C
57,0
77
A
56,2
76
3. opakování
B
38,9
52
C
56,5
76
Pozn.: var.A: otvory štěrbinové 4 x 12 mm, var.B: otvory kruhového tvaru o průměru 5 mm
kolmé k podélné ose síta, var.C: otvory kruhového tvaru o průměru 5 mm souběžné
s podélnou osou síta
Ověřovaný princip ukazuje vyšší podíl jader v podsítné frakci u síta A a C, jádra však nejsou
odseparována úplně, propad vykazuje podíl slupek. Čistota separace dosahuje 54–77 %.
Tab. 2: Celkové vyhodnocení
Pokusná
varianta
síto A
síto B
síto C
1. opakování
2. opakování
3. opakování
Průměr
54,3
40,0
53,9
55,4
41,5
57,0
56,2
38,9
56,5
55,3
40,1
55,8
Směrodatná
odchylka
0,95
1,31
1,66
K vyhodnocení průkaznosti rozdílů mezi hodnocenými variantami pokusu byla použita
analýza variance (hladina významnosti α=0,05). Jako metoda následného testování byl
použit Tukeyův–HSD test na hladině významnosti α=0,05. Uvedené metody statistického
vyhodnocení byly aplikovány pomocí počítačového softwaru Unistat 4.53 pro Excel a MS
Excel (Tab.3 a Tab.4).
123
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 3: Analýza rozptylu – klasicky uspořádaný experiment
Zdroj
variability
Hlavní efekty
S1
Vysvětleno
Chyba
Celkem
Součet
čtverců
475,722
475,722
475,722
10,767
486,489
Stupně
volnosti
2
2
2
6
8
Průměrný
čtverec
237,861
237,861
237,861
1,794
60,811
Stat F
Významn.
132,554
132,554
132,554
0,0000
0,0000
0,0000
Z výsledků statistického vyhodnocení (Tab.3) vyplývá, statistická průkaznost vlivu velikosti a
tvaru otvorů u sít na účinnost separačního zásahu.
Tab. 4: Následné testování–95 % Tukey-HSD test
Skupina
Příp
Průměr
B
3
40,1333
A
3
55,3000
C
3
55,8000
Pozn: * označuje významně odlišné páry
B
A
*
C
*
*
*
Obr. 1: Experimentální zařízení (po vytažení síta)
Dílčí výsledky získané při ověřování účinnosti separačního zařízení s pasivními
poloválcovými síty při separaci vinných jader nelze v současné fázi považovat za uspokojivé.
V jádrech odseparovaných na sítech s rozdílným tvarem i velikosti otvorů byl v obou
případech poměrně vysoký podíl nečistot (slupek). Vysoké byly rovněž ztráty jader, které
během separace nebyly odloučeny.
Teoretickým rozborem procesu separace vinných jader se v zahraničí zabýval např. Plíva,
Jelínek (1999), Baydar a kol. (2007). Z výsledků jejich studií vyplývá, že lze vlastní separaci
jader z matoliny provádět na sítech, aspirátorech, či pneumatických odlučovačích, rotačních
třídičích nebo kombinovaných čističkách na základě stejných principů jako u obilovin.
Rozborem matoliny a separací jader se aktuálně zabýval např. Dědina (2010). Prováděl rozbor
matoliny na rovinných sítech. Využíval při něm sít s průměrem ok 2, 3,5 a 5 mm, ovšem pro
separaci používali již vysušené matoliny s obsahem vysušených vinných jader. Z výsledků
124
„Úroda 12/2012, vědecká příloha časopisu“
jejich měření shodně vyplývá, že byl největší podíl jader zachycen na sítech s průměrem ok
3,5 mm.
Otázkou separace vinných jader na laboratorních sítech zabýval také Trainor (2005).
Z výsledků jeho experimentálních měření vyplývá, že na sítech s průměrem ok 5 a 6 mm
dochází k hrubé separaci jader, kdy se odstraní převážná většina slupek, případných zbytků
dužniny a třapin. Největší podíl jader zůstává soustředěn na sítě s průměrem ok 3,5 mm.
Využití vinných jader pro výrobu olejů je závislé především na technologických možnostech
dodavatelů, zpracovatelů a na celkových objemech, které by bylo možno získat (Wiemer a
kol., 2005). Proto je nutno před dalšími úvahami o realizaci tyto otázky vyjasnit.
Ze statistických údajů je zřejmé, že v ČR se ročně ve velkých vinařských závodech
zpracovává cca 60 000 t vinných hroznů, což představuje 3 600 t nesušených jader tj. 2 400 t
suchých jader. Z tohoto množství se dá při optimální výtěžnosti získat 290 t surového oleje. I
když se zatím nepodařilo zjistit, jakou část dovozu může tato kapacita pokrýt, je zřejmé, že
výzkum jak separace jader, tak vlastního lisování, může přinést producentům vína další
činnost, která se vyplatí jak z ekonomického, tak i ekologického hlediska.
Závěr
Z výsledků vyplývají možnosti zaměření experimentů pro separaci v dalším období:
a)
hledat tvar a velikost otvorů síta pro maximální zvýšení podílu jader v propadu
b)
ověřit účinnost 2stupňové separace uplatněním 2 různých sít s cílem dosáhnout
maximální čistoty separace
c)
navrhnout a realizovat úpravu zařízení pro snížení otáček lopatkového hřídele
d)
hledat jiný způsob separace s vyšší účinností
Sledovaný způsob využití upraveného malého (středního) odstopkovače hroznů pro separaci
jader jednoduchou výměnou síta (nebo 2 sít) má význam pro možnost lokálního zpracování
matolin (získání jader) u malovinařů. Ti mohou v budoucnu vnímat možnost prodeje jader
jako prostředek zlepšení efektů při pěstování a zpracování hroznů.
Dedikace
Příspěvek vychází z řešení výzkumného projektu QI 111B107 „Výzkum získávání a využití
biologicky aktivních látek (BAL) ze semen vinných hroznů pro zlepšení metabolismu
hospodářských zvířat jako podklad pro návrh nejlepší dostupné techniky (BAT) ”.
Použitá literatura
Anastasiadi M., Pratsinis H., Kletsas D., Skaltsounis A-L., 2010: Bioactive non-coloured
polyphenols content of grapes, wines and vinification by-products: Evaluation of the
antioxiadant activities of their extracts. Food Research International, 43: 805–810
Arvanitoyannis, I.S., Ladas, D., Mavromatis, A., 2006: Potential uses and applications of
treated wine waste. a review. International Journal of Food Science and Technology 41,
475–487
Baydar N. G., Özkan G., Çetin E. S., 2007: Characterization of grape seed and pomace oil
extracts. Grasas y aceites, 58: 29–33
Boulton, R.B., Singleton, V.L., Bisson, L.F., Kunkee, R.E., 1999. Principles and Practices of
Winemaking. Kluwer Academic/Plenum Publishers, New York.
Dědina, M., 2010: Separace vinných jader v laboratorních podmínkách. Periodická zpráva.
Praha: VÚRV. 12 s.
Plíva P., Jelínek A., 1999: Vinný olej- žádaná surovina na trhu. Agromagazín, 3/1: 21–23
125
„Úroda 12/2012, vědecká příloha časopisu“
Rubio M., Álvarez-Orti M., Pardo J. E., 2009: A review on the utilization of grape seed oil as
an alternative to conventional edible vegetable oils. La rivista italiana delle sostanze
grasse, 84: 121–129
Russ, W., Meyer-Pittroff, R., 2004. Utilizing waste products from the food production and
processing industries. Critical Reviews in Food Science and Nutrition 44, 57–62
Schieber A., Stintzing F.C., Carle R., 2001: By-products of plant food processing as a source
of functional compounds- recent developments. Trends in food science and technology, 12:
401–415
Trainor, P., 2005: Study of Techniques in Separation of Grape Seed for Mass Production of
Cold Pressed Grape seed Oil. ISS Institute, Depart. of Education, Science and Training,
Australia, 25 p.
Wiemer et al., 2005: Small Scale Processing of Oilfruit and Oilseeds. Deutsche Gesellschaft
fur Technische Zusammenarbeit. pp. 1–92
Zemánek, P., 2001: Využití technických prostředků při kompostování zbytkové biomasy,
Habilitační práce, Zahradnická fakulta MZLU Brno, červen 2001, 231s.
Žufánek, J., 1998: Bilance zdrojů biologických odpadů ve vinohradnictví a ovocnictví.
Sborník z mezinárodní konference "Ekologické aspekty výzkumu, vývoje a provozu
zahradnické techniky", konané u příležitosti setkání kateder a ústavů VŠ a výzkumných
pracovišť v Lednici 23. a 24. 4. 1998, s. 203–208
Kontaktní adresa:
doc. Ing. Patrik Burg, Ph.D.,
Ústav zahradnické techniky, Zahradnická fakulta, Lednice
MENDELU v Brně, CZ
e-mail: [email protected]
126
„Úroda 12/2012, vědecká příloha časopisu“
PŘEDPOVĚĎ MIKROBIOLOGICKÉ KVALITY POTRAVIN POMOCÍ
MODELOVÁNÍ RŮSTU PATOGENŮ - LISTERIE
Prediction of microbiological quality of foods by mathematical modeling
of the pathogens grow – Listeria
Erban V., Eichlerová E., Landfeld A., Čírtková V., Houška M.
Výzkumný ústav potravinářský Praha, v. v. i.
Abstrakt
Cílem práce bylo vytvořit matematický předpovědní model růstu různých kmenů Listerií, za různých
podmínek prostředí ( teplota, vodní aktivita a pH)
Klíčová slova: matematický předpovědní model, Listeria, podmínky prostředí
Abstract
The goal of this study was formation of mathematical predictive model of growing various Listeria
under influence various surroundings as temperature, water activity and pH
Key words: mathematical predictive model, Listeria, conditions of surroundings
Úvod
Jako u všech mikroorganismů jsou podmínky růstu dány jednak zdrojem živin a jednak
fyzikálně chemickými podmínkami prostředí. Listerie svými fyziologickými
charakteristikami růstu, vysokou adaptabilitou na prostředí a specifickou patogenitou kmene
L.monocytogenes jsou významným rizikem pro zdravotní bezpečnost potravin.
Materiál a metody
Pro studium podmínek růstu Listerií je nutné porovnávat jejich růstové parametry za různých
podmínek prostředí. Tyto parametry jsou klíčovou odpovědí na nebezpečí růstu Listerií
v konkrétním výrobku za konkrétních provozních a skladovacích podmínek.
Vytváření modelů se skládá z následujících kroků:
1. Odhad rozsahu fyzikálních podmínek růstu (pH, Aw a teplota).
2.
Naměřit soubor růstových křivek (primární modely).
3. Ze souboru primárních modelů se vytváří sekundární modely, které charakterizují
fyziologické vlastnosti mikroorganismu (lag fáze, rychlost růstu, maximální nárůst a další
fyziologické charakteristiky)
4.
Vytvoření vlastního matematického modelu (terciárního modelu)
5. Na základě tohoto modelu jednak hodnotit adaptační schopnosti modelového organismu
a vytipovat kritické oblasti, ve kterých je nutné hodnotit získané izoláty tak, aby bylo možné
zjistit, zda různé izoláty mají i různé fyziologické charakteristiky a tím i různou míru
nebezpečí pro výrobek ve kterém se vyskytují.
Na základě výchozích úvah byly měřeny růstové křivky v mediu tryptose phosphate broth
TPB (Oxoid). Při přípravě medií bylo vycházeno z dvojnásobné koncentrace surovin, které
byly upravovány na vhodnou hodnotu aktivity vody Aw pomocí přídavku solí. Konečná Aw
127
„Úroda 12/2012, vědecká příloha časopisu“
byla kontrolována měřením. Poté byla media rozdělena na alikvotní objemy upravené pomocí
HCl a NaOH na požadované pH. Hotová media byla sterilována 15min při 121°C. Médium
bylo rozplněno do mikro destiček po 0,2ml, inokulováno 1% různých kmenů Listeria.
Inkubace probíhala v Bioscreenu za nepravidelného třepání při širokopásmové vlnové délce,
odečty optické denzity OD probíhaly jednou za hodinu.
Výsledky a diskuze
Primární modely (obr. 1) jsou souhrnem růstových křivek mikroorganismu při různých
fyzikálních podmínkách prostředí.
Obr. 1: Ukázka primárního modelu
Obr. 2: Ukázka sekundárního modelu pro
teplotu 30°C
minGT
43:12:00
38:24:00
33:36:00
28:48:00
24:00:00
19:12:00
14:24:00
9:36:00
4:48:00
0:00:00
0,800
OD wideband
0,700
0,600
0,500
0,400
0,300
19
22
1-8
16
1-7,5
13
1-7
10
1-6,5
7
1-6
7
0,500-0,600
0,400-0,500
0,300-0,400
Time (hours)
0,200-0,300
0,100-0,200
Aw
0,000-0,100
4
1-5,5
0,600-0,700
1
1-5
1-4,5
Experiment name
6
25
0,000
0,700-0,800
0,94
0,96
0,98
1
5
28
31
34
0,100
37
8
0,200
pH
GT[hod]
Recalculated OD values
G. curves L.i.; Aw=0,998;30°C
38:24:00-43:12:00
33:36:00-38:24:00
28:48:00-33:36:00
24:00:00-28:48:00
19:12:00-24:00:00
14:24:00-19:12:00
9:36:00-14:24:00
4:48:00-9:36:00
0:00:00-4:48:00
Sample short name
Na základě těchto primárních modelů je možné vytvořit sekundární modely (Obr.2), které
vyjadřují fyziologické charakteristiky MO (lag fáze, rychlost růstu, maximální nárůst a další
fyziologické charakteristiky). I tyto modely však vyjadřují danou charakteristiku pouze pro
jednu teplotu.
Matematické modely
Vzhledem ke značnému množství dat a obtížné orientaci v přehledových grafech s malou
přesností odečtu byl po statistickém vyhodnocení vytvořen matematický model růstu pro
každý kmen Listerie.
Pro odhad růstu patogenů slouží počítačové terciární modely předpovědní mikrobiologie
(PM). Jejich podstatou je matematický popis růstu počtu mikrobů v potravinách za
specifických podmínek prostředí, které zahrnuje vnitřní faktory (pH, aw) a vnější, faktory,
(teplota, inhibiční látky). K inhibici růstu patogenů dochází i při kombinaci těchto faktorů, z
nichž žádný sám o sobě nemá dostatečnou úroveň samostatné inhibice. Matematické modely
nejlépe zajišťují dosažení realistické předpovědi růstu mikroorganismu při různé kombinaci
těchto faktorů.
Byl vytvořen Excelový soubor, ve kterém se zadá teplota, Aw, pH, čas pro který má být
spočtena OD, a výchozí OD. Model nabízí hodnotu OD k zadanému času, dobu lag fáze, čas,
kdy je růst kultury nejrychlejší, dobu zdvojení OD kultury a maximální nárůst OD až pro 6
křivek zároveň.
Pro modely byl použit Gompertzův růstový model s parametry A, B, C a M, (Tabulka 1)
Gompertzův růstový model
log(OD) = A + C.exp(-exp (-B.(t-M)))
Z těchto parametrů matematického modelu je možné spočítat parametry růstových křivek
A
parametr
Gompertzova
modelu - inoculum
log (OD)
pomocí
následujících
vztahů:Trvání
fáze lagu (TFL) = M - [ 1/B]. Exponenciální
růstová
B
parametr
Gompertzova
modelu –čas
růstová
rychlost 10 (2) e/BC) (McMeekin log
(OD)/t
rychlost
(ERR)=BC/e.
Generační
(GT)=Log
T.A.
a spol. 1993)
C
(OD)
parametr
Gompertzova
modelu
(ODVBA
Z důvodu
velkého
počtu dat
bylo– maximální
využito přírůstek
makro ve
nelineární
regrese
max-Odo )pro výpočetlog
v rámci
Excelu.Gompertzova
Byly tak určovány
Gompertzova
M parametr
modelu – časparametry
maximální růstové
rychlosti modelu B, C at M pro každou
128
„Úroda 12/2012, vědecká příloha časopisu“
růstovou křivku (viz označení). Parametry B, C, M pak byly korelovány k teplotě, aktivitě
vody a pH Vztahy byly použity při tvorbě matematického modelu růstu Listeria
monocytogenes a Listeria innocua.
Získané parametry B, C a M (Parametr A byl zvolen -1 pro všechny růstové křivky) byly
použité pro výpočet zjednodušených kvadratických modelů v transformaci přirozených
logaritmů pro Gompertzovy parametry B, M a C použité pro předpověď TFL, ERR a GT, tak
jak jsou ovlivněny teplotou, pH a Aw pro každý kmen rostoucí v BHI.
Tabulka 1: Tabulka ovládání předpovědního růstového modelu
Růstový model L. monocytogenes 2219:
Přepočítej tabulku
(platnost modelu: aw = < 0,92 - 0,98 >, pH = < 4,5 - 6,5 >, t = < 5 - 37 °C >)
teplota (°C)
25
25
25
25
25
aw (-)
0,92
0,92
0,92
0,92
0,92
pH (-)
6,5
6
5,5
5
4,5
čas (hodiny) výchozí OD OD (v čase)
48
0,1
0,50
48
0,1
0,58
48
0,1
0,50
48
0,1
0,33
48
0,1
0,16
lagfáze (hodiny) čas do GT (hodiny)
32,17
35,67
29,37
32,58
26,44
29,76
23,29
27,18
19,20
24,83
Vytvoř
ytvoř graf
GT (hodiny)
3,97
3,41
3,87
6,19
22,02
ODmax
0,53
0,59
0,50
0,33
0,16
Získané modely byly použity pro porovnání růstu jednotlivých kmenů L. mon. a L. inn. Byla
zvolena kritická hodnosta růstu při Aw = 0,92, při různých pH a teplotě 25°C. Pro každý
kmen byly vygenerovány růstové křivky při zvolených parametrech a ty byly následně
porovnávány (Graf č. 1, 2, 4, 5, 6, 7 a 8). Inokula byla použita se stejnou historií
Graf č. 1: Růstové křivky L.
monocytogenes 2219 při 25°C,
Aw = 0,92, a pH = 4,5-6,5
Graf č. 2 Růstové křivky L.
monocytogenes 2182 při 25°C,
Aw = 0,92, a pH = 4,5-6,5
Graf č. 4: Modelové růstové
křivky L. monocytogenes 2002
při 25°C, Aw = 0,92, a pH = 4,56,5
Graf č. 5: Modelové růstové
křivky L. monocytogenes 1225
při 25°C, Aw = 0,92, a pH = 4,56,5
Graf č. 7: Modelové růstové křivky L. innocua
4030 při 25°C, Aw = 0,92, a pH = 4,5-6,5
129
Graf č. 3: Modelové růstové
křivky L. monocytogenes 2023
při 25°C, Aw = 0,92, a pH = 4,56,5
Graf č. 6: Modelové růstové
křivky L. innocua 4549 při 25°C,
Aw = 0,92, a pH = 4,5-6,5
„Úroda 12/2012, vědecká příloha časopisu“
Z porovnání maximálních hodnot D pro jednotlivé kmeny vyplývá, že kromě kmene L. mon.
1225 a L. inn. 4030 dosahují všechny kmeny maximálního nárůstu při hodnotě pH 6. To
naznačuje, že pro nárůst listerií je tato hodnota optimální. Z porovnání je zřejmé, že různé
kmeny L. mon. se chovají odlišně, mají různou TFL, ERR i max. OD. Podobně se chovají i
testované kmeny L. inn. To znamená, že nelze vybrat typový kmen ani zvolit průměrnou
směsnou kulturu pro testování podmínek růstu v konkrétním případě technologického
procesu. Testované kmeny listerií je možné rozdělit do dvou hlavních podskupin podle TFL;
kmeny s krátkou dobou TFL do 5-ti hodin (Graf č. 2, Graf č. 4, Graf č. 5 a Graf č. 8) a do
skupiny s dlouhou dobou TFL mezi 20 a 30 hodinami (Graf č. 1, Graf č. 6 a Graf č. 7). Je
zajímavé, že kmeny L.mon s krátkou dobou TFL citlivěji reagují růstovou rychlostí na
snižování pH. Kdežto kmeny s dlouhým TFL mají ERR mnohem vyrovnanější a odpovídají
maximální ERR listerií ze skupiny s krátkým TFL. To je ve shodě s představou, že čím delší
TFL tím lepší adaptace na prostředí tím a tím rychlejší růst.
Závěr
Pro kvalifikovaný odhad předpovědi růstu listerií v konkrétních podmínkách je nutno vždy
volit konkrétní model pro daný kmen listerií nebo alespoň z odpovídající skupiny podle TFL.
Tento fakt je také nutno zohlednit při testování růstu listerií na konkrétním potravinářském
produktu a modely využívat s velkou opatrností pouze mikrobiology jako podklad pro další
analýzy.
Z uvedených příkladů vyplývá význam a nutnost bližší identifikace kmenů a k nim vytvářet
prediktivní modely.
Dedikace
Práce byla podpořena grantovou agenturou MŠMT č. 2B08050
Použitá literatura
McMeekin T.A., Olley J.N., Ross T., Ratkowsky D.A., Predictive mikrobiology theory and
application, Reseach Studies Press LTD, 1993.
ANON1991: Recommendations by The National Advisory Committee on microbiological
criteria for foods: The pathogenesis and virulence of Listeria monocytogenes,
http://www.sciencedirect.com/science/article/B6T7K-476W8K4N7/2/efb5c39e5bc64991b40c25af075906b1
Aarnisalo,K., Vihavainen,E., Rantala,L., Maijala,R., Suihko,M. L., Hielm,S., Tuominen,P.,
Ranta,J., Raaska,L., Use of results of microbiological analyses for risk-based control of
Listeria monocytogenes in marinated broiler legs, International Journal of Food
Microbiology, 3, 275-284, 2008
Angelidis,A., Boutsiouki,P., Papageorgiou,D.,: Loss of viability of Listeria monocytogenes in
contaminated processed cheese during storage at 4, 12 and 22 –C. Food Microbiology, 27,
809 – 818, 2010
Augustin,J. Ch., Rosso,L., Carlier,V.: A model describing the effect of temperature history on
lag time for Listeria monocytogenes International Journal of Food Microbiology 57, 169181, 2000,
Kontaktní adresa:
RNDr. Vladimír Erban, CSc.
Výzkumný ústav potravinářský Praha
Radiová 7 103 21 Praha 10
[email protected]
130
„Úroda 12/2012, vědecká příloha časopisu“
VLIV SKLADOVÁNÍ NA KVALITU BRAMBOR RŮZNÝCH
VARNÝCH TYPŮ
Effect of storage on quality of potatoes of different cooking types
Šottníková V., Kučerová J.
Mendelova univerzita v Brně
Abstrakt
Byl sledován vliv skladování na obsah redukujících cukrů, škrobu a vařivost různých varných typů
brambor. Senzoricky byla hodnocena konzistence, vlhkost, moučnatost a stabilita po uvaření. K
nejnižšímu poklesu obsahu škrobu došlo u odrůdy Ditta (varný typ AB) a nejnižšímu nárůstu obsahu
cukru u odrůdy Ditta (varný typ AB). Nejlépe senzoricky byla hodnocená odrůda Princess
(varný
typ A).
Klíčová slova: brambory, varný typ, kvalita
Abstract
The effect of storage on the content of reducing sugars, starch and cooking different cooking types of
potatoes. Sensory analysis was evaluated consistency, moisture, and stability of mealiness after
cooking. The lowest decrease in starch content was observed in a variety Ditta (cooking type AB), the
lowest increase in the variety of sugar Ditta (cooking type AB). Top sensory variety Princess was
assessed (cooking type A).
Key words: potatoes, cooking type, duality
Úvod
Celosvětově patří brambory mezi významné plodiny a to nejen z pohledu lidské výživy, ale
i krmivářství. Podle statistických údajů FAO je druh Solanum tuberosum, se svojí roční
úrodou kolem 320 milionů tun, na čtvrté příčce celosvětově významných plodin, hned za
pšenicí, rýží a kukuřicí. Tak jako zmírnily hladomory po svém příchodu do Evropy, mohly by
v současnosti sehrát podobnou roli i v rozvojových zemích. Částečně se to daří již dnes,
ačkoliv je spotřeba brambor v rozvojových zemích stále až čtyřikrát nižší než v rozvinutých
průmyslových zemích (PRUGAR, 2009).
O významu brambor svědčí i to, že před více než 40ti lety bylo v Peru nedaleko hlavního
města Limy založeno Mezinárodní bramborářské centrum CIP (Centro Internacional de la
Papa) (HEJNÝ, 1994). V genové bance CIP je přes 6 000 vyšlechtěných i planých odrůd
brambor, jejichž vzájemným křížením by se do budoucna měla vyšlechtit ideální odrůda
brambor jak po stránce pěstitelské, tak nutriční a kulinární (JŮN, 2007).
Materiál a metody
Vzorky brambor byly odebírány ve firmě SENECO, spol. s r.o. v hospodářském roce 2011.
Firma SENECO, spol. s r.o. má sídlo v Polné na Vysočině, v nadmořské výšce 490 m n.m.,
což je ryze bramborářská oblast. Brambory byly skladovány v bramborárně v ohradových
paletách o nosnosti cca 1000 kg. Klima v bramborárně je řízeno ručně, podle počasí, které je
venku, je tedy zcela odkázáno na pracovní sílu. Vzorky brambor byly odebírány
bezprostředně po sklizni, a pak každý následující měsíc až do vyskladnění celé bramborárny.
Pro hodnocení byly zařazeny odrůdy Princess (A), Ditta (AB), Dali (BA), Laura (B) a Agria
(BC), patřící každá do jednoho z varných typů. U daných odrůd ve sledovaném období bylo
stanoveno % škrobu polarimetricky, dle ČSN 56 0512-16. Procento redukujících cukrů bylo
stanoveno dle ČSN 560116-6. Stanovení konzistence, struktury, vlhkosti, moučnatosti a
stability odrůd bylo stanoveno dle ČSN 462211. Vzorky hlíz byly středně velké, nepoškozené,
131
„Úroda 12/2012, vědecká příloha časopisu“
bez vizuálních příznaků chorob, nedeformované. Hlízy byly skladovány při teplotě 6°C a
jeden den před zkouškou vyjmuty ze skladu a umístěny do pokojové teploty. Hodnocení
provádělo pět osob. Brambory byly vařeny ve slupce a v páře. Hodnotila se konzistence, která
vyjadřuje odolnost dužniny tlaku, spolu s moučnatostí určuje zařazení odrůdy do varného typ,
struktura vyjadřuje jemnost nebo hrubost dužniny. Vlhkost je znak, který souvisí s obsahem
sušiny. Škrob má souvislost jak s konzistencí, strukturou, tak i s moučnatostí a vlhkostí. Dle
těchto znaků lze hlízy zařadit do varného typu (DOMKÁŘOVÁ, 2009).
Naměřené výsledky byly zpracované pomocí „Analýzy hlavních komponent“, což je metoda
pro zachycení nejdůležitější informace ze získaných dat. Graf PCA, je výstupem z této
analýzy.
Výsledky a diskuse
Stanovením obsahu škrobu v hlízách brambor a následnými výpočty bylo zjištěno, že
u odrůdy Agria došlo k největšímu poklesu obsahu škrobu, a to o 15,72 %, což činí pokles
z 15,9 % obsahu škrobu na 13,4 % obsahu škrobu. U odrůdy Ditta byl nejnižší pokles obsahu
škrobu v průměru o 12,23 %, ve sledovaném období, což činí pokles škrobu v hlízách
bramboru z původních 13,9 % na konečných 12,2% (obr. 1). Stanovením obsahu redukujících
cukrů před a po inverzi a následnými výpočty bylo zjištěno, že u odrůdy Laura došlo
k největšímu nárůstu obsahu všech cukrů o 311%, z původních 0,26 % na 1,07 %. Nejnižšího
nárůstu obsahu cukru bylo zaznamenáno u odrůdy Ditta o 112%, kdy počáteční stav všech
cukrů byl 0,55 % a konečný obsah cukrů 1,17 % (obr.2).
Obsah škrobu se symetricky snižoval, a naopak se obsah cukrů v hlízách brambor zvyšoval.
S výjimkou měsíce února, kdy bylo extrémně mrazivé počasí a teplota v bramborárně klesla
k 0°C (venkovní teplota vzduchu klesla na mínus 22°C obr. 6), hodnota sledovaných
parametrů, a to především obsahu cukrů se výrazně zvýšila, což je patrné z obr. 2. K tomuto
jevu dochází vždy, když klesne skladovací teplota pod 2°C (WANG et. al 2005).
Obr. 1: Obsah škrobu za sledované období
Agrie
Dali
Ditta
Laura
Princess
škrobnatost v %
15,5
14,5
13,5
12,5
11,5
9
10
11
12
1
2
3
Stanovení množství cukrů
v bramborách za
rok 2011 - 2012 (měsíce 9-3)
% skutečného obsahu cukrů
Stanovení škrobnatosti brambor
za rok 2011 - 2012 (měsíce 9-3)
Obr. 2: Skutečný obsah cukrů za sledované
období
Agria
Dali
Ditta
Laura
Princess
1,6
1,4
1,2
1
0,8
0,6
0,4
0,2
0
9
10
11
12
1
2
3
Po venkovním oteplení, stoupla i teplota skladování, a tím se obsah cukru v hlízách všech
odrůd vrátil k hodnotám, které byly před mrazem. Skladování brambor při nízké teplotě (pod
2°C) má nevýhodu, která spočívá v redukci cukrů a následném sládnutí hlíz. Proto je nutné
konzumní brambory skladovat při vyšší teplotě. U běžných odrůd dochází
k rovnováze mezi redukcí cukrů a jejich prodýcháváním nad 7 °C. To je důležité hlavně
u odrůd brambor určených na výrobu smažených výrobků. U nich totiž dochází při vysokých
teplotách během smažení k reakci mezi aminokyselinami a redukovanými cukry, vlivem této
reakce dochází k hořknutí a hnědnutí produktů. Proto se bramborám skladovaným pro tyto
účely zachovává skladovací teplota mezi 7–10 °C (hranolky 7–9 °C, chipsy 8–10 °C) a
132
„Úroda 12/2012, vědecká příloha časopisu“
případné klíčení se omezuje chemicky (MARANGONI, et al., 1997, HAJIREZAEI et al.
2003). Skladování brambor ovlivňuje především teplota v průběhu skladovacího období a
opatření umožňující výměnu vzduchu v „mezihlízovém prostoru“, odvod oxidu uhličitého a
vody vzniklé dýcháním hlíz (ČEPL, 2009). Při prodýchávání brambor ve skladu, vznikají
rozkladem škrobu redukující cukry. Nízká teplota ( 4-6°C) při skladování tento fyziologický
proces brzdí (ŠTEFÁNEK, 1999).
Na obr. 3 je znázorněno snížení senzorické kvality u odrůdy Agrie (modře vybarvená plocha),
když teplota ve skladu klesla na z 6°C na 0°C, a to o celé 2 body v hodnocení stability a ke
snížení moučnatosti a vlhkosti o 1,4 bodu. Na obr. 4 je reakce odrůdy Princess na změnu
teploty při skladování. Nejvíce se zhoršila struktura a vlhkost o 1,6 bodu, stabilita odrůdy se
snížila o 1,4 bodu, konzistence o 1 bod a moučnatost se nezměnila. Bylo zjištěno, že
z hodnocených odrůd je tato odrůda nejlépe přizpůsobivá změnám teploty při skladování.
Obr. 3: Senzorické hodnocení odrůdy Agrie
Obr. 5:Projekce proměnných
do faktorové roviny
Obr. 4: Senzorické hodnocení odrůdy
Princess
Obr. 6 Teploty vzduchu ve sledovaném
skladovacím období
Pomoci metody „Analýzy hlavních komponent“ byl zjištěn vztah mezi sledovanými
parametry. Komponenty, které jsou ve stejném směru se chovají podobně (například cukr
a čas mají stejný směr, což značí, že když roste čas roste i koncentrace cukru), pokud směřuji
na opačnou stranu, mají opačný vliv (teplota směřuje na jednu stranu a cukr na opačnou, tedy
jeden přispívá k vysvětleni hlavní informace v datech záporně a druhý kladně, podobně je to
se škroby (škroby mají záporný vliv, cukr kladný „jdou proti sobě“) což je vidět z obr. 5.
Závěr
Nejlépe přizpůsobivá, co se týče sledovaných parametrů, konzistence, struktury, moučnatosti,
vlhkosti a stability odrůdy byla odrůda Princess, která ani v podmínkách, kdy teplota
133
„Úroda 12/2012, vědecká příloha časopisu“
v bramborárně klesla k 0°C výrazně nezměnila senzoricky sledované hodnoty. Nejhůře se
s výkyvem teploty vyrovnala odrůda Agria.
Analýzou hlavních komponent bylo zjištěno, že koncentrace zvyšujícího se množství cukru je
ovlivněna časem i teplotou a současně čas má také vliv na snižující se množství škrobu.
Zároveň bylo zjištěno, že vlhkost, moučnatost, konzistence, struktura ani stabilita odrůdy
neovlivňuje obsah cukru. Vlhkost, moučnatost, konzistence, struktura jsou závislé na
množství škrobu a teplotě při skladování.
Použitá literatura
Čepl, J., Brambory – zdravá potravina, (2005). Bramborářství, 13 (6): 20-21.
Domkářová, J., Horáčková, V., Habětínek, J., (2003). Úroveň a vývojové trendy stolní
hodnoty odrůd Solanum tuberosum L. v genofondu bramboru, Výzkumný ústav
bramborářský Havlíčkův Brod, Vědecké práce 14: 31-45.
Hajirezaei Mr, Börnke F, Peisker M, Takahata Y, Lerchl J, Kirakosyan A, Sonnewald U.,
(2003). Decreased sucrose content triggers starch breakdown and respiration in stored
potato tubers (Solanum tuberosum). J Exp Bot., Jan, 54 (382): 447-88.
Hejný, S., (1994). Co všechno víme a nevíme o bramboru, Živa, 42 (3): 104-106.
Jun, J., (2007). Peru nebo Chile? Co k původu a historii brambor říká odborná literatura slovy
prof. Ing. Josefa Pulkrábka, CSc., ČZU Praha, Bramborářství, , 15 ( 2): 16-20.
Leeman, M., Östman, E., Björck, I., (2008). Glycaemic and satiating properties of potato
products. European Journal of Clinical Nutrition, 62 (1): 87-95.
Marangoni, A.G. , Duplessis, P.M.,Yada, R.Y., (1997). Sugars in crop plants, Kinetic model
for carbon partitioning in Solanum tuberosum tubers stored at 2°C and the mechanism for
low temperature stress-induced accumulation of reducing sugars, Biophys Chem. Apr 22;
65 (2-3): 211-20.
Prugar, J., (2009). Ohlédnutí za „bramborovým“ rokem 2008. Výživa a potraviny, 64 (1):
21-22.
Štefánek, F., (1999) . Pěstování brambor, Sativa Keřkov a.s., Humpolec.
Wang, Q.,Huang, H.Y.,Zhang, J.W.,Li, X.C., (2005). Effects of antisense acid invertase gene
on reducing sugar and starch contents of potato (Solanum tuberosum L.) tuber stored at
low temperature, Zhi Wu Sheng Li Yu Fen Zi Sheng Wu Xue Xue Bao. 31(5):533-8.
Kontaktní adresa:
Ing. Viera Šottníková, Ph.D.
Mendelova univerzita v Brně
Zemědělská 1, 613 00 Brno
e-mail: [email protected]
134
„Úroda 12/2012, vědecká příloha časopisu“
VYBRANÉ ZNAKY SEMEN ŘEPKY OZIMÉ OVLIVŇUJÍCÍ RŮST,
VÝVOJ A VÝNOS V PODMÍNKÁCH SUCHA
Selected seed traits of winter rape affecting growth, development and seed
yield under drought conditions
Bláha L. 1, Vyvadilová M. 1, Urban M. O. 2
1
2
Výzkumný ústav rostlinné výroby, Praha 6-Ruzyně
Přírodovědecká fakulta Univerzity Karlovy v Praze
Abstrakt
Geografický původ odrůdy, provenience osiva a odolnost semen vůči stresu vysoké teploty při klíčení
ovlivňují nejen procesy klíčení, ale predikují i následný růst a vývoj, zejména v podmínkách sucha.
Osivo použité k testování odolnosti k suchu musí však být z lokality vhodné pro produkci semen.
Rozdíl v obsahu osmoticky aktivních látek v listech rostlin pěstovaných za sucha a standardních
podmínek v nádobových pokusech významně koreluje s testovanými vlastnostmi semen a potvrzuje i
shodu v pořadí odolnosti odrůd v laboratorních a nádobových pokusech.
Klíčová slova: řepka ozimá, vlastnosti semen, sucho, osmotický potenciál, predikce odolnosti
Abstract
Geographic origin of cultivar, seed provenance and resistance to high temperature stress during
germination processes affect not only germination, but also could predict the subsequent growth and
development, especially in drought conditions. Seeds for drought resistence tests must originate from
the locality suitable for seed production. The difference in the content of osmotically active substances
from leaves of plants grown under drought and standard conditions in pot experiments correlates
significantly with the seed traits and also confirms the compliance in the varieties hierarchy from the
laboratory and pot experiments.
Key words: winter oilseed rape, seed traits, drought, osmotic potential, resistance prediction
Úvod
Z našich předchozích prací a z literatury je známo, že vitální osivo dobré provenience
zaručuje nejen lepší vzcházivost, růst a vývoj kořenové soustavy, ale má v konečném
důsledku významný vliv i na výnos. Výkonnější genotypy mají efektivnější úroveň
metabolismu po celou vegetaci. Provenience často ovlivňuje fyziologické vlastnosti semen
více, než jejich hmotnost a klíčivost. Zjistili jsme, že původ semen, výběr odrůdy a také
změny teplot, které se vyskytují na povrchu půdy po vysetí, mohou do značné míry ovlivnit
klíčivost řepky v daných podmínkách. Byl též prokázán vliv hmotnosti kořenového systému
na suchovzdornost a výši výnosu semene. Pro výnos je významný rychlý nástup růstu
kořenového systému po ukončení zimního období.
Odhaduje se, že abiotické stresory snižují celosvětově výnosový potenciál až o 70%. Podle
analýzy posledních 60ti let, provedené vědeckým týmem z Goddarova střediska vesmírných
letů NASA, jsou změny klimatu a zvyšující se variabilita průběhu počasí větší, než se
předpokládalo. Jejich vliv na produkci rostlin bude značný (Morison et al. 2006, Viner et al.
2006). Cílem práce bylo prověřit, zda na základě fyziologických vlastností osiva,
ovlivňujících následný růst a vývoj rostlin, lze předpovědět nejen výnos, jak tomu bylo
v předchozích pracích, ale i reakci na stres sucha.
Materiál a metody
V tabulce 1 je uveden přehled původu čtyř modelových odrůd použitých v této práci.
135
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 1: Použité rostlinné materiály a jejich původ
Odrůda/ materiál
Země původu
Firma
Californium
Viking
Navajo
Cadeli
Francie
Německo
Velká Británie
Francie
Monsanto SAS
NPZ (Norddeutsche Pflanzenzucht)
CPB Twyford Ltd
Monsanto SAS
Pro skleníkové nádobové pokusy, laboratorní testy odolnosti semen vůči teplotnímu stresu při
klíčení a u standardní semenářské analýzy byly použity již dříve publikované postupy (např.
Bláha 2009, Bláha et al. 2011). Hladiny kompatibilních solutů jsou většinou analyzovány z
extraktu pletiva nebo buněk bez přihlédnutí k jejich kompartmentaci (Hare et al. 1998).
Hodnocení osmotického potenciálu rostlin stresovaných suchem v nádobových pokusech bylo
v této práci provedeno na druhém plně vyvinutém listu ve třech opakováních. Listy byly
odstřiženy, vloženy do injekční stříkačky, uzavřeny a okamžitě zmraženy v tekutém dusíku.
Před hodnocením byly vzorky rozmraženy a vylisovány. Buněčná šťáva byla přenesena na
celulozní terčík, který byl vložen do komůrky osmometru (Wescor 5500, Wescor Inc., Utah,
USA). Hodnota osmolality (mmol/kg) byla převedena na MPa pomocí van´t Hoffovy rovnice.
Výsledky a diskuse
Jak vyplývá z našich dosavadních výsledků (Bláha et al. 2011), semena odrůd sklizená
z lokality Slapy u Tábora jsou v průměru horší ve všech sledovaných parametrech než
z lokality Chlumec nad Cidlinou a predikce dalšího vývoje a růstu jednotlivých odrůd je méně
přesná. Z těchto důvodů je pozornost soustředěna převážně na výsledky z Chlumce nad
Cidlinou, tedy lokality produkující kvalitnější osivo.
Testování klíčivosti semen při vysokých teplotách, které se vyskytují na povrchu půdy po
vysetí (den 42 ºC a noc 20 ºC) ukázalo rozdíly v odolnosti jednotlivých odrůd. Odrůdy
Californium a Cadeli původem z Francie, tedy ze sušší a teplejší oblasti, jsou odolnější
k vysokým teplotám (Graf 1).
Jak dokumentuje tabulka 2, kde je uveden procentuální podíl vzešlých semen, stejné výsledky
byly zjištěny také při hodnocení vzcházivosti semen v kontejnerech ve skleníkovém pokusu.
Hodnota korelačního koeficientu vzcházivosti s klíčivostí je průkazná (r=0,93*). Případný
rozdíl mezi vzcházivostí a klíčivostí vypovídá o odolnosti vůči biotickým a abiotickým
půdním stresorům. Průkazné jsou obecně i další korelace vzcházivosti se všemi zde
uvedenými údaji. Odrůdy, které lépe odolávají stresu vyšší teplotou při klíčení, lépe vzcházejí
i ve standardních podmínkách (možný vliv větší aktivity enzymů).
Klíčivost testovaná standardní metodou ISTA ve standardních podmínkách nemá takovéto
predikční vlastnosti na rozdíl od klíčivosti ve stresu. Ale vitalita hodnocená jako klíčivost za
24 a 48 hod. naznačuje výsledky, které ukazují, že Californium a Cadeli jsou lepší než Navajo
a Viking. Klíčení semen v chladném prostředí (den 20ºC a noc 0ºC), které se v půdě může
vyskytnout po vysetí, nemá žádný vztah k uvedeným znakům, přestože existují odrůdové
rozdíly.
Tab. 2:Vzcházivost semen v půdě ve skleníkovém prostředí (%)
Viking
Navajo
79,34
85,00
Cadeli
Californium
88,68
88,66
136
„Úroda 12/2012, vědecká příloha časopisu“
Graf 1: Klíčivost v podmínkách vysoké teploty přes den a v noci (počet vyklíčených
semen z 50)
Klíčivost testovaných odrůd
v podmínkách vysoké teploty
60
50
40
30
20
10
0
Navajo
Viking
Cadeli
Californium
Snižování osmotického potenciálu (Ψπ) v buněčné šťávě je obecně spojováno se zvýšením
tolerance k nedostatku vody v rostlině. Graf 2 dokumentuje, že byly zjištěny rozdíly mezi
osmotickými potenciály u druhých zcela vyvinutých listů rostlin pěstovaných za
celovegetačního sucha a ve standardních podmínkách, které jsou v korelaci s řadou dalších
měřených parametrů - s rychlostí klíčení (r=0,91*), se vzcházivostí (r=0,89*), odolností vůči
vysoké teplotě při klíčení (r=0,97**) a se suchovzdorností hodnocenou podle změny poměru
sušin kořenů a nadzemní části (r=0,95**). Odrůdy z Francie, s nižším úbytkem nadzemní a
podzemní hmoty rostlin v podmínkách sucha, měly i menší rozdíly mezi osmotickými
potenciály listů rostlin pěstovaných v kontrastních podmínkách. Poměr sušin kořenů a
nadzemní části byl zpracován pro sucho a standard. Suchovzdornější genotypy mají
v podmínkách sucha menší redukci kořenů (Graf 3).
Graf 2: Rozdíly mezi osmotickými potenciály u druhých zcela vyvinutých listů rostlin ze
standardních
podmínek
a
celovegetačního
sucha
Diference složky osmotického potenciálu p r o v e n ie n ce
C h lu m
e c n / C
(k o n t r o la -st r e s)
Rozdíl mezi kontrolou a stresovanou
rostlinou (MPa)
Viking
Chlumec
0,70
0,60
Navajo
Chlumec
0,50
0,40
Cadeli
Chlumec
0,30
0,20
0,10
Californium
Chlumec
0,00
Graf 3: Procentuální poměr kořenů a nadzemní části rostlin za standardních podmínek
a sucha
Porovnání poměru sušin kořenů a nadz emní části
0,9
0,8
0,7
0,6
0,5
Standard
0,4
Sucho
0,3
0,2
0,1
0
Californium
Cadeli
Navajo
137
Viking
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 3: Porovnání délky a objemu kořenů ze standardních podmínek a celovegetačního
sucha (standard 100%)
Odrůda
Viking
Délka
13,53
objem
28,72
průměr
21,13
Californium
Cadeli
60,60
78,60
34,18
24,71
47,39
51,66
Navajo
60,91
31,50
46,21
Vlastní parametry kořenů a nadzemní části mají jinou hierarchii absolutních hodnot, ale
procento změny parametrů kořenů za sucha proti standardním podmínkám (100%) odpovídá
zjištěné hierarchii odrůd u předchozích testů.Odrůdy Viking a Navajo mají za sucha větší
procento poklesu sušiny než Californium a Cadeli (Tab.3).
Závěr
Odrůda a její geografický původ, provenience semen, odolnost semen vůči stresu a zejména
vůči vysoké teplotě mohou značně ovlivnit nejen procesy klíčení, ale i následný růst a vývoj.
Odolnost semen vůči stresu může tedy být dobrým markérem pro další vybrané vlastnosti.
Osivo pro predikce odolnosti k suchu musí být z pěstitelsky vhodné lokality. Výkonnější
odrůdy jsou nejvitálnější již v juvenilní fázi růstu. Množství osmoticky aktivních látek
významně koreluje s velkou řadou námi naměřených parametrů. Výsledky potvrdily shodu v
hierarchii odrůd z nádobových pokusů a laboratorních testů.
Dedikace
Práce vznikla za podpory projektů MZe ČR QH82285 a 0002700604.
Použitá literatura
Bláha L.,Vyvadilová M., Klíma.M. (2011): Vliv genotypových rozdílů v parametrech
kořenového systému na suchovzdornost a výnos řepky ozimé. In:Aktuální poznatky v
pěstování, šlechtění, ochraně rostlin a zpracování produktů, konference, Brno. VÚPP
Troubsko, Vědecká příloha časopisu Úroda, Brno listopad 2011, s.137-144.
Bláha L.,Vyvadilová M., Klíma M. (2011): Vliv vlastností semen na výnos vybraných
genotypů řepky ozimé. Nové poznatky z genetiky a šlachtenia polnohospodárskych rastlín.
Zborník z 18. vedeckej konferencie, Piešťany: VÚRV, 2011: 69-71.
Bláha L. (2009): Význam vlastností semen trav pro hodnocení suchovzdornosti. Úroda 10, s.
49-51.
Hare P.D., Cress W.A., Van Staden J. (1998): Dissectingthe roles of osmolyte accumulation
during stress. Plant Cell and Environment, 21, s. 535–553.
Morison I.L, Morecroft M.E. (2006). Plant Growth and climate change, Blackwell publishing
Ltd.
Viner D, Jamesi L,Walalce M.,Walalce C. (2006): Recent and future climate change and thein
implications for plant growth.In.: Plant Growth and climate change, Blackwell publishing
Ltd, s. 1-17.
Kontaktní adresa:
Ing. Ladislav Bláha CSc,Výzkumný ústav rostlinné výroby v.v.i.
161 06 Praha 6, Ruzyně, Drnovská 507
e-mail: [email protected]
138
„Úroda 12/2012, vědecká příloha časopisu“
GENOTYPOVÁ VARIABILITA LIPIDACYLHYDROLASOVÉ
AKTIVITY U PATATINOVÝCH BÍLKOVIN PURIFIKOVANÝCH
Z HLÍZ VYBRANÝCH DRUHŮ BRAMBOR
Genetic variability of the lipid acyl hydrolase activity of patatin proteins
purified from tubers of potato species
Brabcová A. 1, Bárta J.1, Bártová V.1, Horáčková V.2
1
Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta
2
Výzkumný ústav bramborářský Havlíčkův Brod, s.r.o.
Abstrakt
V příspěvku byla hodnocena aktivita lipidacylhydrolasy (LAH) u patatinových bílkovin
purifikovaných z hlíz vybraných genotypů kulturních a planých druhů brambor – diploidní S.
bulbocastanum, S. chacoense, S. leptophyes, S. phureja, S. stenotomum; tetraploidní S. andigenum, S.
goniocalyx, S. sucrense, S. tuberosum (cv. Desireé a cv. Kuras) a hexaploidní S. demissum. LAH byla
stanovena kvalitativně (na gelu po provedené PAGE) i kvantitativně (spektrofotometricky). Detekcí
LAH na gelu byly u jednotlivých druhů nalezeny 1 (S. bulbocastanum, S. chacoense) až 3 (S. phureja,
S. stenotomum) bílkovinné pruhy s relativní elektroforetickou mobilitou 0,77 - 0,89. Kvantifikace
specifické aktivity LAH se pohybovala v intervalu od 3,46 (S. phureja) – 13,80 (S. sucrense)
μmol/[min mg].
Klíčová slova: brambory, plané a kulturní druhy, patatin, lipidacylhydrolasová aktivita
Abstract
The presented contribution is focused on lipid acyl hydrolase activities (LAH) of the major potato
tuber protein patatin of selected cultivated and wild potato species - diploid S. bulbocastanum, S.
chacoense, S. leptophyes, S. phureja, S. stenotomum; tetraploid S. andigenum, S. goniocalyx, S.
sucrense, S. tuberosum (cv. Desireé a cv. Kuras) a hexaploid S. demissum. LAH was determined
qualitatively (on the gel) and quantitatively (by spectrophotometry). Detection of LAH on the
polyacrylamide gel showed from 1 (S. bulbocastanum, S.chacoense) to 3 (S. phureja, S. stenotomum)
protein bands with the relative mobility 0.77-0.89. Quantification of LAH specific activitiy resulted in
the interval from 3.46 (S. phureja) – 13.80 (S. sucrense) μmol/[min mg].
Key words: potatoes, wild and cultivated species, patatin, lipid acyl hydrolase activity
Úvod
Bílkoviny patatinového komplexu jsou glykoproteiny s molekulovou hmotností 40 - 43 kDa.
V hlízách kulturního druhu brambor představují 30 - 40 % z celkových bílkovin a jejich
funkce je především zásobní. U těchto bílkovin bylo také potvrzeno, že vykazují několik
enzymových aktivit, z nichž nejvýznamnější je aktivita lipidacylhydrolasy (LAH) (Shewry
2003). Obecně jsou patatiny jako LAH aktivní s fosfolipidy, monoacylglyceroly a pnitrofenylovými estery karboxylových kyselin, středně aktivní s galaktolipidy, ale zřejmě
neaktivní s di- a tri- acylglyceroly (Jiménez-Atiénzar et al. 2003). Ačkoli přesná fyziologická
funkce patatinu není známa, díky svým enzymovým aktivitám může hrát roli v obranných
mechanismech bramborové rostliny (Jiménez et al. 2001, Sakaki et al. 2007). Jak ve své práci
naznačují Pots et al. (1999), intenzita (nízká/vysoká) LAH aktivity patatinu v hlízách může
souviset s odolností odrůdy (genotypu) vůči biotickým a abiotickým činitelům. Pokud by se
potvrdila hypotéza, naznačující, že vyšší LAH aktivitu vykazují genotypy s vyšší odolností
vůči původcům chorob hlíz, tak by tato enzymová aktivita patatinů mohla sloužit jako
biochemický marker pro šlechtění rostlin. Další význam LAH aktivity patatinu spočívá v tom,
že purifikovaný patatin z hlíz resp. patatin připravený pomocí expresních systémů je schopný
139
„Úroda 12/2012, vědecká příloha časopisu“
syntetizovat estery monokarboxylových kyselin, jenž mohou být využívány pro další
průmyslové výroby a samotný patatin je také schopný vytvářet hodnotné potravinářské pěny
(Pots et al. 1999, Davis and Macrae 2001). Z tohoto pohledu je vysoké zastoupení
patatinových bílkovin v hlízách velice zajímavé, protože při zpracování brambor na škrob
přechází do hlízové vody, ze které může být v nativní podobě (mj. se zachovanou aktivitou
LAH) izolován a následně používán pro výše uvedené syntetické účely. Plané a netradiční
kulturní druhy jsou obecně zdrojem genetické variability a mohly by tak poskytnout
patatinové bílkoviny s vyšší aktivitou LAH. Cílem příspěvku bylo hodnotit úroveň LAH
aktivity u patatinových proteinů purifikovaných z hlíz vybraných druhů brambor.
Materiál a metody
Rostlinný materiál byl získán z Genové banky bramboru udržované ve Výzkumném ústavu
bramborářském Havlíčkův Brod s.r.o. Vstupním materiálem pro analýzu byla lyofilizovaná
sušina hlíz vybraných druhů brambor Solanum stenotomum (EVIGEZ 07S0300001), Solanum
phureja (EVIGEZ 07S0300136), Solanum goniocalyx (EVIGEZ 07S0300109), Solanum
andigenum (EVIGEZ 07S0300235), Solanum tuberosum odrůdy Desireé (EVIGEZ
07S0100243) a Kuras (EVIGEZ 07S0101763), Solanum bulbocastanum (EVIGEZ
07S0300263), Solanum chacoense (EVIGEZ 07S0300037), Solanum demissum (EVIGEZ
07S0300301), Solanum sucrense (EVIGEZ 07S0300062). Extrakce bílkovin byla provedena
pomocí 25 mM pufru Tris-HCl pH 7,4, kdy poměr sušina:pufr byl 1:10. Purifikace bílkovin
patatinového komplexu byla provedena dvoustupňově pomocí iontovýměnné (DEAE-52
Cellulose Servacel; SERVA, Německo) a afinitní chromatografie (Concanavalin A Sepharose
4B; GE Healthcare, USA). Purifikované bílkoviny patatinového komplexu byly dále odsoleny
a zakoncentrovány pomocí centrifugačních filtrů s MWCO 3 kDa (Millipore, USA). U
purifikovaných patatinů byla stanovena koncentrace pomocí bicinchoninové kyseliny (BCA
Protein Assay Kit; Pierce, USA) a k analýzám byly použity roztoky patatinů o koncentraci
100 µg/ml. LAH aktivita patatinu byla stanovena jak na gelu tak spektrofotometricky. Při
detekci LAH aktivity na gelu byla nejprve provedena PAGE s diskontinuálním uspořádáním
matrice (7,5% separační a 3,75% zaostřovací gel) v prostření Na-borátového pufru (pH 7,2).
Poté byla LAH vyzualizována inkubací gelu (tma, 37°C) se substrátem α-naphthyl butyrate
(Sigma-Aldrich, USA) (modifikováno dle práce Bárta et al. 2003). U tohoto typu stanovení
byla určena relativní elektroforetická mobilita (Rm) patatinů a počet detekovaných pruhů na
gelu představující isoformy patatinů. Kvantifikace LAH byla stanovena na základě měření na
spektrofotometru (BioMate 5, ThermoElectron, UK) při λ= 410 nm dle Pots (1999)
s použitým substrátem p-nitrophenyl butyrate (Sigma-Aldrich, USA). Podle sestrojené
kalibrační řady pomocí p-nitrophenolu jako standardu (Fluka, Švýcarsko) byl proveden
přepočet a stanovena specifická aktivita patatinů. Statistické vyhodnocení bylo provedeno
v programu STATISTICA 10 (StatSoft, USA).
Výsledky a diskuze
LAH aktivita byla na gelu detekována u všech vybraných druhů (resp. genotypů) brambor v
podobě 1 – 3 pruhů, což potvrzuje existenci nábojových isoforem bílkovin patatinového
komplexu (viz tab. 1). Relativní mobilita těchto pruhů (0,77 - 0,89) byla stejná s majoritními
proteinovými pruhy v celkovém bílkovinném spektru hlíz bramboru (data neukázána).
Intenzita LAH aktivity na gelu se u jednotlivých druhů liší, jak je patrné na obr. 1, což
potvrzuje komplikovanost genetického založení patatinů při rozdílné úrovni ploidity.
Specifická aktivita patatinů, která byla kvantifikována spektrofotometricky, se mezi
studovanými druhy lišila poměrně výrazně a pohybovala se v intervalu od 2,68 (S. tuberosum
cv. Kuras) do 13,80 (S. sucrense) μmol/[min mg]. Výsledky ukazují, že netradiční kulturní a
plané (resp. primitivní) druhy mohou být zdrojem vyšším LAH aktivity. Kromě patatinu
140
„Úroda 12/2012, vědecká příloha časopisu“
izolovaného z hlíz S. sucrence byla zjištěna vyšší aktivita LAH i u dalších druhů – S.
stenotomum, S. chacoense, S. leptohyes. Na druhé straně z pohledu druhu S. tuberosum byly
hodnoceny jen dvě odrůdy, takže se skutečný potenciál toho druhu nemohl dostatečně
projevit. LAH aktivita patatinu, ale i jiné enzymové aktivity, byly v minulosti studovány
hlavně u odrůd kulturního druhu Solanum tuberosum (Racusen 1986, Pots et al. 1999,
Jiménez et al. 2001). Např. z nedávných výsledků získaných na našem pracovišti (Bárta et al.
2012), kdy bylo hodnoceno 20 odrůd bramboru (S. tuberosum) určených pro konzumní a
zpracovatelské účely, bylo nalezeno rozpětí LAH aktivity patatinu v rozpětí 0,92 – 5,46
μmol/[min mg]. Tento výsledek je v souladu s představou, že plané či netradiční kulturní
druhy by mohly být genovým zdrojem patatinu s vyšší aktivitou LAH pro šlechtění nových
odrůd brambor. U netradičních kulturních druhů a druhů planých či primitivních jsou literární
informace o bílkovinách hlíz nedostatečné či neúplné a navíc staršího data (Racusen 1987,
Racusen 1992). Z nedávno publikovaných výsledků (Dobson et al. 2010) metabolomických
studií hlíz genotypů ze skupin Andigena, Phureja, Stenotomum a Tuberosum ve Skotsku
Tab. 1: Souhrnné výsledky LAH aktivity purifikovaných patatinových bílkovinu
vybraných genotypů brambor
Druh
Kulturní
S. tuberosum, odrůda Desireé
S. tuberosum, odrůda Kuras
Netradiční kulturní
S. andigenum
S. goniocalyx
S. phureja
S. stenotomum
Ploidita (EBN)*
(2x=24)
Počet pruhů/
Relativní mobilita
Specifická aktivita
(μmol/[min mg])
4x (4 EBN)
4x (4 EBN)
2 (0,80; 0,83)
3 (0,85; 0,86; 0,88)
8,60 cd
2,68 e
4x (4 EBN)
2 (0,83; 0,85)
2 (0,84; 0,86)
3 (0,77; 0,78; 0,84)
3 (0,84; 0,85; 0,87)
7,67 d
9,58 c
3,46 e
13,07 a
2x (2 EBN)
2x (2 EBN)
Plané (primitivní)
2x (1 EBN)
S. bulbocastanum
1 (0,86)
9,52 c
6x (4 EBN)
S. demissum
2 (0,85; 0,87)
6,87 d
2x (2 EBN)
S. chacoense
1 (0,86)
11,20 b
2x (2 EBN)
S. leptophyes
2 (0,85; 0,87)
10,73 bc
S. sucrense
4x (4 EBN)
2 (0,86; 0,89)
13,80 a
Neshodná písmena indikují průkazný rozdíl na hladině významnosti P < 0,05 (Tukey HSD)
*převzato a upraveno dle práce Hawkes (1990)
Obr. 1: Detekce LAH aktivity purifikovaných patatinových bílkovin na gelu po
předchozí nativní PAGE (trojice vzorků jednotlivých genotypů)
Rm
0,7
0,8
0,9
zřetelně vyplývá význam těchto druhů pro zlepšování nutriční hodnoty a organoleptických
vlastností komerčně využívaných genotypů bramboru (S. tuberosum) prostřednictvím
moderního šlechtění bramboru.
141
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
V rámci souboru 10 druhů brambor (Solanum spp.) byla potvrzena výrazná variabilita LAH
aktivity patatinových bílkovin jak na kvalitativní úrovni (v rámci hodnoceného souboru druhů
byly pomocí PAGE detekovány 1 – 3 pruhy), tak i na úrovni kvantitativní (specifická aktivita
LAH byla v intervalu 2,68 – 13,80 μmol/[min mg]). Výsledky ukázaly, že v rámci
praktického využití LAH aktivity patatinu mohou být plané a netradiční kulturní druhy
brambor zdrojem těchto bílkovin s vyšší úrovní aktivity. Ve studiu rozsahu LAH aktivity
hlízových patatinů je třeba i nadále pokračovat a soubor studovaných genotypů u jednotlivých
druhů více rozšířit.
Dedikace
Výsledky byly získány v rámci řešení projektů NAZV QI91A069, GAJU 029/2012/Z, GAJU
064/2010/Z.
Použitá literatura
Bárta, J., Čurn, V., Diviš, J. (2003): Study of biochemical variability of potato cultivars by soluble
proteins, isoesterase, and isoperoxidase electrophoretic patterns. Plant Soil and Environment 49:
230-236.
Bárta J., Bártová V., Zdráhal Z., Šedo O. (2012): Cultivar variability of patatin biochemical
characteristics: table versus processing potatoes (Solanum tuberosum L.). Journal of Agricultural
and Food Chemistry 60: 4369-4378.
Davis C., Macrae A.R. (2001): Způsob výroby esterů alifatických monokarboxylových kyselin.
Patentový spis. Úřad průmyslového vlastnictví, CZ 289151 B6 (uděleno dne 18. 09. 2001), 10 p.
Dobson, G., Shepherd, T., Verrall, S. R., Griffiths, W. D., Ramsay, G., McNicol, J. W., Davies, H. V.,
Stewart, D. (2010): A metabolomics study of cultivated potato (Solanum tuberosum) groups
Andigena, Phureja, Stenotomum, and Tuberosum using gass-chromatography – mass spectrometry.
Journal of Agricultural and Food Chemistry 58: 1214-1223.
Jiménez-Atiénzar, M., Cabanes, J., Gandía-Herrero, F., Escribano, J., García-Carmona, F., PérezGilabert, M. (2003): Determination of the phospholipase activity of patatin by a continuous
spectrophotometric assay. Journal of Lipid 38(6): 677-82.
Jiménez, M., Escribano, J., Pérez-Gilabert, M., Chazarra, S., Cabanes, J., García-Carmona, F. (2001):
An octaethylene glycol monododecyl ether-based mixed micellar assay for determining the lipid
acyl hydrolase activity of patatin. Lipids 36: 1169-1173.
Pots, A. M., Gruppen, H., Diepenbeek, Van R., Lee, Van Der J. J., Boekel, Van M.A.J.S., Wijngaards,
G., Voragen, A.G.J. (1999): The effect of storage of whole protein of three cultivars on the patatin
and protease inhibitor content, a study using capillary electrophoresis and MALDI-TOF mass
spectrometry. Journal of the Science of Food Agriculture 79: 1557-1564.
Racusen D. (1987): Patatin in wild species of Solanum. Canadian Journal of Botany 66: 727-729.
Racusen D. (1986): Esterase specifity of patatin from two potato cultivars. Canadian Journal of Botany
64: 2104 – 2106.
Racusen D. (1992): Esterase activity and structural heterogeneity from a wild potato species. Canadian
Journal of Botany 70: 597-600.
Sakaki, T., Kato, T., Saji, H. (2007): Lipid acyl-hydrolase in leaves of different kidney bean
(Phaseolus vulgaris L.) cultivars: Purification and characterization of a kidney bean lipid acylhydrolase, and foliar lipid changes in the cultivars with ozone exposure. Plant Science 172: 462472.
Shewry, P. R. (2003): Tuber Storage Proteins. Annals of Botany 91: 755-769.
Kontaktní adresa:
Ing. Adéla Brabcová
Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta
Studentská 13, 370 05 České Budějovice, e-mail: [email protected]
142
„Úroda 12/2012, vědecká příloha časopisu“
VZTAH MEZI PODJEDNOTKAMI GLUTENINŮ A REOLOGICKOU
KVALITOU GENETICKÝCH ZDROJŮ PŠENICE
Relationships between glutenin subunits and rheological quality of wheat
genetic resources
Bradová J.1, Papoušková L.1, Faměra O.2, Dvořáček V.1, Dotlačil L.1
1
Výzkumný ústav rostlinné výroby,v.v.i.,, Praha - Ruzyně
2
Česká zemědělská univerzita Praha
Abstrakt
U souboru 28 genotypů ozimé pšenice se známým složením gluteninových podjednotek byly
stanoveny reologické parametry pomocí farinografu, Mixolabu a Solvent Retention Capacity testu.
Bylo provedeno pokusné pečení. Statistickou analýzou hlavních komponent byl prokázán pozitivní
vztah HMW-GS alel Glu-A1b, Glu-B3i a Glu-D3d k parametru stability těsta měřeném na Mixolabu i
farinografu. Pozitivní korelaci s objemem pečiva vykazovaly ve větší míře alely nízkomolekulárních
gluteninů oproti alelám vysokomolekulárních gluteninů.
Klíčová slova: genetické zdroje pšenice, reologická kvalita, podjednotky gluteninů
Abstract
Rheological parameters were determined by farinograph, Mixolab and Solvent Retention Capacity
Test in a set of 28 winter wheat genotypes with known glutenin subunits composition. Baking test was
performed as well. Subsequent statistical analysis of the main components showed a positive
relationship of HMW-GS alleles Glu-A1b, Glu-B3i and Glu-D3d for stability dough parameter
measured by Mixolab and farinograph. Positive correlation with bread volume was found mainly for
low molecular weight glutenin alleles compared to high molecular glutenin alleles.
Key words: wheat genetic resources, rheological quality, glutenin subunits
Úvod
V současné době dochází k rozšiřování sbírek genetických zdrojů, které je zaměřeno na
shromáždění a záchranu genetických zdrojů domácího původu, na rozšíření kolekcí o novou
genetickou diversitu a na získání donorů hospodářsky a biologicky cenných znaků (Dotlačil et
al., 2010). Jako velmi cenné se jeví zejména krajové odrůdy, které si zachovaly lepší hodnoty
některých znaků, které v důsledku selekce jen zřídka nalézáme u moderních odrůd,
např.vysoký obsah proteinů, odolnost proti stresům, ranost (Kato & Yokoyama, 1992).
Kvalita a využitelnost pšenice závisí na složení jednotlivých proteinů, které je podmíněné
specifickými bílkovinnými geny (Shewry, 2001) a je charakteristické pro každou odrůdu
(Bushuk, 1998). Jako nejvýznamnější markery pro hodnocení pekařské jakosti pšenice se
uvádí vysoko- (HMW-GS) i nízko- (LMW-GS) molekulární podjednotky gluteninů
(Gianibelli et al., 2002).
Cílem práce bylo vyhodnotit vliv jednotlivých gluteninových podjednotek na vybrané
reologické parametry pomocí relativně nových metod (Mixolab, SRC test), u kterých nejsou
zatím z dostupných zdrojů k dispozici žádné informace o působení jednotlivých
gluteninových alel na parametry těchto testů.
Materiál a metody
Soubor 28 genotypů ozimé pšenice zahrnující perspektivní krajové a moderní registrované
odrůdy se známým složením gluteninových podjednotek (Tab.1) byl v roce 2009 pěstován v
opakovaných pokusech na lokalitě v Praze-Ruzyni a v roce 2010 na 3 lokalitách PrahaRuzyně, Kroměříž a Humpolec. Vedení a hodnocení pokusů probíhalo dle standardních
pokusnických zásad a interních postupů vedení genetických zdrojů oddělení Genové banky. K
identifikaci LMW-, HMW- GS byla použita metoda SDS-PAGE (Bradová et al., 2011).
143
„Úroda 12/2012, vědecká příloha časopisu“
Reologické hodnocení bylo provedeno pomocí: i) Mixolabu fy Chopin, Tripette et Renaud
(Mixolab application handbook, 2008); ii) Solvent Retention Capacity testu (AACC 56-11);
iii) farinografu (ČSN ISO 5530-1); iiii) pokusného pečení (dle protokolu Výzkumného ústavu
mlýnsko-pekárenského průmyslu).
Tab.1 Seznam hodnocených genotypů a složení jejich gluteninových podjednotek
HMW-GS
LMW-GS
Genotyp/linie
1A
1B
1D
3A
3B
Bílá od Dukovan/5B
a (1)
c (7+9)
a (2+12) a
b
Viglašská červenoklasá/12B
a (1)
c (7+9)
a (2+12) a
b
Vouska z Třemošnice/13B
c (0)
c (7+9)
a (2+12) a
g°
Bergland/18B
c (0)
c (7+9)
a (2+12) f
d
Tschermak weisser Marchfelder/20B a (1)
c (7+9)
a (2+12) a
g°
Szekacz 19/37B
a (1)
c (7+9)
b (3+12) a
d
Mindeszentpusztai/44B
a (1)
c (7+9)
a (2+12) e/f
b
Szekacz 1242/47B
b (2*) c (7+9)
d (5+10) a
d
Szekacz 1242/47E
b (2*) c (7+9)
d (5+10) a
d
Hatvani 5612/48A
a (1)
c (7+9)
d (5+10) e/f
c
Ukrajinka/52A
a (1)
c (7+9)
d (5+10) a
b
Stepowa/53D
b (2*) c (7+9)
d (5+10) e/f
b
Slovenská 2/63A
c (0)
k (22)
a (2+12) a
c
Altsteirer linie a (Feldbach)/64C
c (0)
b (7+8)
a (2+12) a
i
Verrosaz 1229 BA/74C
a (1)
c (7+9)
a (2+12) a
c
Ostka Czerwona Lopusta/111B
c (0)
k (22)
a (2+12) a
b
Ostka Czerwona Lopusta/111C
c (0)
k (22)
a (2+12) a
c
Szekacz/116A
a (1)
c (7+9)
d (5+10) e/f
b
Eszterhazi Mindenes/117C
a (1)
b (7+8)
d (5+10) e/f
g
Fleischman 481/119A
b (2*) k (22)
a (2+12) d
b
Hassan-Orif
b (2*) c (7+9)
d (5+10) a
c
Bohemia
c (0)
i (17+18) d (5+10) a
g
Akteur
a (1)
c (7+9)
d (5+10) d
g
Biscay
c (0)
d (6+8)
a (2+12) e/f
g
Florett
b (2*) b (7+8)
d (5+10) a
g
RU 440-6
a (1)
e (20)
d (5+10) e/f
g
Šárka
c (0)
b (7+8)
d (5+10) d
g
Rheia
a (1)
d (6+8)
d (5+10) a
g
1D
a
a
b
c
b
c
d
b
a
b
a
b
b
b
c
a
a
a
a
a
c
c
c
c
c
c
c
c
Výsledky a diskuze
V uvedené práci vzhledem ke genetické heterogenitě sledovaných genotypů, velkému počtu
kombinací gluteninových alel i jejich nepravidelné distribuci v jednotlivých genotypech byla
použita analýza PCA pro vyhodnocení přímých vazeb jednotlivých HMW- a LMW-GS k
vybraným parametrům (Obr.1, 2).
Z grafu pro HMW-GS (Obr.1) je zřejmý výrazný pozitivní vztah alelických podjednotek Glu1Ab (2*), Glu-1Dd (5+10) i Glu-1Bi (17+18) k parametru stability těsta měřeném na
Mixolabu i farinografu, ke tvarové charakteristice pečiva (výška/šířka) i k parametru SRC
testu pro kyselinu mléčnou, který koreluje k Zelenyho sedimentaci (Dvořáček et al., 2012).
Oproti tomu alela Glu-1Da (2+12), pro kterou jsou udávány horší pekařské vlastnosti
(Radovanovič et al., 2002), silně pozitivně korelovala s poklesem konzistence těsta
stanoveným na farinografu i s odpovídajícím parametrem Mixolabu (C1-C2). Kombinace
144
„Úroda 12/2012, vědecká příloha časopisu“
gluteninových podjednotek Glu-1Aa (1) a Glu-1Bc (7+9) vykazovaly významný pozitivní vliv
na objem pečiva i na vaznost vody moukou stanovenou na Mixolabu.
Obr.1 PCA analýza pro HMW-GS a vybrané reologické parametry
PCA graf (p1 vs. p2)
1,2
1,0
0,8
0,6
1D {5+10}
1B {7+8}
0,4
p2 = 17 %
1B {17+18}
1B {20}
1B {22}
0,0
-0,2
1A {2*}
1B {6+8}
1A {0}
0,2
SRC kys.ml.
v-š stabilita těsta m.
stabilita těsta f.
pokles konzistence
C1-C2
1D {3+12}
1D {2+12}
-0,4
vývin těsta
C1
1A {1}
1B {7+9}
-0,6
objem pečiva
vaznost m.
vaznost f.
-0,8
-1,0
-1,2
-1,2
-1,0
-0,8
-0,6
-0,4
-0,2
0,0
0,2
0,4
0,6
0,8
1,0
1,2
p1 = 27 %
Nezanedbatelným faktorem na výslednou pekařskou kvalitu je i efekt nízkomolekulárních
gluteninů (Izadi-Darbandi, 2010). To bylo potvrzeno i v této práci, kdy LMW-GS se výrazně
podílely na variabilitě některých technologických i reologických parametrů. Z grafu pro
analýzu LMW-GS (Obr.2) je patrné, že pozitivní korelaci s objemem pečiva, který je
významným technologickým znakem, vykazovala řada alel (například Glu-3Da, Glu-3Bb).
Obr.2. PCA analýza pro LMW-GS a vybrané reologické parametry
PCA graf (p1 v s. p2)
1,0
m.
v aznostv faznost
.
0,8
objem pečiv a
0,6
0,4
3A {a}
3B {g°}
pokles konz.C1-C2
3D {a}
3B {b}
3B {d}
3D {d} 3D {b}
p2 = 18 %
0,2
v ýv inC1
těsta
3A {f }
3B {c}
0,0
3B {i}
3A {e/f }
v -šstabilita těsta f .
-0,2
stabilita těsta m.
-0,4
SRC ky s.ml.
3D {c}
3B {g}
-0,6
3A {d}
-0,8
-1,0
-1,0
-0,8
-0,6
-0,4
-0,2
0,0
0,2
0,4
0,6
0,8
1,0
p1 = 21 %
Z výsledků vyplynulo (Tab.1), že hodnocené genotypy, které vykázaly dobré pekařské
vlastnosti, obsahovaly gluteninové alely s pozitivním vlivem na tyto vlastnosti. Například pro
linie 47/B a 47/E odvozené z maďarské krajové odrůdy Szekacz 1242 byla charakteristická
skladba gluteninových alel Glu-1Ab (2*), Glu-1Bc (7+9) a Glu-1Dd (5+10). Naopak linie
145
„Úroda 12/2012, vědecká příloha časopisu“
Bergland 18/B s alelickou kombinací Glu-1Ac (0), Glu-1Bc (7+9) a Glu-1Da (2+12) patřila
při hodnocení technologických i reologických charakteristik spíše k průměrným materiálům.
Závěr
Nalezené výsledky potvrzují možnost využití LMW- a HMW- gluteninových alel jako
markerů pekařské kvality pro účely šlechtění moderních perspektivních odrůd pšenice.
Dedikace
Výsledky byly získány při řešení projektu MZe ČR č. QH 91184 a 0002700604.
Použitá literatura
AACC 56-11. (2000): Solvent Retention Capacity. 10th Edition Approved Methods of the
AACC, St.Paul, MN.
Bradová J., Dvořáček V., Štočková L. (2011): Využití gelové a čipové elektroforézy pro
identifikaci podjednotek gluteninů s vysokou a nízkou molekulovou hmotností u pšenice.
Praha, VÚRV,v.v.i.
Bushuk W. (1998): Wheat breeding for end-product use. Euphytica, 100, 137-145.
ČSN ISO 5530-1 (1995): Pšeničná mouka. Fyzikální charakteristiky těst. Část 1: Stanovení
vaznosti vody a reologických vlastností na farinografu. Český normalizační institut, Praha.
Dotlačil L., Hermuth J., Stehno Z., Dvořáček V., Bradová J., Leišová L. (2010): How can
wheat landraces contribute to present breeding? Czech J.Genet.Plant Breed., 46, 70-74.
Dvořáček V., Papoušková L., Hermuth J., Dotlačil L., Faměra O., Sedláček T., Hálová I.,
Riljáková B. (2012): Využití metody retenční kapacity mouky pro predikci technologické
kvality pšenice v České republice. Metodika pro praxi. Výzkumný ústav rostlinné výroby,
v.v.i., xPrint s.r.o.
Gianibelli M. C., Masci S., Larroque O. R., Lafiandra D., MacRitchie F. (2002): Biochemical
characterisation of a novel polymeric protein subunit from bread wheat. Journal of Cereal
Science, 35, 265-276.
Izadi-Darbandi A., Yazdi-Samadi B., Shanejat-Boushehri A.-A., Mohammadi M. (2010):
Allelic variations in Glu-1 and Glu-3 loci of historical and modern Iranian bread wheat
(Triticum aestivum L.) cultivars. Journal of Genetics, 89, 2, 193-199.
Kato K., Yokoyama H. (1992): Geographical variation in heading characters among wheat
landraces, Triticum aestivum L., and its implication for their adaptability. Theoretical and
Applied Genetics, 84, 3-4, 259-265.
Mixolab applications handbook (2008): Rheological and Enzymatic Analysis. Chopin
Applications Laboratory.
Radovanovic N., Cloutier S., Brown D., Humphreys D.G., Lukow O.M. (2002): Genetic
variance for gluten strength contributed by high molecular weight glutenin proteins. Cereal
Chemistry, 79(6), 843–849.
Kontaktní adresa:
Ing. Jana Bradová
Výzkumný ústav rostlinné výroby,v.v.i.
Drnovská 507, Praha 6 – Ruzyně
[email protected]
146
„Úroda 12/2012, vědecká příloha časopisu“
NETRADIČNÍ OBILNINY A MOŽNOSTI JEJICH VYUŽITÍ
Non-traditional cereals and possibilities for their use
Ehrenbergerová J.1, Jirsa O.2, Martinek P. 2, Balounová M. 2, Stehno Z.3,
Pluháčková H.1, Laknerová I.4, Macháň, P.1
1
Mendelova univerzita v Brně
Agrotest fyto, s.r.o., Kroměříž
3
Výzkumný ústav rostlinné výroby, v.v.i., Praha
4
Výzkumný ústav potravinářský Praha, v.v.i.
2
Abstrakt
Cílem práce bylo zjistit, zda se ve studovaném souboru cereálií vyskytnou genotypy s vyššími
hodnotami nutričně a zdravotně prospěšných látek, pro které by mohly být využity v pekárenských či
pečivárenských technologiích. Soubor tvořily netradiční odrůdy pšenice jarní a ozimé s odlišným
zbarvením zrna, pšenice dvouzrnky a genotypy ječmene jarního bezpluchého typu se světlým i černým
zrnem. Byly zjištěny mezidruhové i meziodrůdové rozdíly v obsahu dusíkatých látek, škrobu, betaglukanů, minerálních látek i objemové hmotnosti. Výsledky potvrdily možnost využití těchto
netradičních genotypů jako zdrojů pro nové receptury výroby cereálních výrobků, které svojí přidanou
hodnotou mohou obohatit současný sortiment.
Klíčová slova: odrůdy minoritních druhů pšenice, dvouzrnka, bezpluchý ječmen, nutriční látky
Abstract
The aim of this study was to determine whether the set of cereals under study contained genotypes
with higher values of nutritiously and for health beneficial substances for which they could be used in
bakery technologies. The set comprised non-traditional varieties of spring and winter wheat with
different grain color, emmer and spring barley genotypes of a hulless type with pale and dark grains.
Interspecies and intervarietal differences in the content of nitrogenous substances, starch, volume
weight, beta-glucans and mineral substances were determined. Results confirmed the possibility of
using these non-traditional genotypes as sources for new formulas of cereal products which with their
added value could enrich the current assortment. Some of the genotypes bring with their properties the
possibility for the use in production of so-called functional foodstuffs
Key words: minority wheat varieties, emmer, hulless barley, nutritional substances
Úvod
Současné obohacování cereálních výrobků látkami zdraví prospěšnými či jinými, je často
omezeno jejich nežádoucími technologickými účinky (Jirsa a Vaculová, 2011). Proto jsou
hledány možnosti obohacení základní výrobní suroviny přírodními látkami, či surovinami,
které dodají novou užitnou hodnotu (Laknerová et. al., 2011). Ta může spočívat ve změně
senzorických vlastností, např. barvě mouky, obohacení minerály, či v přínosnějším nutričním
složení. Také se může jednat o základní surovinu, která bude mít větší výtěžnost mouky, což
má i ekonomický dopad. Využití netradičních zdrojů cereálií ve výrobě výrobků z nich může
přispět pestřejší k nabídce spotřebitelům. Současně se takto využije nabídka široké diverzity
genetických zdrojů obilnin.
Materiál a metody
Pro studium byly vybrány následující odrůdy a linie:
Pšenice ozimá: RU 440-6 (pro modré zbarvení aleuronové vrstvy), Citrus a Bona Dea
(pro žluté zrno), Indigo (pro purpurové zbarvení perikarpu) a 48M (pro modré zbarvení
147
„Úroda 12/2012, vědecká příloha časopisu“
aleuronové vrstvy). Pšenice jarní: UC 66049 (pro modré zbarvení aleuronové vrstvy), ANK
28B, Abyssinskaja arrasajta a Konini (pro purpurové zbarvení perikarpu). Pšenice dvouzrnka:
Rudico (pro vyšší obsah polyfenolů a vit. skup. B), May Emmer (pro vyšší obsah kyseliny
ferulové), Weisser Sommer (pro vyšší obsah cukrů, kys. ferulové a vit. B1) a Tapioszele
(pro vyšší obsah vitamínu E a B). Ječmen jarní - bezpluché formy: AF Lucius (pro vyšší
obsah polyfenolických látek), KM 1057 (pro vyšší obsah tuku, aminokyselin, vitamínu E
a nízký obsah beta-glukanů), KM 2084 (pro vyšší obsah beta-glukanů), KM 2283 (pro vyšší
obsah beta-glukanů) a Nudimelanocrithon (pro černé zrno a vyšší obsah
anthokyanogenů).Vybrané genotypy byly pěstovány ve sklizňových letech 2010 a 2011
na lokalitách Kroměříž a Praha standardní pěstební technologií. Získané výsledky vyjádřené
v sušině zrna byly statisticky vyhodnoceny.
Metody:
Stanovení N-látek: metodou podle Dumase (ICC Standard No. 167), přístroj FP-528 (LECO)
ICC STANDARD No. 167. Stanovení sušiny - gravimetricky (sušením), ČSN EN ISO 712.
Minerální látky: Metodiky stanovení jsou součástí akreditovaných postupů (Jiří Zbíral a kol.,
2005). Obsah beta-glukanů enzymatickou kolorimetrickou metodou - kit Megazyme (návod
K-BGLU 04/06) (zapracováno v normách AACC 32-23, ICC 166, AOAC 995.16)
Objemová hmotnost u obilovin byla stanovena dle ČSN ISO 7971-2 (2003).
Výsledky a diskuse
Z grafů č. 1 až 3 je patrný významný vliv odrůd/linií i lokalit na výši a variabilitu hodnot
objemové hmotnosti a dusíkatých látek (NL). Obsah škrobu a beta glukanů (BG) byl
významně ovlivňován pouze genetickou složkou – odrůdami/liniemi.
V obsahu NL (graf č.1) se průměru za oba roky hodnoty NL pohybovaly od 10,78 % (odrůda
Indigo) do 16,79 % (odrůda Tapioszele) na lokalitě Kroměříž a od 12,57 % (odrůda Citrus) po
20,37 % (odrůda Tapioszele) na lokalitě Praha. Odrůda Tapioszele tedy dosahovala
nejvyšších hodnot na obou lokalitách. Spolu s odrůdami May Emmer (19,32 %), Rudico
(19,04 %) a Weisser Sommer (18,40 %) se na lokalitě Praha lišily svými nejvyššími obsahy
NL od ostatních v souboru, vyšších hodnot dosáhl také černý genotyp Nudimelanocrithon
(16,97 %) a UC 66049 (16,80 %). K odrůdám s nejnižšími hodnotami NL patřily: Citrus
(12,57 %), Bona Dea (12,80 %) a Indigo (12,86 %). Na kroměřížské lokalitě byly nejvyšší
hodnoty (avšak nižší než v Praze) rovněž zjištěny u odrůdy Tapioszele a Weisser Sommer
(16,03 %) a odrůdy May Emmer (15,34 %), další nejvyšší hodnota patřila černému genotypu
Nudimelanocrithon (14,96 %). Vyšší obsah NL měly v obou lokalitách pšenice dvouzrnky (až
statisticky významně vyšší v Praze), z ozimých genotypů pšenice pak UC 66049
a z bezpluchých genotypů ječmene genotyp Nudimelanocrithon. Odrůdy ozimé pšenice byly
tedy většinou překonány pšenicí dvouzrnkou. O odrůdách Rudico a Tapioszele uvádí
Lachman et al. (2012), že se rovněž vyznačují vysokým obsahem celkových polyfenolů
a vitamínu E.
Avšak genotypy s nejvyššími hodnotami NL právě na lokalitě v Praze poskytly z této lokality
nejnižší objemovou hmotnost (graf č.2). Je možné hovořit o záporném vztahu zmiňovaných
dvou znaků, neboť bezpluchá linie jarního ječmene KM 2283 s nejnižším průměrným
obsahem NL (12,21 %) dosáhla nejvyšší objemové hmotnosti (OH) v souboru (79,90 kg.hl-1),
patrnější byl negativní vztah na lokalitě Praha zejména u genotypů Tapioszele
a Nudimelanocrithon. Odrůdy Tapioszele a May Emmer s vysokými obsahy NL poskytly
i poměrně vysoké hodnoty OH.
Záporný vztah mezi obsahem NL a škrobu uvádí např. Hřivna et. al. (2009), neboť mezi
těmito látkami stanovili středně silný záporný korelační koeficient. (r = -0,56*). V naší práci
potvrdil tento záporný vztah zejména jarní ječmen Nudimelanocrithon (průměrný obsah
škrobu 54,30 %), odrůdy pšenice dvouzrnky Tapioszele, May Emmer, Weisser Sommer a
148
„Úroda 12/2012, vědecká příloha časopisu“
ozimá pšenice UC 66049, neboť na rozdíl od vysokých hodnot NL (graf č. 1) měly nejnižší
obsah škrobu (od 59,74 % do 61,63 % - graf č. 2). Naopak nejvyšší (v mnoha srovnáních
statisticky významně vyšší) průměrný obsah škrobu jsme zaznamenali u ozimých odrůd
Citrus a Bona Dea (67,94 a 67,54 %), které v obsahu NL patřily k nehorším. Nejvyšší obsah
škrobu u o odrůdy Citrus uvádí také Jirsa a Vaculová (2011).
Pokud se podíváme na graf č.3, je z něj patrný velmi malý počet statisticky významných
rozdílů v obsahu BG mezi studovanými genotypy. Zejména se to týká ozimých odrůd pšenice
i pšenic dvouzrnek. Od těchto se z obou stanovišť liší zjištěné hodnoty u bezpluchých
genotypů ječmene včetně černě zbarveného zrna u genotypu Nudimelanocrithon. Ten spolu
s liniemi se žlutým zrnem KM 2284, KM 2283, KM 1057 a bezpluchou odrůdou AF Lucius
měly statisticky významně vyšší množství BG od 2,55 % (KM 1057) do 5,53 % (KM 2084)
než ostatními genotypy.
Z minerálních látek byl zaznamenán vyšší obsah K (více jak 0,4 %) a P (více jak 0,5 %)
oproti ostatním genotypům, dále u všech odrůd pšenice dvouzrnky, linie KM 2283 a jarního
ječmene Nudimelanocrithon.
Graf č.1 Průměrný obsah NL (%) za roky 2010 a 2011
24
22
20
NL
18
16
14
12
10
Tapioszele
May-Emmer
Rudico
Nudimelano.
KM 2283
KM 2084
AF Lucius
Weiss. Somm.
Lokalita Kroměříž
Loklaita Praha
KM 1057
Konini
Abyss. arr.
ANK-28B
UC 66049
48M
Bona Dea
Citrus
RU 440-6
6
Indigo
8
Odrůda
Graf č.2 Průměrné hodnoty objemové hmotnosti (kg/hl) a škrobu (%) za roky 2010 a 2011
90
85
80
75
70
65
60
55
50
OH
Škrob
Lokalita: Kroměříž
RU 440-6
Citrus
Bona Dea
Indigo
48M
UC 66049
ANK-28B
Abyssi. arr.
Konini
KM 1057
AF Lucius
KM 2084
KM 2283
Nudimelano.
Rudico
May-Emmer
Weiss. Somm.
Tapioszele
RU 440-6
Citrus
Bona Dea
Indigo
48M
UC 66049
ANK-28B
Abyssi. arr.
Konini
KM 1057
AF Lucius
KM 2084
KM 2283
Nudimelano.
Rudico
May-Emmer
Weiss. Somm.
Tapioszele
45
Lokalita: Praha
149
„Úroda 12/2012, vědecká příloha časopisu“
Graf č.3 Průměrný obsah Beta-glukanů (%) za roky 2010 a 2011
7
6
Beta-glukany
5
4
3
2
1
Tapioszele
May-Emmer
Rudico
Nudimelano.
KM 2283
KM 2084
AF Lucius
KM 1057
Konini
Abyss. arr.
ANK-28B
UC 66049
48M
Indigo
Weiss. Somm.
Lokalita Kroměříž
Lokalita Praha
Bona Dea
Citrus
-1
RU 440-6
0
Odrůda
Vysv.: intervaly spolehlivosti jsou konstruovány při P=0,05
Závěr
Výsledky studia potvrdily, že genotypy bezpluchého ječmene mohou být využity pro přípravu
potravin s přidanou hodnotou, tzv. funkčních potravin, zejména pro vysoký obsah betaglukanů ale i dalších nutričně důležitých látek. Odrůdy ozimé a jarní pšenice s netradičním
zbarvením zrna skýtají možnost aplikace v pekárenských technologiích, v přípravě výrobků
barevně pestřejších. Studované pšenice dvouzrnky i černě zbarveného genotypu jarního
ječmene by mohly být použity jako komponenty v nových recepturách cereálních výrobků
jako donory vyššího obsahu dusíkatých a minerálních látek.
Dedikace: Tento projekt byl podporován projektem NAZV MZe č. QI91B095 a QI111B044.
Použitá literatura
Hřivna L., Vavroušová P., Somerlíková K.: Hodnocení vztahů mezi vybranými
technologickými parametry zrna ječmene a sladu. [CD-ROM]. In Jakost a efektivnost
produkce regionálních a malých pivovarů, 2009:1-6. ISBN 978-80-7375-268-2.
Jirsa, O., Vaculová K.: Možnosti potravinářského využití netradičních genotypů pšenice a
ječmene. Úroda 12, 2011, vědecká příloha , s. 491-494. ISSN 0139-6013.
Lachman J., Orsák M., Pivec V., Jírů K.: Antioxidant activity of grain of einkorn (Triticum
mono-coccum L.), emmer (Triticum dicoccum Schuebl [Schrank]) and spring wheat
(Triticum aestivum L.) varieties. Plant Soil Environ., 58, 2012 (1): 15–21. ISSN 12141178.
Laknerová, I., Mašková E., Ouhrabková J., Erban V., Balounová, M.: Vliv složení suroviny
na senzorickou a nutriční jakost chleba. Úroda 12, 2011, vědecká příloha , s. 491-494.
ISSN0139-6013.
Kontaktní adresa:
Prof. Ing. Jaroslava Ehrenbergerová, CSc.
Mendelova univerzita v Brně, Zemědělská 1, 613 00 Brno
[email protected]
150
„Úroda 12/2012, vědecká příloha časopisu“
VYUŽITÍ MOLEKULARNÍCH MARKERŮ VE ŠLECHTENÍ F1
HYBRIDNÍCH ODRŮD ŘEPKY (B. NAPUS L.)
The utilization of molecular markers in breeding of F1 hybrid oil seed rape
Havlíčková L., Jozová, E., Hejna O., Čurn V.
Biotechnologické centrum, ZF JU v Českých Budějovicích
Abstrakt
Molekulární markery jsou moderní a progresivní technologií využívanou při šlechtění nových odrůd.
Pro účely genotypizace existuje poměrně velké množství různých molekulárních přístupů a technik,
které mají ve srovnání s dosud používanými morfologickými přístupy mnoho výhod. V porovnání k
ostatním plodinám jsou programy zaměřené na šlechtění hybridních odrůd řepky olejky velmi úspěšné
zejména proto, že využívají efektivních a ekonomicky výhodných systémů zabraňujících samosprášení
při produkci F1 hybridního osiva. V současné době je snahou českých šlechtitelů využít stabilní AI
dihaploidní (DH) linie s unikátními recesivními S alelami v hybridním šlechtění. Na základě analýzy
genu S lokusu SLG třídy I, byl v této studii vyvinut selektivní marker vhodný pro časnou detekci
AI/AK rostlin. Molekulární markery tak mohou být použity k marker asistované selekci požadovaných
rostlin v hybridním šlechtění řepky olejky.
Klíčová slova: autoinkompatibilita (AI), Brassica napus, PCR, S lokus, MAS
Abstract
Molecular markers in general can be used as modern and progressive tool in breeding of new varieties.
In comparison with morphological characteristics/traits, molecular markers have many advantages and
relatively high number of different molecular techniques and approaches are available for plant
genotyping purposes. Rapeseed hybrid breeding programmes are more successful in comparison with
other plants, because of utilization of effective and economic pollination control system for the
production of F1 hybrid seeds. Czech breeders currently utilize SI doublehaploid lines with stable
recessive S alleles in programmes of oil seed rape hybrid breeding. We developed molecular selectable
marker based on analysis of S-locus class I SLG gene for early detection of SI/SC plants. Molecular
markers thus should be used for marker-assisted selection in hybrid oilseed rape breeding.
Key words: self-incompatibility (SI), Brassica napus, PCR, S locus, MAS
Úvod
V hybridních šlechtitelských programech je nezbytné zajistit efektivní systém kontroly při
opylování, který zabrání samosprášení v rámci jedné rostliny, nebo na úrovni mateřské
rodičovské linie. Při použití samosprašných rostlin v hybridním šlechtění jsou využívány
různé přístupy a systémy zabraňující samosprášení na úrovni mateřských rostlin.
Autoinkompatibilita (AI) je u řepky olejky úspěšně využívána k produkci F1 hybridů. Princip
AI je založen na odmítnutí pylového zrna pocházejícího z rostliny se stejným genotypem. U
řepky je specificita interakce mezi pylem a bliznou kontrolována na sporofytické úrovni a to
působením (minimálně) dvou genů a jejich alelických forem (S haplotypů) přítomných v
jednom Mendelistickém lokusu, nazývaném též S lokus [1], [2]. Studium genů S lokusu vedlo
k identifikaci samčího a samičího determinantu, kteří se podílejí na AI reakci; konkrétně jde o
peptidový ligand (S locus protein 11;SP11, nebo také S locus cistein-rich protein; SCR) [3],
[4] a odpovídající receptor (S-locus receptor kinase; SRK) [5]. Specificita rozpoznávací reakce
je zajištěna vzájemnou interakcí mezi samčím determinantem SRK a jeho ligandem; samičím
determinantem SP11. Interakce mezi SP11 a SRK spouští signalizační kaskádu s ohledem na
přítomné S haplotypy, která plyne v odmítnutí vlastního pylu. Přesná signalizační dráha
včetně přítomnosti její regulace je stále nejasná [6]. S haplotypy jsou členěny do dvou tříd:
třída I je obecně dominantní nad třídou II v pylu a kodominantní v blizně a způsobuje silný AI
151
„Úroda 12/2012, vědecká příloha časopisu“
fenotyp [7]. Řepka (Brassica napus; 2n = 38, AACC) je autokompatibilní tetraploid, vzniklý
spontánní mezidruhovou hybridizací dvou autoinkompatibilních druhů; B. rapa (2n = 20, AA)
a B. oleracea (2n = 18, CC). Teoreticky jsou linie řepky olejky považovány za homozygotní v
obou S lokusech; jeden S haplotyp tak pochází z B. rapa a druhý z B. oleracea. Vzhledem
k inkompatibilitě vyskytující se u obou předků (B. rapa a B. oleracea) by bylo reálné
předpokládat, že i potomek (B. napus) bude mít AI projev ve svém fenotypu, jak je tomu
například u resyntetizovaných linií. Většina kultivovaných odrůd je však autokompatibilních
[6] a vlastní ve svém A genomu S haplotyp třídy I (podobný haplotypu S47 z B. rapa) a ve
svém C genomu S haplotyp třídy II (podobný haplotypu S15 z B. oleracea) [8], [9]. AK je u
řepky olejky způsobena přítomností nezávislé mutace v dominantním S haplotypu, která
způsobuje potlačení funkčního recesivního S haplotypu [8]. Na molekulární úrovni byly
dosud identifikovány čtyři a tři odlišné S haplotypy třídy II u Brassica rapa (S29, S40, S44, S60)
a B. oleracea (S2, S5, S15) [10]. U homozygotních rostlin se dvěma recesivními S haplotypy
tedy dochází k projevu autoinkompatibility i na úrovni jejich fenotypu. Dosud nebyla
vyšlechtěna česká odrůda řepky olejky pomocí systému AI, avšak v současné době je AI
intenzivně používána v programech českého hybridního šlechtění. Použití technik
molekulárních markerů za účelem genotypizace šlechtitelských populací řepky olejky může
pobídnout k investicím, které mohou urychlit proces hybridního šlechtění. Cílem této práce
bylo praktické využití molekulárních markerů založených na detekci AI pro hybridní
šlechtění.
Materiál a metody
AI linie ‚AI20‘ se stabilním recesivním S haplotypem byla odvozena po křížení mezi AI
donorem (WRG15) a AK donory 00-kvality (2051; Viking). Dihaploidní ‚AI20‘ byla
následně křížena jako mateřská rostlina se čtyřmi AK odrůdami ‚Da Vinci‘ ‚Cabernet‘
‚Chagall‘ a ‚Wisent‘ (Obr. 1) s cílem získat F1 hybridy, ze kterých bylo odvozeno 159
dihaploidních (DH) rostlin F2 populace pomocí mikrosporové embryogeneze. Veškerý
materiál byl získán z VÚRV, Praha-Ruzyně.
Semenný test
Hlavní a dvě postranní nakvítající větve byly zabaleny do plátěných izolátorů, zabraňujících
cizosprášení. Po třech týdnech byly izolátory odstraněny pro zajištění přirozeného vývinu
semen. Po dosažení zralosti byl počítán počet vyvinutých semen na šešuli – rostliny byly
označeny jako AI, když se počet semen na šešuli pohyboval v rozmezí 0 až 3.
DNA extrakce a PCR amplifikace
Genomická DNA byla izolována z mladých listů řepky olejky pomocí metody CTAB [11].
PCR reakce byla připravena s použitím primerů SLGa [12], vyvinutých ze sekvence SLGA10 (úsek s bodovou mutací v S I haplotypu), kde tyto primery amplifikují region u AK
rostlin, zatímco u AI rostlin nedochází k amplifikaci. Pro PCR reakci bylo použito 10 ng
genomické DNA, 1,25 μl (10 μM) každého primeru, 12,5 μl PPP MM (TopBio), vše doplněno
destilovanou vodou do finálního objemu 25 µl. PCR kondice byla připravena, jak uvádí
Zhang et al. [12]. Produkty PCR byly separovány na 1,5% agarozovém gelu v 1 × TBE pufru
a vizualizovány pomocí EtBr.
Výsledky a diskuze
Semenný test
AI byla hodnocena na úrovni F2 populace u 159 DH rostlin. Hodnocení AI rostlin vykazovalo
tři trendy: i) přítomnost rostlin s méně, než třemi semeny na šešuli; ii) rostliny se 4 – 10
semeny na šešuli (značených jako AI/AK); iii) rostliny s více, než 10ti semeny na šešuli, které
byly považovány za AK. Distribuce AI : AK rostlin v F2 DH populaci korespondovala s
152
„Úroda 12/2012, vědecká příloha časopisu“
předpokládaným poměrem 1:1; 13 % rostlin bylo vyhodnoceno za indiferentní (AI/AK;
Obr. 2).
PCR reakce
Primerový pár SLGa amplifikoval band o předpokládané velikosti ~1100 bp u AK rostlin
s S haplotypem třídy I. Segregační poměr AI : AK rostlin na základě molekulární analýzy
vykazoval poměr 1 : 1 (Obr. 2).
Obr. 1 Přehled modelu křížení; produkce tříliniových hybridů a tříliniových DH linií B.
napus
Obr. 2 159 F2 DH rostlin bylo podrobeno semennému testu a následně provedena
molekulární analýza jejich genotypů. PCR reakce s primery (SLGaF/R) detekující S
haplotyp třídy I vedla k amplifikaci přibližně 1,1 kb fragmentu, který byl specificky
přítomen u AK rostlin.
Přesná funkce genu SLG na AI reakci není stále jasná, ale předpokládá se, že má pozitivní
vliv na AI odpověď a to ne zcela známým mechanismem [13]. Specifické primery použité
v této studii detekují gen SLG třídy I a identifikují tak i nefunkční S haplotyp třídy I, který je
přítomen pouze u AK rostlin. Přes veškeré dosavadní poznatky týkající se interakce mezi
geny SP11 a SRK, má použití genu SLG nesporný význam, zejména při determinaci
jednotlivých haplotypů. S použitím těchto primerů byla detekována haploidní rostlina
s S haplotypem třídy I a dále AI rostliny, které byly vlivem nechtěného cizosprášení
vyhodnoceny semenným testem jako AK. Na základě molekulární analýzy tak nedošlo ke
ztrátě cenných AI genotypů.
Závěr
V této studii byla ověřena možnost aplikace specifických markerů do tradičního systému
hybridního šlechtění řepky olejky. Porovnání výsledků semenného testu a výsledků
molekulární analýzy ukázalo, že kromě časové a prostorové náročnosti při prováděném
semenném testu může selekce založena pouze na tomto základě dále vést ke ztrátě cenných
AI genotypů (v našem případě se jednalo o 5% AI rostlin vyloučených na základě nepřesné
selekce semenným testem). Molekulární analýza potvrdila předpokládaný štěpný poměr 1
153
„Úroda 12/2012, vědecká příloha časopisu“
(AK) : 1 (AI) v F2 DH odvozených liniích. Použití molekulárního markeru založeného na
analýze genu SLG I bylo úspěšně validováno; tento marker může být úspěšně použit k selekci
AI rostlin za účelem eliminace AK rostlin v raném stádiu jejich ontogenetického vývoje. S
použitím tohoto markeru tak lze výrazně redukovat počet rostlin pro následující experiment.
Dedikace
Tato studie byla podpořena projekty Mze NAZV QI111A075 a GAJU/064/2010/Z.
Použitá literatura
[1] Bateman, A.J. (1955). Self-incompatibility Systems in Angiosperms: III, Cruciferae.
Heredity 9, pp. 52-58.
[2] Nasrallah, J.B., Nishio, T., Nasrallah, M.E. (1991). The self-incompatibility genes of
Brassica: expression and use in genetic ablation of floral tissues. Ann Rev Plant Physiol
Plant Mol Biol 42, pp. 393-422.
[3] Schopfer, C.R., Nasrallah, M.E., Nasrallah, J.B. (1999). The male determinant of selfincompatibility in Brassica. Science 286, pp. 1697-1700.
[4] Suzuki, G., Kai, N., Hirose, T., Fukai, K., Nishio, T., Takayama, S., Isogai, A.,
Watanabe, M., Hinata, K. (1999). Genomic organization of the S locus: identification and
characterization of genes in SLG/SRK region of S(9) haplotype of Brassica campestris
(syn. rapa). Genetics 153, pp. 391-400
[5] Stein, J.C., Howlett, B., Boyes, D.C., Nasrallah, M.E., Nasrallah, J.B. (1991). molecular
cloning of a putative receptor protein kinase encoded at the self-incompatibility locus of
Brassica oleracea. Proc Natl Acad Sci USA 88, pp. 8816-8820.
[6] Zhang, X., Yin, D., Zhu, W, Ma, C., Fu, T. (2011). Progress on Characterization of
Self-incompatibility in Brassica napus L. Euphytica
[7] Nasrallah, J.B., Nasrallah, M.E (1993). Pollen-stigma signaling in the sporophytic selfincompatibility response. Plant Cell 5, pp. 1325-1335.
[8] Okamoto, S., Odashima, M., Fujimoto, R., Sato, Y., Kitashiba, H., Nishio, T. (2007).
Self-compatibility in Brassica napus is caused by indipendent mutations in S-locus genes.
Plant J 50, pp. 391-400.
[9] Zhang, X.G., Ma, C.Z., Tang, W., Tu, J.X., Shen, J.X., Fu, T.D. (2008). Distribution of
S haplotypes and its relationship with restorer-maintainers of self-incompatibility in
cultivated Brassica napus. Theor Appl Genet 117, pp. 171-179.
[10] Sato, Y., Sato, K., Nishio, T. (2006). Interspecific pairs of class II S haplotypes having
different recognition specificities between Brassica oleracea and Brassica rapa. Plant Cell
Physiol 47, pp. 340-345.
[11] Williams, J.G.K., Hanafey, M.K., Rafalski, J.A., Tingey, S.V. (1992). Genetics analysis
using RAPD markers. Method Enzymol 260, pp. 335-348.
[12] Zhang, X., Ma, C., Fu, T., Li, Y., Wang, T., Chen, O., Tu, J., Shen, J. (2008).
Development of SCAR markers linked to self-incompatibility in Brassica napus L. Mol
Breeding 21, pp. 305-315.
[13] Shiba, H., Iwano, M., Entani, T., et al. (2002) The dominance of alleles controlling selfincompatibility in Brassica pollen is regulated at the RNA level. The Plant Cell 14, pp.
491-504.
Kontaktní adresa:
Ing. Lenka Havlíčková, Ph.D.
Biotechnologické centrum, ZF JU v Českých Budějovicích
Studentská 13, 370 05 České Budějovice
e-mail:[email protected]
154
„Úroda 12/2012, vědecká příloha časopisu“
VELIKOST KOŘENOVÉHO SYSTÉMU – MOŽNÉ SELEKČNÍ
KRITÉRIUM PRO SUCHOVZDORNOST PŠENICE
Root system size – possible selection criterion for drought wheat resistance
Heřmanská A.1, Bláha L.2
1
SELGEN, a.s., Šlechtitelská stanice Úhřetice
2
VÚRV,v.v.i., Praha - Ruzyně
Abstrakt
Práce je zaměřena na hodnocení velikosti kořenového systému sedmi odrůd pšenice jarní,
u kterých se porovnávala elektrická kapacita kořenů v polních podmínkách. Využití elektrické
kapacity, jako sekundárního selekčního znaku pro šlechtění pšenice na velikost kořenové soustavy
(odolnost vůči suchu), by nemělo být opomíjeno vzhledem k možnosti rychlého předběžného
screeningu.
Klíčová slova: pšenice jarní, sucho, velikost kořenového systému (VKS), elektrická kapacita, selekce
Abstract
In the presented work, the evaluation of the root system of seven spring wheat varieties measured by
the their electrical capacity in the field conditions was provided. The utilisation of the electrical
capacity as the secondary selection trait for the wheat breeding i. e. for
the root system size (drought resistance) should not be neglected due to the possibility
of quick preliminary screening.
Key words: spring wheat, drought, root system size (RSS), electrical capacity, selection
Úvod
Globální změny klimatu způsobují v posledních letech častější výskyt sucha i v ČR. Letošní
rok byl v době vegetace jedním z nejsušších za posledních 60 let. Sucho natolik poškodilo
v některých regionech porosty polních plodin, že se plochy osetých obilnin musely dokonce
zaorávat. Celovegetační sucho, střídavé sucho a sucho doprovázené vysokou teplotou je
v přírodě a v zemědělství nejdůležitější faktor limitující výkon rostlin. U pšenice se stává
pravděpodobně hlavním abiotickým stresorem. V současné době je ve světě více jak 40 %
potravin produkováno pouze ze zavlažovaných ploch. V jižní Evropě, ale již i na řadě míst
naší republiky, je patrný pokles hladiny spodní vody, ubývání srážek, které jsou navíc
nerovnoměrně rozdělené, neustále se zvyšuje průměrná teplota v době vegetace. Jižní Morava
a Polabí přestávají být hlavními obilnářskými oblastmi. Jejich místo zaujímají vyšší polohy
například okraj Českomoravské Vysočiny atd. Podle britských modelů je ve střední Evropě
100 % pravděpodobnost výskytu sucha každým druhým rokem.
Z hlediska fyziologického má celovegetační sucho většinou vliv na zvýšení hloubky pronikání
kořenů do půdy. Kořeny po prodloužení přivádějí vodu i k výše položeným bočním větvím,
což umožňuje příjem živin díky zvlhčování přilehlého prostoru. Také mají schopnost změnit
svoji morfologii po nástupu sucha, kdy se mění poměr kořenů k nadzemní části rostliny
ve prospěch kořenů, u některých odrůd se naopak zmenší objem, ale zvětší se hloubka
pronikání. Je známo, zejména z Austrálie, že v suchém roce jsou odrůdy pšenice s větším, ale
hlavně do hloubky pronikajícím kořenovým systémem výnosnější a s lepšími
kvalitativnějšími parametry. Kořeny však patří dosud mezi nedostatečně prozkoumaný orgán
rostliny. Význam vlastností kořenů pro odolnost vůči abiotickým stresorům je však velký.
Kořeny jsou nejcitlivějším orgánem rostliny, který svými morfologickými a fyziologickými
vlastnostmi reaguje podstatně citlivěji na vnější prostředí, nežli nadzemní části rostliny.
Na základě vlastností kořenového systému lze vybírat rostliny odolnější suchu. Pomineme-li
výrazně suchovzdorné plodiny, pak můžeme během vegetace u odrůd jednotlivých plodin
vzdorujících suchu pozorovat při přechodném suchu obranu rostlin označovanou jako
155
„Úroda 12/2012, vědecká příloha časopisu“
„dehydratation avoidance“, tedy strategii vyhnutí se dehydrataci. Ta spočívá ve zvýšeném
příjmu vody z hlubších vrstev půdy, a to zejména díky reakci spočívající v prodloužení
kořenů, snížení výparu vody (např. rolování listů, částečná defoliace atd.) a vyšší citlivostí
průduchů ke ztrátě vody. Velký význam pro rostliny má ta reakce, například u odrůd se
sníženou hladinou etylénu, která při nástupu sucha částečně uzavírá průduchy, omezuje
dýchání, nemění intenzitu fotosyntézy, zvyšuje mírně obsah ABA a současně dochází
ke zvětšení kořenů. Takovýto typ je vždy odolnější vůči suchu a slouží i jako model
pro šlechtění suchovzdornějších typů. Pro vyšlechtění nové odrůdy pšenice, která bude
efektivněji hospodařit s vodou, je nutné vytipovat vhodné donory suchovzdornosti. Obilniny
jsou svým původem stepní trávy a tak plané formy a krajové odrůdy mohou být cennými
šlechtitelskými zdroji pro efektivní hospodaření s vodou. Vedle testování genotypů
v podmínkách sucha se ukázaly být efektivní některé nepřímé metody hodnocení kořenů.
Jednou z metod pro stanovení velikosti kořenového systému, kterou jsme hodnotili v našem
pokusu, je měření elektrické kapacity kořenů v půdě.
Materiál a metody
V roce 2009 byl na lokalitě Úhřetice, na dvou honech vzdálených od sebe cca 500 m, vysetý
sortiment 37 odrůd pšenice seté (Triticum aestivum L.) formy jarní. Pokus byl založen
ve čtyřech opakováních, ruční výsev proveden ve sponu 10 x 15 cm v řádcích o délce 1 m,
tj. 10 rostlin v řádku = 1 odrůda. V rámci víceúčelového, blokově založeného pokusu
ve čtyřech opakováních bylo na základě získaných měření elektrické kapacity v BBCH 34-39
a přihlédnutí k vegetačnímu hodnocení pro následné křížení (s cílem získat soubor kříženců
pro výběr odolných genotypů vůči suchu dle velikosti kořenového systému) vybráno 7 odrůd
z odlišných proveniencí a s rozdílnou velikostí elektrické kapacity kořenů, a to odrůda
Amaretto (DEU), Bárbaro-B (CHL), Bhouth 4 (SYR), Frontana (MEX), Granny, Septima
a Zuzana (všichni tři CZE). V letech 2010-2012 bylo pro stanovení velikosti kořenového
systému těchto 7 odrůd jarní pšenice včetně jejich 20 získaných potomstev vyseto
na 3 lokalitách - Chlumec nad Cidlinou, Hustopeče u Brna a Úhřetice. Každá odrůda
a potomstvo byly zastoupeny na dané lokalitě 40 rostlinami. Během vegetace probíhalo
měření elektrické kapacity kořenů šesti středových rostlin ve všech řádcích ve dvou
termínech, a to ve fázi sloupkování až naduření listové pochvy (BBCH 34-43) a v době
metání až kvetení (BBCH 59-69). Větší rozpětí ve fázích BBCH bylo dáno odlišnou raností
sledovaných odrůd.
Měření elektrické kapacity kořenů probíhalo pomocí přístroje LCR Meter ELC-133A, který
byl nastaven na paralelní kapacitu při měřící frekvenci 1 kHz. Naměřené hodnoty se uvádí
v jednotkách kapacity nanofaradech (nF). V obvodu, mezi kořenovým systémem a půdou,
prochází střídavý proud o frekvenci 1 kHz. Jedna deska „kondenzátoru“ tak představuje
povrch kořenového systému a druhá tvoří substrát, v němž kořeny rostou. Jedná se tedy
o měření elektrického rozhraní mezi vnitřním a vnějším prostředím po připojení dvou
elektrod – jedné pomocí sondy do půdního (kultivačního) prostředí, kde rostlina roste
(v polovině sponu) a druhé připevněné na kleště na bázi všech stébel rostliny, a to ve výšce
cca 1-2 cm nad povrchem půdy, bez kontaktu s půdou. Zjišťuje se tak pouze živá část kořene,
která vykazuje určitou elektrickou aktivitu na membránách (Chloupek, 1977; Středa et al.,
2009).
Výsledky a diskuze
Z výsledků měření elektrické kapacity kořenů byly zjištěny odrůdové rozdíly ve velikosti
kořenového systému na všech třech lokalitách. Vypočítaná průměrná hodnocení elektrické
kapacity na jednu rostlinu z měření ve vývojové fázi sloupkování a metání na třech lokalitách
v letech 2010-2012 jsou znázorněna v grafu 1.
156
„Úroda 12/2012, vědecká příloha časopisu“
Graf 1 – Průměrná elektrická kapacita kořenového systému pšenice jarní měřená ve fázi
sloupkování a metání na třech lokalitách v letech 2010-2012
Průměrná elektrická kapacita kořenového systému pšenice jarní
4,8
AM
4,4
BA
BH
FR
GR
SE
ZU
4,0
3,6
kapacita v nF
3,2
2,8
2,4
2,0
1,6
1,2
0,8
0,4
0,0
Chlumec 2012
Chlumec 2011
Hustopeče 2011
Hustopeče 2010
Úhřetice 2011
Úhřetice 2010
Z výsledků je patrné, že ve sledovaných třech letech na třech lokalitách nejvyšší průměrnou
velikost kořenového systému měla odrůda Amaretto a Bárbaro-B, jen na lokalitě Chlumec
2011 odrůda Amaretto dosahovala nepatrně slabší elektrickou kapacitu kořenů (graf 2).
Dle Dostála et al. (2008) se však jedná jen o odhad, protože použitá metoda měření velikosti
kořenového systému neumožňuje porovnání velikosti kořenového systému různých druhů
a měření v rozdílné půdě. Růst kořenového systému je ovlivňován meteorologickými
podmínkami daného ročníku, ale také půdními podmínkami, jako je půdní druh, typ, úrodnost
půdy atd. Z našich měření však vyplývá, že jsou některé odrůdy s velkým kořenovým
systémem schopny reagovat na více lokalitách a v různých ročnících poměrně stejně.
Graf 2 – Průměrná elektrická kapacita kořenového systému pšenice jarní měřená ve fázi
sloupkování a metání na lokalitě Chlumec nad Cidlinou v roce 2011
Elektrická kapacita kořenového systému pšenice jarní na lokalitě Chlumec nad Cidlinou, 2011
4,4
sloupkování
4,0
metání
průměr
3,6
kapacita v nF
3,2
2,8
2,4
2,0
2,87
2,50
2,43
2,46
2,39
2,29
2,15
1,6
1,2
0,8
0,4
0,0
AMARETTO
BÁRBARO-B
BHOUTH 4
FRONTANA
GRANNY
SEPTIMA
ZUZANA
Tabulka 1 – Průměrná elektrická kapacita kořenového systému pšenice jarní na lokalitě
Úhřetice v roce 2010
Odrůda
Amaretto
Bárbaro-B
Bhouth 4
Frontana
Granny
Septima
Zuzana
Průměrná elektrická kapacita kořenů (nF)
sloupkování
4,57
4,41
3,04
3,19
3,87
3,98
4,35
metání
1,00
0,92
0,70
0,52
0,93
1,08
0,83
průměr
2,79
2,66
1,87
1,86
2,40
2,53
2,59
Tyto dvě odrůdy potvrdily velký kořenový systém i v jednotlivých vývojových fázích
(sloupkování a metání) po celou dobu sledování, kromě roku 2010, kdy na lokalitě Úhřetice
157
„Úroda 12/2012, vědecká příloha časopisu“
větší naměřenou průměrnou kapacitu v době metání měla odrůda Septima (1,08 nF), jak je
uvedeno v tabulce 1.
Jsou-li tyto dvě odrůdy případným donorem pro velký kořenový systém, ukáže až selekce
potomstev v rané generaci F2 a F3, kdy se provádí selekce rostlin na velký a malý kořenový
systém. Selekce je v těchto počátečních generacích po křížení zaměřena především na znaky
geneticky kvalitativní, a tak lze rostliny poměrně lehce identifikovat. Průměrnou velikost
kořenového systému odrůdy Frontana můžeme považovat v různých prostředích a ročnících
za stabilní. Do hodnocení VKS nebyly zahrnuty rostliny nevyrovnané (malé) a napadené
patogenem (virózní), jak jsme zjistili, dovedou ovlivnit elektrickou kapacitu. Odrůdy pšenice
tolerantní k suchu by podle výpočtu autorů mohly zvýšit výnos o 14,5 % v suchých letech;
každý další milimetr extrahované vody z půdy by se v Austrálii projevil vyšším výnosem
o 55 kg.haˉ¹ (Manschadi et al., 2006).
Závěr
Existuje mnoho vhodných metod pro hodnocení kořenové soustavy. V našem pokusu jsme
použili metodu vhodnou přímo pro selekci v polních podmínkách, a to využití elektrické
kapacity kořenového systému, která dokáže vyselektovat genotypy s větším kořenovým
systémem. Pokus byl založen na třech lokalitách - Chlumec nad Cidlinou, Hustopeče
a Úhřetice. Hodnocení velikosti kořenového systému probíhalo v letech 2009-2012 převážně
ve fázi sloupkování a metání. Nejlepších výsledků, tedy většího kořenového systému,
dosahovaly dvě odrůdy Amaretto a Bárbaro-B. Naproti tomu odrůda Frontana prokázala
ve všech zkoušeních stabilní velikost kořenového systému.
Ze zjištěných výsledků vyplývá, že lze provádět pomocí měření elektrické kapacity kořenů
selekci na velký kořenový systém, a to by mohlo být jedním ze sekundárních selekčních
znaků pro šlechtění pšenice na odolnost vůči suchu. Odrůdy, které mají schopnost vyvinout
větší kořenový systém, jsou nejen předpokladem tolerance k suchu, ale mohou zajistit
i výnosovou stabilitu v suchých letech.
Použitá literatura
Bláha, L., Vyvadilová, M: Současné možnosti využití hodnocení kořenového systému
při pěstování a šlechtění rostlin. In: Bláha L., Hnilička F., Martinková J. (ed.): Současné
možnosti fyziologie a zemědělského výzkumu přispět k produkci rostlin. VÚRV, Praha,
2010, 276-300.
Dostál, V., Středa, T., Chloupek, O.: Výnos a kvalita zrna odrůd pšenice a ječmene v suchém
roce 2007 v souvislosti s velikostí kořenového systému. Pšenice – od genomu po rohlík.
České Budějovice, 2008, 156-163.
Chloupek, O.: Evaluation of size of a plant´s root system using its electrical capacitance. Plant
Soil 48, 1977, 525-532.
Manschadi, A. M., Christopher, J., Devoil, P., Hammer, G. L.: The role of root architectural
traits in adaptation of wheat to water – limited environments. Functional Plant Biology,
vol. 33, no. 9, 2006, 823-837.
Středa, T., Dostál, V., Chloupek, O.: Šlechtění a výběr odrůd obilnin s větší tolerancí k suchu.
Úroda 57, č. 5, 2009, 10-12.
Kontaktní adresa:
Ing. Anna Heřmanská, DiS., SELGEN, a.s.
Šlechtitelská stanice Úhřetice, 538 32 Úhřetice
[email protected]
158
„Úroda 12/2012, vědecká příloha časopisu“
VYUŽITÍ MOLEKULÁRNÍCH MARKERŮ PRO HODNOCENÍ
DIVERZITY GENETICKÝCH ZDROJŮ ŘEPKY (BRASSICA NAPUS L.)
Use of molecular markers for assessment of diversity of genetic resources
oil seed rape (Brassica napus L.)
Jozová E.1, Havlíčková L.1, Čurn V.1 , Kučera V.2, Klíma M.2, Vyvadilová M.2
1
2
Zemědělská fakulta JČU, České Budějovice
Výzkumný ústav rostlinné výroby, v.v.i., Praha 6 – Ruzyně
Abstrakt
Diverzita genetických zdrojů řepky (Brassica napus L.) byla sledována pomocí analýzy ISSR
markerů. Pro analýzu bylo vybráno 94 genetických zdrojů světového sortimentu významných
z pohledu českých šlechtitelských programů – krajových odrůd, starších i moderních odrůd
populačních liniových a hybridních, šlechtitelských materiálů se změněnými parametry kvality,
obsahu oleje, žlutosemennosti, materiálů využívaných v hybridním šlechtění. Celkem byly pro
hodnocení genetické diverzity použity tři ISSR markery (UBC 812, UBC 840 a UBC 845), díky nimž
bylo možné odlišit jak jednotlivé genetické zdroje z pohledu geografického rozložení, tak i z hlediska
historie šlechtění. Tato technika je díky své opakovatelnosti a poměrně vysokému polymorfismu
vhodná jako marker pro určení geneticky nejvzdálenějších zdrojů a v kombinaci s jinými
molekulárními metodami (SSR, AFLP atd.) se jeví jako velmi vhodná pro hodnocení genetické
diverzity a charakterizování genetických zdrojů řepky.
Klíčová slova: Brassica napus, ISSR, DNA markery, šlechtění
Abstract
Genetic diversity in a group of 94 genetic resources from world collection of - landraces, old and
modern varieties, population, lines and hybrid varieties, breeding materials with changed parameters
of quality, oil content, yellow-seeds, materials used in hybrid breeding was assessed using ISSR
markers. Three ISSR markers (UBC 812, UBC 840 and UBC 845) were used to determine differences
of genetic resources in terms of geographical distribution, as well as from the history of breeding. Due
to its relatively high repeatability and high polymorphism level is this technique suitable as a marker
for identification of genetic distances in breeding material. ISSR technique as well as SSR or AFLP
seems to be very suitable tools for assessment of genetic diversity and genetic resources of oilseed
rape.
Key words: Brassica napus, ISSRs, DNA markers, breeding
Úvod
V České republice je řepka (brukev řepka olejka, Brassica napus L.) jednou
z nejvýznamnějších plodin, v roce 2012 byla pěstovaná na ploše 401,2 tisíc ha o průměrném
výnosu 2,79 t/ha. Řepka olejná sice patří do skupiny pozdně zkulturněných plodin, přesto
v posledních desetiletích došlo k intenzivnímu šlechtění. Bohužel v důsledku zaměření
selekčního procesu pouze na hospodářsky nejdůležitější parametry došlo k zúžení genetického
základu odrůd řepky a tím pádem klesla míra genetické diverzity [8]. Díky vysokému a
rychlému nárůstu počtu odrůd řepky, klesla i schopnost jejich identifikace pouze na základě
morfologických znaků, proto jsou vyvíjeny vhodné molekulární markerovací systémy, které
mají dostatečnou vypovídací schopnost. Molekulární markery mají celou řadu výhod a jsou
úspěšně používány při určování pravosti odrůd, kontrole odrůdové čistoty hybridních odrůd,
ale i detekci transgenů. Markerovací systémy se odlišují v obsahu informací, počtu
výsledných polymorfismů, stupni automatizace, pracnosti a výší finančních nákladů [3].
V poslední době se k metodám vhodným pro indetifikaci odrůd zařadila technika ISSR neboli
Inter Simple Sequence Repeats. Tato technika je modifikací techniky SSR markerů [5, 11]. Je
159
„Úroda 12/2012, vědecká příloha časopisu“
založena na použití PCR amplifikace s náhodně ukotveným mikrosatelitovým motivem. Na
rozdíl od techniky SSR není při ISSR nutná žádná předchozí znalost sekvence či struktury
studovaného genomu. ISSR se stala účinným nástrojem pro studium genetické rozmanitosti
na úrovni rodičů a jejich potomstva u rodu Brassica [1, 6]. Tato metoda je vhodná díky
vysokému polymorfismu, reprodukovatelnosti výsledků a finanční nenáročnosti [4]. Cílem
této studie bylo zjistit variabilitu mezi odrůdami a dalšími genetickými zdroji, které prošly
vývojem jak z hlediska šlechtitelského, tak i geografického a případně pomoci šlechtitelům
při výběru nejvzdálenějších genotypů jako vhodných rodičů v novošlechtění.
Materiál a metody
Pro analýzu ISSR markerů byl vybrán soubor 94 genetických zdrojů světového sortimentu
obsahující krajové, starší i moderní odrůdy, populační liniové a hybridní odrůdy, šlechtitelský
materiál se změněnými parametry kvality, obsahu oleje, žlutosemennosti a materiál využívaný
v hybridním šlechtění, tj. AI linie, sterilní komponenty typu Ogu-INRA, Pol/Shaan 2A a
obnovitele fertility. Analyzované genetické zdroje byly na základě původu a charakteru
rozděleny do patnácti skupin (Tab. 1). Veškerý semenný materiál byl získán z partnerských
pracovišť VÚRV Praha, VÚO Opava, Sempra Slapy a Selgen Chlumec.
Tab. 1 Rozdělení odrůd do jednotlivých skupin
skupina
O1
O2
O3
O4
O5
O6
O7
původ
staré české krajové odrůdy a odrůdy přechodného typu
staré „00“ odrůdy české a západoevropské
anglosaské odrůdy
francouzské odrůdy
německé odrůdy
moderní české odrůdy
Australské a americké odrůdy
skupina
O8
O9
O10
K
SL
CMSS
AIK
CMSO
původ
východoevropské odrůdy
čínské odrůdy
odrůdy z nejasným původem
šlechtitelský materiál se změněnými parametry kvality
šlechtitelský materiál
materiál pro CMS typu Pol/Shaan 2A
materiál pro AIK
materiál pro CMS typu Ogu-INRA
Pro analýzu ISSR markerů byly rostliny odebírány ve fázi děložních lístků, vždy 36 rostlin u
každého z 94 analyzovaných genetických zdrojů, z kterých byl vytvořen směsný vzorek.
DNA byla ze vzorků izolována pomocí komerčního kitu Invisorb Spin Plant Mini Kit
(INVITEK).
Na základním souboru vzorků bylo vyzkoušeno 18 UBC primerů z nichž byly použity 3 UBC
primery s nejlepší vypovídací hodnotou a vysokou variabilitou. PCR reakce probíhala
v objemu 10 µl, v 1x reakčním pufru (75 mM Tris–HCl, pH=8,8, 20 mM (NH4)2SO4, 0,01%
Tween 20, 2,5 mM MgCl2, 200 µM dNTPs), 12,5 pmol primeru (IDT), 0,5 U Taq Purple
DNA polymerázy (PPP Master Mix, Top-Bio, CZ), 2x BSA a 50 ng templátové DNA.
Amplifikace proběhla při následujícím teplotním profilu: 2min při 95°C, 40 cyklů: 20s 93°C,
1min 52°C, 20s 72°C a 6min 72°C. Fragmenty byly vyzualizovány na 2% agarosovém gelu
obarveném ethidium bromidem vždy ve dvou opakováních pro každý analyzovaný vzorek.
Výsledky a diskuze
Pro analýzu byly na základě provedené optimalizace vybrány 3 ISSR markery (viz. Tab 2).
Výsledky z gelové elektroforézy byly zaznamenány, gely byly digitalizovány, provedena
obrazová analýza a zaznamenány pozice ISSR markerů. Ze získaných dat byla sestavena
matice znázorňující přítomnost či nepřítomnost jednotlivých fragmentů. Molekulární data
byla statisticky vyhodnocena pomocí programu MVSP (Kovach Comp. Serv.) a byla
provedena shluková (UPGMA) a PCO analýza. Výsledky PCO analýzy v podobě ordinačního
diagramu jsou uvedeny na Obr. 1.
160
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 2 Charakteristika použitých primerů
Primery
označení sekvence*
UBC 845 (CT)8RG
UBC 812 (GA)8A
UBC 840 (GA)8YT
* R=A/G, Y=C/T
teplota
anealingu (°C)
52
52
52
počet
fragmentů
13
19
20
variabilních
fragmentů
12
18
17
velikost
fragmentů (bp)
1000-120
1000-180
1000-170
Obr. 1 Výsledky analýzy ISSR markeru založeného na přítomnosti a nepřítomnosti
fragmentů po zpracování v programu MVSP. Použitý matematický model PCO analýza
PCO case scores (Gower General Similarity Coefficient)
0.41
o1
0.33
o2
I_151
0.25
I_006
I_086
I_087
I_009
I_045
I_036 I_148
I_153
I_035
I_089
I_090
I_147
Axis 2
I_095
-0.41
-0.33
-0.25
I_152
o3
I_150 I_173
I_037
I_104
o4
I_154
I_024 0.16
I_155
I_069
I_067
I_061
I_158
I_172
I_072
I_163
I_049
I_169
I_071
I_0400.08
I_054
I_102
I_149
I_068
I_052
I_050
I_098 I_030I_076I_051
I_075
I_165
I_077
I_070
I_160
I_161
I_004
I_066
I_046
I_214 I_157
I_159
I_003-0.08
I_063 0.08
-0.16
0.16 I_039 I_164
0.25
0.33
I_156
I_056
I_033
I_196
I_025 I_198
I_007
I_174
I_162
I_001
I_005
-0.08 I_034
I_065
I_059
I_055
I_048
I_062
I_058
I_073
I_182
I_212
I_031
I_057
I_032
o7
0.41
k
CMSO
sl
I_029
-0.25
I_064
o10
I_010
I_002
I_060
I_215
o6
AIK
-0.16
I_038
o5
I_167
o8
I_008
I_027
o9
-0.33
CMSS
I_053
-0.41
Axis 1
Z provededené analýzy je patrné, že u českých odrůd dochází k významnému zúžení
genetické variability. Původní krajové odrůdy (O1) vykazují velkou šíři genetické diverzity,
která je pravděpodobně zapříčiněna odlišným genetickým pozadím. Starší „00“ a moderní
„00“ odrůdy mají výrazně užší rozsah genetické diverzity, velmi výrazné zúžení je patrné
zejména u poslední zmiňované skupiny (O6). Patrné je odlišné umístění těchto skupin (O2 a
O6) v ordinačním diagramu a lze konstatovat, že v průběhu poměrně krátké doby došlo u
českých odrůd řepky k dosti zásadní změně v genetickém pozadí. Odrůdy západoevropského
původu (O3 - O5) stále vykazují poměrně značnou variabilitu a u těchto skupin není zúžení
genetické variability tak zřetelné. Tento fakt neznamená, že u těchto skupin odrůd došlo ke
konzervaci jejich genetické struktury Odrůdy východoevropské a odrůry mimoevropského
původu pak leží na okrajích diagramu genetické variability a představují materiály s výrazně
odlišným genetickým pozadím. Genetické zdroje – šlechtitelské materiály z aktuálních
českých šlechtitelských programů pak představují velmi zajímavou skupinu. U těchto
materiálů byla porušena uzavřenost a malá šíře genetiské varibility typická pro moderní české
161
„Úroda 12/2012, vědecká příloha časopisu“
odrůdy a aktuální šlechtitelské materiály v podstatě zaujímají rozsah genetické diverzity
evropských odrůd. Šlechtitelské materiály zaměřené na změnu parametrů kvality naopak
představují poměrně úzce vymezenou skupinu (vzorky I86-90). Analýza ISSR markerů se jeví
jako vhodný nástroj pro hodnocení velkých souborů genetických zdrojů řepky. U řepky,
obdobně jako u dalších zemědělských plodin je dostupný poměrně rozsáhlý soubor
nejrůznějších molekulárních markerovacích technik [2, 11]. Markerovací systémy se liší
v obsahu poskytovaných informací, hladině identifikovaného, stupni automatizace, nutnosti
lidské práce a finančními náklady. Zpočátku pro fingerprinting odrůd často využívaná
technika RAPD je nyní nahražována novými technikami, jako jsou mikrosatelity (SSR) a
AFLP [7, 9].
Závěr
U souboru 94 šlechtitelsky významných genetických zdrojů řepky (staré krajové odrůdy,
starší i moderní odrůdy českého i světového sortimentu, aktuální šlechtitelské materiály) byla
provedena analýza ISSR markerů a byla vyhodnocena úroveň genetické diverzity genetických
zdrojů řepky. Celkem bylo testováno 18 ISSR primerů, na základě výsledků amplifikace,
stability a reprodukovatelnosti získaného spektra markerů byly vybrány 3 nejvhodnější
primery. Tyto primery generovaly celkem 52 fragmentů, z nichž bylo 47 polymorfních.
Získaná molekulární data byla statisticky vyhodnocena a z analýz vyplývají významné změny
v genetické diverzitě (šíři genetické variability a genetické struktuře) analyzovaných
genetických zdrojů resp. skupin genetických zdrojů. Výsledky poukazují i na vhodnost
techniky ISSR pro rychlé hodnocení genetické diverzity řepky.
Poděkování
Studie byla získána za podpory projektů MZe NAZV QI 111A075 a GAJU 064/2010/Z.
Použitá literatura
[1]Abdelmigid H.M., (2012). African Journal of Biotechnology, Vol. 11(24): 6409-6419
[2]Caetano-Anolés, et al., (1997). DNA Markers: Protocols, Applications, and Overwies
[3]Čurn V., et al., (2007). Elsevier Publ., 45: 155-179.
[4]Gupta K., et al., (2004). Proceeding of the 4th International Crop Science Congress,
Brisbane, Australia, 26 September – 1 October 2004
[5]Kantety R.V., et al., (1995). Mol. Breed. 1: 365-337.
[6]Liu A., et al., (2006). Genetic Resources and Crop Evolution, 53: 603-611
[7]Lombard V., et al., (2000). Crop Science 40: 1417-1425.
[8]Sobotka R., et al., (2004). J. Appl. Genet. 45: 161-173.
[9]Soltis D.E., et al., (1998). „Molecular Systematics of Plants II DNA Sequencing.“ Kluwer
Academic Publishers, Novell, MA.
[10]Weising K., et al., (2005). DNA Fingerprinting in Plants. Principles, Methods, and
Apllications
[11]Zietkiewics E., et al., (1994). Genomics 20: 176-183.
Kontaktní adresa:
Ing. Eva Jozová
Biotechnologické centrum
ZF, JČU v ČB, Studentská 13, 370 05 České Budějovice
email: [email protected]
162
„Úroda 12/2012, vědecká příloha časopisu“
STANOVENÍ PODOBNOSTÍ V ČESKÉ KOLEKCI ŠTÍROVNÍKU
RŮŽKATÉHO (LOTUS CORNICULATUS L.)
The determination of similarities in the Czech collection of birdsfoot trefoil
(Lotus corniculatus L.)
Knotová D.1, Hutyrová H.2
1
2
Zemědělský výzkum, spol. s r.o., Troubsko
Výzkumný ústav pícninářský, spol. s r.o. Troubsko
Abstrakt
V individuální výsadbě byla v letech 2008 a 2009 hodnocena česká kolekce zahrnující 25 původů
štírovníku růžkatého (Lotus corniculatus L.). 14 původů představovalo odrůdy světového sortimentu a
11 původů plané formy získané sběrovými expedicemi v ČR a v zahraničí. Na 10 rostlinách každého
původu byly zhodnoceny morfologické, výnosové a kvalitativní znaky. Celkem bylo zhodnoceno 34
znaků. Ze zjištěných hodnot byly pro jednotlivé původy odhadnuty bodové a intervalové střední
hodnoty a variační koeficienty jako míry variability mezi a uvnitř původů v daném znaku. Bodové
odhady středních hodnot původů vytvořily matici, která posloužila zpracování metodou shlukové
analýzy. Na základě těchto výsledků byly určeny původy s největší podobností.
Klíčová slova: štírovník růžkatý, shlukový analýza, popisné deskriptory, kolekce odrůd
Abstract
In 2008 and 2009 the Czech collection of 25 origins Lotus corniculatus L. were evaluated in
individual out planting. The 14 origins represent the origins of the world range of varieties and the 11
origins were the wild form obtained by collecting expeditions in CZ and in abroad. On 10 plants of
each origin the morphological, yield and quality characters were evaluated. In total the 34 characters
were evaluated. From the obtained values the point and interval middle values and the coefficients of
variations were estimated for each of the origin in concrete character. Point estimations of middle
values created matrix were elaborated by the method of cluster analysis. Based on these result the
origins were determined with the greatest similarities.
Key words: Lotus corniculatus L., cluster analysis, descriptors, collection of varieties
Úvod
Štírovník růžkatý (Lotus corniculatus L.) je druh běžně vyskytující se v Evropě, západní Asii
a severní Africe. V dalších oblastech je jeho výskyt druhotný (Rak, 2007). Roste na teplých a
vlhkých stanovištích jako jsou louky, pastviny, břehy, meze (Chrtek, 2002). Pícninářsky je
hodnotným druhem s vysokým obsahem bílkovin. Nejčastěji se uplatňuje ve směskách,
vzácněji jako monokultura. Zvyšuje nutriční hodnotu píce a sena (Slavík a kol. 1995). Lotus
corniculatus L. je tetraploidní druh, i když byl někdy charakterizován jako druh diploidní
(Grant a Small, 1996). Průzkumy ukazují, že tento druh je jedním z nejrozšířenějších druhů
celoročně přítomných na přírodních pastvinách v rozmezí nadmořských výšek, pH a množství
srážek (Sardaro et all, 2008). Steiner a Santos (2001) uvádí, že geografická vzdálenost není
spojena s genetickou vzdáleností. Podobnost genotypů je spojena s podobností stanoviště, i
když geograficky velmi vzdálenými. Studium podobnosti původů v kolekcích genofondů je
důležité z hlediska vyloučení duplicit v uložených materiálech genetických zdrojů v genových
bankách. Kolekce významných zemědělských plodin bývají značně rozsáhlé a často se v nich
objevují duplikace (Dotlačil 2005). Z tohoto důvodu je pro uživatele kolekcí velmi obtížná
orientace v těchto materiálech. Mezi základní studie genofondů rostlin patří hodnocení
variability znaků a vlastností mezi jednotlivými populacemi a genotypy (Brindza 1998). Popis
a zhodnocení planých populací jetele lučního z hlediska morfologických a hospodářských
163
„Úroda 12/2012, vědecká příloha časopisu“
znaků a jejich porovnání s registrovanými odrůdami provedla Drobná (2005). Praktickým
využitím statistických metod při studiu diverzity se na příkladu genetických zdrojů cizrny
beraní zabývaly Žáková et Benková (2003).
Materiál a metodika
V průběhu roku 2008 a 2009 bylo v individuální výsadbě v polních podmínkách hodnoceno
25 původů druhu Lotus corniculatus, soustředěných v české kolekci tohoto druhu. 14 původů
představovaly odrůdy světového sortimentu a 11 původů plané formy získané sběrovými
expedicemi v ČR a v zahraničí. Na 10 rostlinách každého původu bylo hodnoceno 34 znaků:
šířka řapíku, délka lodyh, tloušťka lodyh, počet internodií, výška rostliny, délka kořene,
tloušťka kořenového krčku, počet lodyh, počet bočních větví, délka středního internodia,
zelená hmota trsu, suchá hmota trsu, počet květenství na rostlině, počet květů v květenství,
délka květu, šířka květu, délka květního kalicha, délka lusku, šířka lusku, počet semen v
lusku, počet květenství na lodyze, šířka terminálního lístku, délka terminálního lístku, plocha
listu, plocha terminálního lístku, výnos semen a jedna hodnota byla stanovena u znaků obsah
dusíkatých látek, obsah tuku, obsah vlákniny, obsah popele, obsah SNL, obsah cukrů,
stravitelnost sušiny a hmotnost tisíce semen. Z naměřených hodnot byly pro jednotlivé
původy provedeny bodové a intervalové odhady středních hodnot jako míry proměnlivosti
mezi původy a dále odhady variačních koeficientů jako míry vnitroodrůdové variability.
Matice středních hodnot byla zpracována metodou shlukové analýzy.
Výsledky a diskuse
Některé morfologické parametry tohoto druhu studoval v porostu např. Sareen a Dev (2003).
Shlukovou analýzu 28 světových genotypů provedenou na základě 18 morfologických
charakteristik uvádí např. Steiner and Santos (2001). Matice středních hodnot posloužila ke
zpracování shlukové analýzy, jejíž výsledek je uveden v gr. 1. Největší podobnost mezi
zkoušenými původy byla zjištěna u dvojice planých forem TROU 164/95 a TROU 151/96,
dále velkou podobnost vykázaly plané formy POD 1/98 a SVN 55/01. Ani v jednom z obou
případů se však nejedná o duplicity, protože se jednalo o sběry z různých lokalit. Velkou
podobnost také vykázaly odrůdy Táborák (CZE) a Grassland Goldie (NZL). Ani v tomto
případě nejde o duplicity jak je zřejmé z jejich státu původu. Studovaný materiál vytvořil
v podstatě 5 shluků. První je tvořen planými formami (TROU 164/95, TROU 151/96 a ZN
1/00) a k nim se dále přiřazují již zmíněné odrůdy Táborák a Grassland Goldie. Tyto původy
zaznamenaly vysoké hodnoty ve znacích počet bočních větví, délka středního internodia a
obsahu dusíkatých látek, tuku, popele a stravitelných dusíkatých látek. Druhý shluk je tvořen
pouze planými formami (POD 1/98, SVN 55/01 a TROU 8/01). Původy v tomto shluku měly
vysoké hodnoty znaků délka kořene a hmotnost tisíce semen. Třetí shluk tvoří odrůdy Bekeszi
(HUN), Skrzeszowiecka (POL) a k nim se přiřazuje planá forma TROU 144/95. Původy
tohoto shluku vynikaly ve stravitelnosti. Další shluk tvoří odrůdy Víglašský (SVK), Lotar
(CZE), Puszta (HUN) a Malejovský (CZE). Tyto genotypy se od ostatních původů lišily
vysokými hodnotami znaků plocha terminálního lístku, plocha listu a tloušťka lodyh. Poslední
shluk tvoří zbývající odrůdy kolekce a planá forma SUM 382/94 z Rakouska. U odrůd se
jedná o kanadské odrůdy Mirabel, Upstart, Bull a Leo a dále o odrůdy Szabolci (HUN) a
Polom (SVK). V tomto shluku se soustředily původy, které vynikaly ve znacích zelená hmota
trsu, počet květenství na rostlině, délka terminálního lístku a plocha listu. Samostatně stojí
planá forma označená ROH 63/00. Tento původ zaznamenal nejvyšší hodnoty u znaků počet
internodií, zelená hmota trsu, suchá hmota trsu počet květenství na rostlině a počet květenství
na lodyze.
164
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
Planě rostoucí populace jsou velice často cenným zdrojem vlastností, které mohou být dále
rozvíjeny ve šlechtitelském procesu. Rozsáhlá genetická variace byla popsána u štírovníku
růžkatého Chrtkovou-Žertovou (1973). Steiner a Poklemba (1994) uvádí, že stávající odrůdy
byly vyšlechtěny z úzkého genetického základu.
Ukázalo se, že využití shlukové analýzy pro hodnocení genofondů rostlin na základě
morfologických a výnosových charakteristik je vhodné. Soubor se rozdělí na několik shluků
podle největší podobnosti. Tímto způsobem je možné vyhledat duplicity v souboru a uživatel
si pak může vybrat nejvhodnější shluk, případně nejvíce podobné či odlišné genotypy.
S těmito výsledky je možné dále pracovat ve šlechtitelských programech, neboť je možné
vybírat z geneticky vzdálenějších populací.
Graf 1: Dendrogram položek štírovníku růžkatého (Lotus corniculatus L.)
Lotus corniculatus
Com plete linkage
Euclidean distances
TROU 164/95
TROU 151/96
ZN 1/00
Grassland Goldie
CD-11 (Táborák)
POD 1/98
SVN 55/01
TROU 8/01
Bekesi
TROU 144/95
Skrzeszowiecka
Malejovsk
Víglašsk
Lotar
Puszta
TROU 6/97
TROU 28/96
ROH 63/00
SUM 382/94
Polom
Szabolci
Leo
Mirabel
Upstart
Bull
0
100
200
300
400
500
Distance of connection
Dedikace
Výsledek byl získán za částečné institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace a částečně z prostředků Národního programu konzervace a využití
genetických zdrojů kulturních rostlin a agrobiodiverzity, financovaného MZe ČR.
165
„Úroda 12/2012, vědecká příloha časopisu“
Použitá literatura
Brindza J. (1998): Hodnotenie genofondu rastlín z pohl´adu teorie chaosu. Zborník:
Hodnotenie genetických zdrojov rastlín. 16-20
Chrtková-Zertová, A. 1973. A monographic study of Lotus corniculatus L. I. Central and
Northern Europe. Rozpravy Ceskoslovenske Akademie Ved 83:1–94.
Dotlačil L. (2005) : Cíle a metody pro lepší management a využití kolekcí. In: Racionalizace
managementu a využívání genetických zdrojů zemědělských plodin. Agritec Plant
Research, s.r.o. Šumperk a VÚRV Praha – Ruzyně. Genetické zdroje č. 93, 4- 12.
Drobná J. (2005): Hodnotenie divorastúcich populácií ďateliny lúčnej (Trifolium pratense L.).
In: Hodnotenie genetických zdrojov rastlín, VÚRV Piešťany: 154 – 155
Grant, W. F., and E. Small. 1996. The origin of Lotus corniculatus (Fabaceae): A synthesis of
diverse evidence. Can. J. Bot. 74:975–989.
Kubát, K., Hrouda, L., Chrtek, J. jun., Kaplan, Z., Kirschner, J. a Štěpánek J. (eds.): Klíč ke
květeně České republiky, Academia, Praha, 2002, s. 426 – 427.
Rak, L., 2007: Lotus corniculatus: http://botany.cz/cs/lotus-corniculatus/ 1. 4. 2010
Sareen, S., Dev, I.: A preliminary study to explore potential of Lotus corniculatus L
(Birdsfoot trefoil) in Palampur ( Himachal Pradesh, India)., Lotus Newsletter, 2003,
Volume 33: 3 – 5.
Savo, M. L., Sardaro, Atallah, M., Tavakol, E., Russi, L. and Porceddu, E.:
Diversity for AFLP and SSR in Natural Populations of Lotus corniculatus L. from Italy
Crop Sci., May 1, 2008; 48(3): 1080 - 1089.
Slavík, B. a kol.: Květena České republiky 4, Academia, Praha, 1995, s. 492 – 497.
Steiner, J.J., and Poklemba, C.J.: Lotus corniculatus classification by seed globulin
polypeptides and relationship to accession pedigrees and geographic origin. Crop Sci.,
1994; 34,: 255–264.
Steiner, J.J. and de los Santos, G.G.: Adaptive Ecology of Lotus corniculatus L. Genotypes: I.
Plant
Morphology
and
RAPD
Marker
Characterizations
Crop Sci., March 1, 2001; 41(2): 552 - 563.
Žáková M., Benková M. (2003): Využitie štatistických metód v studiu diverzity kolekcie
genetických zdrojov v príklade cícera baranino. In: Hodnotenie genetických zdrojov
rastlín, VÚRV Piešťany: 104 – 111
Kontaktní adresa:
Ing. Daniela Knotová
Zemědělský výzkum, spol. s r.o.
Zahradní 1, 66441 Troubsko
[email protected]
166
„Úroda 12/2012, vědecká příloha časopisu“
VARIABILITA HMW GLUTENINŮ PŠENICE
Variability of wheat HMW glutenins
Leišová-Svobodová L.1, Štočková L.1, Bradová J.1
1
Výzkumný ústav rostlinné výroby, v.v.i. Praha – Ruzyně
Abstrakt
U 63 odrůd pšenice (Triticum aestivum) bylo nalezeno 21 alel HMW gluteninů. Největší alelickou
variabilitu vykazují geny Glu B1x a Glu B1y (6 a 5 alel, resp.), nejmenší Glu D1y (2 alely). Celkový
index diversity činil DG 0,953. Celkem 30 rozdílných genotypů bylo nalezeno analýzou alelické
variability HMW gluteninů u studovaného souboru odrůd pšenice. Shoda detekce alel na úrovni
proteinů (SDS PAGE) a na úrovni DNA (PCR) je poměrně nízká (64 %) a je dána zejména
nedostatečnými znalostmi rozdílů DNA sekvencí mezi alelami HMW gluteninů.
Klíčová slova: SDS PAGE, PCR, alelická variabilita
Abstract
Twenty-one alleles of HMW glutenins was found in 63 wheat (Triticum aestivum) varieties. Genes
Glu B1x and Glu B1y showed the greatest variability (6 and 5 alleles, resp.), to the contrary Glu D1y
was represented only by 2 alleles. Diversity index DG was found to be 0,953. Thirty different
genotypes were found in the studied set of 63 wheat varieties. There was found a low level of
congruence between the detection of HMW glutenin alleles on protein level (SDS PAGE) and on
DNA level (PCR) (64 %). It is more likely caused by insufficient knowledge of differences of DNA
sequences between HMW glutenin alleles
Key words: SDS PAGE, PCR, allelic variability
Úvod
Pekařské vlastnosti pšenice (Triticum aestivum) jsou ovlivněné zejména obsahem a složením
proteinové složky zrna. Zásobní proteiny jsou složeny z gluteninů, rozlišované dle
molekulární hmotnosti na vysokomolekulární (HMW) a nízkomolekulární (LMW) gluteniny a
z gliadinů, které mají obdobnou velikost jako nízkomolekulární gluteniny. Ačkoli HMW
gluteniny tvoří jen 10 % obsahu zásobních proteinů v zrnu, mají značný vliv na pekařskou
kvalitu pšenice, ovlivňují zejména viskoelastické vlastnosti těsta (Payne et al., 1984).
Geny HMW gluteninů jsou lokalizovány na dlouhém rameni chromozomu 1 u všech tří
genomů A, B a D. Na každém lokusu jsou přítomny 2 geny označované ´x´ a ´y´ (Kong et al.,
2004). Ne všechny přítomné geny bývají exprimovány, odrůdy pšenice mívají obvykle 3 - 5
HMW gluteninových podjednotek detekovaných na úrovni proteinů, nejčastěji metodou SDS
PAGE (Halford et al., 1987). U genu 1Ax byly dosud detekovány 2 alely, s tím, že u
některých odrůd není tento gen exprimován a označuje se za nulovou alelu (Anderson et
Greene, 1989). Gen 1Ay není exprimován u žádné odrůdy pšenice, ačkoli je na úrovni DNA
přítomen. Geny 1Bx, 1Dx a 1Dy jsou exprimovány vždy a vykazují značnou alelickou
variabilitu. Gen 1By rovněž vykazuje značnou alelickou variabilitu, ale u některých odrůd
pšenice exprimován není a označuje se jako nulová alela (1By0) (Halford et al., 1987).
Všechny geny HMW gluteninů se skládají z unikátních N a C terminálních domén a z velké
centrální repetitivní domény bohaté na aminokyseliny glycin, prolin a glutamin (D´Ovidio et
al., 1995). Alelická variabilita je dána různou délkou repetitivní oblasti (Anderson et Greene,
1989; Liu et al., 2007).
Hlavním cílem této práce bylo zjištění míry variability HMW gluteninů u vybraného souboru
pšenice a porovnání dvou přístupů – detekce na úrovni proteinů pomocí SDS PAGE a detekce
ne úrovni DNA pomocí PCR.
167
„Úroda 12/2012, vědecká příloha časopisu“
Materiál a metody
Celkem bylo analyzováno 63 odrůd pšenice. Pro charakterizaci HMW gluteninů na úrovni
proteinů byla použita metoda vertikální elektroforézy v polyakrylamidovém gelu v prostředí
dodecylsulfátu sodného (SDS PAGE) (Laemmli, 1970).
Pro účely studia HMW gluteninů na úrovni DNA byla nejprve DNA extrahována z listových
čepelí cca 30 rostlin ve stadiu 1. pravého listu pomocí detergentu CTAB dle
optimalizovaného protokolu. Kvalita a koncentrace extrahované DNA byly ověřeny
elektroforeticky v 0,8 % agarózovém gelu a vizualizaci pomocí ethidiumbromidu v UV světle
srovnáním s velikostním a koncentračním standardem λHind III (Fermentas).
PCR byly prováděny v reakčním objemu 15 μl obsahujícím 0,33 μM primerů specifických pro
každou alelu každého ze studovaných genů (D´Ovidio et al., 1995), 0,33 mM dNTP, 1x pufr,
2mM MgCl2, 1x Q roztok, 1U Taq polymerázy Qiagen a 200 ng DNA vzorku. Reakce byly
prováděny v cykleru Gene Quant Pro za reakčních podmínek: počáteční denaturace 5 minut
při 96°C, 35 cyklů: 30 sekund při 95°C, 30 sekund při 60°C a 1 minutu při 72°C, závěrečná
fáze syntézy při teplotě 72°C po dobu 10 minut. Produkty PCR reakce byly separovány
elektroforeticky v 1,6 % agarózovém gelu a vizualizovány pomocí ethidium-bromidu v UV
světle srovnáním s velikostním standardem 100 bp+ (Fermentas).
Statistické analýzy byly prováděny pomocí programů MS Excel, Multilocus 1.3 (Agapow et
Burt, 2001) a Darwin (Perrier and Jacquemoud-Collet, 2006).
Výsledky a diskuze
U studovaného souboru 63 odrůd pšenice bylo celkem detekováno 21 alel HMW gluteninů,
včetně nulových alel. U Glu A1x byly detekovány 3 alely, u Glu A1y 1 alela (nulová), u Glu
B1x 6 alel, u Glu B1y 5 alel, u Glu D1x 4 alely a u Glu D1y 2 alely. Mezi detekcí pomocí
SDS PAGE a pomocí PCR metody došlo ke značné neshodě. U Glu A1 se výsledky
neshodovaly ve 27 % z celkového počtu studovaných odrůd pšenice, u GluB1 v 56 % odrůd
a u Glu D1 v 25 % odrůd pšenice. Rozdíly jsou dány zejména tím, že dosud nejsou k dispozici
primery specifické pro všechny alely detekované na úrovni proteinů a pravděpodobně rovněž
tím, že na úrovni DNA dosud není k dispozici dostatek kvalitních sekvencí známých alel
HMW gluteninů, komplikovaná DNA sekvence genů a ne příliš jasně definované rozdíly
DNA sekvencí jednotlivých alel. Proto je velmi komplikované připravit alelově specifické
PCR markery pro geny HMW gluteninů.
Jednotlivé alely se ve studovaném souboru vyskytovaly v různých četnostech (Obrázek 1). U
Glu A1x převládal výskyt alely Glu A1x0, tzn., že u většiny studovaných odrůd pšenice se
Glu A1x podjednotka nevyskytovala vůbec. U Glu B1x se nejčastěji vyskytovala alela Glu
B1x7, často v kombinaci s nulovou alelou Glu B1y0. U Glu B1y vykazovala nejčetnější
výskyt alela Glu B1y8. U genu Glu D1x se nejčastěji vyskytovala alela Glu D1x2, většinou
v kombinaci s alelou Glu D1y12.
Statistickou analýzou bylo nalezeno 30 rozdílných genotypů v souboru 63 studovaných odrůd
pšenice. Index diversity DG činil 0,953, což je hodnota, naznačující vysokou úroveň
biodiversity sestavy HMW gluteninových alel studovaného souboru odrůd pšenice.
Clusterová analýza potvrdila vysokou míru alelické variability HMW gluteninů
u studovaného souboru odrůd a zároveň existenci týchž genotypů ve studovaných lokusech
(Obrázek 2). Nejčastějším byl genotyp s kombinací alel Glu A1x0, Glu B1x6, Glu B1y8, Glu
D1x2 a Glu D1y12 a vyskytoval se u 10 odrůd pšenice (Thesse, Magister, Clement, Beaver,
Gawain, Brimstone, Damier, Champion, Riband a Joss). Naopak unikátní sestava alel byla
detekována u 16 odrůd pšenice (Magdalena, Insignia, Ducat, Nectar, Campremy, Austerlitz,
Salmone, Orca, Abbondanza, Hereward, Florin, Avalon, Viking, Brock, Resistente a
Magnif27).
168
„Úroda 12/2012, vědecká příloha časopisu“
Obrázek 1 – Četnosti výskytu alel u 63 odrůd pšenice
GluA1x
GluB1x
40
45
40
Četnost výskytu
Četnost výskytu
35
30
25
20
15
10
5
35
30
25
20
15
10
5
0
0
GluA1x0
GluA1x1
GluB1x6
GluA1x2
GluB1x7
GluB1y
GluB1x13 GluB1x17 GluB1x18 GluB1x20
GluD1x
35
40
30
35
GluD1y
25
20
15
10
30
25
20
15
10
5
5
0
0
GluB1y0
GluB1y8
GluB1y9
45
Četnost výskytu
Četnost výskytu
Četnost výskyt
50
35
30
25
20
15
10
5
0
GluD1x2
GluB1y16 GluB1y18
40
GluD1x3
GluD1x4
GluD1y10
GluD1x5
GluD1y12
Obrázek 2 Dendrogram vytvořený na základě genetických vzdáleností vypočtených
z alelické variability HMW gluteninů 63 odrůd pšenice
64
25
65
Magdalena
29
15
68
17
65
60
62
31
0
Salmone
Orca
Abbondanza
25
16
Rivoli
Louvre
66
34
Hereward
Florin
18
1
Avalon
Viking
2
61
20
0
Campremy
Austerlitz
1
1
Hardi
Copain
62
37
10
Iena
Champlein
Brock
Roazon
Aquilej a
Darius
Longbow
Galahad
Monitor
45
26
Resistente
Thesse
Magister
Clement
Beaver
Gawain
Brimstone
Damier
Champion
Riband
Joss
73
23
46
Belaviso
Axel
Sabre
Magali
Chinese_Spring
Scipion
82
59
84
42
Prinqual
Gabo
Proqual
Moulin
Kite
Magnif27
0
Protinal
Fidel
Lodi
85
0.1
169
Insignia
60
25
22
Resceler
Nisu
Tarasque
Rex
Chopin
Ducat
Nectar
Soissons
Champtal
Pernel
Gerbier
Goya
Carat
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
Odrůdy pšenice vykazují vysokou míru alelické variability Genů HMW gluteninů. Je třeba
dále věnovat pozornost studiu těchto genů na úrovni DNA i proteinů pro pochopení vývoje
této variability, vlivu jednotlivých alel na kvalitu pšenice a mechanismu, jak těchto znalostí
využít v praxi.
Dedikace
Tento výzkum byl podpořen finančními prostředky projektů Mze ČR MZE0002700604
a QH92155.
Použitá literatura
Agapow P.M., Burt A. (2001): Indices of multilocus linkage disequilibrium. Mol Ecol Notes
1: 101-102.
Anderson O.D., Greene F.C. (1989): The characterization and comparative analysis of highmolecular-weight glutenin genes from genomes A and B of a hexaploid bread wheat.
Theor Appl Genet 77: 689-700.
D´Ovidio R., Masci S., Porceddu E. (1995): Development of a set of oligonucleotide primers
specific for genes at the Glu-1 complex loci of wheat. Theor Appl Genet 91: 189-194.
Gale K.R. (2005): Diagnostic DNA markers for quality traits in wheat. J Cereal Sci 41: 181192.
Halford N.G., Forde O.D., Anderson O.D., Greene F.C. Shewry P.R. (1987): The nucleotide
and deduced amino acid sequences of an HMW glutenin subunit gene from chromosome
1B of bread wheat (Triticum aestivum L.) and comparison with those of genes from
chromosomes 1A and 1D. Theor Appl Genet 75: 117-126.
Liu S., Zhao S., Chen F., Xia G. (2007): Generation of novel high quality HMW-GS genes in
two introgression lines of Triticum aestivum/ Agropyron elongatum. BMC Evol Biol 7: 76
(doi:10.1186/1471-2148-7-76).
Kong X.Y., Gu Y.Q., You F.M., Dubcovsky J., Anderson O.D. (2004): Dynamics of the
evolution of orthologous and paralogous portions of a complex locus region in two
genomes of allopolyploid wheat. Plant Mol Biol 54: 55-69.
Laemmli, V. K. (1970): Cleavage of Structural Proteins during Assembly of The Head
Bacteriophag. Nature, 227, 1970: 680-685.
Payne P.I., Nightingale M.A., Krattiger A.F., Holt L.M. (1987): The relationship between
HMW glutenin subunit composition and the bread-making quality of British grown wheat
varieties. J Sci Food Agric 40: 51-65.
Perrier X, Jacquemoud-Collet JP. (2006) DARwin software http://darwin.cirad.fr/darwin.
Kontaktní adresa:
RNDr. Leona Leišová-Svobodová
Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507, 161 06 Praha 6 – Ruzyně
[email protected]
170
„Úroda 12/2012, vědecká příloha časopisu“
VLIV PODMÍNEK SKLADOVÁNÍ NA KLÍČIVOST A OBSAH
ŽIVIN V ZRNINÁCH
Influence of storage conditions on germination ability and content
of nutrients in grain crops
Vaculová K.1, Kýhos K.2, Balounová M.1, Sedláčková I.1
1
2
Agrotest fyto, s.r.o., Kroměříž
Výzkumný ústav potravinářský Praha, v.v.i.
Abstrakt
Byly hodnoceny změny v ukazatelích klíčivosti (klíčivost-CK, energie-EK a rychlost klíčení-RK) a
obsahu vybraných živin (škrob, beta-glukany, tuk, dusík-N) v zrninách (ječmen, oves, pšenice,
tritikale, kukuřice a hrách) v průběhu skladování celého zrna po dobu 24 měsíců v prostředí s
modifikovanou atmosférou (vakuum, N2). Sledované ukazatele se významně lišily u jednotlivých
druhů i odrůd. Obecně nebyla zjištěna průkazná diference mezi variantou ošetření s vakuem nebo N2 a
interakcemi mezi modifikovanou atmosférou a délkou skladování. Délka skladování měla negativní
vliv na CK (zejména u ječmene, ovsa, tritikale a hrachu) a RK (u hrachu). Byly nalezeny neprůkazné
pozitivní trendy vlivu skladování na zvýšení obsahu tuku, EK (u ovsa, pšenice a kukuřice) a RK (u
ovsa). Pozorovaný nárůst obsahu tuku může důsledkem metabolických změn v průběhu skladování.
Klíčová slova: zrniny, skladování, modifikovaná atmosféra, klíčivost, složky zrna
Abstract
Changes in germination ability (G), germination energy (GE), speed (GS), content of selected
nutrients (starch, beta-glucans, fat and nitrogen-N) in grain crops (barley, oats, wheat, triticale, maize
and peas) were evaluated during storage for 24 months of the whole grain under modified atmosphere
conditions (vacuum, presence of N2). The parameters measured significantly differed for individual
crops and cultivars. Generally there were no significant differences between vacuum and N2 and
interactions between atmosphere conditions and storage duration. The storage duration has negative
impact on the G (especially in barley, oats, triticale and peas) and GS (in peas). No significant trends
to increase during storage were found for fat, GE (in oats, wheat, and maize) and GS (in oats). The
observed increase in the fat content can be attributed to metabolic changes during storage.
Key words: grain crops, storage, modified atmosphere, germination ability, grain constituents
Úvod
Hlavním úkolem při skladování zrna je zachování jeho biologické, fyziologické a nutriční
kvality. Kromě poškození obilek, přítomnosti plísní a mikroorganismů, nevhodných
skladovacích podmínek (vysoká vlhkost a teplota, apod.) může kvalitu zrna významně snížit
napadení skladovými škůdci (Kučerová et al. 2003). Jedním z nejnebezpečnějších skladových
škůdců je pilous černý (Sitophilus granarius, L.) který se velmi obtížně likviduje zejména v
ekologickém systému hospodaření, kde je použití chemických prostředků vyloučeno. Proto
jsou hledány různé alternativní metody, které by nahradily běžně používané pesticidy
(Finkelman et al. 2006, Trdan et al. 2006, aj.). V současně řešeném projektu se zabýváme
způsoby inaktivace pilouse černého různými, ekonomicky dostupnými technologickými
postupy, mezi které patří i využití skladování v prostředí kontrolovaně modifikované
atmosféry. V předloženém příspěvku jsou uvedeny výsledky hodnocení biologických a
kvalitativních ukazatelů vybraných zrnin, skladovaných při běžných teplotních podmínkách v
modifikované atmosféře (vakuum, dusík).
Materiál a metody
Netříděné zrno různých druhů zrnin (ječmen jarní: odrůdy Bojos, Sebastian a AF Lucius; oves
setý: Neklan a Pogon; pšenice jarní: Vánek; tritikale jarní: Kargo; kukuřice setá: hybrid
171
„Úroda 12/2012, vědecká příloha časopisu“
CE2607 a hrách polní: Concorde a Zekon), sklizené v roce 2009 bylo naváženo (0,5 kg x 20)
do upravených sáčků z plastové folie (s bariérou proti propustnosti atmosférického kyslíku) a
následně ošetřeno odsátím vzduchu (varianta s vakuem), resp. odsátím vzduchu a nahrazením
plynným dusíkem (varianta s N2). Všechny sáčky byly umístěny v uzavřeném kontejneru ve
skladové hale (hala HARD) s neregulovanou teplotou prostředí. V průběhu 24 měsíců byly v
celkem 9 intervalech (duben 2010-duben 2012) odebírány vždy 2 sáčky z obou variant
ošetření a vzorky zrna byly hodnoceny z hlediska ukazatelů klíčivosti (klíčivost-CK, energie
klíčení-EK, rychlost klíčení-RK-vše v %) a obsahu živin (škrob, beta-glukany-BG, tuk, dusíkN-vše v % suš.) dle platných metodik ČSN, EBC a ISO norem. Příprava sáčků a ošetření
vzorků modifikovanou atmosférou (vakuum nebo N2), provedené na laboratorním zařízení, je
analogické postupu popsanému v přijatém užitném vzoru č. PUV 21488 (Kýhos et al. 2010).
Experimentální data byla vyhodnocena použitím software STATISTICA, verze 8.0 (StatSoft,
Inc., Tulsa, Oklahoma, USA).
Výsledky a diskuse
Kontrolovaně modifikovaná atmosféra v podobě vakua (zbytkový O2 do cca 2%) a vakua s
nahrazením plynným dusíkem (N2) byla zvolena jako médium na základě dílčích experimentů
s různými vývojovými stádii pilouse černého a dostupných výsledků zahraničních autorů
(Bera et al. 2004, Žďárková a Voráček 1993, aj.). Předpokladem použití jakékoliv metody
inaktivace škůdců v podmínkách ekologického systému hospodaření je možnost variabilního
využití skladovaného zrna – tedy jak pro účely setí v následujícím období, tak také pro další
potravinářské zpracování. Zemědělci hospodařící v ekologickém zemědělství mají zřídka
možnost skladovat větší objemy zrna v teplotně regulovaném prostředí. Proto byly vzorky
zrna uskladněny v podmínkách, kde v důsledku konstrukce haly dochází k výrazným
teplotním výkyvům v průběhu celého roku.
Tab. 1 - Efekt vlivu faktorů na sledované ukazatele (GLM, ANOVA)
MS
Zdroj proměnlivosti
df
Druh
Ošetření
Datum
Druh*Datum
Ošetření*Datum
Chyba
5 8.55***
1 3.87***
8 2.72***
40
0.06
8 0.29**
72
0.09
Zdroj proměnlivosti
df
vlhkost
energie
rychlost
klíčení
klíčení
1926.08*** 39381.79*** 6495.12***
27.52
108.51
13.82
146.18**
517.22***
297.82**
93.83**
251.34***
57.51
10.17
97.15
51.37
48.14
87.59
80.40
klíčivost
MS
škrob
beta-glukany
tuk
Druh
5 1483.86
94.83***
50.29***
Ošetření
1
0.43
0.01
0.23
Datum
8 12.82***
0.19
3.09***
Druh*Datum
40 6.73***
0.10
0.11
Ošetření*Datum
8
0.38
0.04
0.04
Chyba
72
1.51
0.14
0.27
1)
- viz. Materiál a metodika; * - P0.05; ** - P0.01, *** - P0.001
N1)
17.47***
0.01
0.09**
0.02
0.01
0.03
Hodnocení proměnlivosti pomocí analýzy variance (Tab.1) ukázalo, že nejvýznamnějším
faktorem byl druh studované zrniny, a to jak pro ukazatele klíčivosti a vitality (měřené jako
energie a rychlost klíčení – Prokeš 2005, 2009), tak i změn v obsahu vlhkosti, BG, tuku i
obsahu N. Vlhkost zrna hraje významnou roli při zachování biologické a fyziologické kvality
172
„Úroda 12/2012, vědecká příloha časopisu“
zrna při skladování v podmínkách s vysokými teplotami i teplotami pod bodem mrazu
(Fleurat-Lessard et al. 1994, Domin a Kluza 2010). Počáteční vlhkost vzorků při zakládání
pokusu ani v jednom případě nepřekročila limitní hranici 14,5%. Přesto byly diference mezi
variantami ošetření zrna (varianta s N2=12,72% vs. vakuum=12,97%; P≤0,05), datem odběru i
jejich interakcemi statisticky významné. Vzhledem k tomu, že nejvyšší průměrné hodnoty
vlhkosti (13,01-13,25%) byly naměřeny v prvních 4 odběrech, lze tyto rozdíly zřejmě přičíst
na vrub postupné ztráty vody v důsledku probíhajících metabolických dějů v zrnu. V důsledku
vysoké proměnlivosti mezi jednotlivými druhy zrnin nebyl způsob ošetření průkazný pro
žádný další hodnocený ukazatel.
Obr. 1 - Průměrné hodnoty a variabilita obsahu vybraných složek zrna jednotlivých
druhů zrnin ve všech experimentálních termínech odběru
72
6
72
6
68
64
4
64
4
60
56
2
48
68
64
4
60
56
2
52
60
56
2
52
48
52
48
04-2010
05-2010
06-2010
07-2010
09-2010
10-2010
04-2011
10-2011
04-2012
0
04-2010
05-2010
06-2010
07-2010
09-2010
10-2010
04-2011
10-2011
04-2012
0
04-2010
05-2010
06-2010
07-2010
09-2010
10-2010
04-2011
10-2011
04-2012
0
72
6
68
tritikale
kukuřice
pšenice
Y2
Y1
N (Y1),
tuk (Y1),
72
6
beta-glukany (Y1),
72
6
68
64
4
56
64
4
48
68
64
4
60
56
2
52
60
56
2
52
48
52
48
04-2010
05-2010
06-2010
07-2010
09-2010
10-2010
04-2011
10-2011
04-2012
0
04-2010
05-2010
06-2010
07-2010
09-2010
10-2010
04-2011
10-2011
04-2012
0
04-2010
05-2010
06-2010
07-2010
09-2010
10-2010
04-2011
10-2011
04-2012
0
72
6
68
60
2
škrob (Y2) - vše v % (suš.)
oves
ječmen
hrách
Délka skladování se naopak ukázala jako faktor proměnlivosti, který ovlivňoval jak obsah
škrobu, tuku, N i všech ukazatelů klíčivosti. Obsah škrobu a tuku s dobou skladování mírně
vzrůstal (Obr. 1). Zřetelnější trend nárůstu byl pozorován pro obsahu tuku, kde mezi
průměrnou hodnotou prvního a posledního odběru byla zjištěna průkazná diference (2,44 vs.
3,41 %; P≤0,05). Tyto změny jsou zřejmě důsledkem metabolických reakcí, při kterých
dochází k uvolňování některých vazeb mezi tuky a proteiny a postupné inaktivaci některých
enzymových systémů. Fleurat-Lessard et al (1994) zaznamenali u pšenice postupný úbytek
počtu nukleotidů, silnější v důsledku vyšších teplot při skladování než vlivem modifikované
atmosféry. Také Kaukovirta-Norja et al. (1998) pozorovali při skladování suchých intaktních
vzorků sladovaného zrna redukční reakci vybraných masných kyselin působením enzymu
lipoxygenázy, přičemž síla reakce závisela na stupni metabolických přeměn v zrnu. Chloupek
(2009) uvádí, že ztráta vitality začíná degradací buněčných membrán vlivem oxidace
membránových lipidů, snižuje se syntéza ATP a respirace. V průběhu námi hodnocené doby
skladování zřejmě ještě nedošlo k významnějším změnám ve struktuře buněčných stěn,
protože obsah BG, jako jedné ze stavebních složek buněčné stěny, se v průběhu hodnocení
významně neměnil a byl jediným ukazatelem s proměnlivostí výhradně ovlivněnou zvoleným
druhem plodiny. Kolísání obsahu N v průběhu skladování nevykazovalo žádný zřetelný trend.
Nejvýznamnější změny, zapříčiněné jak délkou skladování, tak interakcemi s jednotlivými
173
„Úroda 12/2012, vědecká příloha časopisu“
druhy byly pozorovány pro ukazatele klíčivosti a vitality zrna (Obr. 2). Přesto, že odrůdy
některých druhů (ječmen, oves a hrách) reagovaly rozdílně (u ječmene byly průkazně nejnižší
hodnoty ukazatelů klíčivosti zjištěny u odrůdy Sebastian), zvolená délka skladování měla
negativní vliv na celkovou klíčivost u většiny druhů a na RK u hrachu.
Obr. 2 - Průměrné hodnoty a variabilita ukazatelů klíčivosti u jednotlivých druhů zrnin
v průběhu všech experimentálních termínů odběru (I – IX, data odběru viz. Obr. 1)
klíčívost;
EK,
RK - vše v %
%
100
80
60
40
20
0
I III V VII IX
II IV VI VIII
I III V VII IX
II IV VI VIII
I III V VII IX
II IV VI VIII
I III V VII IX
II IV VI VIII
ječmen
pšenice
oves
hrách
I III V VII IX
II IV VI VIII
kukuřice
I III V VII IX
II IV VI VIII
tritikale
Výjimku tvořila kukuřice kde, podobně jak uvádějí Domin a Kluza (2010), naopak vzrostl
podíl klíčivých zrn. Na rozdíl od výsledků autorů Benková et al. (2011) měly odrůdy ovsa
nejnižší klíčivost i celkovou vitalitu a obdobně se chovaly i odrůdy hrachu. Byly pozorovány
pozitivní trendy vlivu délky skladování na zvýšení EK u ovsa, pšenice a kukuřice a RK u
ovsa.
Závěr
Skladování různých druhů zrnin v podmínkách s modifikovanou atmosférou (vakuum, N2)
nemá statisticky průkazný vliv na ukazatele klíčivosti nebo obsah základních složek zrna.
Významným faktorem ovlivňujícím zejména klíčivost a vitalitu zrna je délka skladování.
Interakce délky skladování s variantou ošetření nebyly v našem pokusu nalezeny.
Dedikace
Příspěvek byl vypracován za finanční podpory projektu MZe ČR č. QI101B088.
Použitá literatura: Citace použité literatury jsou k dispozici u autorů příspěvku.
Kontaktní adresa:
Ing. Kateřina Vaculová, CSc.,
Agrotest fyto, s.r.o., Havlíčkova 2787/121, 767 01 Kroměříž
[email protected]
174
„Úroda 12/2012, vědecká příloha časopisu“
ŠLECHTĚNÍ HRACHU NA REZISTENCI KE KOMPLEXU VIRÓZ
A ANTRAKNÓZ
Resistance breeding of pea to complex of virosis and ascochyta
Dostálová R., Ondřej M. a Ondráčková E.
Agritec Plant Research s.r.o., Šumperk
Abstrakt
V letech 2010–2012 byly některé pěstitelské oblasti hrachu napadány komplexem viróz a antraknóz.
Výnos hrachu a stupeň napadení antraknózou byly v korelaci se stupněm napadení virózami. Silný
přirozený infekční tlak viróz umožnil vybrat zdroje odolnosti proti původcům obou chorob současně a
realizovat selekci odolných rostlin k získání perspektivních linií pro šlechtitelské využití.
Klíčová slova: hrách, virózy, antraknóza, selekční metody
Abstract
In 2010–2012 peas in some growing areas were attacked by viruses and ascochyta blight complex.
Both yield of pea and damage degree of pea with ascochyta blight correlated with pea virus attack.
Due to strong natural infection pressure of viruses, the resistant sources of pea to virus diseases and
Ascochyta blight were selected. Resistant strains were used for breeding program of pea.
Keywords: peas, virus diseases, ascochyta, selection methods
Úvod
Virová mozaika hrachu přenosná semenem (Pea seed-borne mosaic virus, PSbMV) se často
vyskytuje spolu s původcem výrustkové mozaiky hrachu (Pea enation mosaic virus, PEMV).
Typickými příznaky infekce hrachu virem PSbMV je svinutka listů, zkrácení internodií, různý
stupeň zakrslosti infikovaných rostlin, dále potom deformace květů a vývoj malých
deformovaných lusků. Příčinou snadného šíření je přenos semeny, který byl popsán u tak
celosvětově významných plodin jako je hrách, čočka nebo bob. U náchylných odrůd hrachu se
uvádí přenos semeny až do 30 %, ale byly zaznamenány případy, kdy 90 % komerčního osiva
bylo infikováno. Virus je přirozeně přenosný vektory, a to mšicemi nepersistentním
způsobem. Rezistence je založena recesivně geny sbm-1, sbm-2, sbm-3 a sbm-4, které
odpovídají 4 patotypům PSbMV. Virus PEMV je celosvětově označován za nejnebezpečnější
a ekonomicky nejzávažnější. Viróza je přenosná mšicemi a k přenosu dochází již po krátké
době sání. Mezi typické a nezaměnitelné projevy na rostlinách hrachu, kromě výrůstků je i
mozaika přecházející v typické „dvůrky“. Později vznikají deformace lusků, snižuje se HTS.
Dědičnost rezistence proti viróze PEMV zajišťuje dominantní gen En. Obě virózy mohou
způsobovat významné výnosové ztráty převyšující i 50 – 60 %. Antraknóza hrachu, která je
vyvolávána houbou Ascohyta pisi, způsobuje na produkci značné výnosové ztráty (Dostálová,
2010). Existence vzájemných interakcí mezi jednotlivými druhy antraknóz (Ascocyta pisi,
Mycosphaerella pinodes a Phoma pinodella) a virózami je zatím málo známa. Selekcí
odolných jedinců v podmínkách silného přirozeného infekčního tlaku lze získat cenný
výchozí materiál.
Cílem práce bylo nalezení zdrojů vysoké a kumulované odolnosti proti virózám (PSbMV a
PEMV) a antraknóze (A. pisi). Dále pak zhodnocení přínosu zjištěné odolnosti na výnosové
parametry v polních podmínkách.
Materiál a metody
Polní pokusy - byly hodnoceny registrované odrůdy hrachu ze seznamu doporučených odrůd
(SDO), šlechtitelské linie Agritecu (označených AGT), zdroje rezistence s ověřenými
vlastnostmi – 12 linií B 99/98-118, odrůdy Franklin, Lifter. Napadení rostlin virózami a
175
„Úroda 12/2012, vědecká příloha časopisu“
antraknózou bylo hodnoceno bonitační stupnicí 1–9 (náchylné - odolné). Po sklizni byl zjištěn
výnos semen a proveden rozbor zdravotního stavu napadení semen antraknózou (%).
Kontrolní náchylná odrůda byla Terno. V letech 2010-2012 bylo celkem hodnoceno 34 odrůd
a 100 šlechtitelských linií hrachu.
Laboratorní a skleníkové pokusy- hybridní populace odvozené od zdrojů rezistence k PEMV
(gen En) a PSbMV (gen sbm-1) byly selektovány v laboratorních skleníkových podmínkách.
Selekce bezpříznakových rostlin byla provedena pomocí umělé mechanické inokulace s
virulentními izoláty k PEMV a PSbMV. Jako kontroly byly využity zdroje rezistence a
diferenciační linie. K inokulačním screeningovým testům byl použit izolát 58 UP a nové
izoláty získané v přirozených polních podmínkách.
Molekulární analýzy
Šlechtitelské perspektivní materiály polního hrachu byly otestovány pomocí certifikované
metodiky: Molekulární detekce genu rezistence hrachu k viru mozaiky přenosné semenem PSbMV (Smýkal, 2011). Tato metoda přímé detekce genu rezistence hrachu k
nejrozšířenějšího patotypu P1 PSbMV viru (sbm-1 lokusu, eIF4E genu), plně nahradila
časově náročné a ne zcela spolehlivé symptomatické a biochemické ELISA testování. Postup
je návodem přesné, alelicky specifické detekce eIF4E genu pomocí polymerázové řetězcové
reakce (PCR) s aplikací pro šlechtění hrachu a hodnocení genových zdrojů.
Výsledky a diskuse
Polní pokusy - selekce kmenů, na základě polního pozorování
V polních podmínkách byla provedena selekce na základě pozorování v poli, s cílem vybrat
kmeny bez příznaků enační mozaiky nebo semenem přenosné mozaiky hrachu. Zvýšená
pozornost byla věnována těm kombinacím, ve kterých potomstva měla geny rezistence
ke sledovaným virózám. Vizuální hodnocení zdravotního stavu bylo prováděno průběžně a
vlastní výběry perspektivních kmenů byly prováděny ve dvou termínech: před květem a
ve žluté zralosti. Hodnocením byl zjištěn velmi úzký vztah mezi intenzitou napadení rostlin
virózou a původcem antraknózy (A. pisi). Ztráta odolnosti se prokázala i v inokulačních
testech. Semena rezistentních genotypů hrachu k PEMV byla napadena antraknózou do 3,5 %
ve srovnání s náchylnými genotypy, u kterých napadení dosáhlo 28,5–33,5 %, byla zjištěna
imenší HTS a redukce výnosu oproti rezistentním genotypům. Postupný návrat druhu A. pisi
do pěstitelských ploch hrachu v ČR byl pozorován i v jiných zemích (Mathew et al. 2010,
Gossen et al. 2011, Morral et al. 2007). Ve všech skupinách kombinací byla nalezena, jak
potomstva bez viditelných příznaků, tak i potomstva citlivá a výrazně napadená. Při sklizni
byly vybírány ty kmeny, u kterých byly za vegetace pozorovány a následnými rozbory
zjištěny vhodné hospodářské vlastnosti (ranost, délka lusku, počet semen v lusku).
Z vybraných rostlin, pocházejících z perspektivních potomstev, bude založena kmenová
školka v následujícím roce. Hodnocení registrovaných odrůd je uvedeno v tabulce č. 1.
Z hodnocení odrůd je zřejmé, že žádná komerční odrůda není k virózám odolná, opakovaně
bylo zjištěno, že odrůda Terno je vysoce náchylná jak k PEMV tak k antraknóze.
Tab č. 1: Hodnocení výskytu viróz na registrovaných odrůdách (stupnice 9-1)
Odrůda
Sponsor
Hardy
Terno
Concorde
Prophet
Slovan
Sully
Starter
Velvet
Atlas
Audit
Stupeň napadení
(9-1)
2010
6,5
6,5
6
7
6,5
6,5
7
7
7
7,5
7
Odrůda
Terno
Prophet
Slovan
Sully
Starter
Velvet
Atlas
Audit
Avantgarde
Salamanca
Gambit
Stupeň napadení Stupeň napadení
(9-1)
(9-1)
2011
2012
5
4
6
4
6
6
7
4
7
5
6
6
7
5
6
6
7
6
7
6
6
6
176
„Úroda 12/2012, vědecká příloha časopisu“
V Agritecu byly vyšlechtěny linie polního hrachu, které byly v průběhu minulých let
testovány jak v polních, tak laboratorních podmínkách. V tabulce č. 2 je u vybraného souboru
prezentováno zvýšení odolnosti k virózám a současně i k antraknóze. U napadených rostlin
hrachu virózami lze očekávat ztrátu rezistence k antraknóze. Lze předpokládat potlačení nebo
úplnou ztrátu schopnosti tvorby obraných imunitních látek – pisatinu. (Lepoivre, 1979). Bylo
potvrzeno, že v přírodních podmínkách se virózy i antraknozy vyskytují vždy v komplexu
velkého množství rozdílných kmenů, patotypů a ras, lišících se ve virulenci a v řadě dalších
vlastností (Nelson 1973, Kvíčala 1974,1977). Nejodolnější proti komplexu viróz a a
antraknóz byly linie, kde byly ke křížení využity odrůdy s kumulovanými geny rezistence
(Franklin, Lifter a linie B99/98-118). Nejvyšší odolnost byla zjištěna u linií AGT 210.23,
AGT 212.25 a AGT 212.18. Bylo prokázáno i malé procentické napadení semen antraknózou.
Tab. č. 2: Hodnocení napadení linií virózami, antraknózou, % napadení sklizených
semen a vliv na výnos
AGT 209.4
AGT210.23
AGT210.20
AGT209.10
AGT210.2
AGT211.34
AGT211.4
AGT212.1
AGT212.22
AGT212.25
AGT212.10
AGT212.18
Terno
virózy
(9-1)
7
8,5
8
7
7
4
7
8
8
8,5
8
8
4
antraknózy
(9-1)
8
8
7
6
7
4
6
7
8
8
7
8
5
% napadení semen
antraknózou
2
0,5
3
3,5
2,5
33,5
2,5
2
1,5
0,8
2,2
0,8
28,5
2
výnos (g/10m )
4360
3590
4280
4553
4553
2865
3920
3480
4460
4080
3940
4280
3000
Laboratorní a skleníkové pokusy
V roce 2010-2012 byly otestovány šlechtitelské perspektivní materiály polního hrachu a
dřeňového hrachu, pomocí umělé mechanické inokulace s virulentními izoláty k PEMV a
PSbM. Ve skleníku byly postupně vysety linie AGT (F6-F8) odvozené od ověřených zdrojů
rezistence a kontrolní citlivá a rezistentní odrůda (Terno-S, Franklin-R). Na vyseté rostliny
hrachu bylo aplikováno inokulum 58 UP.V tabulce č. 3 je uveden seznam a výsledky
testování k PEMV a PSbMV z r. 2011. S využitím metody PCR-eIF4E byl současně proveden
screening kmenů a linií AGT na ověření rezistence k PSbMV. Na základě jeho výsledků bylo
možno rozhodnout o tom, zda osivo bylo sklizeno z rostliny rezistentní k P1 PSbMV, zda
původní rostlina byla recesivní homozygot (sbm-1/sbm-1) a zda je její potomstvo vhodné pro
vytvoření čisté rezistentní linie. Kmeny a linie uvedené v tabulce č. 3 prokázaly spolehlivě
rezistenci k P1 PSbMV. Tímto postupem bylo analyzováno přibližně 800 vzorků hrachu
(semen, rostlin) F2 až F8 generací šlechtitelského materiálu.
177
„Úroda 12/2012, vědecká příloha časopisu“
Tab.č. 3 Screeningové laboratorní testy na odolnost k virovým patogenům (PEMV,
PSbMV)
Kmeny AGT a kontrola (S)
Terno
1 AGT 209.27 RKY x Franklin
2 Sponsor x B99-118
3 Sponsor x B99-118
4 AGT 206.22 x B99-116
5 RKY x B99-118
6 RKY x B99-118
7 Lu 1977 x Franklin
8 Bilbo x Franklin
9 Bilbo x Franklin
10 Panna x B99-116
11 Komet x B99-116
12 RKY x B99-118
13 Sponsor x B99-118
14 Lu 1977 x Franklin
15 RKY x B99-118
16 RKY x B99-118
17 AGT 209.4
18 Sponsor x B99-118
19 AGT 209.24
20 AGT 209.24
Terno
PSbMV
S
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
S
PEMV
S
R/S
R
R
R
R
R
R/S
S
S
R/S
S
S
R/S
R/S
R/S
R/S
R/S
R/S
R
R
S
Kmeny
Terno
5004 x B99-116
Faktor x B99-118
Faktor x B99-118
RKY x B99-118
AGT210.8
AGT210.23
AGT209.4
5004 x B99-116
RKY x B99-118
LU 1977 x Franklin
Franklin Luy x Lifter
AGT209.1
LU 1977 x Franklin
LU 1977 x Franklin
LU 1977 Lifter
Kamelot x Franklin
Catania x B99-112
AGT206.22 x B99-116
LU 1977 x Franklin
Franklin Luy x Lifter
Terno
PSbMV
S
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
S
PEMV
S
R/S
R
R
R
R
R
R/S
R/S
R/S
R/S
R/S
R/S
R/S
R/S
R/S
R/S
R/S
R/S
R
R
S
Kmeny
Terno
LU 1977 x Franklin
LU 1977 x Franklin
LU 1977 x Franklin
LU 1977 x Franklin
LU 1977 x Franklin
LU 1977 x Franklin
Kamelot x Franklin
AGT209.1
AGT209.27
Bilbo x Franklin
LU 1977 x Franklin
Catania x B99-112
AGT209.4
LU 1977 x Franklin
Franklin Luy x Lifter
Sponzor x B99-118
LU 1977 x Lifter
AGT211.6
AGT211.7
AGT211.21
Terno
PSbMV
S
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
R
PEMV
S
R/S
R/S
R/S
R
R
R
R/S
R/S
R/S
R/S
R
R
R/S
R/S
R/S
R/S
R/S
R/S
R
R
S
Závěr
Získání odolných kmenů a realizaci selekce odolných bezpříznakových jedinců proti viróze
(PEMV a PSbMV) a antraknóze (A. pisi) umožnil silný infekční tlak viróz v letech 20102012. Spolehlivé selekční metody umožnily vytvoření rezistentních linií, které budou využity
pro
šlechtění
nových
odrůd
hrachu.
Tato práce byla finančně podpořena projektem č. RO 0111 a projektem NAZV
QI91A229.
Použitá literatura
Dostálová R., Ondřej M.: Hodnocení rezistence hrachu proti virózám a antraknóze. In Vliv
abiotických a biotických stresorů_na vlastnosti rostlin 2010. ISBN: 978-80-213-2048-2, p.
168-172
Gossen B. D., Hwang S. F., Conner R. L., and Chang K. F. (2011). Managing the Ascochyta
blight complex on field pea in western Canada, Prairie Soils and Crop Journal, Vol. 4:
135–141
Kvíčala B. 1974 Poznatky o šlechtěné na rezistenci proti některým virům hrachu. Ochrana
rostlin 10:239 –243
Lepoivre P. 1979: Protection de Pisum sativum coutre l´infection par Ascochyta pinodes par
préinoculation avec A.pisi or A. pinodella. Parasitica35:73-78
Mathew F. M., Goswami R. S., and Markell S. G. (2010) First Report of Ascochyta Blight of
Field Pea Caused by Ascochyta pisi in South Dakota. Plant Disease, Vol. 94, No. 6: 789
Morral R. A. A., Carriere B., Erns B., Pearse C., Schmeling D., Thomson I. (2007) Seedborne pathogens of pea in Sasktchewan in 2006. Can. Plant. Dis. Surv., No. 87: 125–126
Nelson R. R. (1973): Breeding plants for disiase resistance. Concepts and aplications. The
pennsylvania State Univ. Press. 401 pp.
Smýkal P. (2011): Molekulární detekce genu rezistence hrachu k viru mozaiky přenosné
semenem (PSbMV). Vydal Agritec Plant Research s.r.o. v nakladatelství AGRITEC,
výzkum, šlechtění a služby, s.r.o. Šumperk. ISBN: 978-80-87360-08-8
Kontaktní adresa:
Ing. Radmila Dostálová
Agritec Plant Research, s.r.o., Zemědělská 16, 787 01 Šumperk
[email protected]
178
„Úroda 12/2012, vědecká příloha časopisu“
VYUŽITÍ PCR METODY PŘI IDENTIFIKACI HOUBOVÝCH
PATOGENŮ RODU FUSARIUM VYSKYTUJÍCÍCH SE
NA TRVALÝCH TRAVNÍCH POROSTECH
Use of PCR method for identification of fungal genus Fusarium occurring
on permanent grassland
Cholastová T.1, Hujslová M.2
1
2
Zemědělský výzkum, s.r.o. Troubsko
Výzkumný ústav rostlinné výroby, v.v.i.
Abstrakt
Rod Fusarium je celosvětově rozšířený rod vyskytující se ve všech klimatických pásmech a napadající
nejrůznější druhy rostlin. Pro kontrolu zdravotního stavu rostlin, šlechtění na rezistenci a pro různé
epidemiologické studie je rychlá a spolehlivá diagnostika takřka nepostradatelná. Zásadní průlom
v diagnostice patogenních mikroorganismů nastal po zavedení moderních molekulárně genetických
metod orientovaných na analýzu genomové DNA. Pro detekci hub rodu Fusarium izolovaných z
rostlinného materiálu trvalých travních porostů byla použita specifická PCR amplifikace využívající
primery, které pro druhy Fusarium avenaceum, F. culmorum, F. graminearum a F. poae navrhli autoři
Lees (1995), Schilling et al. (1996), Nicholson et al. (nepublikováno) a Parry et Nicholson (1996).
Klíčová slova: Fusarium spp., PCR, patogen-specifické primery, trvalé travní porosty
Abstract
The genus Fusarium is a worldwide genus occurring in all climate zones and affecting various plant
species. To check the health of plants, breeding for resistance and for epidemiological studies is a
rapid and reliable diagnosis almost indispensable. Major breakthrough in the diagnosis of pathogenic
microorganisms occurred after the introduction of modern molecular genetic methods based on the
analysis of genomic DNA. For Fusarium spp. detection, isolated from plant material of permanent
grassland, the specific PCR with primers designed for Fusarium avenaceum, F. culmorum, F.
graminearum and F. poae by Lees (1995), Schilling et al. (1996), Nicholson et al. (unpublished
observations) and Parry et Nicholson (1996) was used.
Key words: Fusarium spp., PCR, pathogen-specific primers, permanent grassland
Úvod
Trvalé travní porosty (TTP) zaujímají v České republice přes 23 % výměry zemědělské půdy.
Je to zhruba 970tis. ha, z toho je asi 800tis. ha využívaných pro produkci píce. Už sama tato
čísla napovídají, že jde o významnou součást agroekosystému.
Kvetoucí luční porosty s převahou trav jsou nejen zdrojem pylu (z alergologického hlediska),
ale mohou se stát také zdrojem fuzarióz s nekontrolovatelným únikem do okolního prostředí.
Řada lučních trav je napadána tzv. parazitární běloklasostí, přenášenou hmyzem a roztoči.
Předpokladá se však, že prvotní příčinou tohoto onemocnění je Fusarium poae (Soroka,
2005). V rámci sledování kvality a bezpečnosti krmiva je důležité monitorovat výskyt
fuzarióz s toxinogenním účinkem.
Určení druhu na základě morfologie je mnohdy neúspěšné, protože morfologické a
fyziologické charakteristiky jednotlivých druhů jsou velmi podobné a druhy se příliš neliší ani
svými projevy po napadení hostitele. Navíc situaci ztěžuje geografické rozšíření druhů,
protože se často na jednom území vyskytuje současně více než jeden druh rodu Fusarium.
Klasické mikrobiologické kultivační metody jsou navíc poměrně časově náročné a do jisté
míry subjektivní. V současné době je však potřeba rychlá a jednoznačná detekce patogena. To
všechno jsou důvody pro používání moderních molekulárně biologických metod pro
identifikaci a detekci Fusarium spp. Jednou z nich je polymerázová řetězová reakce s
179
„Úroda 12/2012, vědecká příloha časopisu“
použitím specifických primerů. Genetické studie na základě PCR prováděl u rodu Fusarium
spp. například Schilling et al. (1996), který odlišil F. culmorum a F. graminearum. Detekci
rodu Fusarium spp. pomocí polymerázové řetězové reakce uvádí také Lees (1995), Turner et
al. (1998), Doohan et al. (1998) a Arif et al. (2012).
Cílem řešení byla molekulární identifikace patogenů Fusarium avenaceum, F. culmorum, F.
graminearum a F. poae izolovaných z rostlinného materiálu trvalých travních porostů
prostřednictvím polymerázové řetězové reakce s využitím patogen-specifických primerů.
Materiál a metody
Biologický materiál. Testovaný soubor byl tvořen rostlinným materiálem trvalých travních
porostů. Vzorky houbových izolátů pro PCR analýzu byly získány ze směsných vzorků, které
byly vytvořeny smícháním 4 směsí (A technická směs – lipnice luční, kostřava červená, jílek
vytrvalý, psineček tenký; B technická směs s jetelem – lipnice luční, kostřava červená, jetel
plazivý; C pícní směs – kostřava luční, lipnice bahenní, srha laločnatá, bojínek luční; D pícní
směs s jetelem – festulolium, kostřava luční, jetel luční)
Samotná izolace izolátů hub rodu Fusarium spp. probíhala standardními mykologickými
postupy. Byly připraveny monosporické izoláty, které byly následně předány k izolacím DNA
a PCR analýzám.
Jako standardy byly použity izoláty Fusarium avenaceum CCM 8015, Fusarium culmorum
CCM F-553, Fusarium graminearum CCM 8244 a Fusarium poae CCM F-169 získané
z České sbírky mikroorganismů Masarykovy univerzity v Brně.
Izolace DNA. Genomová DNA byla izolována z nárůstu mycélia z monosporických izolátů
hub pomocí komerčně dostupného kitu DNeasy® Plant Mini Kit (Qiagen, Německo). Kvalita
DNA byla testována elektroforeticky.
PCR amplifikace a agarózová gelová elektroforéza. Amplifikační reakce byly prováděny
v objemu 25µl. Amplifikační reakce pro F. culmorum a F. avenaceum obsahovala 0,5U
DyNAzyme II DNA polymerázy (Finnzymes, Finsko), 10mM Tris-HCl (pH 8.8), 1,5mM
MgCl2, 50mM KCl a 0,1% Triton®X-100 (DyNAzyme II DNA polymerase 10x Buffer,
Finnzymes, Finsko), 0,2mM dNTP (TaKaRa, Japonsko), 1µM oba primery (Metabion,
Německo) a přibližně 50-100mg houbové DNA. Amplifikační směs pro F. graminearum a F.
poae byla podobná s výjimkou 0,4mM dNTP (TaKaRa, Japonsko) a 0,4µM primerů
(Metabion, Německo).
Pro identifikaci patogenů byly použity následující dvojice primerů, které použili níže citovaní
autoři: F. avenaceum (AF/AR: CAAGCATTGTCGCCACTCTC/GTTTGGCTCTACCGGGA
CTG,
Lees,
1995),
F. culmorum
(OPT18F470/OPT18R470:
GATGCCAGACCAAGACGAAG/GATGCCAGACGCACTAAGAT, Schilling et al., 1996),
F. graminearum (Fg11F/R: CTCCGGATATGTTGCGTCAA/GGTAGGTATCCGACATGG
CAA,
Nicholson
et
al.,
nepublikováno)
a
F.
poae
(Fp82F/R:
CAAGCAAACAGGCTCTTCACC/TGTTCCACCTCAGTGACAGGTT, Parry et Nicholson,
1996). K amplifikaci houbové DNA byl použit teplotní a časový profil, který se měnil
v závislosti na specificitě primerů. Použitím F. avenaceum specifických primerů byl
termocykler naprogramován na 40 cyklů (95°C-30s, 60°C-30s a 72°C 40s). Program pro F.
graminearum a F. poae specifické primery byl podobný s výjimkou annealingové teploty,
která byla upravena na 62°C. Použitím F. culmorum specifických primerů byl termocykler
naprogramován na 30 cyklů (94°C-1min., 55°C-1min. a 72°C 2min.). V závěrečném cyklu
každého programu byl poslední krok prodloužen na 5min., aby byly dosyntetizovány
chybějící úseky fragmentů.
Produkty amplifikace byly separovány na horizontální elektroforéze HE 99X (Hoefer, USA) v
1,5% agarózovém gelu při konstantním napětí 120V po dobu 80 minut.
180
„Úroda 12/2012, vědecká příloha časopisu“
Výsledky a diskuze
Z biologického materiálu byla vyizolována vysokomolekulární DNA s kvalitou vhodnou pro
následnou amplifikaci.
Pomocí F. avenaceum specifických primerů AF/AR byly amplifikovány produkty o délce
920bp (obr. 1), primer Fp82F/R specifický pro detekci F. poae amplifikoval fragment o
velikosti 220bp (obr. 2), produkt amplifikovaný F. culmorum specifickým primerem
OPT18F470/OPT18R470 měl velikost 472bp (obr. 3) a s využitím primerové kombinace
Fg11F/R byla velikost amplifikovaného produktu detekujícího F. graminearum 400bp (obr.
4). Tyto velikosti PCR markerů uvádí též Doohan et al. (1998) a Schilling et al. (1996). YliMattila et al. (2004) uvádí pro F. graminearum 400bp velikost specifického fragmentu, která
byla potvrzena i v této práci.
Obrázek 2: Elektroforeogram PCR produktů při
použití primerů Fp82F/R pro detekci Fusarium
poae
Obrázek 1: Elektroforeogram PCR produktů při použití
primerů AF/AR pro detekci Fusarium avenaceum
M 1
2 3
4
5 6 7
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M
8 9 10 11 12 13 14
M= 100bp-1,5kb DNA Ladder (Bio Basic Inc.)
1 – pozitivní kontrola F. avenaceum
2 – negativní kontrola
3, 4, 6, 7, 10, 13 a 14 – pozitivní nález F. avenaceum
(ZH1, P, ZH2)
5, 8, 9, 11 a 12 – negativní nález F. avenaceum
(SP1, M)
M= 100bp-1,5kb DNA Ladder (Bio Basic Inc.)
1 – pozitivní kontrola F. poae
2 – negativní kontrola
3, 4, 5, 6, 8, 9, 12, 13 – pozitivní nález F. poae
(ZH2, M)
7, 10, 11 a 14 – negativní nález F. poae
(ZH1, P, SP1)
Obrázek 4: Elektroforeogram PCR produktů při
použití primerů Fg11F/R pro detekci Fusarium
graminearum
Obrázek 3: Elektroforeogram PCR produktů při použití
primerů OPT18F470/OPT18R470 pro detekci Fusarium
culmorum
M
1
2
3
4
5
6
7
M
1
2
3
4
5
6
7
8
M= 100bp-1,5kb DNA Ladder (Bio Basic Inc.)
1, 2 – pozitivní kontrola F. culmorum
3 – pozitivní nález F. culmorum (ZH2)
4 – 7 – negativní nález F. culmorum (ZH1, P, SP1, M)
8 – negativní kontrola
M= 100bp-1,5kb DNA Ladder (Bio Basic Inc.)
1 – pozitivní kontrola F. graminearum
2 – 6 – negativní nález F. graminearum
(ZH1, ZH2, P, SP1, M)
7 – negativní kontrola
Pro detekci napadení byly použity primery, které navrhli Lees (1995), Schilling et al. (1996) a
Nicholson et al. (nepublikováno), Parry et Nicholson (1996). Přítomnost patogena v
rostlinném vzorku je indikována amplifikací specifického DNA fragmentu typického pro
daný patogen.
Závěr
181
„Úroda 12/2012, vědecká příloha časopisu“
Korektní identifikace patogenů je důležitá pro kontrolu zdravotního stavu rostlin, šlechtění na
rezistenci a pro různé epidemiologické studie. Z těchto důvodů je proto přesná diagnostika
takřka nepostradatelná. Taktéž následný výzkum chování patogenu musí být založen na
správné identifikaci druhu. Variabilita druhů rodu Fusarium je velmi vysoká a identifikace
těchto hub je mimořádně náročná na dodržování postupů dle zvoleného klíče. Je proto často
výhodné používat molekulárně biologické metody (např. PCR a její modifikace, dot blot
hybridizace, sekvenování, microarray aj.).
V tomto příspěvku jsou prezentovány výsledky molekulárně genetické detekce izolátů F.
avenaceum, F. culmorum, F. graminearum a F. poae získaných z rostlinného materiálu
trvalých travních porostů v podmínkách Laboratoře molekulární biologie a genetiky VÚP s.r.o.
v Troubsku.
Dedikace
Výsledky byly získány za finanční podpory Mze ČR NAZV při řešení výzkumného projektu
č. QI111C016 a za částečné institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace.
Použitá literatura
Arif M., Chawla S., Zaidi N. W., Rayar J. K., Variar M., Singh U. S. (2012): Development of
specific primers for genus Fusarium and F. solani using rDNA sub-unit and transcription
elongation factor (TEF-1a) gene. African Journal of Biotechnology, 11 (2): 444 – 457.
Doohan F. M., Parry D. W., Jenkinson P., Nicholson P. (1998): The use of species-specific
PCR-based assays to analyse Fusarium ear blight of wheat. Plant Pathology 47: 197 – 205.
Lees A. K. (1995): Diagnosis and Control of Foot Rot Pathogens of Wheat. Buckinghamshire,
UK: Open University, Ph.D. thesis.
Nicholson et al. (nepublikováno) - In.: Doohan F. M., Parry D. W., Jenkinson P., Nicholson
P. (1998): The use of species-specific PCR-based assays to analyse Fusarium ear blight of
wheat. Plant Pathology 47: 197 – 205.
Parry D. W., Nicholson P. (1996): Development of a PCR assay to detect Fusarium poae in
wheat. Plant Pathology 45: 383 – 91.
Schilling A. G., Möller E. M., Geiger H. H. (1996): Polymerase chain reaction – based assays
for specific detection of Fusarium culmorum, F. graminearum and F. avenaceum.
Phytophatology 86: 515 – 522.
Soroka J. J., Gossen B. D. (2005): Phytophagous arthropods and silvertrop levels associated
with post harvest residue treatments in three turfgrass species grown for seed. Canadian
Journal of Plant Science 56: 213 – 224.
Turner A. S., Lees A. K., Rezanoor H. N., Nicholson P. (1998): Refinement of PCR –
detection of Fusarium avenaceum and evidence from DNA marker studies for phenetic
relatedness to Fusarium tricinctum. Plant Pathology 47: 278 – 288.
Yli-Mattila T., Paavanen-Huhtala S., Parikka P., Konstantinova P., Gagkaeva T. Y. (2004):
Molecular and morphological diversity of Fusarium species in Finland and north-western
Russia. European Journal of Plant Pathology 110: 573 – 585.
Kontaktní adresa:
Cholastová Tereza, Mgr.
Zemědělský výzkum, spol. s r.o., Zahradní 1, Troubsko
[email protected]
182
„Úroda 12/2012, vědecká příloha časopisu“
KLÍČIVOST KONIDIÍ COLLETOTRICHUM ACUTATUM PO APLIKACI
ÚČINNÝCH LÁTEK VYBRANÝCH FUNGICIDŮ
Conidial germination of Colletotrichum acutatum after application of active
ingredients of selected fungicides
Jílková B.1, Víchová J.1, Pokorný R.1, Vejražka K.2
1
2
Mendelova univerzita v Brně
Zemědělský výzkum, spol. s r.o., Troubsko
Abstrakt
V laboratorních in vitro testech byla zkoušena klíčivost konidií Colletotrichum acutatum po aplikaci
účinných látek vybraných fungicidů. K testům bylo použito šest izolátů C. acutatum z různých plodin.
Byla zjištěna rozdílná citlivost izolátů C. acutatum k fungicidním přípravkům obsahujícím různé
účinné látky. Žádný z hodnocených izolátů nebyl k vybraným fungicidním přípravkům tolerantní.
Výraznější rozdíly mezi jednotlivými izoláty byly zaznamenány po aplikaci fungicidních přípravků
s ú. l. azoxystrobin a metiram. U fungicidního přípravku s ú. l. azoxystrobin bylo nejvyššího
inhibičního účinku dosaženo u izolátu 1109 za světlice, zatímco nejnižší inhibice byla prokázána u
izolátu PCF 437 z lupiny. Nejnižší klíčivost konidií u fungicidního přípravku s ú. l. metiram byla
stanovena u izolátu 1209 ze světlice, naopak nejvyšší klíčivost měl izolát 710 z třezalky.
Nejvyšší účinek na klíčivost konidií byl prokázán u ú. l. captan (98,53–100 %),
folpet (99,2–100 %) a mancozeb (99,8–100 %).
Klíčová slova: Colletotrichum acutatum, konidie, fungicidy, účinnost
Abstract
Conidial germination of Colletotrichum acutatum was tested after application of selected fungicides
with different active ingredients in laboratory in vitro test. Six isolates of C. acutatum, which
originated from various host plants, were used. Different sensitivity of the pathogen's isolates was
found to effect of the fungicides. None of the evaluated isolates was tolerant to fungicides. Significant
differences between the isolates were observed after application of fungicides with a. i. azoxystrobin
and a. i. metiram. The highest inhibitory effect of fungicide with a. i. azoxystrobin was achieved in
isolate 1109 from safflower, while the lowest inhibition was found in isolates PCF 437 from lupine.
The lowest germination of conidia was established in isolate 1209 from safflower in fungicide with a.
i. metiram, while the highest germination was found in isolate 710 from Hypericum perforatum. The
highest inhibitory effect was observed in fungicides with a. i. captan (98.53–100%),
folpet (99.2–100%) and mancozeb (99.8–100%).
Keywords: Colletotrichum acutatum, conidium, fungicides, efficacy
Úvod
Patogen Colletotrichum acutatum, J. H. Simmonds 1968, patří mezi polyfágní houbové
patogeny rozšířené v mnoha zemích na všech kontinentech. Způsobuje značné ekonomické
škody na kulturních plodinách – především však na rostlinách a plodech jahodníku. V České
republice byl v roce 2005 laboratorně potvrzen výskyt tohoto patogena na jahodníku, třešni a
lupině. Ve stejném roce byly v okrese Brno-venkov poprvé zaznamenány příznaky napadení
patogenem C. acutatum na rostlinách světlice barvířské (Víchová et al., 2011). Patogen se
zpočátku vyskytoval ohniskově, později se za vhodných podmínek rozšířil do celého porostu.
V roce 2010 byly odebrány vzorky patogena C. acutatum z napadených plodů rajčete (okres
Brno-venkov) a napadených plodů jabloně v okresech Brno-venkov a Znojmo (Víchová et al.
2012). Staňková et al. (2011) zjistili, že izoláty tohoto patogena z různých plodin jsou
schopny infikovat různé hostitelské druhy rostlin.
183
„Úroda 12/2012, vědecká příloha časopisu“
Jednou z možností ochrany plodin vůči patogenu je použití fungicidních přípravků. V ČR je
registrován pouze jediný fungicid proti C. acutatum – Ortiva (ú.l. azoxystrobin) do jahodníku.
Cílem práce bylo stanovit vliv vybraných účinných látek fungicidních přípravků na klíčení
konidií C. acutatum.
Materiál a metody
Pro testování bylo použito sedm různých jednosložkových fungicidních přípravků
(Tab. 1). Schopnost klíčení konidií byla testována v laboratorních podmínkách na šesti
monosporických izolátech C. acutatum z různých rostlinných hostitelů: CBS 786.86 (Malus
domestica Borkh.), PCF 231 (Fragaria × ananassa Duch.), PCF 437 (Lupinus alba L.), 710
(Hypericum perforatum L.), 1109 a 1209 (Carthamus tinctorius L).
Metodika vycházela z postupu Kloutvorové a Kupkové (2009) a byla upravena dle aktuálních
podmínek. Fungicidní přípravky byly rozpuštěny či smíchány s Potato Dextrose Broth (PDB),
přičemž byla připravena o 100 % vyšší koncentrace než koncentrace základní. Z oranžových
mas konidií jednotlivých izolátů bylo laboratorní kličkou odebráno takové množství, aby při
zvětšení 400× mikroskopu Olympus CX41 bylo v zorném poli vidět 25–35 konidií. V PDB
byla připravena suspenze jednotlivých izolátů. Do každé jamky mikroskopického sklíčka se
třemi jamkami bylo napipetováno 10 μl fungicidního přípravku a 10 μl suspenze s konidiemi,
aby výsledná koncentrace fungicidního přípravku dosahovala koncentrace základní. Každá
jamka byla hodnocena jako jedno opakování. Mikroskopické sklíčko s jednou jamkou bylo
považováno za kontrolní a do jamky bylo napipetováno 10 μl PDB a 10 μl suspenze s
konidiemi. Mikroskopická sklíčka byla umístěna jednotlivě do sterilních Petriho misek o
průměru 10 cm, na jejichž dně byl položen filtrační papír dostatečně nasycený sterilní
destilovanou
vodou,
aby
se
předešlo
vyschnutí
pokusného
materiálu.
Misky byly kultivovány při optimální teplotě pro růst a sporulaci 25 ± 2 °C. Po 48 h od
založení pokusu bylo při zvětšení 400× mikroskopu Olympus CX41 počítáno v náhodně
vybraném zorném poli množství klíčících konidií v celkovém souboru 150 konidií.
Výsledky byly statisticky zpracovány jednofaktorovou ANOVA (faktor izolát) programem
UPAV. Hladina významnosti byla stanovena na α=0,05.
Výsledky a diskuse
Všechny hodnocené účinné látky fungicidních přípravků prokázaly inhibiční vliv
na klíčení konidií patogena (Tab. 2). Rozdíly v klíčivosti konidií izolátů nebyly zjištěny u
fungicidních přípravků s ú. l. dithianon, folpet a mancozeb. Výraznější rozdíly mezi
jednotlivými izoláty byly zaznamenány u fungicidních přípravků s ú. l. azoxystrobin a
metiram. U fungicidního přípravku s ú. l. azoxystrobin bylo nejvyššího inhibičního účinku
dosaženo u izolátu 1109 (42,07% inhibice), zatímco nejnižší 22,97% inhibice byla prokázána
u izolátu PCF 437. Nejnižší klíčivost konidií u fungicidního přípravku s ú. l. metiram byla
stanovena u izolátu 1209 (76,73% inhibice), naopak nejvyšší klíčivost měl izolát 710 (16,9%
inhibice).
Celkově nejnižší inhibiční účinek byl zaznamenán u již zmiňovaných fungicidních přípravků
s ú. l. azoxystrobin a metiram. Zjištění nízké inhibice ú. l. azoxystrobin bylo překvapivé a byl
zde objeven rozpor se studovanou literaturou. Podle etikety totiž tento použitý fungicidní
přípravek působí preventivně proti klíčení konidií a měl by být aplikován v časných fázích
vývoje choroby (Anonym, 2012). Dobrý inhibiční účinek ú. l. azoxystrobin navíc potvrdily i
Kloutvorová a Kupková (2009) ve svých testech klíčivosti konidií C. acutatum. U ostatních
účinných látek fungicidních příravků použitých při našem testování se inhibice pohybovala
v rozmezí 95,7–100 %. Nejvyšší fungicidní účinek byl prokázán u ú. l. captan (98,53–100 %),
folpet (99,2–100 %) a mancozeb (99,8–100 %). Kloutvorová a Kupková (2009) rovněž
zaznamenaly úplné potlačení klíčivosti konidií u ú. l. captan, ale i u ú. l. thiram.
184
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
V laboratorním testu zaměřeného na klíčení konidií byla zjištěna rozdílná citlivost izolátů
houbového patogena C. acutatum k fungicidním přípravkům obsahujícím různé účinné látky.
Žádný z hodnocených izolátů nebyl tolerantní k vybraným účinným látkám fungicidních
přípravků.
Laboratorní testy lze využít pouze pro předběžná zjištění, účinnost musí být vždy ověřena
v polních testech. Při tomto testování je vhodné provádět umělé inokulace více izoláty
příslušného patogena, aby se předešlo riziku snížené účinnosti fungicidního přípravku vlivem
výskytu odolnější populace patogena.
Dedikace
Příspěvek byl zpracován s podporou NAZV MZe ČR č. QH81029 "Inovace ochrany světlice
barvířské (Carthamus tinctorius L.) proti významným houbovým patogenům".
Použitá literatura
Anonym: Ortiva. Přípravek na ochranu rostlin. Etiketa, Syngenta. [cit. 2012-01-18].
Dostupné na: http://www.agromanual.cz/download/pdf_etiketa/e_ortiva.pdf.
Kloutvorová, J., Kupková, J. 2009. Laboratorní testy citlivosti houby Colletotrichum
acutatum k fungicidům. Vědecká práce ovocnářská. sv. 21 s. 47–52.
Staňková, B., Víchová, J., Pokorný, R. 2011. Virulence of Colletotrichum acutatum isolates
to several host plants. Acta Universitatis Agriculturae et Silviculturae Mendelianae
Brunensis. sv. LIX, č. 3, s. 161–169. ISSN 1211-8516.
Víchová, J., Staňková, B., Pokorný, R. 2012. First Report of Colletotrichum acutatum on
Tomato and Apple Fruits in Czech Republic. Plant Disease. sv. 96, č. 5, s. 769–770. ISSN
0191-2917.
Víchová, J., Vejražka, K., Cholastová, T., Pokorný, R., Hrudová, E. 2011. Colletotrichum
simmondsii Causing Anthracnose on Safflower in the Czech Republic. Plant Disease..
sv. 95, č. 1, s. 79. ISSN 0191-2917.
185
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 1 Účinné látky fungicidních přípravků použité při testování
Základní
koncentrace
Mechanismus působení
(%)
0,40
systemické, translaminární vlastnosti, zastavuje transport
elektronů při dýchání mitochondrií
1,50
kontaktní, multi-side inhibitor, inhibuje růst mycelia,
sporulaci a respiraci
0,10
kontaktní, ovlivňuje širokou škálu enzymů, zasahuje do
buněčného dýchání hub
0,40
kontaktní, inhibuje respiraci a klíčení spor
0,40
kontaktní, inhibuje klíčení spor
0,45
kontaktní
0,40
kontaktní s vícebodovým účinkem, zasahuje do procesu
dýchání hub
Účinná látka
azoxystrobin (25%)
captan (50%)
dithianon (70%)
folpet (80%)
mancozeb (80%)
metiram (70%)
thiram (80%)
Tab. 2 Inhibice klíčivosti konidií izolátů u jednotlivých účinných látek fungicidních
přípravků v %
Účinná látka
dithianon folpet
mancozeb metiram
thiram
Izolát
CBS
786.86
azoxystrobin captan
28,37
AB
100,00
A
100,00 A
100,00 A
99,80
A
55,03
AB
96,40
PCF 231
25,63
AB
100,00
A
100,00 A
100,00 A
99,83
A
61,84
A
100,00 A
PCF 437
22,97
B
100,00
A
98,43
A
100,00 A
100,00
A
20,13
C
100,00 A
710
36,10
AB
98,53
B
96,77
A
99,20
A
100,00
A
16,90
C
95,70
B
1109
42,07
A
100,00
A
97,87
A
100,00 A
99,87
A
29,37
BC
96,60
AB
1209
29,27
AB
100,00
A
96,50
A
100,00 A
100,00
76,73
A
100,00 A
A
Statisticky průkazné rozdíly při hladině významnosti α = 0,05 jsou označeny rozdílnými velkými písmeny
Kontaktní adresa:
Ing. Jana Víchová, Ph.D.
Mendelova univerzita v Brně
Agronomická fakulta
Zemědělská 1, 613 00 Brno
[email protected]
186
B
„Úroda 12/2012, vědecká příloha časopisu“
DRUHOVÉ SPEKTRUM PLEVELŮ V MÁKU SETÉM
Spectrum of weed species in Papaver somniferum
Jonášová K., Horák O.
Ústav agrosystémů a bioklimatologie, AF, Mendelova univerzita v Brně
Abstrakt
Cílem této práce bylo posoudit aktuální zaplevelení porostu máku setého v provozních podmínkách
Zemědělského družstva Olbramkostel a společnosti PODYJÍ, a.s., v Horním Břečkově. Intenzita
zaplevelení byla zkoumána s použitím metody počítání na ploše 1 m² v patnácti (Olbramkostel 27,74
ha) a padesáti (Horní Břečkov 100,96 ha) opakování. Hodnocení v máku setém bylo provedeno
v dubnu, červnu a srpnu. Mák setý byl zaplevelen na obou lokalitách těmito plevely:
Tripleurospermum inodorum, Fallopia convolvulus, Elytrigia repens, Polygonum aviculare, Viola
arvensis. Výsledky vyhodnocení zaplevelení byly zpracovány analýzou DCA. Kanonickou
korespondenční analýzou (CCA) bylo zjištěno, že na porost máku v Horním Břečkově jsou vázány
tyto plevele: Sinapis alba, Papaver rhoeas, Cirsium arvense, Fumaria officinalis. Na porost máku
v Olbramkostele jsou vázány tyto plevele: Avena fatua, Thlaspi arvense, Persicaria lapathifolia,
Brassica napus var. napus, Descurainia sophia.
Klíčová slova: plevele, mák setý, druhová diverzita
Abstract
The aim of this thesis to evaluace current weed infestation of Papaver somniferum in field conditions
of agricultural enterprise in Olbramkostel (27,74 ha) and Horní Břečkov (100,96 ha). Observed fields
are located in South Moravia region in dry and warm climatic region. Intensity of weed infestation
was carried out in chosen fields using counting method on area of 1 m² in 15 and 50 replications.
Evaluation in Papaver somniferum was done on April, June and August. The obtained results were
analysed using Canonical Correspondence Analysis. Both these fields were weed infestation of
species: Tripleurospermum inodorum, Fallopia convolvulus, Polygonum aviculare, Viola arvensis.
The fields in the Horní Břečkov are bound by the following species: Sinapis alba, Papaver rhoeas,
Cirsium arvense, Fumaria officinalis. The fields in the Olbramkostele are bound by the following
species: Avena fatua, Thlaspi arvense, Persicaria lapathifolia, Brassica napus var. napus, Descurainia
sophia.
Key words: weeds, poppy, species diversity
Úvod
Mák setý má vůči plevelům jen malou konkurenční schopnost, proto je zaplevelení kritickým
bodem velkovýrobní pěstitelské technologie (Baranyk et al., 2010). Hlavní ochrana proti
plevelům by měla začít již v předplodinách, v nichž je ochrana snazší. Mák je totiž proti
herbicidům méně odolný. O to pečlivější a přesnější musí být aplikace herbicidů v máku
z hlediska jejich koncentrace a přesné aplikace (Bechyně, 1998).
Materiál a metody
Stanovení zaplevelení probíhalo na dvou lokalitách – v Horním Břečkově a Olbramkostele.
Obě tyto obce leží v Jihomoravském kraji v okrese Znojmo, od něhož jsou vzdáleny asi 11
km. Vzdálenost mezi sledovanými pozemky je 5 km. V Horním Břečkově hodnocení
probíhalo na pozemku o výměře 100,96 ha, který patří společnosti PODYJÍ, a.s., a náleží do
katastrálního území Horní Břečkov. Tato lokalita se nachází v bramborářské výrobní oblasti.
Druhé hodnocení zaplevelení probíhalo na pozemku patřící Zemědělskému družstvu
Olbramkostel, katastrální území Olbramkostel. Nachází se na pomezí kukuřičné a řepařské
výrobní oblasti a jeho výměra je 27,74 ha.
187
„Úroda 12/2012, vědecká příloha časopisu“
V Horním Břečkově je mák setý řazen do osevního sledu jako zlepšující plodina mezi dvě
obilniny, v hodnoceném období byl zařazen po pšenici seté. Pěstována byla odrůda Major.
V Olbramkostele byla zaseta odrůda Bergam, shodně po obilnině, ale po ječmenu jarním.
Zaplevelení bylo hodnoceno ve třech termínech. První termín byl na jaře po vzejití máku, tedy
20.-25. dubna, druhý termín byl v době květu máku setého, tedy 20.-25. června a třetí termín
hodnocení byl před sklizní porostu máku, tedy 7.-12. srpna.
Intenzita zaplevelení byla zkoumána s použitím metody počítání na ploše 1 m². V Horním
Břečkově bylo provedeno padesát opakování na 100,96 ha a v Olbramkostele patnáct
opakování na 27,74 ha.
Výsledky zaplevelení byly zpracovány mnohorozměrnými analýzami ekologických dat.
Výběr optimální analýzy se řídil délkou gradientu (Lengths of Gradient), zjištěného
segmentovou analýzou DCA (Detrended Correspondence Analysis). Dále byla použita
kanonická korespondenční analýza CCA (Canonical Correspondence Analysis). Při testování
průkaznosti pomocí testu Monte-Carlo bylo propočítáno 499 permutací. Data byla zpracována
pomocí počítačového programu Canoco 4.0. (Ter Braak, 1998).
Tab. 1 Průměrné počty plevelů na lokalitách Horní Břečkov a Olbramkostel
Sledovaná lokalita a termín pozorování
Horní Břečkov
Olbramkostel
Druhy plevelů
1.
2.
3.
1.
2.
3.
Anagallis arvensis
0,28
0,50
0,47
0,87
Atriplex patula
0,02
0,12
0,07
0,27
Atriplex sagittata
0,16
0,34
Avena fatua
0,10
0,20
0,80
0,67
Brassica napus var. napus
1,53
1,00
Capsella bursa-pastoris
0,02
0,06
3,73
Cirsium arvense
1,56
0,18
0,18
Chenopodium album
0,86
0,36
0,04
0,40
Descurainia sophia
1,20
0,67
0,87
Echinochloa crus-galli
0,24
0,64
1,20
0,33
Elytrigia repens
1,56
0,42
0,32
2,87
0,27
0,27
Euphorbia helioscopia
0,02
Fallopia convolvulus
19,14
0,58
1,16
10,40
0,27
0,93
Fumaria officinalis
0,36
0,18
0,16
Galium aparine
0,12
0,07
0,07
Papaver rhoeas
0,48
0,48
0,33
0,80
Persicaria lapathifolia
6,67
5,87
10,27
Plantago major
0,02
Polygonum aviculare
0,66
0,90
1,44
3,67
2,47
3,20
Sinapis alba
0,80
0,46
Sonchus arvensis
0,18
0,22
Taraxacum officinale
0,04
Thlaspi arvense
1,34
10,40
5,47
6,27
Tripleurospermum inodorum
0,06
0,38
1,50
5,00
4,20
4,47
Triticum aestivum
0,04
0,04
Veronica hederifolia
0,04
0,02
0,04
0,40
0,20
Viola arvensis
0,10
0,30
0,66
3,87
0,53
1,53
188
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 1 Ordinační diagram zobrazující vliv
daného pozemku na zaplevelení
Zkratky vybraných druhů: Fum offi =
Fumaria officinalis, Tri aest = Triticum
aestivum, Sin alba = Sinapis alba, Ely repe =
Elytrigia repens, Che albu = Chenopodium
album, Fal conv = Fallopia convolvulus, Tar
offi = Taraxacum officinale, Pla majo =
Plantago major, Cir arve = Cirsium arvense,
Bra napu = Brassica napus var. napus, Tri
inod = Tripleurospermum inodorum, Vio arve
= Viola arvensis, Des soph = Descurainia
sophia, Ver hede = Veronica hederifolia, Per
lapa = Persicaria lapathifolia, Thl arve =
Thlaspi arvense, Cap burs = Capsella bursa
– pastoris, Gal apar = Galium aparine, Eup
heli = Euphorbia helioscopia, Ech crus =
Echinochloa crus – galli, Atr sagi = Atriplex
sagittata, Pap rhoe = Papaver rhoeas, Son arve = Sonchus arvensis, Ana arve = Anagallis
arvensis, Ave fatu = Avena fatua, Atr patu = Atriplex patula, Pol avi = Polygonum aviculace.
Vysvětlivky k ordinačnímu diagramu: Horní B. = Horní Břečkov, Olbramko = Olbramkostel
Výsledky a diskuze
Na obou sledovaných lokalitách bylo zjištěno celkem 27 druhů plevelných rostlin. Průměrné
počty těchto jedinců jsou uvedeny v Tab. 1. Nejprve byla vypočtena délka gradientu (Lenghts
of Gradient) pomocí analýzy DCA, která činila 4,385. Na základě tohoto výpočtu byla
k dalšímu zpracování zvolena kanonická korespondenční analýza CCA. Analýza CCA
vymezuje prostorové uspořádání jednotlivých druhů plevelů a variant faktorů, a to na základě
dat, která byla o frekvenci výskytu plevelných druhů zjištěna. Toto je následně graficky
vyjádřeno pomocí ordinačního diagramu.
Výsledky analýzy CCA, která hodnotila vliv lokality na výskyt plevelů, jsou signifikantní na
hladině významnosti α = 0,002, pro všechny kanonické osy. Na základě analýzy CCA (Obr.
1) je možné nalezené druhy plevelů rozdělit do tří skupin.
První skupina plevelů se vyskytovala především na lokalitě Olbramkostel a jsou to tyto druhy:
Veronica hederifolia, Viola arvensis, Tripleurospermum inodorum, Brassica napus var.
napus, Persicaria lapathifolia, Descurainia sophia, Capsella bursa – pastoris, Thlaspi
arvense.
Druhá skupina plevelů se vyskytovala především na lokalitě Horní Břečkov a jsou to tyto
druhy: Fumaria officinalis, Triticum aestivum, Sinapis alba, Elytrigia repens, Chenopodium
album, Fallopia convolvulus, Taraxacum officinale, Plantago major, Cirsium arvense.
Třetí skupina plevelů není ovlivněna výběrem pozemku a jsou to tyto druhy: Galium aparine,
Euphorbia helioscopia, Echinochloa crus – galli, Papaver rhoeas, Atriplex patula, Atriplex
sagittata, Sonchus arvensis, Avena fatua, Polygonum aviculace.
Závěr
Z výsledků je patrné, že byly zjištěny rozdíly zaplevelení mezi sledovanými pozemky.
Některé plevelné druhy se vyskytovali pouze na jedné z vybraných lokalit, jako např.
Persicaria lapathifolia, Descurainia sophia v Olbramkostele a Fumaria officinalis a Cirsium
arvense v Horním Břečkově. Na obou lokalitách dochází k zaplevelování pozemků předchozí
189
„Úroda 12/2012, vědecká příloha časopisu“
pěstovanou plodinou: v Horním Břečkově byl zjištěn výskyt Sinapis alba a v Olbramkostele
pak Brassica napus var. napus. Dále se na obou pozemcích vyskytoval Papaver rhoeas, jehož
další rozšíření by mohlo v budoucnosti ovlivnit možnost pěstování máku setého na těchto
pozemcích.
Z výsledků této práce je zřejmé, že provádět hodnocení aktuálního zaplevelení v porostech
plodin je nezbytné. Na hodnocených lokalitách se vyskytovaly jak plevelné druhy, které byly
nalezeny pouze na jednom z pozemků, tak i druhy rozšířeny na obou lokalitách ve všech
termínech pozorování. Z tohoto důvodu se zjišťování aktuálního zaplevelení, jeho následné
vyhodnocení a vhodná volba plevelohubného zásahu jeví jako nevyhnutelná agronomická
povinnost.
Dedikace
Práce vznikla jako výstup projektu Interní grantové agentury AF MENDELU číslo: TP
9/2012 “Inovace pěstitelských postupů v suchem ohrožených oblastech“ a projektu Excelence
doktorského studia na AF MENDELU pro navazující vědecko-výzkumnou kariéru
CZ.1.07/2.3.00/20.0005.
Použitá literatura
Baranyk, P., et al. (2010): Olejniny. 1. vyd. Praha: Profi Press, 206 s.
Bechyně, M., (1998): Mák setý, s. 147-152. In: Hosnedl, V., Vašák, J., Mečiar, L., Rostlinná
výroba – II (luskoviny, olejniny). Praha: Agronomická fakulta ČZU v Praze, katedra
rostlinné výroby, 180 s.
Ter Braak, C., J., F.:Canoco, A Fortran (1998): program for canonical community ordination
by [partial] [detrended] [canonical] correspondence analysis (version 4.0.). Report LWA88-02 Agricultural Mathematics Group. Wageningen, 1998.
Kontaktní adresa:
Ing. Kateřina Jonášová
Ústav agrosystémů a bioklimatologie,
Mendelova univerzita v Brně,
Zemědělská 1,
613 00 Brno, Česká republika,
[email protected]
190
„Úroda 12/2012, vědecká příloha časopisu“
VLIV ODRŮDY, OŠETŘENÍ, LOKALITY A ROČNÍKU NA NAPADENÍ
OBILEK JARNÍHO JEČMENE PATOGENY RODU FUSARIUM
Effect of variety, treatment, locality and year on spring barley grains
infection by Fusarium spp.
Kmoch M., Šafránková I., Pokorný R.
Mendelova univerzita v Brně
Abstrakt
Cílem práce bylo zjistit vliv vybraných faktorů na úroveň přirozené infekce obilek jarního ječmene
houbami r. Fusarium. Pro identifikaci těchto hub byla použita mikrobiologická metoda. V obilkách
byly dominantní F. poae, F. avenaceum, F. tricinctum a F. graminearum. Na infekci obilek houbami
r. Fusarium měla nejvyšší vliv lokalita a ročník. Vliv fungicidního ošetření byl nejednoznačný.
Patogeny F. graminearum a F. sporotrichioides vyvolaly statisticky významně nižší infekci obilek na
ošetřené variantě, oproti F. avenaceum a F. poae, které způsobily nižší infekci na neošetřené variantě.
Odrůda/linie neměla statisticky průkazný vliv na infekci obilek pravděpodobně díky nízké infekci.
Klíčová slova: Fusarium spp., jarní ječmen, odrůdy, mikrobiologická metoda
Abstract
The aim of the study was to determine the effect of selected factors on the natural infection level of
spring barley grains by Fusarium fungi. Microbiological method was used to identify these fungi.
Pathogens F. poae, F. avenaceum, F. graminearum and F. tricinctum were dominant in the barley
grains. Locality and year had the highest effect on grains infection. Effect of fungicidal treatment was
ambiguous. F. graminearum and F. sporotrichioides caused a statistically significantly lower grains
infection on treated variant, compared to F. avenaceum and F. poae, which caused lower infection on
untreated variant. Varieties/lines had no statistically significant effect on grains infection probably due
to the low infection.
Key words: Fusarium spp., spring barley, varieties, microbiological method
Úvod
Fytopatogenní houby rodu Fusarium způsobují několik chorob obilnin, včetně spály klíčních
rostlin a hnilob pat stébel a klasů [běloklasost, spála klasů] (Parry et al, 1995). Nejčastějšími
druhy na ječmeni (Hordeum vulgare L.) jsou F. graminerarum Schwabe (teleomorfa
Gibberella zeae Schwein [Petch]), F. culmorum (W. G. Smith) Saccardo, F. poae (Peck)
Wollenweber a F. avenaceum (Fries) Saccardo (t. G. avenacea Cook) (Tekauz et al., 2000;
Brennan et al., 2003). Kromě snižování výnosů (Nicholson et al., 1998) produkují celou řadu
sekundárních metabolitů – mykotoxinů (Logrieco, 2003), které mohou být příčinou
onemocnění člověka a hospodářských zvířat (D'Mello et al., 1999). V obilovinách převládají
trichotheceny a zearalenon (Nicholson et al., 2003; Desjardins, 2006). Houby r. Fusarium na
ječmeni lze omezovat aplikací fungicidů, jejichž účinnost závisí na účinné látce, způsobu,
termínu a frekvenci aplikací (Parry et al., 1995; Homdork et al., 2000), meteorologických
podmínkách (Mesterhazy et Bartok, 1996), virulenci patogenních kmenů a na přítomných
druzích hub (Parry et al., 1995). Cílem práce bylo zjistit vliv odrůdy/linie, fungicidního
ošetření, lokality a ročníku na úroveň přirozené infekce obilek jarního ječmene houbami r.
Fusarium v podmínkách České republiky.
Materiál a metody
Pokus se třemi opakováními byl proveden v letech 2010 a 2011 na lokalitě Žabčice (179 m n.
m.) a Kroměříž (220 m n. m.). Do pokusu bylo zařazeno 14 odrůd/linií jarního ječmene
(pluchaté – Aksamit, Blaník, Bojos, Jersey, Kangoo, Prestige, Radegast, Sebastian, Malz,
Tolar a bezpluché – KM 1057, AF Lucius, KM 2084 a KM 2283) ve dvou variantách, tj.
191
„Úroda 12/2012, vědecká příloha časopisu“
fungicidně ošetřená – konvenční (osivo namořeno přípravkem Raxil TNT, během vegetace
postřiky fungicidy Archer Top 400 EC a Fandango 200 EC) a bez ošetření (nemořené osivo).
Fungicid Archer Top 400 EC (0,9 l ha-1) byl aplikován ve vývojové fázi ječmene DC 34
(čtvrté kolénko patrné) a Fandango 200 EC (1,2 l ha-1) ve fázi DC 58–59 (celý klas vymetán).
Raxil TNT – účinná látka tebukonazol (20 g l-1) + triazoxid (20 g l-1)
Archer Top 400 EC – účinná látka fenpropidin (275 g l-1) + propikonazol (125 g l-1)
Fandango 200 EC – účinná látka fluoxastrobin (100 g l-1) + prothiokonazol (100 g l-1)
K rozlišení jednotlivých druhů r. Fusarium byla použita mikrobiologická metoda. Obilky byly
povrchově dezinfikovány (60 sec, 5% chlornan sodný), následně dvakrát opláchnuty sterilní
destilovanou vodou a vyskládány do Petriho misek (PM) na bramboro-dextrózový agar
(PDA), 10 ks/PM, v pěti opakováních. Inkubace probíhala při laboratorní teplotě (20–24 °C).
Izolace hub z obilek byla provedena čtvrtý až sedmý den. Pro identifikaci byly vypěstovány
čisté kultury z monosporických izolátů (PDA, případně SNA [Spezieller Nährstoffarmer
Agar]), 10–25 dnů, t 20–24 °C, tma). K determinaci druhů byl použit optický mikroskop
Olympus BX41 (zvětšení 200–400×) a stereomikroskop Olympus SZX12. Byly využity
především morfologické znaky makro a mikrokonidií a charakteristiky kolonie houby.
Determinace byla provedena podle určovacího klíče Leslie et Summerell (2006) a Samson et
al. (1996). Statistické vyhodnocení rozdílů úrovně infekce obilek ječmene houbami bylo
provedeno pomocí analýzy rozptylu a mnohonásobného porovnávání (Tukey-HSD; α = 0,05)
za použití programu UNISTAT 5.1 (Unistat Ltd., London, UK). V tabulkách ve výsledcích
představuje každé písmeno jinou hladinu statistické významnosti při p = 0,05.
Úroveň infekce (počet infikovaných obilek v %) byla vypočítána podle vzorce:
Úroveň infekce =
[%]
Výsledky a diskuze
V letech 2010 a 2011 bylo na lokalitách Kroměříž a Žabčice identifikováno v obilkách jarního
ječmene F. avenaceum (FA), F. poae (FP), F. graminearum (FG), F. tricinctum (FT), F.
sporotrichioides (FSP), F. culmorum (FC) a F. verticillioides (FV). Dominantními druhy byly
F. poae (40,53 %), F. avenaceum (23,16 %), F. tricinctum (19,74 %) a F. graminearum
(10,26 %). Při porovnání úrovně infekce obilek druhy r. Fusarium nebyly zjištěny statisticky
průkazné rozdíly mezi jednotlivými odrůdami/liniemi [Tab. 1]. Statisticky významné rozdíly
v úrovni napadení obilek byly nalezeny mezi ošetřenou a neošetřenou variantou. U F. poae a
F. avenaceum byla úroveň infekce nižší na neošetřené variantě, naopak u F. graminearum a
F. sporotrichioides na ošetřené variantě [Tab. 2]. Podle Simpson et al. (2001) a Jones (2000)
je F. graminearum citlivé na skupinu triazolů, do kterých patřily námi použité fungicidní
účinné látky tebukonazol, propikonazol a prothiokonazol. Ošetření pšenice látkou
tebukonazol provedené Ioos et al. (2005) rovněž výrazně snížilo infekci F. graminearum a F.
culmorum. Mezi lokalitami byl zjištěn statisticky průkazný rozdíl v úrovni infekce obilek u F.
avenaceum, F. poae, F. tricinctum a F. sporotrichioides (nižší napadení bylo zaznamenáno na
lokalitě Žabčice) [Tab. 3]. Statisticky průkazný rozdíl mezi ročníky v napadení obilek byl
zjištěn u F. poae, F. tricinctum a F. sporotrichioides (nižší napadení v roce 2010) [Tab. 4].
Rozdíly v napadení obilek ječmene houbami r. Fusarium mezi lokalitami Žabčice Kroměříž a
mezi ročníky 2010 a 2011 byly s nejvyšší pravděpodobností způsobeny odlišnými
meteorologickými podmínkami. Na lokalitě Kroměříž, kde byla v porovnání s lokalitou
Žabčice zjištěna vyšší infekce obilek, byl zaznamenán i vyšší úhrn srážek. Podle Mesterhazy
et Bartok (1996), Shaner (2003) a Logrieco et al. (2003) ovlivňuje výskyt a prevalenci druhů
r. Fusarium ročník, daná oblast pěstování a genotyp houby a hostitelské rostliny.
192
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 1 Vliv odrůdy/linie na napadení obilek ječmene (%) houbami r. Fusarium
Odrůda/druh
FA
FP
FG
FT
FSP
FC
FV
Fusarium sp.
AF Lucius
Aksamit
Blaník
Bojos
Jersey
Kangoo
KM 1057
KM 2084
KM 2283
Malz
Prestige
Radegast
Sebastian
Tolar
1,00 a
1,00 a
2,00 a
1,00 a
3,00 a
1,50 a
1,75 a
1,75 a
1,50 a
1,25 a
1,50 a
2,25 a
1,25 a
1,25 a
4,00 a
2,00 a
2,00 a
2,75 a
3,50 a
4,00 a
3,75 a
4,25 a
2,00 a
1,50 a
2,50 a
2,50 a
3,00 a
0,75 a
0,00
0,00
1,25 a
1,00 a
1,00 a
0,50 a
0,75 a
0,75 a
1,50 a
1,25 a
0,50 a
0,75 a
0,00
0,50 a
1,25 a
2,25 a
1,25 a
1,25 a
2,25 a
0,25 a
1,25 a
2,00 a
1,25 a
0,50 a
1,75 a
0,50 a
1,00 a
2,00 a
0,25 a
0,00
0,25 a
0,25 a
0,25 a
0,25 a
0,25 a
0,25 a
0,25 a
1,50 a
0,25 a
0,25 a
0,25 a
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,03
0,00
0,00
0,00
0,00
0,00
0,03
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
6,50 a
5,50 a
7,00 a
6,50 a
10,00 a
6,50 a
8,00 a
9,25 a
6,50 a
6,25 a
6,75 a
6,25 a
5,50 a
4,50 a
Tab. 2 Vliv fungicidního ošetření na napadení obilek ječmene (%) houbami r. Fusarium
Varianta/druh
FA
FP
FG
FT
FSP
FC
FV
Fusarium sp.
Neošetřená
Ošetřená
1,04 a
2,11 b
1,79 a
3,71 b
1,00 b
0,39 a
1,43 a
1,25 a
0,61 b
0,14 a
0,04 a
0,04 a
0,04a
0,00
5,93 a
7,64 a
Tab. 3 Vliv lokality na napadení obilek ječmene (%) houbami r. Fusarium
Lokalita/druh
FA
FP
FG
FT
FSP
FC
FV
Fusarium sp.
Kroměříž
Žabčice
2,21 b
0,93 a
4,64 b
0,86 a
0,79 a
0,61 a
2,29 b
0,39 a
0,61 b
0,14 a
0,07 a
0,00
0,04 a
0,00
10,64 b
2,93 a
Tab. 4 Vliv ročníku na napadení obilek ječmene (%) houbami r. Fusarium
Ročník/druh
FA
FP
FG
FT
FSP
FC
FV
Fusarium sp.
2010
2011
1,32 a
1,82 a
0,14 a
5,36 b
0,71 a
0,68 a
0,39 a
2,29 b
0,25 a
0,50 b
0,00
0,07 a
0,00
0,04 a
2,82 a
10,75 b
Závěr
Dominantními druhy v obilkách jarního ječmene během let 2010 a 2011 na lokalitách Žabčice
a Kroměříž byly F. poae, F. avenaceum, F. tricinctum a F. graminearum. Sporadicky
izolovanými druhy byly F. culmorum a F. verticillioides. Na infekci obilek ječmene houbami
r. Fusarium měla nejvyšší vliv lokalita (nižší napadení na lokalitě Žabčice), dále pak ročník
(nižší infekce v roce 2010). Vliv fungicidního ošetření byl nejednoznačný. F. graminearum a
F. sporotrichioides vyvolalo statisticky významně nižší infekci obilek na ošetřené variantě,
oproti F. avenaceum a F. poae, které způsobily nižší infekci na neošetřené variantě.
Odrůda/linie neměla statisticky průkazný vliv na infekci obilek pravděpodobně díky nízké
infekci obilek druhy r. Fusarium. Kontrolou mykotoxigenních hub r. Fusarium lze kromě
193
„Úroda 12/2012, vědecká příloha časopisu“
příznivého ovlivňování výnosů minimalizovat průnik mykotoxinů do potravního řetězce a tím
chránit zdraví lidí a hospodářských zvířat.
Dedikace: Příspěvek byl zpracován s podporou projektu Výzkumného centra pro studium
obsahových látek ječmene a chmele č. 1M0570 a projektu č. QI111B044 „Komplexní
strategie pro minimalizaci negativního dopadu infekce toxikogenními houbami r. Fusarium
v obilovinách a odvozených produktech“.
Použitá literatura
Brennan, J. M., Fagan, B., Van Maanen, A., Cooke, B. M., Doohan, F., M., 2003: Studies on
in vitro growth and pathogenicity of Fusarium fungi. European Journal of Plant Pathology
109: 577–587.
Desjardins, A. E., 2006: Fusarium Mycotoxins: Chemistry, Genetics and Biology. APS Press.
260 s.
D'Mello, J. P., F., Placinta, C. M., Macdonald, A. M. C., 1999: Fusarium mycotoxins: a
reviewof global implications for animal health, welfare and productivity. Anim. Feed Sci.
Technol 80, 183–205.
Homdork, S., Fehrmann, H., Beck, R., 2000: Effects of field application of tebuconazole on
yield, yield components and the mycotoxin kontent of Fusarium – infected wheat grain, J.
Phytopathol. 148: 1–6.
Leslie, J. F., Summerell, B. A., 2006: The Fusarium Laboratory Manual. Oxford: Blackwell
Publishing. 388 s.
Logrieco, A., Bottalico, A., Mulé, G., Moretti, A., Perrone, G., 2003: Epidemiology of
toxigenic fungi and their associated mycotoxins for some Mediterranean crops. European
Journal of Plant Pathology 109: 645–667.
Mesterhazy, A., Bartok, T., 1996: Control of Fusarium head blight of beat by fungicides and
its effect on the toxin contamination of the. Pflanzenschutz-Nachrichten Bayer 49 (2):
181–198.
Nicholson, P., Chandler, E., Draeger, R. C., Gosman, N. E., Simpson, D. R., Thomsett, M.,
Wilson, A. H., 2003: Molecular tools to study epidemiology and toxicology of fusarium
head blight of cereals. European Journal of Plant Pathology 109 (7): 691–703.
Nicholson, P., Simpson, D. R., Weston, G., Rezanoor, H. N., Lees, A. K., Parry, D. W.,
Joyce, D., 1998: Detection and quantification of Fusarium culmorum and Fusarium
graminearum in cereals using PCR assay. Physiol. Mol. Plant Pathol. 53: 17–37.
Parry, D. W., Jenkinson, P., Mcleod, L., 1995: Fusarium ear blight (scab) in small grain
cereals- a review. Plant Pathology 44: 207–238.
Samson, R. A., Hoekstra, E. S., Frisvad, J. C., Filtenborg, O., 1996: Introduction to foodborne fungi. 5th ed. Centraalbureau voor Schimmelcultures, Baarn and Delft, 322 s.
Shaner, G., 2003: Epidemiology of Fusarium head blight of small grain cereals in North
America. In: Leonard, K., J., Bushnell, W., R. (Eds.), Fusarium Head Blight of Wheat and
Barley. APS Press, St. Paul, MN, pp. 84–119.
Simpson, D. R., Weston, G. E., Turner, J. A., Jennings, P., Nicholson, P., 2001: Differential
control of head blight pathogens of wheat by fungicides and consequences for mycotoxin
contamination of grain. European Journal of Plant Pathology 107: 421–431.
Tekauz, A., McCallum, B., Gilbert, J., 2000: Review: Fusarium head blight of barley in
western Canada. Canadian Journal of Plant Pathology 22: 9–16.
Kontaktní adresa:
Ing. Martin Kmoch, Mendelova univerzita v Brně, Zemědělská 1/1665, 613 00 Brno
e-mail: [email protected]
194
„Úroda 12/2012, vědecká příloha časopisu“
RELATIVNÍ ČETNOST PŮVODCŮ ČERNÁNÍ STONKU BRAMBORU
V ČESKÉ REPUBLICE V ROCE 2012
Relative incidence of potato blackleg pathogen
in the Czech Republic in 2012
Krejzar V., Pánková I., Kůdela V.
Výzkumný ústav rostlinné výroby, v.v.i., Praha-Ruzyně
Abstrakt
V letech 2012 jsme na šesti lokalitách v České republice (kraj Vysočina a Plzeňský kraj) uskutečnili
průzkum výskytu původců bakteriálního černání stonku bramboru. Z příznakových rostlin jsme
k mikrobiologickým analýzám odebrali celkem 75 vzorků. Identifikační testy jsme provedli u 95
bakteriálních izolátů. Relativní četnost výskytu jednotlivých původců černání stonku bramboru jsme
stanovili v procentech z celkového počtu identifikovaných patogenů. Mezi získanými izoláty převládal
druh Pectobacterium carotovorum subsp. carotovorum, který tvořil 65 % identifikovaných izolátů.
Druh P. atrosepticum byl v roce 2012 zastoupen 17 % izolátů, druh Dickeya chrysanthemi nebyl v
roce 2012 zaznamenán. Druhy rodu Pseudomonas byly mezi identifikovanými izoláty zastoupeny v
rozmezí 1-7 %.
Klíčová slova: bakteriální černání stonku bramboru; Dickeya chrysanthemi; Pectobacterium
atrosepticum; P. carotovorum subsp. carotovorum; Pseudomonas cichorii; P. corrugata; P.
fluorescens; P. marginalis; P. putida; P. viridiflava; brambory;
Abstract
In this study, we evaluate incidence of various soft rot bacteria in potato stems sampled from five
localities in the Czech Republic in 2012. We analysed microbiologically altogether 75 samples of
potato stems. Relative incidence of individual potato blackleg pathogen was expressed as percentage
of the total number of identified pathogens. Of a total 95 isolates obtained from symptomatic blackleg
stems, Pectobacterium carotovorum subsp. carotovorum was surprisingly prevailing as it was
determined in 65% respectively, P. atrosepticum was determined in 17% respectively. Dickeya
chrysanthemi was not determined in 2012. The bacterium of Pseudomonas genera were determined
isolates in 1-7% respectively.
Key words: blackleg; Dickeya chrysanthemi; Pectobacterium atrosepticum; P. carotovorum subsp.
carotovorum; Pseudomonas cichorii; P. corrugata; P. fluorescens; P. marginalis; P. putida; P.
viridiflava; potatoes;
Úvod
Publikace navazuje na vědecký článek: „Relativní četnost původců černání stonku bramboru
v České republice v roce 2010-2011”, který byl uveřejněn v časopise Vědecké práce Výzkumný stav bramborářský Havlíčkův Brod v roce 2011 a přináší informaci o spektru
výskytu původců bakteriálního černání stonku bramboru v České republice v roce 2012.
Černání stonku bramboru je choroba způsobovaná odlišnými bakteriálními patogeny, které
jsou přenosné hlízami a jejich výskyt je závislý na převládajících klimatických podmínkách.
Bakterie Pectobacterium atrosepticum se běžně projevuje typickou černou hnilobou na bázi
stonku. Příznaky choroby mohou být rozdílné v závislosti na převládajících vnějších
podmínkách (PÉROMBELON, KELMAN 1980). Patogen byl poprvé popsán jako původce černání
báze stonku bramboru pod názvem Bacillus atrosepticus, později redukován na poddruh pod
názvem Erwinia carotovora subsp. atroseptica. Status samostatného druhu opět nabyl pod
názvem Pectobacterium atrosepticum (GARDAN et al. 2003). V oblastech mírného
podnebního pásma je P. atrosepticum běžným patogenem, ke kterému se vztahuje název
choroby. Obdobné příznaky černání stonku, které souvisejí s infekcí bakterií P. atrosepticum,
mohou v polních podmínkách vyvolat další dvě pektinolytické bakterie, P. carotovorum
195
„Úroda 12/2012, vědecká příloha časopisu“
subsp. carotovorum a Dickeya chrysanthemi. Záleží na tom, který z těchto tří patogenů
převládá na rozkládající se matečné hlíze, proniká do stonků a za příznivých povětrnostních
podmínek se množí v xylémových cévách. Každý z těchto tří patogenů může také samostatně
nebo v kterékoliv kombinaci způsobit měkkou hnilobu, a to jak u skladovaných hlíz, tak u
sadbových hlíz na začátku vegetace, což má za následek nevzcházivost hlíz a mezerovitost
porostu. Po proniknutí těchto odlišných pektinolytických bakterií dovnitř rostlinných pletiv je
infekční proces obdobný a viditelné symptomy na rostlinách bramboru stěží rozlišitelné
(PÉROMBELON, KELMAN 1987). Geografické rozšíření tří pektinolytických bakterií spjatých
s rostlinami bramboru je odrazem klimatické distribuce jejich hostitelských rostlin a
růstových charakteristik patogenů při různých teplotách (ELPHINSTONE 1987). Teplota je
hlavní faktor ovlivňující patogenezi odlišnými pektinolytickými bakteriemi a určující, který
patogenní organizmus bude převládat (LUMB et al. 1986). P. c. subsp. carotovorum a D.
chrysanthemi jsou fenotypicky a geneticky heterogennější než P. atrosepticum (TOTH et al.
2003). P. atrosepticum je většinou omezeno na oblasti mírného podnebního pásma, P. c.
subsp. carotovorum je celosvětově rozšířeno jak v mírném tak i tropickém podnebním pásmu.
Je patogenní pro široké spektrum rostlin a je schopno přežívat v různém prostředí, např.
v půdě, ve vodních tocích a jezerech. D. chrysanthemi je široce rozšířena v tropických a
subtropických oblastech i v teplých oblastech mírného pásma, kde je patogenní pro mnohé
plodiny, včetně těch, které se pěstují ve sklenících v mírných oblastech. Od konce 80. let
minulého století byla zaznamenána na sadbových hlízách v některých mírných oblastech (ve
Švýcarsku, Nizozemí, Francii a Japonsku), kde mimo jiné způsobila i černání stonku
bramboru v polních podmínkách (DICKEY 1979; PÉROMBELON, KELMAN 1987).
Pektinolytické enzymy produkují i některé pseudomonády způsobující měkké hniloby u
bramboru, zeleninových a ovocných druhů. Patří k nim Pseudomonas viridiflava, P.
marginalis a určité kmeny P. fluorescens a P. putida, které produkují enzym pektatlyázu.
Některé kmeny nepektinolytických fluorescentních pseudomonád se mohou změnit za
určitých podmínek na pektinolytické (LIAO 1991).
Cílem tohoto příspěvku je zjistit spektrum výskytu původců bakteriálního černání stonku
bramboru v České republice v roce 2012.
Materiál a metody
V roce 2012 bylo na 5 lokalitách z celkem 22 odrůd odebráno 75 vzorků stonků bramboru s
příznaky bakteriálního černání. Ze zhnědlých částí cévních svazků na příčném a podélném
řezu stonkem byly odebírány segmenty, které byly macerovány ve sterilní destilované vodě a
roztírány na dva typy živných médií: (i) MPAg vhodné pro izolaci a kultivaci bakterií rodu
Dickeya a Pectobacterium; (ii) King B vhodné pro kultivaci a izolaci bakterií rodu
Pseudomonas. Živná média byla uchovávána v termostatu při teplotě 28°C po dobu 1 - 2 dnů.
Petriho misky s živným médiem MPAg byly hodnoceny na přítomnost bakterií rodu Dickeya
a Pectobacterium po 24 hodinách, Petriho misky s živným médiem King B byly hodnoceny
na přítomnost bakterií rodu Pseudomonas po 48 hodinách. U získaných čistých kultur
bakteriálních izolátů byly stanoveny jejich biochemické vlastnosti při využití identifikačního
systému Biolog GEN III MicroPlateTM. Izoláty z rodu Pseudomonas byly podrobeny testům
hypersenzitivity na rostlinách tabáku (Nicotiana tabacum L.). Pektinolytické vlastnosti
vybraných bakteriálních izolátů byly ověřovány metodou inokulace plátků hlíz bramboru.
Relativní četnost výskytu jednotlivých izolovaných původců černání stonku bramboru v roce
2012 byla stanovena v procentech z celkového počtu identifikovaných patogenů.
Výsledky a diskuse
V roce 2012 bylo na 5 lokalitách odebráno 75 vzorků stonků bramboru s příznaky
bakteriálního černání, pocházejících celkem z 22 odrůd. Ze 75 vzorků bylo získáno celkem 95
196
„Úroda 12/2012, vědecká příloha časopisu“
bakteriálních izolátů. Z celkem 95 bakteriálních izolátů bylo 65 % identifikováno jako
Pectobacterium carotovorum subsp. carotovorum, 17 % jako P. atrosepticum, 7 % jako
Pseudomonas fluorescens, 4 % jako P. synxantha, 2 % jako P. marginalis, 2 % jako P.
syringae, 1 % jako P. corrugata a 1 % jako P. cichorii. Druh Dickeya chrysanthemi nebyl
mezi získanými izoláty identifikován (tab. 1, 2).
Tab. 1: Výsledky identifikace 95 bakteriálních izolátů pocházejících z 5 lokalit v roce
2012
Lokalita Počet
Počet
Výsledky identifikace (%)
odrůd izolátů
Pcc
Pa
Pf
Psyn
Pm
Ps
Pcorr Pcich
1
5
20
85
5
0
5
0
0
0
1
2
4
21
95
5
0
0
0
0
0
0
3
3
14
43
57
0
0
0
0
0
0
4
6
19
37
32
21
0
0
11
0
0
5
4
21
57
0
14
14
10
0
1
0
Celkem
22
95
65
17
7
4
2
2
1
1
Pcc - Pectobacterium carotovorum subsp. carotovorum; Pa - P. atrosepticum; Pf Pseudomonas fluorescens; Psyn - P. synxantha; Pm - P. marginalis; Ps - P. syringae; Pcorr P. corrugata; Pcich - P. cichorii;
Výsledky mikrobiologické analýzy stonků bramboru s příznaky bakteriálního černání získané
v roce 2012 jsme porovnali s výsledky získanými v letech 2010 a 2011 (tab. 2).
V roce 2010 z celkového počtu 120 testovaných bakteriálních izolátů pocházejících z 52
vzorků odebraných na celkem 3 lokalitách bylo 63 % identifikováno jako P. c. subsp.
carotovorum, 13 % jako D. chrysanthemi, 6 % jako P. atrosepticum, 2 % jako P. viridiflava, 2
% jako P. putida a 2 % jako P. fluorescens. Celkem 12 % bakteriálních izolátů se nepodařilo
identifikovat (KREJZAR et al. 2011) (tab. 2).
V roce 2011 z celkového počtu 76 testovaných bakteriálních izolátů pocházejících z 29
vzorků odebraných na 3 lokalitách bylo 58 % identifikováno jako P. c. subsp. carotovorum,
16 % jako P. atrosepticum, 3 % jako P. putida a 20 % jako P. fluorescens. Celkem 4 %
bakteriálních izolátů nebylo možno spolehlivě identifikovat (tab. 2). Bakterie D. chrysanthemi
nebyla při průzkumu provedeném v roce 2011 detekována (KREJZAR et al. 2011).
Tab. 2: Výsledky identifikace bakteriálních izolátů pocházejících z 5 lokalit v roce 2012
v porovnání s výsledky identifikace na 3 lokalitách v letech 2010 a 2011
Rok Počet Počet
Výsledky identifikace (%)
odrůd izolátů Pcc
Pa
Dch
Pf
Pv
Ppu Pm Pcorr Pcich
2010
120
63
6
13
2
2
3
0
0
0
2011
76
58
16
0
20
0
3
0
0
0
2012
22
95
65
17
0
7
2
0
2
1
1
Pcc - Pectobacterium carotovorum subsp. carotovorum; Pa - P. atrosepticum; Dch - Dickeya
chrysanthemi; Pf - Pseudomonas fluorescens; Pv - P. viridiflava; Ppu - P. putida; Pm - P.
marginalis; Pcorr - P. corrugata; Pcich - P. cichorii;
Převládajícím izolovaným patogenem v roce 2012, podobně jako v letech 2010 a 2011, byl
druh P. c. subsp. carotovorum. Průměrná růstová teplota P. atrosepticum je okolo 27°C (při
36°C neroste), P. c. subsp. carotovorum okolo 29°C a D. chrysanthemi okolo 35°C
(ELPHINSTONE 1987). Převládají-li v době výsadby brambor nízké teploty pod 15 °C, převládá
napadení druhem P. atrosepticum, a to jak stonků, tak i hlíz. Se stoupající teplotou se zvyšuje
četnost a síla napadení stonků a hlíz bakteriemi P. c. subsp. carotovorum a D. chrysanthemi
197
„Úroda 12/2012, vědecká příloha časopisu“
(ELPHINSTONE 1987). Efektivní regulace původce černání stonku spočívá primárně na
produkci a používání „čisté“ sadby (PÉROMBELON 2000). Cílem je vypracování spolehlivých
a ekonomicky přijatelných testů, kterými by bylo možno kvantifikovat kontaminaci hlíz
patogeny, které představují pro porosty bramboru v určité oblasti hlavní riziko. Předpokládá
se, že při použití tohoto přístupu se dosáhne lepších výsledků, než tomu bylo při aplikaci
uznávání sadbových porostů založených na inspekci a odstraňování rostlin s příznaky černání
báze stonku, které většinou nebývá důsledné. Kromě toho, vizuální hodnocení četnosti
výskytu černání stonku v porostu je nespolehlivým indikátorem kontaminace dceřiných hlíz.
Podle DE BOERA (2001) významně klesá škodlivost původce černání stonku bramboru
v případech, kdy jsou sadbové brambory odvozeny z vegetativně množených mikrorostlin a
počet polních generací se sníží.
Dedikace
Tato práce vznikla za finanční podpory Ministerstva zemědělství ČR, projekt č. 0002700604.
Použitá literatura
De Boer S.H. (200l): Blagleg/soft rot of potato. In: Maloy O.C., Murry T.D.: Encyclopedia of
plant pathology, Volume I., II. John Wiley & Sons, Inc., New York.
Dickey R.S. (1979): Erwinia chrysanthemi: a comparative study of phenotypic properties of
strains from several hosts and other Erwinia species. Phytopathology 69: 324-329.
Gardan L., Gouy C., Christen R., Samson R. (2003): Elevation of three subspecies of
Pectobacterium carotovorum to species level: Pectobacterium atrosepticum sp. nov.,
Pectobacterium betavasculorum sp. nov. and Pectobacterium wasabiae sp. nov.
International Journal of Systematic and Evolutionary Microbiology 53: 381-391.
Elphinstone, J.G. (1987): Soft rot and blackleg of potato. Erwinia spp. Technical Information
Bulletin 21. International Potato Center, Lima, Peru.
Krejzar V., Pánková I., Hausvater E., Doležal P., Kůdela V. (2011): Relativní četnost
původců černání stonku bramboru v České republice v roce 2010-2011. Vědecké práce Výzkumný ústav bramborářský Havlíčkův Brod, 2011, 19: 27-34.
Liao G.H. (1991): Cloning of pectate lyase gene pel from Pseudomonas fluorescens and
detection of sequences homology to pel in Pseudomonas viridiflava and Pseudomonas
putida. Journal of Bacteriology 173: 4386-4393.
Lumb V.M., Pérombelon M.C.M., Zutra D. (1986): Studies of a wilt diseases of the potato
plant in Israel caused by Erwinia chrysanthemi. Plant Pathol. 35: 196-202.
Pérombelon, M.C.M. - Kelman, A. (1980): Ecology of the soft rot erwinias. Ann. Rev.
Phytopathol., 18: 361-387.
Pérombelon M.C.M., Kelman A. (1987): Blackleg and other potato diseases caused by soft rot
erwinias: a proposal for a revision of the terminology. Plant Disease 71: 283-285.
Pérombelon M.C.M. (2000): Blackleg risk potential of seed potatoes determined by
quantification of tuber contamination by the causal agent and Erwinia carotovora subsp.
atroseptica: a critical review. OEPP/EPPO. Bulletin, 30: 413-420.
Toth J.K., Bell K.H., Holeva M.C., Birtch P.R.J. (2003): Soft rot erwiniae: from genes to
genomes, Molecular Plant Patology 4: 17-30.
Kontaktní adresa :
Ing. Václav Krejzar, Ph.D.
Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507, 161 06 Praha 6-Ruzyně, e-mail: [email protected]
198
„Úroda 12/2012, vědecká příloha časopisu“
VLIV PŘEDPLODINY A ZPRACOVÁNÍ PŮDY NA DIVERZITU A
DRUHOVÉ SPEKTRUM PLEVELŮ
Influence previous crop and soil tillage on species spectrum and weeds
diversity
Neischl A.1, Winkler J.2, Klepáčková V.2, Zelená V.1
1
Ústav biologie rostlin, 2Ústav agrosystémů a bioklimatologie
Mendelova univerzita v Brně
Abstrakt – Stanovení druhové rozmanitosti plevelných společenstev bylo provedeno u plodiny
pšenice ozimé roce 2010 a 2011. Polní pokus byl založen v Žabčicích na polní pokusné stanici
Mendlovy univerzity. Pšenice ozimá byla pěstována po předplodině vojtěšce seté a po předplodině
kukuřici silážní. Při porovnání tří variant zpracování půdy (orba, minimalizace a přímé setí) bylo
zjištěno největší zaplevelení, na variantě s minimalizačním zpracováním půdy a nejmenší na variantě,
kde byla použita tradiční technologie zpracování půdy. Po tradiční technologii (orbě) bylo nalezeno 20
druhů plevelů, kde nejvíce dominoval Veronica polita, po minimalizační technologii druhů 17, kde
měl opět největší zastoupení Veronica polita a po bezorebné technologii druhů 14, přičemž dominoval
plevelný druh Capsella bursa-pastoris.
Klíčová slova: plevele, zpracování půdy, předplodina, diverzita
Abstract – Determination of species diversity of weed communities was made in winter wheat stand
in 2010 and 2011. The field experiment was established in Žabčice on the field experimental station of
Mendel University in Brno. Winter wheat was raised by previous crop alfalfa as well as by previous
crop silage maize. Comparison of three variants of soil tillage (ploughing, minimum tillage and direct
sowing) shown that the highest weed infestation was on the variant with minimum tillage and the
lowest was on the variant where the conventional way of tillage was used. After conventional
technology (ploughing) was found 20 species of weeds, the most dominant was Veronica polita, on
the minimum-tillage variant 17 species, the most common was Veronica polita again and after notillage was found 14 species and the most dominant was the weed specie Capsella bursa-pastoris.
Key words: weeds, soil tillage, previous crop, diversity
Úvod
Zemědělství České republiky a jeho vliv na životní prostředí je poznamenán minulostí.
Biologická rozmanitost na zemědělské půdě nedosahuje požadované úrovně, což se projevuje
snížením populací původních druhů (MARADA et al., 2010).
Dle MIKULKA et al. (1999) procházejí plevelná společenstva složitým vývojovým cyklem.
V minulosti byla tato společenstva druhově bohatá a na polích bylo zastoupeno mnoho desítek
plevelných druhů. Vývoj druhového spektra plevelných společenstev byl a stále bude
ovlivňován celou řadu faktorů.
Za základní příčinu snížení diverzity v agroekosystémech je považována ztráta funkce
ekosystémů jejich narušením. Je to právě zemědělství, které má zájem na jednoduchých a
uniformních ekosystémech řízených člověkem. Tím způsobuje vymizení mnoha původních
druhů rostlin a živočichů, snížení druhové diverzity společenstev, ekosystémů a změny v
početnosti druhů (MARADA et al., 2010; BOHÁČ et al., 2006).
Vliv rozdílných technologií zpracování půdy a předplodiny na výskyt a druhovou rozmanitost
společenstva plevelů v porostu pšenice ozimé byl hodnocen na polním pokusu.
Materiál a metody
Polní pokus byl založen na polní pokusné stanici v Žabčicích v roce 2003. Jednotlivé parcely
mají velikost 1000 m2 (100 x 10 m). V polním pokusu byl použit sedmihonný osevní postup
199
„Úroda 12/2012, vědecká příloha časopisu“
(vojtěška setá - první užitkový rok; vojtěška setá – druhý užitkový rok; ozimá pšenice;
kukuřice na siláž; ozimá pšenice; cukrovka; jarní ječmen).
V rámci sedmihonného osevního postupu byly k plodině pšenice ozimé použity tři varianty
zpracování půdy. První varianta byla tradiční zpracování půdy, v textu označena jako orba.
Druhá varianta byla minimalizace zpracování půdy s mělkým zpracováním, u které bylo
použito označení minimalizace a třetí variantou bylo přímé setí, v textu označeno bez orby.
Zaplevelení bylo vyhodnocováno před aplikaci herbicidů v porostech pšenice ozimé. Termíny
vyhodnocení byly 9. 4. 2010 a 1. 4. 2011. Počty jedinců jednotlivých druhů plevelů byly
zjišťovány na ploše 1 m2 a to ve 12 opakováních. České a latinské názvy jednotlivých druhů
plevelů byly použity podle Kubáta (KUBÁT, 2002).
Druhová diverzita byla vyjádřena pomocí Indexu diverzity (Idiv.), který byl vypočten dle
vzorce „Idiv. = S.I-1“, kde S je počet druhů a I je počet jedinců. Ke statistickému zpracování
počtu druhů plevelů a Indexu diverzity byl použit počítačový program STATISTICA.Cz, dále
byla aplikována analýza rozptylu a následně metoda minimální průkazné diference (LSD).
K vyhodnocení výskytu jednotlivých druhů plevelů na variantách byla použita
mnohorozměrná analýza ekologických dat kanonická korespondenční analýza CCA
(Canonical Correspondence Analysis). Průkaznost byla testována pomocí testu Monte-Carlo a
bylo propočítáno 499 permutací. Data zpracoval počítačový program Canoco 4.0. (TER
BRAAK, 1998).
Výsledky a diskuze
V průběhu sledování bylo na pokusu nalezeno celkem 24 druhů plevelů. V Tab. 1 jsou
uvedeny výsledky testování LSD počtu druhů a indexu diverzity. Rozdíly v hodnotách počtu
druhů a byly indexu diverzity statisticky průkazné mezi osevními postupy a variantami
zpracování půdy.
Tab. 1 Výsledky testování LSD počtu druhů plevelů a Index diverzity
Varianty
Počet druhů
Index diverzity
Průměrný Idiv.
Statistická
Rok
Průměrný
Statistická
průkaznost
sledovaní
počet druhů
průkaznost
(druh.m-2)
(α =0,05) (α =0,01)
(α =0,05)
2010
2011
Předplodina
3,45
3,33
Kukuřice
Vojtěška
Zpracování
půdy
3,17
3,62
Orba
Minimaliza
ce orby
Bez
3,17
3,81
3,20
a
a
Statistická
průkaznost
(α =0,01)
a
b
Statistická
průkaznost
(α =0,01; α
=0,05)
a
b
a
0,53
0,59
0,62
0,49
0,64
0,50
0,53
a
b
a
a
Statistická
průkaznost
(α =0,01)
a
b
Statistická
průkaznost
(α =0,01; α =0,05)
a
b
b
Výsledky analýzy CCA, která hodnotila vliv technologie zpracování půdy na výskyt plevelů
je signifikantní na hladině významnosti α = 0,002, pro všechny kanonické osy. Na základě
analýzy CCA (Obr. 1) je možné nalezené druhy plevelů rozdělit do 4 skupin: druhy
v blízkosti značky CT
ovlivněné orbou (rozrazil perský, ostrožka východní, úhorník
200
„Úroda 12/2012, vědecká příloha časopisu“
mnohodílný, rozrazil břečťanolistý, mák vlčí, opletka obecná, hořčice rolní, zemědým
lékařský, merlík bílý, starček obecný), druhy v blízkosti značky MT
ovlivněné
minimalizační technologií (rozrazil lesklý, hluchavka nachová, penízek rolní, hluchavka
objímavá, silenka noční), druhy v blízkosti značky NT
ovlivněné bezorebnou technologií
(svízel přítula, tolice vojtěška, heřmánkovec nevonný, violka rolní, rdesno ptačí, pcháč oset,
locika kompasová), druhy ostatní
ovlivněné jiným faktorem (ptačinec prostřední, kokoška
pastuší tobolka).
Vliv zpracování půdy a předplodiny na výskyt plevelů je také signifikantní na hladině
významnosti α = 0,002 a je zobrazen na Obr. 2. Na základě analýzy CCA je možné nalezené
druhy plevelů rozdělit do 3 skupin: druhy v blízkosti značky Vojteska
(svízel přítula,
ptačinec prostřední, hluchavka objímavá, heřmánkovec nevonný, tolice vojtěška, violka rolní,
rdesno ptačí), druhy v blízkosti značky Kukurice
(penízek rolní, hluchavka nachová,
kokoška pastuší tobolka, silenka noční), druhy ostatní
ovlivněné jiným faktorem (rozrazil
lesklý, rozrazil perský, mák vlčí, ostrožka východní, úhorník mnohodílný, rozrazil
břečťanolistý, starček obecný, zemědým lékařský, merlík bílý, hořčice rolní, locika
kompasová, opletka obecná).
Obr. 1 Ordinační diagram vyjadřující
Obr. 2 Ordinační diagram vyjadřující vliv
vliv technologie zpracování půdy na výskyt
technologie zpracování půdy a
plevelů
předplodiny na výskyt plevelů
Vysvětlivky ke zkratkám: technologie zpracování půdy CT – orba, MT – minimalizace, NT – bezorebná
technologie. předplodina Vojteska, Kukurice. Technologie zpracování půdy: NT – bezorebná technologie, MT –
minimalizační technologie, CT – orba.
Druhy plevelů: Cap burs (Capsella bursa-pastoris), Cir arve (Cirsium arvense), Con orie (Consolida orientalis),
Des soph (Descurainia sophia), Fall con (Fallopia convolvulus), Fum offi (Fumaria officinalis), Gal apar
(Galium aparine), Che albu (Chenopodium album), Lac serr (Lactuca serriola), Lam ampl (Lamium
amplexicaule),Lam purp (Lamium purpureum), Med sati (Medicago sativa), Pap rhoe (Papaver rhoeas), Pol
avic (Polygonum aviculare), Sen vulg (Senecio vulgaris), Sil noct (Silene noctiflora), Sin arve (Sinapis arvensis),
Ste medi (Stellaria media), Thl arve (Thlaspi arvense),Tri inod (Tripleurospermum inodorum), Ver hede
(Veronica hederifolia), Ver pers (Veronica persica), Ver poli (Veronica polita), Vio arve (Viola arvensis).
201
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
Z výsledků testování minimální průkazné diference (LSD) vyplývá, že rozdíly v počtu druhů
byly statisticky průkazné mezi předplodinami a variantami zpracování půdy. Dle výsledků
testování LSD Indexu diverzity byla společenstva plevelů druhově pestřejší v roce 2010, po
předplodině vojtěšce, u minimalizace a bezorebné technologie.
Na variantě, kde byla provedena orba bylo nalezeno 20 druhů plevelů, na pozemcích s
minimalizací se vyskytovalo 17 plevelných rostlin a v porostech s bezorebnou technologií
bylo zjištěno 14 druhů plevelů. Na variantě s orbou dominoval rozrazil lesklý a rozrazil
perský. Na minimalizační variantě vykazoval největší zastoupení rozrazil lesklý a hluchavka
objímavá. Na pozemcích s bezorebnou technologií se v nejvíce vyskytovala kokoška pastuší
tobolka a rozrazil lesklý.
Obecně lze říci, že s vyšší diverzitou roste odolnost společenstva. Při masivním používání
chemických prostředků však zůstává otázkou, zda je vůbec možné druhovou diverzitu plevelů
nějak zachovat a současně podpořit, protože celý ekosystém je výrazně ovlivňován vůli
člověka – pěstitele. Průměrný počet druhů byl u minimalizace vyšší oproti orbě. Index
diverzity vykazoval druhově pestřejší společenstva plevelů u minimalizace a bezorebné
technologie, a také po předplodině vojtěšce. Celkově druhů však bylo málo. Z velké části se
jednalo a jednoleté přezimující druhy plevelů.
Dedikace
Práce vznikla jako výstup projektu Interní grantové agentury AF MENDELU číslo: TP
9/2012 “Inovace pěstitelských postupů v suchem ohrožených oblastech“.
Použitá literatura
Boháč, J., Moudrý, J., Desetová, L. 2006: Biodiversity and Agriculture. Život. Prostr., Vol.
41, No. 1. Katedra agroekologie Zemědělské fakulty Jihočeské univerzity V Českých
Budějovicích. Dostupné na: www.jaroslavbohac.wz.cz/download/05_bohac.pdf
Kubát, K. 2002: Klíč ke květeně České republiky. Academia. Praha. 928 s. ISBN 80-2000836-5
Marada, P., Havlíček, Z., Skládanka, J. 2010: Ochrana přírody a krajiny – Ekosystémové
služby, nový trend zemědělského podnikání, 1.vyd. Brno, Mendlova univerzita v Brně,
45 s.
Mikulka, J. a kol. 1999: Plevelné rostliny polí, luk a zahrad. 1.vyd., Praha, 160 s.
Ter Braak, C., J., F. 1998: CANOCO – A FORTRAN program for canonical community
ordination by [partial] [detrended] [canonical] correspondence analysis (version 4.0.).
Report LWA-88-02 Agricultural Mathematics Group. Wageningen,.
Kontaktní adresa:
Ing. Jan Winkler, Ph.D.
Ústav agrosystémů a bioklimatologie, Mendelova univerzita v Brně
Zemědělská 1
613 00 Brno, Česká republika
[email protected]
202
„Úroda 12/2012, vědecká příloha časopisu“
POTVRZENÝ VÝSKYT PŮVODCE BLEEDING CANKER
JÍROVCŮ V ČR
The first report of causal agent of bleeding canker of horse chestnut
in the Czech Republic
Pánková I.1, Krejzar V. 1, Mertelík J. 2, Kloudová K. 2
Výzkumný ústav rostlinné výroby, v.v.i.
Výzkumný ústav Silva Taroucy pro krajinu a okrasné zahradnictví, v.v.i.
1
2
Abstrakt
Choroba bleeding canker (BC) s českým názvem slizotoková nekróza na jírovci maďalu (Aesculus
hippocastanum) vyvolaná bakterií Pseudomonas syringae pv. aesculi (Psa) byla v České republice
poprvé prokázána v roce 2010. První výskyt choroby byl zjištěn na lokalitě Měděnec v Krušných
horách, přítomnost Psa na této lokalitě byla potvrzena v roce 2011. Od roku 2011 byl výskyt bakterie
Psa prokázán i na dalších dvou lokalitách. Přítomnost bakterií Psa byla prokázána v korových a
floémových pletivech stromů různého stáří. Bakterie Psa byly úspěšně izolovány v průběhu celého
vegetačního období. Bakterie byly identifikovány metodami Biolog, Sherlock a qPCR. Patogenita
izolátů byla ověřena na semenáčcích jírovce maďalu.
Klíčová slova: Aesculus hippocastanum L. – jírovec maďal, bleeding canker, Pseudomonas syringae
pv. aesculi, izolace
Abstract
Disease bleeding canker (BC) with the czech name „slizotoková nekróza“ on horse chestnut (Aesculus
hippocastanum) caused by the bacteria Pseudomonas syringae pv. aesculi (Psa) has been
demonstrated for the first time in 2010 in the Czech Republic. The first occurrence of the disease was
recorded on the locality Měděnec in the Ore mountains. The presence of the pathogen on this locality
was confirmed in 2011. From 2011 the presence of this Pseudomonas subspecies on the other two
localities was demonstrated. The presence of the bacteria was demonstrated in the bark and floem
tissue of trees of different ages. The bacteria were successfully isolated and identified during the entire
growing period. Bacteria have been identified by Biolog, Sherlock a qPCR methods. Pathogenicity of
isolates was confirmed by inoculation of the horse chestnut seedlings.
Keywords: Aesculus hippocastanum L. – horse chestnut, bleeding canker, Pseudomonas syringae pv.
aesculi, isolation
Úvod
Jírovec maďal (koňský kaštan) je převládajícím druhem jírovce v České republice. Porosty
jírovců jsou v současnosti v ČR nejvíce ohrožovány klíněnkou jírovcovou (Cameraria
ohridella), některými houbovými chorobami (Phytophthora sp.) a nově bakterií Pseudomonas
syringae pv. aesculi (Psa), způsobující bleeding canker (BC), česky slizotokovou nekrózu
jírovce maďalu. Choroba se projevuje praskáním korových pletiv, především na hlavním
kmeni. Z různě velkých prasklin vytéká rezavý až tmavě hnědý klej, který postupně zasychá a
vytváří na povrchu kmene tmavě hnědé shluky, připomínající krápníky. Na kmeni se mohou
tvořit puchýřky vyplněné touto tekutinou. Při silné infekci je zasažena i koruna, dochází k
celkovému chřadnutí stromu, které končí úhynem. Po roce 2000 došlo postupně k masivnímu
odumírání jírovců v západní Evropě – ve Velké Británii, Belgii, Holandsku a Německu.
Příčiny vypuknutí této epidemie dosud nebyly objasněny. K rychlému šíření choroby
v západní Evropě pravděpodobně přispívá celkové oteplování klimatu. Mírnější a vlhčí zimy
umožňují přežívání patogena. Příznaky BC jsou velmi podobné příznakům vyvolaným
houbami rodu Phytophthora spp. Vzhledem k postupu infekce v západní Evropě probíhal
v České republice v letech 2003 - 2008 orientační průzkum výskytu BC v rámci sledování
jiných chorob jírovce maďalu. Sporadicky byly zaznamenávány výtoky kleje z prasklinek na
203
„Úroda 12/2012, vědecká příloha časopisu“
kmeni jírovců. Při mikrobiologických analýzách byla v jednom případě identifikována infekce
houbou Phytophthora cactorum. Systematický průzkum výskytu BC jírovců v důsledku
napadení gramnegativní fluorescentní bakterii Pseudomonas syringae pv. aesculi (Psa) byl
zahájen v roce 2009 v rámci projektu NAZV – QI92A246 (Mertelík et al., 2012). Izoláty
mohou být identifikovány biochemickými, chemickými nebo molekulárně-biologickými
systémy. Stávající databáze biochemických a chemických systémů umožňují spolehlivě
identifikovat původce BC na úroveň druhu. Přestože rozlišení jednotlivých patovarů
Pseudomonas syringae (Ps) je obtížné jakoukoliv metodou, jako nejperspektivnější metoda
identifikace v současnosti se jeví qPCR (Green et al., 2009).
Materiál a metody
V letech 2009-2012 byly v ČR během vegetačního období odebírány vzorky korových a
floémových pletiv jírovce maďalu (Aesculus hippocastanum) z městských a krajinných
výsadeb s podezřením na příznaky BC. Z každého příznakového stromu byly podle intenzity
napadení odebírány 1-3 vzorky. Pro porovnání byly na jaře a na podzim odebírány stejné typy
pletiv jírovce maďalu z lokalit v Holandsku (Keukenhof) a Německu (Meppen) s již dříve
potvrzeným výskytem BC. Všechny odebrané vzorky pletiv byly podrobeny mikrobiologické
analýze, bylo stanoveno spektrum přítomných bakterií, s důrazem na přítomnost Psa a hub,
s důrazem na přítomnost rodu Phytophthora. Části korových pletiv s příznaky BC byly
macerovány ve sterilní vodě, maceráty byly roztírány na bakteriologické médium King B
(KING et al., 1954) a mykologické mrkvové médium (Stelfox and Herbut, 1979). Houby byly
kultivovány 2 týdny při 21-24°C. Bakterie byly kultivovány 2-4 dny při teplotě 21°C.
Spektrum hub bylo hodnoceno zejména mikroskopicky. Spektrum bakterií bylo hodnoceno
systémy Biolog GEN III system protokol A (Biolog, Inc., Hayward CA), MIDI gas
chromatography system (MIDI, Microbial ID, Inc., Newark, DE), metodou qPCR (Green et
al., 2009), testy hypersensitivity na tabáku a testy patogenity na 1-2letých semenáčcích
jírovce maďalu, genotypu Sklenné. Při testech patogenity na jírovcích byla do vzrostných
vrcholů a letorostů dvou semenáčků injikována suspenze izolátu o koncentraci 106 buněk/ml.
Po 3 měsících byla zjišťována přítomnost lézí. Molekulárně biologická specifikace Psa byla
provedena metodou qPCR (STEP One Plus, Fast SYBR Green PCR Mastermix, Applied
Biosystems) a specifickými primery dle Green et al., (2009). Pro identifikaci byla použita buď
přímo suspenze bakterií izolovaných ve VÚRV,v.v.i., nebo přímo DNA získaná z korových
pletiv pomocí izolačního kitu Qiagen. Jako pozitivní kontrola byla využita korová pletiva
odebraná ze stromů s prokázaným BC v Nizozemí a Německu a kmen Psa PD 2250 (Velká
Británie).
Výsledky a diskuze
V letech 2009-2012 byl proveden průzkum výskytu BC na více než 200 lokalitách,
kontrolováno bylo více než 3000 stromů jírovců různého stáří. Příznaky podobné BC byly
zjištěny na 18ti lokalitách. Analyzováno bylo celkem 39 vzorků s příznaky BC z 9 lokalit
ČR. V žádném z analyzovaných vzorků nebyla prokázána přítomnost houby rodu
Phytophthora. Fluorescentní bakterie byly izolovány ze všech typů pletiv a bez ohledu na
roční období. Izolace byla úspěšná i u starších zaschlých vzorků. Izoláty, včetně pozitivní
kontroly PD 2250 byly nejprve anylyzovány a identifikovány systémem Biolog GEN III a
MIDI databází Sherlock TSBA6. Vzhledem k tomu, že ani v jedné z těchto databází není
dosud uveden patovar aesculi, byla pozitivní kontrola identifikována jako Pseudomonas syr.
pv. tabaci. Získané izoláty byly identifikovány jako patovary druhu syringae (antirrhini,
aptata, maculicola, primulae, syringae). Do dalšího ověřování byly vzhledem k morfologické
a biochemické podobnosti zařazeny i izoláty identifikované jako Pseudomonas fluorescens
(Tabulka 1). V testech patogenity byly prověřovány jak identifikované izoláty Pseudomonas
204
„Úroda 12/2012, vědecká příloha časopisu“
syringae, tj. s koeficientem podobnosti nad 0,5 (SimIndex > 0,5), tak i neidentifikované
izoláty Pseudomonas syringae (SimIndex < 0,5). U vybrané skupiny izolátů identifikovaných
jako Pseudomonas syringae (přednostně s SimIndex > 0,75) byla provedena identifikace
metodou qPCR se specifickými primery pro Psa (Tabulka 1). Jako první byl jako Psa
jednoznačně identifikován izolát 6404/2A z lokality Měděnec. Tento kmen vykazoval
prudkou hypersenzitivní reakci na tabáku. Po inokulaci semenáčků jírovce vyvolával tvorbu
rozsáhlých lézí na letorostech a odumírání vzrostných vrcholů, na listech se tvořily
charakteristické rezavě hnědě drobné skvrny kolem vodivých pletiv. Typ lézí vytvořených po
inokulaci pozitivní kontrolou a izolátem z Měděnce byl shodný. Vzniklé léze jsou dobře
rozlišitelné od dalších typů lézí vyvolaných jinými abiotickými a biotickými faktory.
K naplnění Kochových postulátů byla provedena reizolace patogena z drobných listových
lézí. Virulentní reizolát 6404/2A se v současnosti využívá pro testování hladiny rezistence
jednotlivých genotypů jírovce maďalu vůči bakterii Psa. Přítomnost patogena Psa na lokalitě
Měděnec byla opakovaně potvrzena v letech 2011 a 2012. Vzhledem k nárůstu počtu lokalit
v posledním roce se nechá očekávat další šíření choroby v ČR. Doposud byl zaznamenán
výskyt pouze mírnějších příznaků choroby ve formě výtoků z kmene. Chřadnutí koruny
stromů a úhyn stromů byl v ČR dosud pozorován pouze ojediněle, přičemž bylo zřejmé, že se
jedná o komplexní poškození dalších bionóz a abionóz vázaných na jírovce (Mertelík et al.,
2012). Bohužel stav na lokalitě Měděnec, kde v roce 2010 příznaky BC vykazovalo více jak
70% z více než sta stromů jírovců rozdílného stáří, se již blíží obrázkům poškozených porostů
jírovců v západní Evropě. Účinná ochrana proti bakterii Psa neexistuje. Všeobecně se
doporučuje udržovat porosty jírovců v dobré kondici. Bylo zaznamenáno, že výraznější projev
chřadnutí stromů s BC byl u jedinců se slabší vitalitou, přičemž např. eliminace minování
klíněnky jírovcové měla na posílení vitality významný vliv (Percival a Noviss, 2010).
Tabulka 1: Výsledky identifikace a testů patogenity izolátů rodu Pseudomonas získaných z pletiv
jírovce maďalu odebraných v letech 2010-2012 na lokalitách ČR s podezřením na výskyt
původce bleeding canker, bakterie Pseudomonas syringae pv. aesculi
rok
vzorek
odběru lokalita
identifikace
t.patogenity
číslo
období
BIOLOG
MIDI
qPCR tabák jírovec
2010
Havířov
6335/1 P. fluorescens
Ps. pv. syringae
N
+
jaro
6335/3 Ps. pv. aceris*
P. putida B
N
N
6335/4 Ps. pv. syringae*
neidentifikováno
N
N
Karviná
6336/1 P. fluorescens
Ps. pv. syringae
+
6338/2A P. marginalis
Ps. pv. tabaci *
N
Praha
6338/2B Ps. pv. helianthi*
Ps. pv. syringae
+
2010
Ostrov
6399/1A Ps. pv. helianthi*
Ps. pv. syringae
N
pozdní
6399/1H Ps. pv. tomato*
Ps. pv. tomato*
+
+
léto
6399/1S Ps. pv. syringae
Ps. pv. tabaci
+
2010 Měděnec 6404/2A Ps. pv. syringae
Ps. pv. syringae
+
+
pozdní
6404/2E Ps. pv. tabaci
Ps. pv. syringae
+
+
N
léto
6404/2H Ps. pv. antirrhini
Ps. pv. tomato
+
+
N
2011 Měděnec
6523/1 Ps. pv. primulae
Ps. pv. syringae
N
N
podzim
6523/2A Ps. pv. primulae
Ps. pv. phaseolicola
N
+
N
6523/2B Ps. pv. antirrhini
Ps. pv. syringae
N
+
N
6523/3C Ps. pv. aceris
P. putida B
N
+
N
6523/3D Ps. pv. syringae
P. putida B
N
+
-
205
„Úroda 12/2012, vědecká příloha časopisu“
2012
jaro
6523/4
6523/10A
6523/10C
6523/11
6523/13
Olomouc
6637/2
6637/6
Měděnec
6649/1
6649/2
6649/3
Klatovy
6656/1
PK -2250
P. tolaasii
Ps. pv. antirrhini
Ps. pv. antirrhini
Ps. pv. pisi
Ps. pv. primulae
Ps. pv. aptata
Ps. pv. pisi
Ps. pv. antirrhini
P. fluorescens
P. fluorescens
Ps. pv. aptata
Ps. pv. tabaci
Ps. pv. syringae
Ps. pv. tagetes
Ps. pv. maculicola
Ps. pv. tabaci
Ps. pv. syringae
Ps. pv. maculicola
Ps. pv. tagetes
Ps. pv. tabaci
Ps. pv. tabaci
Ps. pv. antirrhini
Ps. pv. tagetes
Ps. pv. tabaci
N
N
N
N
N
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
N
+
+
N
N
+
+
+
+
* - izolát s indexem podobnosti SimIndex < 0,5; P. – Pseudomonas; Ps. – Pseudomonas syringae; N netestován; intenzita reakce - negativní (-), pozitivní (+)
Závěr
Choroba BC na jírovci maďalu vyvolaná bakterií Psa byla v roce 2010 poprvé prokázána v
ČR. Vzhledem k více jak desetiletým zkušenostem v některých státech západní Evropy lze
předpokládat její postupné plošné šíření. K závažnosti situace přispívá jednak skutečnost, že
původcem BC jsou napadány stromy všech věkových kategorií a bez ohledu na charakter
lokality a jednak vysoké zastoupení jírovců v užitných výsadbách v ČR. Z hlediska úrovně
chřadnutí jírovců s BC ukazují současné výsledky na zhoršování stavu stromů v důsledku
komplexního působení s dalšími biotickými a abiotickými faktory.
Dedikace
Tato práce byla podpořena výzkumným projektem NAZV QI 92A246.
Použitá literatura
Green S., Laue B., Fossdal C. G., A’hara S.W. and Cottrell J. E. (2009): Infection of horse
chestnut (Aesculus hippocastanum) by Pseudomonas syringae pv. aesculi and its detection
by quantitative real-time PCR. Plant Pathology 58, p: 731–44.
King E. O., Ward M. K. & Raney D. E. (1954): Two simple media for the demonstration of
phycocyanin and fluorescin. J Lab Clin Med 44, p: 301–307.
Mertelík J., Kloudová K., Pánková I., Krejzar V. and Kůdela V. (2012): Vývoj slizotokové
nekrózy jírovců způsobené infekcí Pseudomonas syringae pv. aesculi v období 2010 až
2012 na první lokalitě prokázaného výskytu choroby v ČR. Acta Pruhoniciana 101(v
tisku).
Percival C. G. and Noviss K. (2010): Managing Pseudomonas Bleeding Canker of Horse
Cheastnut.Bartlet
Tree
Research
Laboratories
Technical
Report.
http://www.bartlett.com/resources/Managing-Pseudomonas-Bleeding-Canker-of-HorseChestnut.pdf
Stelfox D. and Herbut M. (1979): Growth of a Phytophthora sp. on carrot agar. Can. Plant
Dis. Surv. 59(3), p: 61-62.
Kontaktní adresa:
Iveta Pánková, Ph.D., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, 161 06 Praha
6 – Ruzyně, [email protected]
206
„Úroda 12/2012, vědecká příloha časopisu“
VLIV LOKALITY NA KONTAMINACI SEMEN ŘEPKY OLEJKY
OZIMÉ PATOGENY ALTERNARIA BRASSICAE, ALTERNARIA
BRASSICICOLA A LEPTOSPHAERIA MACULANS,
LEPTOSPHAERIA BIGLOBOSA
Location effect on contamination of winter oilseed rape seeds by pathogens
Alternaria brassicae, Alternaria brassicicola and Leptosphaeria maculans,
Leptosphaeria biglobosa
Plachká E.1, Macháčková I.2
1
2
OSEVA vývoj a výzkum s.r.o., provozovna Opava
SELGEN, a.s., Šlechtitelská stanice Chlumec nad Cidlinou
Abstrakt
Cílem práce bylo kvantifikovat přenos patogenů Alternaria brassicae, A. brassicicola a Leptosphaeria
maculans, L. biglobosa osivem. Pro tyto účely jsme modifikovali metodiku zkoušení pro stanovení
kontaminace semen. Semena jsme umístili na filtrační papír do roztoku kyseliny 2,4dichlorfenoxyoctové. Inkubace patogenů na semenech probíhala při střídání UVC záření a tmy.
Pracovali jsme se 46 vzorky semen z lokalit Opava a Chlumec n. C. sklizených v letech 2010 a 2011.
U Alternaria spp. byla zjištěna kontaminace od 20 % do 95 % semen z lokality Chlumec n. C. a 47 %
až 100 % z lokality Opava. U Leptosphaeria spp. byla stanovena kontaminace 0 % až 4 % sklizně
z Chlumce n. C. a 0 % až 5 % z Opavy. U Alternaria brassicae, A. brassicicola byla potvrzena
korelace mezi lokalitou a kontaminací semen. Byla také zjištěna korelace mezi napadením rostlin
patogeny Leptosphaeria spp. na poli a kontaminací sklizně z lokality Chlumec n. C.
Klíčová slova: Ozimá řepka; kontaminace semen; Alternaria brassicae; Leptosphaeria maculans;
Leptosphaeria biglobosa
Abstract
The aim of this work was to quantify Alternaria brassicae, A. brassicicola and Leptosphaeria
maculans, L. biglobosa pathogens transport by seeds. The testing method for the detection of seed
contamination was modified for this purpose. The seeds were placed on filter paper soaked with 2,4dichlofenoxyacetic acid. Incubation of the pathogens was under alternation of the UVC radiation and
dark periods. In 2010, 2011 forty six seeds samples from the harvest of the locations Opava and
Chlumec n. C. were tested. Pathogen Alternaria spp. contaminated from 20 to 95 % of the harvest
from the location Chlumec n. C. and 47 % to 100 % of the havest from Opava. Leptosphaeria spp.
contaminated from 0 % to 4 % of the harvest from Chlumec n. C. and 0 % to 5 % from Opava. The
correlation between location and seed contamination by Alternaria brassicae, A. brassicicola observed
was confirmed. The correlation was also detected between plant infection by Leptosphaeria spp. in the
field and the seed harvest contamination from location Chlumec n. C.
Key words: Winter oilseed rape; seed contamination; Alternaria brassicae; Leptosphaeria maculans;
Leptosphaeria biglobosa
Úvod
Řepka olejka je celosvětově druhou nejvýznamnější olejninou s přibližnou produkcí 55
milionů tun semen. Jejím největším producentem je Evropská unie a po té Čína (Baranyk a
kol., 2010). V ČR se pěstuje převážně ozimá forma. Osevní plochy se od roku 2007 pohybují
mezi 300 - 370 tisíci hektary. V pěstování řepky mají velký význam choroby alternáriová
skvrnitost brukvovitých a fomová hniloba brukvovitých. Ty způsobují padání klíčních rostlin,
nouzové dozrávání a předčasné otevírání šešulí. Jako původce alternariové skvrnitosti
brukvovitých jsou uváděny dva patogeny - Alternaria brassicae (Berk.) Sacc. a Alternaria
brassicicola (Schwein.) Wiltsh. (Hoffmann, Schmutterer 1999). U fomové hniloby
brukvovitých jsou také uváděny dva patogeny - Leptosphaeria maculans (Desm.) Ces. et de
207
„Úroda 12/2012, vědecká příloha časopisu“
Not. a Leptosphaera biglobosa sp. Nov. Shoemaker & Brun. Oba patogeny mají společné
imperfektní stádium Phoma lingam (Tode ex Fr.) Desm. (Rimmer and Berg, 2007). L.
biglobosa je obecně méně škodlivá, způsobuje povrchové léze na stonku, L. maculans je
hodnocena jako více škodlivá, způsobuje hnilobu (rakovinu) báze stonku (West et al. 2002 cit.
podle Huang et al. 2005). Infekčním zdrojem jsou posklizňové zbytky rostlin řepky a semena.
Přenos semeny byl prokázán. U A. brassicae a A. brassicicola se jedná o přenos sporami nebo
myceliem v osemení. Infekce semen může být vyšší než 20 %. Po 3 měsících skladování
může infekce poklesnout o 50 %. Vysoké ztráty byly zaznamenány na sazenicích zelí
vypěstovaných z osiva s kontaminací 80 %. Kontaminace osiva patogeny L. maculans a L.
biglobosa zůstala v mnoha polních pokusech i přes vysoké napadení stonku nižší než 1 %.
Přenos patogenů L. maculans, L. biglobosa semeny má větší význam u brukvovitých zelenin
při pěstování jejich sadby, protože sazenice jsou infikovány již během růstu (Hoffmann,
Schmutterer 1999).
V ČR chyběla pro potřebu šlechtitelů dostupná metodika pro hodnocení kvality zdravotního
stavu osiva šlechtitelských materiálů a nebyly k dispozici informace o vlivu lokalit množení
na zdravotní stav osiva. Pro tyto účely byla modifikována metodika pro hodnocení
kontaminace semen patogeny Leptosphaeria maculans a Alternaria linicola (Chadová, 2006)
pro patogeny Altermaria brassicae, A. brassicicola a Leptosphaeria maculans, L. biglobosa.
Pomocí modifikované metodiky byla v letech 2010 a 2011 vyhodnocena kontaminace semen
uvedenými patogeny a vliv lokality na zdravotní stav osiva.
Materiál a metody
V roce 2009/2010 a 2010/2011 jsme na sledovaných lokalitách Opava a Chlumec nad
Cidlinou založili polní výkonové zkoušky se stejnými materiály řepky olejky ozimé s nízkým
obsahem glukosinolátů a kyseliny erukové. Hodnocení zdravotního stavu rostlin jsme
provedli ve fázi BBCH 85 (asi 50 % šešulí vyzrálých) stupněm 1 až 9. Pro fomovou hnilobu
brukvovitých/fomové černání stonku je stupeň 9 – bez výskytu choroby, stupeň 1 - více než
50 % rostlin má alespoň jednu skvrnku na hlavním stonku, část skvrn obepíná více než 80 %
stonku. Pro alternárivou skvrnitost brukvovitých/čerň řepkovou je stupeň 9 – bez výskytu
choroby, stupeň 1 - je napadeno více než 75 % plochy větví nebo šešulí. V roce 2010 jsme ze
sklizně testovaného souboru vybrali 11 materiálů, v roce 2011 byl testován celý soubor, to je
35 materiálů z každé lokality. U těchto vzorků jsme stanovili kontaminaci semen patogeny A.
brassicae, A. brassicicola a L. maculans, L. biglobosa.
Jako výchozí metodiku pro stanovení kontaminace semen sledovanými patogeny jsme použili
filtrační metody pro Alternaria linicola a Leptosphaeria maculans (Chadová 2006). Pracovali
jsme s modifikovanou metodou pro podmínky fytopatologické laboratoře v Opavě.
Modifikaci metody jsme realizovali před založením uvedených testů. Velikost zkušebního
vzorku byla 100 semen. Ošetření semen: propláchnutí destilovanou vodou a umístění po 25
semenech na 1 Petriho misku na médium. Médium: 3 vrstvy filtračního papíru s 6 ml 0,2%
roztoku sodné soli kyseliny 2,4-dichlorfenoxyoctové. Po té probíhala inkubace patogenů 11
dní při laboratorní teplotě a střídání UVC záření (9 hodin) a tmy (15 hodin). Jako zdroj záření
jsme použili germicidní lampu vysílající záření s vlnovou délkou 253,7 nm.
Před diagnostikou kolonií černí – A. brassicae, A. brassicicola jsme kolonie černí potvrdili
vyhodnocením přítomnosti konidií patogenů u 20 namátkově vybraných kolonií. Z nich jsme
připravili mikroskopický preparát a vyhodnotili přítomnost konidií pomocí mikroskopu Carl
Zeiss Jena při 312,5 násobném zvětšení. Po té jsme kolonie černí diagnostikovali pomocí 25
násobného zvětšení pomocí binokulární lupy. Diagnostiku pyknid patogenů L. maculans, L.
biglobosa jsme provedli přímo pomocí binokulární lupy při 25 násobném zvětšení.
208
„Úroda 12/2012, vědecká příloha časopisu“
Na závěr testu jsme v procentech vyhodnotili kontaminaci semen v 1 vzorku a průměrnou
kontaminaci, provedli statistické posouzení vlivu napadení rostlin na kontaminaci semen a
kontaminací semen a vlivu lokality. K vyhodnocení jsme použili program MS Office Excel.
Výsledky a diskuze
Kontaminace semen jednotlivých materiálů patogeny A. brassicae, A. brassicicola se ve
sledovaných letech pohybovala od 20 % do 100 %. Průměrná kontaminace semen na lokalitu
se v obou letech pohybovala od 37,89 % do 96,8 %. V literárních zdrojích je uvedeno, že
infekce semen může být vyšší než 20 % (Hoffmann, Schmutterer 1999). Získané výsledky
kontaminace semen byly v závislosti na materiálu, lokalitě a ročníku rovny a vyšší než 20 %.
V roce 2010 byla zaznamenána vyšší kontaminace sklizně z lokality Chlumec nad Cidlinou
92,4 %. V roce 2011 byla zaznamenána vyšší kontaminace sklizně z lokality Opava 96,8 %.
Kontaminace semen jednotlivých materiálů patogeny L. maculans, L. biglobosa se ve
sledovaných letech pohybovala od 0 % do 5 %. Průměrná kontaminace semen na lokalitu se
v obou letech pohybovala od 0,28 % do 1,46 %. Tato skutečnost odpovídá údajům citovaných
v zahraniční literatuře, že kontaminace osiva patogeny L. maculans a L. biglobosa zůstávala
v mnoha polních pokusech i přes vysoké napadení stonku nižší než 1 % (Hoffmann,
Schmutterer 1999). V roce 2010 byla zaznamenána vyšší kontaminace sklizně z lokality
Opava 1,46 %. V roce 2011 byla zaznamenána vyšší kontaminace sklizně z lokality Chlumec
nad Cidlinou 0,83 %.
Vedle kontaminace semen byl korelacemi posouzen vliv lokality na kontaminaci semen u
obou patogenů a vliv napadení rostlin na kontaminaci semen u patogenů L. maculans, L.
biglobosa. Byl potvrzen vliv lokality na kontaminaci semen patogeny A. brassicae, A.
brassicicola v obou sledovaných letech a vliv napadení rostlin patogeny L. maculans, L.
biglobosa na kontaminaci semen na lokalitě Chlumec nad Cidlinou v roce 2011. Vliv
napadení rostlin u A. brassicae, A. brassicicola na kontaminaci semen nebyl posuzován,
protože napadení před sklizní na poli bylo v obou letech a na obou lokalitách vyrovnané.
Výsledky jsou uvedeny v tabulkách 1 až 3.
Tabulka 1: Kontaminace semen patogeny A. brassicae, A. brassicicola a L. maculans, L.
biglobosa v roce 2010, 11 materiálů/vzorků, [%]
Opava
Chlumec n. Cidlinou
Materiál
A. brassicae
L. maculans
A. brassicae
L. maculans
A. brassicicola
L. biglobosa
A. brassicicola
L. biglobosa
Minimální
47
0
83
0
hodnota
Maximální
77
5
95
2
hodnota
Průměr
65,5
1,45
92,4
0,36
Tabulka 2: Kontaminace semen patogeny A. brassicae, A. brassicicola a L. maculans, L.
biglobosa v roce 2011, 35 materiálů/vzorků, [%]
Opava
Chlumec n. Cidlinou
Materiál
A. brassicae
L. maculans
A. brassicae
L. maculans
A. brassicicola
L. biglobosa
A. brassicicola
L. biglobosa
Minimální
86
0
20
0
hodnota
Maximální
100
2
68
4
hodnota
Průměr
96,8
0,28
37,89
0,83
209
„Úroda 12/2012, vědecká příloha časopisu“
Tabulka 3: Výpočet korelací, rok 2010/2011
Napadení
Lokalita
A. brassicae
0,86514728/-0,95082005
A. brassicicola
L. maculans
-0,46879199/0,31715157
L. biglobosa
L. maculans
Na poli
Na poli
Na poli
L. biglobosa
Opava
Chlumec n. Cidlinou
Opava, Chlumec n. C.
Semen
0,062253/-0,15209
-0,16652/-0,43568
-0,16356/-0,04553
Závěr
U Alternaria spp. byla vyšší kontaminace sklizně zjištěna v roce 2010 v Chlumci n. C. - 92,4
% a v roce 2011 v Opavě - 96,8 %. U Alternaria spp. byla v obou letech potvrzena korelace
mezi lokalitou a kontaminací semen. Kontaminace závisela na průběhu počasí na lokalitě.
U Leptosphaeria spp. byla v roce 2010 zjištěna vyšší kontaminace sklizně z Opavy - 1,45 % a
v roce 2011 z Chlumce n. C - 0,83 %. Korelace mezi lokalitou a kontaminací semen nebyla
v žádném roce potvrzena. V roce 2011 byla na lokalitě Chlumec nad Cidlinou potvrzena
korelace mezi napadením rostlin patogeny Leptosphaeria spp. před sklizní a kontaminací
sklizně.
Použitou filtrační metodu je možné použít pro stanovení kontaminace osiva patogeny
Alternaria brassicae, A. brassicicola a Leptosphaeria maculans, L. biglobosa.
Dedikace
Prezentované výsledky byly získány mimo jiné za finanční podpory projektu MZe ČR
QH82285.
Použitá literatura
Baranyk P., Soukup J., Balík J., Kazda J., Markytán P., Šaroun J., Zelený V., Volf M., 2010: Řepka
olejka ozimá, s. 9–57. In: BARANYK P. a kol.: Olejniny. Profi Press s.r.o., Praha, 206 s.
Hoffmann G. M., Schmutterer H., (1999): Parasitäre Krankheiten und Schädlinge an
landwirtschaftlichen Kulturpflanzen. 2. erweiterte und ergänzte Auflage. Verlag Eugen Ulmer
Stuttgart. s. 675.
Huang Y.J., Fitt B.D.L., Jedryczka M., Dakowska S., West J.S., Gladders P., Steed J.M., Li Z.Q.,
2005: Patterns af ascospore release in relation to phoma stem canker epidemiology in England
(Leptosphaeria maculans) and Poland (Leptosphaeria biglobosa). European Journal of Plant
Pathology, 111: 263-277.
Chadová J., 2006: Přehled chorob a skladištních škůdců na osivu vybraných druhů plodin : (metodika
zkoušení zdravotního stavu osiva). České Budějovice, Kurent 2006. 104 s.
Rimmer S.R., van den Berg C.G.J., 2007: Black Leg (Phoma Stem Cnaker), s. 19-22. In: Rimmer
S.R., Shattuck I.V. and Buchwald L. (ed.), Compendium of Brassica Disease. The American
Phytopathological Society.
West J.S., Balesdent M.H., Rouxel T., Narcy J.P., Huang Y.J., Roux J., Steed J.M., Fitt B.D.L.,
SCHMIT J., 2002: Colonisation of winter oilseed rape tissues by A/Tox+ and B/Tox0 Leptosphaeria
maculans (phoma stem canker) in France and England. Plant Pathology 51: 311-321.
Kontaktní adresa:
Ing. Eva Plachká, Ph.D.
OSEVA vývoj a výzkum s.r.o., provozovna Opava, Purkyňova 10, 746 01 Opava předměstí
[email protected]
210
„Úroda 12/2012, vědecká příloha časopisu“
ODOLNOST VYBRANÝCH GENOTYPŮ OZIMÉ ŘEPKY VŮČI
HOUBOVÝM PATOGENŮM TESTOVANÝCH V MEZISTANIČNÍCH
ZKOUŠKÁCH VÝKONU V LETECH 2010–2012
Resistance of selected genotypes of winter oilseed rape to fungal pathogens
tested in interstation tests of performance in 2010–2012
Poslušná J.1, Plachká E.2
1
2
Agritec Plant Research s.r.o.
OSEVA PRO s.r.o., oz VÚO Opava
Abstrakt
Od roku 2000 probíhá v ČR testování nových genotypů ozimé řepky v mezistaničních předzkouškách
výkonu na vybraných stanovištích. Byly posuzovány zejména hospodářské vlastnosti včetně
vyhodnocení výnosu a odolnosti vůči významným houbovým patogenům, které představuje
Leptosphaeria maculas / L. biglobosa (původce fomové hniloby brukvovitých) a Sclerotinia
sclerotiorum (původce bílé hniloby řepky). Nové genotypy ozimé řepky pocházely ze šlechtitelských
stanic v Opavě, Chlumci nad Cidlinou a ve Slapech a byly testovány na vybraných lokalitách
v Šumperku, Chlumci nad Cidlinou a v Kujavách. V letech 2010 až 2012 bylo každoročně testováno
na 50 nových materiálů. Získané výsledky potvrdily šlechtění odolnějších materiálů vůči sledovaným
houbovým patogenům při dosažení stabilního výnosu. Původ genotypů průkazně neovlivnil získané
výsledky jejich odolnosti, přesto nejvyšší průměrné hodnoty odolnosti vůči vybraným patogenům před
sklizní byly pozorovány u genotypů ze šlechtitelské stanice Opava a Chlumec nad Cidlinou.
Klíčová slova: ozimá řepka, genotypy, šlechtění na odolnost, fomová hniloba brukvovitých, bílá
hniloba řepky
Abstract
Since 2000 new genotypes of winter oilseed rape have been tested in interstation tests of performance
at selected sites in Czech Republic. There were assessed particularly economic evaluation of
properties, including yield and resistance to major fungal pathogens as Leptosphaeria maculas / L.
biglobosa (causing phoma stem canker) and Sclerotinia sclerotiorum (causing white rot). New
genotypes of winter oilseed rape derived from breeding stations in Opava, Chlumec Cidlinou and
Slapy and were tested at selected locations in Šumperk, Chlumec Cidlinou and Kujavy. In the years
2010 to 2012 there were tested annually about 50 new materials. The results confirmed the breeding of
more resistant materials to fungal pathogens with achieving a stable yield. The origin of the genotypes
did not significantly affect the results of their resistance to fungal pathogens. Nevertheless, the highest
average values of resistance to fungal pathogens before harvest were observed in genotypes from
breeding station Opava and Chlumec Cidlinou.
Keywords: winter oilseed rape, genotypes, breeding for resistance, phoma stem canker, Sclerotinia
white rot
Úvod
Mezi významné choroby řepky olejky patří zejména fomová hniloba brukvovitých, bílá
hniloba řepky a šedá plísňovitost brukvovitých. Fomová hniloba brukvovitých, kterou
způsobuje komplex patogenů Leptosphaeria maculans / L. biglobosa, může při zvýšené míře
napadení porostů způsobit až 10% škody na výnosu, v letech se silným výskytem chorob až
30-50 % dle míry napadení (Kazda et al., 2008). Stejně tak bílá hniloba řepky, kdy polyfágní
patogen Sclerotinia sclerotiorum napadá celé rostliny řepky, zamořuje pozemek novými
sklerocii, která dlouhodobě přežívají v půdě a mohou následně infikovat následné plodiny.
Obě choroby způsobují nouzové dozrávání, což je nežádoucí faktor ovlivňující výnos i kvalitu
produkce (Poslušná, Plachká, 2009b).
211
„Úroda 12/2012, vědecká příloha časopisu“
Testování hospodářských vlastností nových materiálů v předzkouškách výkonu na více
lokalitách s rozdílnými klimatickými podmínkami značně přispívá k segregaci vhodných a
slibných materiálů, které dále pokračují do Státních odrůdových zkoušek. (Poslušná, Plachká,
2009a). Nejen díky tomuto procesu byly letos přihlášeny nové odrůdy ozimé řepky Oceania a
Orion, které zastupuje/vlastní firma OSEVA PRO, s.r.o. a odrůda Cortes zastoupená firmou
SELGEN a.s. (OSEVA, Agro Brno, 2012).
Materiál a metody
Polní pokusy s novými genotypy ozimé řepky byly založeny na vybraných stanovištích
v Šumperku, Chlumci nad Cidlinou a v Kujavách. Maloparcelkové pokusy s parcelami o
velikosti 10 m2 jsou plně randomizovány a pokus byl veden ve 3 opakováních. Jako kontrolní
materiál k novým genotypům byly vybrány registrované odrůdy totožné s kontrolními
odrůdami ve státních odrůdových zkouškách. Hodnocení zdravotního stavu a výskytu
významných houbových chorob probíhalo dle Metodiky ÚKZÚZ v Brně pro zkoušky užitné
hodnoty odrůd řepky olejky ozimé (2005). Zdravotní stav genotypů se hodnotil v růstové fázi
BBCH 85. Dle míry poškození rostlin chorobami byly zařazeny do jednotlivých stupňů
napadení. Napadení fomovou hnilobou se posuzuje dle 9 stupňů poškození: 9 – bez výskytu, 8
– ojedinělý výskyt tj. 1-2 rostliny se skvrnou na stonku na parcele; 7 – do 10 % rostlin se
skvrnou na hlavním stonku; 5 – do 20 % rostlin má alespoň jednu skvrnu na hlavním stonku;
3 – do 50 % rostlin má alespoň jednu skvrnu na hlavním stonku, část skvrn obepíná více než
80 % obvodu stonku; 1 – více jak 50% rostlin má alespoň jednu skvrnu na hlavním stonku,
většina skvrn obepíná více než 80 % stonku. Napadení bílou hnilobou řepky se posuzuje dle 6
stupňů napadení: 9 – bez výskytu; 8 – ojedinělý výskyt tj. 1-2 rostliny na parcelu; 7 – do 5 %
rostlin; 5 – do 10 % rostlin; 3 – do 50 % rostlin; 1 – více než 50 % rostlin. Získaná data byla
statisticky porovnána za pomocí vybraných statistických metod: srovnání dle Abbotta a Tukey
test: P=0,10; P=0,05.
Výsledky a diskuze
Výskyt houbových chorob v porostu je značně závislý na zdroji infekce a na průběhu
povětrnostních podmínek. Z grafu č. 1 je patrné, že výskyt sledovaných chorob a průměrný
stupeň poškození řepkových porostů ve vybraných ročnících je rozdílný. Na lokalitě Šumperk
byly získány výsledky poměru napadení fomovou hnilobou brukvovitých a bílé hniloby řepky
v roce 2010 (7,30 : 6,26), v roce 2011 (7,09 : 5,74) a v roce 2012 (5,27 : 6,49), veskrze tedy
nízké až střední napadení houbovými chorobami. Na lokalitě Chlumec nad Cidlinou se
jednalo o poměry nízkého a středního stupně napadení chorobami v letech 2010 (7,30 : 6,65)
a 2012 (5,79 : 7,94), v roce 2011 se jednalo o střední napadení oběma chorobami 5,70 : 5,63.
Na lokalitě Kujavy byl zdravotní stav řepkových porostů hodnocen jako komplex houbových
chorob jedním číslem. Výsledky nabývaly středních až vysokých stupňů napadení – v roce
2010 (5,48), v roce 2011 (4,12) a v roce 2012 (7,27).
V následujících grafech jsou znázorněny hodnoty napadení houbovými chorobami vzestupně,
tedy od nejvíce napadeného genotypu ozimé řepky po nejméně napadený genotyp.
Byl hodnocen vliv původu vybraných genotypů na odolnost vůči komplexu houbových
patogenům, výsledky však nebyly statisticky průkazné. Mezi „top ten“ testované genotypy
v roce 2010 patřily materiály ze Slap a Chlumce nad Cidlinou, v roce 2011 materiály ze
šlechtitelských stanic Opava a Slapy a v roce 2012 převažovaly materiály ze šlechtitelské
stanice Opava a Chlumec nad Cidlinou. Avšak v průměru lze dle hodnocení pořadí v grafech
2 - 4 usuzovat, že odolnější genotypy pocházejí ze šlechtitelských stanic Opava a Chlumec
nad Cidlinou.
212
„Úroda 12/2012, vědecká příloha časopisu“
Graf č. 1: Hodnocení odolnosti vybraných genotypů ozimé řepky vůči houbovým
patogenům v MPZ na zkušebních stanicích
Graf č. 2: Odolnost vybraných genotypů ozimé řepky vůči komplexu houbových
patogenů v roce 2010
Graf č. 3: Odolnost vybraných genotypů ozimé řepky vůči komplexu houbových
patogenů v roce 2011
213
„Úroda 12/2012, vědecká příloha časopisu“
Graf č. 4: Odolnost vybraných genotypů ozimé řepky vůči komplexu houbových
patogenů v roce 2012
Závěr
1) Při testování genotypů ozimé řepky na odolnost vůči komplexu houbových patogenů, měla
více jak polovina materiálů výrazně lepší zdravotní stav než kontrolní registrované odrůdy.
2) Nejvyšší průměrné hodnoty odolnosti vůči komplexu houbových patogenů před sklizní
byly pozorovány u genotypů ze šlechtitelské stanice Opava a Chlumec nad Cidlinou.
3) Testování v mezistaničních předzkouškách slouží k selekci slibných genotypů ozimé řepky,
které mají zvýšenou šanci ve Státních odrůdových zkouškách.
Dedikace
Výsledky vycházejí z řešeného projektu MZe ČR NAZV QI111A075.
Použitá literatura
Kazda J., Škeřík J. a kol. 2008. Metodika integrované ochrany řepky. SPZO s.r.o., Praha, 78 s.
OSEVA, Agro Brno. 2012. Nabídka osiva a sadby. Podzim 2012. [online]. [cit. 2012-08-27].
Dostupné z: http://www.oseva-agro.cz/sub/3/Podzim2012.pdf
Poslušná J., Plachká E. 2009a. Monitoring výskytu významných chorob řepky olejky a
odolnost vybraných řepkových genotypů vůči fomové hnilobě (L. maculans) a hlízence
obecné (S. sclerotinia). S. 111. In: Šafránková I., Šefrová H. (eds): XVIII. Česká a
slovenská konference o ochraně rostlin. Sborník abstraktů. MZLU v Brně, 2. – 4.září 2009,
239 s.
Poslušná J., Plachká E. 2009b. Odolnost vybraných genotypů ozimé řepky olejky vůči
fomové hnilobě brukvovitých (Leptosphaeria maculans)a bílé hnilobě řepky (Sclerotinia
sclerotiorum) hodnocených na zkušebních lokalitách v Šumperku a Opavě, Úroda 12/2009,
vědecká příloha s. 191-194
Kontaktní adresa:
Ing. Jana Poslušná
Agritec Plant Research, s.r.o.
Zemědělská 2520/16, 787 01 Šumperk
e-mail: [email protected]
214
„Úroda 12/2012, vědecká příloha časopisu“
VYUŽITÍ METODY MATENÍ SAMCŮ PROTI NESYTCE JABLOŇOVÉ
(SYNANTHEDON MYOPAEFORMIS)
Mating disruption method use against apple clearwing moth
(Synanthedon myopaeformis)
Psota V., Bagar, M
BIOCONT LABORATORY
Abstrakt
V letech 2010 – 2012 byl sledován vliv metody matení samců (Isomate P) na výskyt housenek nesytky
jabloňové (Synanthedon myopaeformis Borkhausen, 1789). Sledování probíhalo v produkčních sadech
na lokalitě Tuchoraz (36 ha) a ve dvou sousedících sadech (sad 9 – 6,5 ha, sad 10 – 12 ha) na lokalitě
Stošíkovice. Metoda matení samců byla aplikována v letech 2010, 2011 v dávce 300 odparníků na ha
(pouze ve Stošíkovicích v roce 2011 bylo 220 dparníků/ha). Hodnocení průměrného výskytu housenek
na jeden strom bylo provedeno každoročně v měsíci dubnu. Na lokalitě Tuchoraz byl zjištěn
následující průměrný výskyt housenek na jeden strom: 2010 – 0,57; 2011 – 0,36 a 2012 – 0,17. Na
lokalitě Stošíkovice průměrný výskyt housenek následující: Sad 9: 2010 – 1; 2011 – 0,13 a 2012 –
0,69; sad 10: 2010 – 1,63; 2011 – 0,5 a 2012 – 1,31.
Klíčová slova: nesytka jabloňová, sady, metoda matení samců, feromony, jabloně
Abstract
The effect of mating disruption method Isomate P (Shin-Etsu, Japan) on apple clearwing moth
(Synanthedon myopaeformis Borkhausen, 1789) larvae occurrence was evaluated during the years
2010, 2011 and 2012 in apple orchards in the Czech Republic on localities Tuchoraz (36 ha) and
Stošíkovic. Location Stošíkovice was consisted of two adjacent orchards (sad 9 – 6.5 ha and aad 10 –
12 ha) Isomate P was applied in 2010 and 2011. Dosage of Isomate P was 300 dispensers per hectare
in Tuchoraz. It Stošíkovice it was 300 dispensers per hectare in 2010 and 220 dispensers per hectare in
2011. Average occurrence of apple clearwing moth larvae was evaluated during April every year. We
found 0.57 larvae per tree in 2010, 0.36 in 2011 and 0.17 in 2012 on the locality Tuchoraz. On the
locality Stošíkovice we found on part sad 9 1 larvae per tree in 2010, 0.13 in 2011 and 0.69 in 2012.
On part sad 10 it was 1.63 larvae per tree in 2010, 0.5 in 2011 and 1.31 in 2012.
Key words: apple clearwing moth, orchards, mating disruption, pheromones, apple
Úvod
Metoda matení samců je založena na postupném uvolňování samičího sexuálního feromonu
ze speciálních odparníků. Tyto odparníky se ve specifickém počtu dle druhu škůdce rozvěsí
před začátkem jeho letu na vybrané ploše. Feromon se pak postupně uvolňuje a ulpívá také na
listech a veškerý zelený porost pak funguje jako sekundární odparník. Tím je pak „vůně“
samic překryta. Samci nejsou schopni nalézt samici a nedochází ke spáření (Psota, 2010).
V České republice se metoda matení samců používá v sadech proti obaleči jablečnému (Falta
a kol., 2008). Do budoucna se také uvažuje o využití proti obaleči východnímu a obaleči
švestkovému (Psota, 2010). Ověřována byla také proti nesytce rybízové (Ouředníčková,
2011).
Dalším potenciálním škůdcem, kde by měla metoda matení samců význam je nesytka
jabloňová (Synanthedon myopaeformis Borkhausen, 1789). Její škodlivost v posledních letech
stoupá a to především ve starších výsadbách. Přednostně jsou napadány pravidelně a hluboce
řezané stromy (Laštůvka a Šefrová, 2012). Na škodlivost a četnost populace nesytky
jabloňové může mít zásadní vliv také průběh počasí (Laštůvka, osobní sdělení), avšak tento
faktor nebyl prozatím podrobně studován. Škodlivé výskyty jsou známé z celého území České
republiky. Škodlivost spočívá především v postupném chřadnutí stromů a snižování jejich
životnosti. Vzhledem k tomu, že housenka nesytky jabloňové žije v lýkové části pod kůrou
215
„Úroda 12/2012, vědecká příloha časopisu“
(Alford, 2007), je téměř nemožné zasáhnout ji insekticidem ve formě postřiku. Prozatím se
využívá především regulace četnosti dospělců pomocí potravních atraktantů (Lánský a kol,
2005). Metoda matení samců by mohla ochránit především mladé výsadby před rozvojem
napadení tímto škůdcem.
Materiál a Metody
V letech 2010 – 2012 jsme ověřovali efekt metody matení samců na četnost housenek nesytky
jabloňové. Pro účely tohoto sledování jsme využili produkt Isomate P japonské firmy ShinEtsu. Jeden odparník obsahuje 180 mg sexuálního feromonu nesytky jabloňové. V dávce 300
odparníků na hektar byl feromon aplikován na dvou lokalitách v produkčních sadech vždy
v poslední dekádě měsíce dubna.
Na první lokalitě (Tuchoraz, střední Čechy) byly feromony aplikovány na ploše 36 hektarů.
Sad byl vysázen v roce 2005 a pěstované odrůdy byly Gala, Golden delicious, a Idared.
Druhá lokalita se nachází na jižní Moravě (Stošíkovice) a feromony byly aplikovány v roce
2010 a 2011 na ploše 18,5 ha ve dvou sousedících sadech (sad 9 - 6,5 ha a sad 10 – 12 ha).
V roce 2011 byla z důvodu meziročního poklesu četnosti nesytky jabloňové dávka na lokalitě
Stošíkovice snížena na 220 odparníků na hektar.
Sad byl vysázen v průběhu let 2007 – 2009. Pěstované odrůdy byly Gala, Golden delicious,
Idared a Breaburn.
Na každé lokalitě jsme vždy v měsíci dubnu hodnotili průměrný výskyt housenek nesytky
jabloňové. Na lokalitě Tuchoraz je sledovaná plocha rozdělena na tři části (sad 3, sad 4 a sad
5). Tyto části jsou rozděleny cestou pro mechanizační prostředky. V každé části byl výskyt
hodnocen vždy na 25 stromech. Na lokalitě Stošíkovice jsme vždy hodnotili 16 stromů. Na
této lokalitě jsme navíc v letech 2010 a 2012 provedli hodnocení v blízkém sadu, bez metody
matení samců. Tento kontrolní sad byl dostatečně vzdálen od feromony ošetřené plochy, tak
aby se tento vliv neprojevil. Četnost housenek byla stanovována při bázi kmene, kde se
housenky nejčastěji vyskytuji. Na místech s podezřením na výskyt housenek nesytky jsme
kůru stromu narušili pomocí kapesního nože a stanovili počet housenek.
Získaná data byla statisticky vyhodnocena pomocí analýzy variance a Tukeyova testu (α 0,05)
v programu Statistica CZ 10 (StatSoft, 2011).
Výsledky a diskuse
Na lokalitě Tuchoraz došlo na sledované ploše ke každoročnímu snižování průměrné četnosti
housenek (obr. 1). Přičemž statisticky významný rozdíl byl prokázán mezi roky 2010 a 2012
(F 8,72; p 0,0002).
Na lokalitě Stošíkovice byl v části Sad 9 v prvním roce pokusu dne 6. 4. 2010 zjištěn
průměrný výskyt housenek v množství 1 kus na strom. V roce 2011 (hodnoceno 14. 4. 2011)
došlo k výraznému snížení četnosti. V roce 2012 se pak četnost housenek opět zvýšila, avšak
nedosáhla úrovně jako v roce 2010 (obr. 2). Dle Tukeyova testu (α 0,05) se četnost v roce
2011 prokazatelně liší od roku 2010 a také 2012 (F 5,27; p 0,01). V části sad 10 byl průměrný
výskyt housenek 1,63, v roce 2011 – 0,5 a v roce 2012 1,31 (obr. 3). Stejně jako v sadu 9 se i
v části sad 10 statisticky prokazatelně lišší výskyt housenek v roce 2011 od roku 2010 a 2012
(F 3,68; p 0,35). Na kontrolní ploše byl průměrný výskyt housenek na jeden strom v roce
2010 1,68 a v roce 2012 to bylo už 2,6.
Z výsledků je patrný rozdíl mezi lokalitami, kdy na větší ploše v Tuchorazi (36 ha) dochází
k postupnému snižování četnosti housenek. Naopak, na menší ploše na lokalitě Stošíkovice
není toto snižovaní tolik výrazné. Je otázkou, jakou roli v nárůstu populační hustoty zahrálo
meziroční snížení dávky a jakou jiné vlivy (např. počasí). Je však patrný rozdíl ošetřené
plochy v porovnání s plochou kontrolní, kde došlo ke zvýšení napadení.
216
„Úroda 12/2012, vědecká příloha časopisu“
Je známo, a uvedené výsledky to potvrzují, že na větších plochách je účinnost metody
dezorientace vyšší a je nižší riziko komplikací. Obecně se uvádí, že minimální plocha, kde
matení samců proti nesytce jabloňové funguje, je zhruba 10 ha. Na druhou stranu tato plocha
může být i výrazně menší, pokud půjde o izolovaný sad bez blízkých zdrojů nesytky
jabloňové v okolí.
Závěr
Z výsledků je patrné, že metoda matení (Isomate P) může účinně ochránit výsadby jabloní
před napadením nesytkou jabloňovou. Je zřejmé, že vyšší účinnosti bude dosahováno na
větších plochách s rozlohou řádově desítek hektarů.
Obrázek 1. Průměrný výskyt housenek na jeden strom na lokalitě Tuchoraz
Obrázek 2. Průměrný výskyt housenek na jeden strom na lokalitě Stošíkovice (část 9)
217
„Úroda 12/2012, vědecká příloha časopisu“
Obrázek 3. Průměrný výskyt housenek na jeden strom na lokalitě Stošíkovice (část 10)
Dedikace
Za spolupráci na tomto sledování děkujeme podnikům AGRO Stošíkovice, s.r.o. a Sady
Tuchoraz s.r.o.
Výzkum byl podpořen z projektu NAZV QJ1210209.
Použitá literatura
Alford, D. V., 2007: Pest of fruit crops. Manson Publishing, London. 461 s.
Falta, V, Stará, J., Kocourek, F., 2008: Metoda dezorientace v ochraně ovocných sadů proti
škodlivým obalečům. VÚRV, 31 s.
Laštůvka, Z., 2012: Osobní sdělení (e-mial).
Laštůvka, Z, Šefrová, H., 2012: Škodlivost nesytek (Sesiidae) mírně narůstá. s. 63-64. In:
Bokor, P., Tóthová, M. (Eds.)., Zborník abstraktov z XIX. Slovenskej a českej konferencie
o ochrane rastlín. Slovak University of Agriculture in Nitra. 165 s.
Lánský, M., Falta, V., Kloutvorová, J., Kocourek, F., Stará, J., Pultar, O., 2005: Integrovaná
ochrana ovoce v systému integrované produkce. Výzkumný a šlechtitelský ústav
ovocnářský, Holovousy. 159 s.
Ouředníčková, J., 2011: Využití feromonů v ochraně rybízu – I. díl. Zahradnictví, 10(11), 2022.
Psota, V., 2010: Metoda matení samců obalečů: délka odparu feromonů v podmínkách České
republiky. Zahradnictví, 9(9): 12-14.
StatSoft, Inc., 2011. STATISTICA (data analysis software system), version 10.
www.statsoft.com.
Kontaktní adresa:
Ing. Václav Psota, Ph.D.
BIOCONT LABORATORY spol. s r.o.
Šmahova 66, 627 00 BRNO
[email protected]
218
„Úroda 12/2012, vědecká příloha časopisu“
INTENZITA NAPADENÍ RŮZNÝCH ODRŮD ČESNEKU
VLNOVNÍKEM ACERIA TULIPAE (KEIFER) (ACARI: ERIOPHYIDAE)
The intensity of infestation of different garlic varieties by dry bulb mite
Aceria tulipae (Keifer) (Acari: Eriophyidae)
Sapáková E. 1, Hasíková L.1 Hřivna L.1 Stavělíková H.2 Šefrová H.1
1
2
Mendelova univerzita v Brně
ýzkumný ústav rostlinné výroby, v.v.i., pracoviště Olomouc
Abstrakt
Bylo hodnoceno napadení jedenácti odrůd česneku kuchyňského vlnovníkem Aceria tulipae (Keifer,
1938). Výzkum byl prováděn v zimním období 2011–2012 na skladovaném česneku, pocházejícím ze
střední Moravy (210 m n. m.). Odrůdy vytvářející květní stvol (Bzenecky Mutant VF, Sochi 25,
Tiraspol, Zailijskij) byly vlnovníkem A. tulipae silně napadené. Odrůdy nevytvářející květní stvol
(Czerga, SIR 10 new breeding, Gjirokaster) byly slabě napadené a odrůda Kelcyre nebyla napadena
vůbec. Nejvyšší početnost vlnovníka A. tulipae byla zjištěna u odrůdy Plovdiv Rogosh (polovybíhající
do květu) s celkovým počtem až 1500 jedinců na stroužku. U čtyř z jedenácti hodnocených odrůd byl
zaznamenán průkazný rozdíl mezi napadením vnější a vnitřní části stroužku. Průkazně nejvíce byla
napadená spodní část stroužku u kořene.
Klíčová slova: česnek, napadení, škodlivost, vlnovník
Abstract
Infestation rate of Aceria tulipae (Keifer, 1938) on eleven garlic (Allium sativum) varieties was
evaluated. The research was done on storage garlic during winter period 2011–2012, coming from
central Moravia (210 m). Bolting garlic varieties (Bzenecky Mutant VF, Sochi 25, Tiraspol, Zailijskij)
were highly infested by mite A. tulipae. Non-bolting garlic varieties (Czerga, SIR 10new breeding,
Gjirokaster) were mite infested weakly or not at all (Kelcyre). The highest abundance of mite was
found in semi-bolting garlic variety (Plovdiv Rogosh) with total number up to 1500 individuals in
clove. Significant differences in infestation between external and internal part of the clove were
observed in 4 of 11 evaluated varieties. Significantly root segment was the most infested part of the
clove.
Key words: garlic, infestation, harmfulness, eriophyid
Úvod
Vlnovník Aceria tulipae byl popsán v Sacramentu v Kalifornii z cibulí tulipánu dovezených
z Nizozemska (Keifer, 1938). Šíří se především pasivně s napadenými rostlinami, případně
vzdušným prouděním. Vlnovník A. tulipae je celosvětově rozšířený, v Evropě je znám v
Bulharsku, Dánsku, Velké Británii, Finsku, Francii, Německu, Maďarsku, Itálii, Nizozemsku,
Polsku, Španělsku a bývalé Jugoslávii. Jeho areál je pravděpodobně ještě širší. Z České
republiky jej jako škůdce tulipánů uvádí Dušek (1985), jako škůdce česneku Rod (1997).
Symptomy a škody na hostitelských rostlinách hodnotili např. Lesna et al. (2004). Několik
autorů studovalo možný přenos rostlinných virů tímto druhem (Van Dijk et al., 1991; OstojaStrazewski & Mattews, 2009). Lesna et al. (2004) a Aratchige et al. (2007) se zabývali
možnostmi ochrany před vlnovníkem A. tulipae pomocí dravých roztočů. Předmětem našeho
studia bylo hodnocení abundance vlnovníka Aceria tulipae na jedenácti odrůdách česneku
během skladování.
219
„Úroda 12/2012, vědecká příloha časopisu“
Materiál a metody
Hodnocené odrůdy česneku byly dodány VÚRV, v.v.i., Centrum regionu Haná pro
zemědělský a biotechnologický výzkum v Olomouci (210 m n. m.), po 150 dnech skladování
při teplotě 15 °C a 80% relativní vlhkosti během zimního období 2011–2012. Byly hodnoceny
následující odrůdy česneku: šest odrůd vytvářející květní stvol (Bzenecky Mutant VF, Sochi
24\1, Sochi 25, Tiraspol, Dushanbijskij 125 a Zailijskij), čtyři odrůdy nevytvářející květní
stvol (Czerga, SIR 10 new breeding, Gjirokaster a Kelcyre) a jediná odrůda polovybíhající do
květu (Plovdiv Rogosh). Cibule byly po celou dobu pokusu uchovávány v lednici při teplotě
4 °C, aby se zabránilo dalšímu vývoji vlnovníka. Od každé odrůdy česneku bylo hodnoceno
pět cibulí, z každé sedm stroužků. Před hodnocením byl vždy stroužek podélně rozříznut. Pro
hodnocení výskytu vlnovníka A. tulipae byl stroužek rozdělen do tří segmentů (kořen, střed a
vrchol) a na vnější a vnitřní část. Odečet roztočů byl proveden okamžitě po vytažení z lednice
pod mikroskopem Olympus SZX9. Abundance byla hodnocena pomocí čtyřbodové stupnice
(tab. 1). Výsledky byly zpracovány metodou analýzy variance s následným testováním dle
Tukey, Statistica 8 (obr. 1, 2).
Tab. 1: Stupnice napadení česneku podle hustoty vlnovníka Aceria tulipae na jednom
stroužku
Hustota
0
1–100
101–1000
> 1001
Stupeň výskytu
1
2
3
4
Intenzita napadení
bez napadení
slabá
střední
silná
Výsledky a diskuze
Vlnovník Aceria tulipae byl zjištěn na deseti z jedenácti hodnocených odrůd (obr. 1). Odrůdy
vytvářející květní stvol (Bzenecky Mutant VF, Sochi 25, Tiraspol, Zailijskij) byly silně
napadené. Odrůdy nevytvářející květní stvol (Czerga, SIR 10 new breeding, Gjirokaster) byly
slabě napadené a odrůda Kelcyre nebyla napadena vůbec (tab. 2). Nejvyšší početnost
vlnovníka A. tulipae byla zjištěna u odrůdy Plovdiv Rogosh (polovybíhající do květu), až
1500 jedinců na jednom stroužku.
U všech odrůd s výjimkou odrůdy Kelcyre bylo vyšší napadení na vnější než na vnitřní části
(obr. 2). U čtyř odrůd byl zaznamenán průkazný rozdíl, u ostatních odrůd byly rozdíly
neprůkazné. Největší rozdíl mezi vnitřní a vnější částí byl pozorován u odrůdy Sochi 25,
Zailiskij a Tyraspol. Nejvyšší napadení ve vnitřní části stroužků bylo zaregistrováno na
odrůdách Zailiskij, Sochi 25 a Tiraspol. Tyto odrůdy pocházejí z Moldávie, Ruska a
Tadžikistánu. Průměrné až vyšší hodnoty abundance byly zjištěny u české odrůdy Bzenecky
Mutant VF. Disperze jedinců vlnovníka A. tulipae na stroužku nebyla homogenní (obr. 2).
Tab. 2: Stupeň napadení jednotlivých odrůd česneku vlnovníkem Aceria tulipae
Class
1
2
3
4
Variety
Kelcyre
Sir 10 new breeding, Gjirokaster
Bzenecky Mutant VF, Tiraspol, Sochi24/1, Dushanbijskij 125, Czerga
Sochi 25, Zailijskij, Plovdiv-Rogosh
220
„Úroda 12/2012, vědecká příloha časopisu“
Obr. 1: Celkový počet vlnovníka A. tulipae na stroužku z každé odrůdy
2000
1800
S
1600
četnost výskytu (ks)
1400
B
B
1200
B
B
1000
800
N
600
B
400
B
200
N
N
0
N
-200
Plovdiv-Rogosh
Kelcyre
Gjirokaster
SIR 10 new breeding
Czerga
Zailijskij
Dushanbijskij 125
Tiraspol
Sochi 25
Bzenecký mutant VF
Sochi 24/1
-400
Odrůdy (B-s květním stvol em , N-bez kv
ětního stvol u, S-pol ovybíhaj ící doětu)
kv
Obr. 2: Výskyt vlnovníka A. tulipae na jednotlivých segmentech stroužku
2500
četnost výskytu (ks)
2000
1500
1000
500
0
Plovdiv-Rogosh
Kelcyre
Gjirokaster
SIR 10 new breeding
Czerga
Zailijskij
Dushanbijskij 125
Tiraspol
Sochi 25
Sochi 24/1
-1000
Bzenecký mutant VF
-500
Odrůdy
kořenový segment
středový segment
vrcholový segment
Průkazně nejvíce byla napadena spodní část stroužku u kořene, nejnižší výskyt byl uprostřed
stroužku. Nebyly zaregistrovány výrazné rozdíly výskytu vlnovníka A. tulipae ve spodní,
střední a vrcholové části. Průkazné rozdíly na jednotlivých segmentech stroužku byly
pozorovány pouze u odrůd Zailiskij a Plovdiv Rogosov. Scalopi et al. (1971) hodnotili
napadení vlnovníkem A. tulipae u pěti odrůd česneku a na rozdíl od našich výsledků nezjistili
významné rozdíly v jeho početnosti.
Naše experimenty prokázaly, že volba vhodných odrůd česneku může významně ovlivnit
jejich napadení a výskyt vlnovníka A. tulipae. Početnost vlnovníka Aceria tulipae se může
v jednotlivých letech měnit v závislosti na abiotických a biotických faktorech. Rezistence
221
„Úroda 12/2012, vědecká příloha časopisu“
odrůdy Kelcyre je pravděpodobně způsobena kompaktností cibule a těsně přiléhajícími
slupkami, které brání vniknutí vlnovníka A. tulipae mezi jednotlivé stroužky a do vnitřního
prostoru. Odrůdy Zailiskij a Plovdiv Rogosh, které byly nejvíce napadeny, jsou méně vhodné
pro skladování.
Závěr
Při hodnocení napadení jedenácti odrůd česneku vlnovníkem Aceria tulipae jsme dospěli k
následujícím závěrům
 Byl prokázán rozdíl v intenzitě napadení různých odrůd česneku
 Odrůda Kelcyre nebyla vůbec napadena
 Nejvyšší početnost vlnovníků byla zjištěna u odrůdy Plovdiv Rogosh (polovybíhající
do květu) s celkovým počtem až 1500 jedinců na stroužku
 Odrůdy Sir 10 new breeding, a Gjirokaster byly napadeny slabě
 Odrůdy Bzenecky Mutant VF, Tiraspol, Sochi24/1, Dushanbijskij 125 a Czerga
varieties byly napadeny středně
 Odrůdy Sochi 25, Zailijskij a Plovdiv-Rogosh byly napadeny silně
Příspěvek byl zpracován v rámci řešení výzkumného záměru MSM6215648905 a projektu IP
7/2012 IGA/.
Použitá literatura
Aratchige, N. S., Sabelis, M. W. & Lesna, I., 2007: Plant structural changes due to herbivory:
do changes in Aceria-infested coconut fruits allow predatory mites to move under the
perianth? Exp. Appl. Acarol., 43: 97–107.
Dušek, J., 1985: Ochrana rostlin. Škůdci okrasných rostlin. Vysoká škola zemědělská, Brno,
164 pp.
Keifer, H. H., 1938: Eriophyid studies. Bull. Calif. Dept. Agric., 27: 185–200.
Lesna, I., Conijn, C. G. M. & Sabelis, M. W., 2004: From biological control to biological
insight: rust-mite induced change in bulb morphology, a new mode of indirect plant
defense? Phytophaga, 14: 285–291
Ostoja-Starzewski, J. C. & Matthews, L., 2009: Aceria tulipae (Keifer) (Acari: Eriophyidae)
on imported onion sets, and present status in Britain. Ent. Month. Mag., 145: 61–68.
Rod, J., 1997: Nejčastější choroby a škůdci česneku. Agro, 2(9): 22–24.
Kontaktní adresa:
Ing. Eva Sapáková
Ústav pěstování, šlechtění rostlin a rostlinolékařství
Mendelova univerzita v Brně, Zemědělská 1, 613 00 Brno, Česká republika
e-mail: [email protected]
222
„Úroda 12/2012, vědecká příloha časopisu“
IDENTIFIKACE PŮVODCŮ FUZARIÓZ KLASU POMOCÍ
MULTIPLEX PCR
Identification of pathogens associated with Fusarium head blight
by multiplex PCR
Sumíková T., Žabka M.
Výzkumný ústav rostlinné výroby v.v.i., Praha
Abstrakt
Fuzariózy klasu patří mezi nejzávažnější choroby obilnin. Identifikace původců, tj. hub rodu
Fusarium, morfologickými metodami je časově náročná a nemusí být jednoznačná. Proto jsou
vyvíjeny molekulární markery, které umožňují přesnou a jednoduchou detekci daného druhu pomocí
PCR. Zde je popsána metoda multiplex PCR, která umožňuje identifikaci šesti původců fuzarióz klasu
(F. avenaceum, F. culmorum, F. poae, F. graminearum, F. pseudograminearum, F. sporotrichioides)
současně v jedné reakci.
Klíčová slova: Fusarium, multiplex PCR, fuzariózy klasu
Abstract
Fusarium head blight (FHB) is one of the most important diseases of cereals. Identification of the
pathogens associated with FHB – fungi from genus Fusarium, by morphological methods is time
consuming and not always unambiguous. Nowadays molecular markers enabling precise and rapid
identification of the pathogens by PCR are developed. Here we describe a multiplex PCR enabling the
identification of six Fusarium pathogens (F. avenaceum, F. culmorum, F. poae, F. graminearum, F.
pseudograminearum, F. sporotrichioides) simultaneously in one reaction.
Key words: Fusarium, multiplex PCR, head blight
Úvod
Fuzarióza klasu (Fusarium head blight) se projevuje předčasným odumřením klasů nebo jejich
zbělením. Hlavními hostiteli jsou pšenice, ječmen a kukuřice. Toto onemocnění se vyskytuje
ve všech oblastech pěstování pšenice, zvláště významné je ve vlhkých oblastech. Mezi
nejčastější a nejvýznamnější původce fuzariź klasu patří následující druhy: F. graminearum,
F. culmorum, F. avenaceum, F. poae a Microdochium nivale var. nivale a var. majus. V menší
míře se vyskytují např. F. tricinctum, F. equiseti, F. acuminatum, F. sambucinum, F.
pseudograminearum a F. oxysporum (Ioos et al., 2004). Na území České republiky začíná
převažovat F. graminearum oproti minulým letům, kdy bylo dominantním druhem F.
culmorum (Chrpová et al. 2004, Ostrý et al. 2004). Poslední studie ukazují zvyšující se
zastoupení druhu F. poae (Remešová et al. 2006). Jedná se o fakultativní nespecifické
parazity, kteří také mohou infikovat další části rostlin (Parry et al., 1995, , Lemmmens et al.,
2004). Poškození klasů tedy může být doprovázeno infekcí kořenů, listů nebo následným
napadením klíčních rostlin.
Škodlivost fuzarióz spočívá jednak v redukci výnosu, ale zejména ve schopnosti mnoha
původců fuzarióz produkovat mykotoxiny. Je známo, že fuzáriové mykotoxiny mohou
způsobovat vážné zdravotní potíže jak u člověka, tak u hospodářských zvířat. Nejvýznamnější
fuzáriové mykotoxiny jsou trichoteceny, zejména deoxynivalenol a nivalenol a zearalenony.
Ke tvorbě zdraví škodlivých toxinů v zrnu dochází zejména při infekci druhy F. graminearum
a F. culmorum.
Přesná detekce jednotlivých původců fuzarióz klasu a zejména stanovení toxinogenních
kmenů je nezbytná jak pro pochopení faktorů podílejících se na rozvoji onemocnění
a akumulaci toxinů, tak z hlediska ochrany rostlin i zdraví konzumentů.
223
„Úroda 12/2012, vědecká příloha časopisu“
Mykologické určení jednotlivých druhů je dosti obtížné a relativně časově náročné, proto
došlo v poslední době k rozvoji metod založených na PCR. V současnosti jsou známy
druhově specifické primery pro mnoho druhů rodu Fusarium např. pro F. avenaceum
(Doohan et al., 1998, Turner et al., 1998), F. culmorum a F. graminearum (Nicholson et
al.,1998), F. poae (Parry et Nicholson, 1996), F. pseudograminearum (Aoki et O´Donnell,
1999) a F. sporotrichioides (Demeke et al., 2004).
Efektivnější metodou je použití tzv. multiplex PCR tj. PCR, která díky přítomnosti několika
primerových párů umožňuje detekci více druhů současně. Rutinně je možné detekovat
současně 2 – 14 lokusů. Nutností ovšem je zajistit, aby se amplifikované produkty dostatečně
lišily ve svých délkách a bylo je tak možno bez problémů rozlišit na agarózovém gelu.
Neméně důležitým předpokladem k úspěšnému použití multiplex PCR je pečlivá optimalizace
reakčních podmínek, zejména zajištění vhodné annealingové teploty a koncentrace
jednotlivých primerů. Problémem mohou být také nespecifické produkty, které se amplifikují
společně s požadovanými fragmenty a mohou zkreslovat výsledek reakce. Nicméně při
vhodné optimalizaci dochází ke znatelné úspoře času i materiálu.
Cílem práce bylo vyvinout multiplex PCR, s využitím publikovaných primerů, k detekci šesti
nejběžnějším původců fuzarióz klasu současně.
Materiál a metody
Monosporické izoláty hub F. avenaceum, F. culmorum, F. poae, F. graminearum, F.
pseudograminearum a F. sporotrichioides byly získány z přirozeně napadených pšeničných klasů.
Identifikace byla provedena klasickými morfologickými metodami a potvrzena molekulárními
markery.
Izolace DNA byla provedena z narostlého houbového mycelia izolační soupravou Mobio
(MoBio Ultra CleanTM Microbial DNA Isolation kit) podle instrukcí výrobce.
K dosažení nejlepší výtěžnosti reakce byla testována nejvhodnější annealingová teplota,
koncentrace hořčíkových iontů a vzájemná koncentrace primerů. Výsledné optimální
podmínky reakce jsou uvedeny v tabulkách 1 a 2. Reakce probíhaly v termocyklerech Veriti
(Appied Biosystems) a UNO II (Biometra). PCR produkty byly naneseny na 2% agarózový
gel (s ethidiumbromidem) spolu s 6µl délkového standardu 100bp DNA Ladder (Fermentas).
Separace elektroforézou probíhala cca 1 - 1,5 hodiny při 60 - 50V. Produkty na gelech byly
poté vizualizovány a detekovány pod UV lampou. Přítomnost produktu amplifikace
požadované délky (v párech bází) značí příslušnost k testovanému druhu (obrázek 1).
Tabulka 1: Reakční směs
Primer mix forward a revers primer (5µM) pro
každý detekovaný druh
dNTP (2,5mM)
pufr Qiagen (10×)
MgCl2 (15mM)
Taq polymeráza Qiagen (5U/1µl)
H 2O
Templátová DNA
Celkový reakční objem
1,5µl* / 1µl**
2µl
2,5µl
1,5µl
0,2µl
doplnit do 24µl
1µl
25µl
* množství primerů pro druhy: F. avenaceum, F. culmorum, F. pseudograminearum, F. sporotrichioides
** množství primerů pro druhy: F. poae, F. graminearum
Tabulka 2: Reakční podmínky
1 cyklus: 95°C – 5 min.
35 cyklů: 95°C – 30 s.
60°C – 30 s.
72°C – 40 s.
Konečná extense: 72°C – 5 min.
224
„Úroda 12/2012, vědecká příloha časopisu“
Výsledky a diskuse
Obrázek 1: Druhově specifické produkty multiplex PCR pro níže uvedené druhy r.
Fusarium
100bp DNA ladder, 1 – F. avenaceum, 2 – F. culmorum, 3 – F. graminearum, 4 – F. poae, 5 – F.
pseudograminearum, 6 – F. sporotrichioides, 7 – voda
Primerové páry byly voleny tak, aby se výsledné PCR produkty dostatečně lišily ve velikosti a
bylo možné je rozlišit horizontální elektroforézou na běžném agarózovém gelu. Jednotlivé
primerové páry je možné libovolně kombinovat což umožňuje detekci jednoho nebo až všech
šesti výše uvedených druhů v jedné PCR reakci. Výsledná determinace izolátů pomocí
multiplex PCR se buď shodovala s morfologickým určením nebo napomohla k definitivní
determinaci v případě, že se jednalo o izoláty, které nebylo možné jednoznačně určit pomocí
morfologických znaků.
Multiplex PCR bývá využívána k rozlišení jednotlivých chemotypů, zejména u druhu F.
graminearum (Wang et al. 2012, Quarta et al. 2006). Identifikaci některých druhů r. Fusarium
z kukuřice pomocí multiplex PCR popisují Faria et al. (2012).
Závěr
Multiplex PCR představuje spolehlivou metodu detekce až šesti patogenů r. Fusarium
(F. avenaceum, F. culmorum, F. poae, F. graminearum, F. pseudograminearum, F.
sporotrichioides.) v jedné reakci. Vzhledem k tomu dochází k úspoře času a chemikálií oproti
využití standardní jednotlivé (single) PCR pro každý uvedený druh.
Dedikace
Práce byla financovaná z projektu ministerstva školství ČR ME 10140 a výzkumného záměru
0002700604 MZe České republiky
Použitá literatura
Aoki T, O´Donnell K. (1999) Morphological and molecular characterization of Fusarium
pseudograminearum sp nov., formerly recognized as the Group 1 population of
F. graminearum. Mycologia 91: 597-609.
225
„Úroda 12/2012, vědecká příloha časopisu“
Demeke T, Clear RM, Patrick SK, Gaba D. (2005) Species-specific PCR-based assays for the
detection of Fusarium species and comparison with whole seed agar plate method and
trichothecene analysis. Inter J Food Microbiol 103:271-284.
Doohan FM, Parry DW, Jenkinson P, Nicholson P. (1998) The use of species-specific PCRbased assays to analyze Fusarium ear blight of wheat. Plant Pathol 47:197 – 205.
Chrpová J, Šíp V, Sýkorová S, Sychrová E, Matějová E. (2004) Beitrag zur Problematic der
Ährenfusariosen bei Getreide. J Appl Bot Food Qual 78: 153-156.
Faria CB, Abe CAL, da Silva CN,Tessmann DJ,Barbosa-Tessmann IP. (2012) New PCR
Assays for the Identification of Fusarium verticillioides, Fusarium subglutinans, and Other
Species of the Gibberella fujikuroi Complex.
Ioos R, Belhadj A, Menez M. (2004) Occurrence and distribution of Microdochium nivale and
Fusarium species isolated from barley, durum and soft wheat grains in France from 2000
to 2002. Mycopathologia 158: 351-362. Int J Mol Sci 13: 115-132.
Lemmens M, Buerstmayr H, Krska R, Schuhmacher R, Grausgruber H, Ruckenbauer P.
(2004): The effect of inoculation treatment and long-term application of moisture on
Fusarium head blight symptoms and deoxynivalenol contamination in wheat grains. Eur J
Plant Pathol 110: 299-308.
Nicholson P, Simpson DR, Weston G, Rezanoor HN, Lees AK, Parry DW, Joyce D. (1998)
Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals
using PCR assay. Physiol Mol Plant Pathol 53:17 – 37.
Ostrý V, Škarková J, Malíř F, Sýkorová S. (2004) Advances on the Occurence of Toxigenic
Fungi and Mycotoxins in the Czech Republic, 99. 67 – 81. In: „An Overview on Toxigenic
Fungi and Mycotoxins in Europe“, Logrieco, Antonie, Visconti, Angelo (Eds.) Kluwer
2004, ISBN: 1-4020-2646-3.
Parry DW, Jenkinson P, Mc. Leod L. (1995) Fusarium ear blight (scab) in small-grain cereals a review. Plant Pathol 44: 207-238.
Parry DW, Nicholson P. (1996) Development of a PCR assay to detect Fusarium poae in
wheat. Plant Pathol 45:383 – 391.
Quarta A, Mita G, Haidukowski M, Logrieco A, Mule G, Visconti A (2006) Multiplex PCR
assay for the identification of nivalenol, 3- and 15-acetyl-deoxynivalenol chemotypes in
Fusarium. FEMS Microbiol Lett 259:7-13.
Remešová J, Sumíková T, Sychrová E, Matějová E, Chrpová J, Šíp V. (2006) Toxigenic
micromycetes of genus Fusarium on wheat isolated in the Czech Republic. In: Sborník
abstraktů "XVII. česká a slovenská konference o ochraně rostlin", 12.-14. září 2006, ČZU
Praha
Turner AS, Lees AK, Rezanoor HN, Nicholson P. (1998) Refinement of PCR-based detection
of Fusarium avenaceum and evidence for phenetic relatedness to Fusarium tricinctum.
Plant Pathol 47:278 – 288.
Wang JH, Zhang JB, Chen FF, Li HP, Ndoye M, Liao YC. (2012) A multiplex PCR assay for
genetic chemotyping of toxigenic Fusarium graminearum and wheat grains for 3acetyldeoxynivalenol, 15-acetyldeoxynivalenol and nivalenol mycotoxin. J Food Agri
Environ 10: 505-511.
Kontaktní adresa:
Mgr. Taťána Sumíková, Ph.D.
Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507, 161 06, Praha 6
[email protected]
226
„Úroda 12/2012, vědecká příloha časopisu“
HODNOCENÍ ODOLNOSTI VYBRANÝCH NOVOŠLECHTĚNÍ
OKUREK NAKLÁDAČEK K VIRU ŽLUTÉ
MOZAIKY CUKETY (ZYMV)
Evaluation of resistance selected new crossing pickling cucumbers to
Zucchini yellow mosaic virus (ZYMV)
Svoboda J.
Výzkumný ústav rostlinné výroby, v.v.i., Praha – Ruzyně
Abstrakt
Virus žluté mozaiky cukety (ZYMV) způsobuje značné ztráty produkce pěstovaných tykvovitých
zelenin v České republice, zejména na jižní Moravě. Běžně pěstované odrůdy okurek jsou k ZYMV
vysoce náchylné. Největší ztráty působí boulovité deformace na plodech. Nejúčinnějším způsobem
ochrany před ZYMV je pěstování rezistentních odrůd. Šlechtění na rezistenci k ZYMV je v České
republice teprve v začátcích. Byla získána semena novošlechtění okurek nakládaček a metodou
porovnání relativních koncentrací viru žluté mozaiky cukety v rostlinách po mechanické inokulaci
českým silně virulentním kmenem viru byla hodnocena jejich odolnost k ZYMV.
Klíčová slova: relativní koncentrace viru, titr viru
Abstract
Zucchini yellow mosaic virus (ZYMV) causes considerable losses of cucurbitaceous vegetables grown
in the Czech Republic, especially in Southern Moravia. Commonly grown cucumber cultivars are
highly susceptible to ZYMV. The highest losses cause lumpy deformations on fruits. The most
effective way of protection is the use of resistant plants. The breeding programme of cucumbers for
the resistance to ZYMV has just started in the Czech Republic. There were obtained seeds of newly
bred pickling cucumbers and their level of resistance to ZYMV was evaluated by comparison the
relative concentration of the virus in plants after mechanical inoculation by a highly virulent Czech
ZYMV strain.
Key words: virus relative concentration, virus titer
Úvod
Virus žluté mozaiky cukety, Zucchini yellow mosaic virus (ZYMV) je hospodářsky
významným virem, který byl objeven poměrně nedávno zároveň v Itálii (Lisa et al., 1981) a
ve Francii (Lecoq et al., 1981). Je to vláknitý virus z čeledi Potyviridae, rod Potyvirus
obsahující +ssRNA nukleovou kyselinu. V České republice (ČR) byl ZYMV poprvé zjištěn
v r. 1990 (Chod a Jokeš, 1991). Od r. 1997 Státní rostlinolékařské správa eviduje jeho
epidemický výskyt na jižní Moravě. Virus vyvolává na infikovaných rostlinách žloutnutí a
deformace listů, boulovitost plodů, zakrslost a výrazné snížení výnosů; v případě náchylných
odrůd a infekce silně virulentním kmenem ZYMV rostliny neplodí vůbec nebo mají
deformované neprodejné plody (obr.1). Tento virus je rozšířen v teplých oblastech po celém
světě a napadá téměř všechny rostliny čeledi Cucurbitaceae (Al-Saleh a Al-Shahwan, 1997).
Snadno se šíří neperzistentně mšicemi a mechanicky (Lisa a Lecoq, 1984). Virus
v podmínkách ČR přezimuje na různých druzích plevelných rostlin, jako jsou ptačinec
žabinec (Stellaria media (L.) Vill.), heřmánkovec přímořský, (Tripleurospermum maritimum
(L.) Sch. Bip.) a jetel plazivý (Trifolium repens L.; Svoboda a Polák, 2002).
Výzkumem rezistence okurek k viru žluté mozaiky cukety se zabývala především
francouzská, italská a americká pracoviště. Provvidenti (1987) nalezl gen rezistence zym
v čínské okurce (Cucumis sativus L.) Taichung Mou Gua (‘TMG-1‘) na Tajwanu. Ansanelli et
al. (1997) referují o vyšlechtění okurek nakládaček ‘CLX 2935‘, ‘CLX 2946‘, ‘Afrodite‘ a
‘Roberta‘ rezistentních k ZYMV. Také v ČR se v posledních letech šlechtí na rezistenci
k ZYMV.
227
„Úroda 12/2012, vědecká příloha časopisu“
Úkolem provedené práce bylo vyhodnotit úroveň rezistence novošlechtění českých okurek
nakládaček k ZYMV po mechanické inokulaci českým silně virulentním kmenem viru.
Materiál a metody
Rostlinný materiál
Bylo získáno osivo novošlechtění kandidátských rezistentních okurek nakládaček (Cucumis
sativus L.) 1/05, 9/05, 12/05, 2/08, 3/08, 4/08, 5/08, 6/08, 8/08, 9/08, 10/08, 11/08, 12/08,
13/08, 14/08 a 15/08 (Ing. Bohuslav Holman s.r.o., Bzenec, ČR). Jako k ZYMV náchylná
kontrola byla použita okurka nakládačka ‘Melody F1’ (Rijk Zwaan, Holandsko) a jako okurka
se známou polní rezistencí ‘Lili F1’ (SEMO, Smržice, ČR; Petříková et al., 2005). Semena
okurek byla vysévána ve skupinách po deseti od každého novošlechtění a odrůdy. Rostliny
byly pěstovány v izolované skleníkové kóji při světelné periodě den/noc 14/10 hodin a teplotě
25/20 °C.
K pomnožení viru pro potřebu mechanické inokulace byla použita tykev cuketa
(Cucurbita pepo L. convar. giromontiina Grebenščikov) ‘Zelená’ (Seva Flora, Valtice, ČR).
Mechanický přenos ZYMV
Při inokulaci ZYMV byl použit silně virulentní kmen ZYMV-H, který byl vybrán z různých
izolátů viru pocházejících z jižní Moravy (Svoboda and Polák, 2002). Molekulární diverzita
ve vztahu k patogenitě českých a slovenských izolátů ZYMV byla studována Glasou et al.
(2007); kmen ZYMV-H patřil k nejvirulentnějším, jeho sekvence byly uloženy do databáze
GenBank pod č. DQ144054 a je součástí Sbírky patogenních virů (2012) ve VÚRV, v.v.i.,
Praha.
Pro mechanický přenos bylo v třecí misce homogenizováno 10 g listů tykve cukety ‘Zelená‘
infikované kmenem ZYMV-H se 30 ml fosfátového pufru (0,03 M Na2HPO4 s přídavkem 0,2
% DIECA, pH 9,3) podle Mahgouba et al. (1997). K homogenátu bylo přidáno aktivní uhlí a
karborundum mesh 200 a byla provedena mechanická inokulace třením děložních listů
okurek. Veškeré chemikálie a nádoby byly předem vychlazeny v chladničce a připravený
homogenát byl uchováván až do skončení inokulace v misce s drceným ledem pro zajištění
dlouhodobé infekčnosti inokula. Náchylná okurka nakládačka ‘Melody F1’ byla zařazena jako
poslední inokulovaná odrůda sloužila jako kontrola účinnosti inokula.
Stanovení relativní koncentrace ZYMV
Čtyři týdny po provedené inokulaci, tj. ve stadiu 4.-5. pravého listu, kdy již byly na rostlinách
náchylných odrůd zřetelně viditelné příznaky systémové infekce ZYMV, byly odebrány
vzorky mladých listů. Vzorky ze všech deseti rostlin jedné odrůdy byly smíšeny z alikvotních
dílů a vzniklý směsný vzorek byl použit k analýze.
Pro určení koncentrace ZYMV ve vzorku byl v něm stanoven titr viru jako nejvyšší ředění
vzorku rozetřeného v extrakčním pufru, které ještě dávalo v ELISA pozitivní reakci.
Koncentrace virového proteinu (c) je nepřímo závislá na titru (t), tj. čím větší ředění ještě
dává pozitivní reakci, tím vyšší je koncentrace virového proteinu v listu. Závislost lze vyjádřit
jako podíl specifické konstanty (k) a stanoveného titru
c = k/t.
Pro porovnání koncentrací téhož virového proteinu v listech různých rostlin není nutné znát
přesnou hodnotu konstanty (k) protože je pro všechny rostliny při použití stejné metody a
antisera totožná. Poměr koncentrací viru v hodnocených rostlinách potom bude
c1 : c2 = 1 / t1 : 1 / t2
228
„Úroda 12/2012, vědecká příloha časopisu“
a převrácenou hodnotu (1/t) lze považovat za relativní koncentraci virového proteinu, která
nemá přesně hodnotu koncentrace ZYMV ve vzorku, ale je ve správném poměru
k vypočteným relativním koncentracím ZYMV ostatních hodnocených vzorků.
Pro stanovení titru byla použita imunoenzymatická metoda DAS-ELISA popsaná Clarkem a
Adamsem (1977), komerční protilátky k ZYMV a pracovní postup podle návodu firmy Loewe
Biochemica, Německo.
Obrázek 1:
Plod náchylné okurky
‘Melody F1’ infikované
silně virulentním kmenem
ZYMV-H
Výsledky a diskuse
Zjištěné relativní koncentrace ZYMV v listech okurek nakládaček ukazuje obr.2. Jako
nejperspektivnější se jeví novošlechtění 14/08 a 15/08. Tyto rostliny prokázaly vysokou
odolnost k silně virulentnímu kmenu ZYMV-H, množení viru v nich bylo potlačeno na
poloviční úroveň oproti známé rezistentní ‘Lili F1’. Tomu odpovídaly i pozorované příznaky
na rostlinách: mírná mozaika na listech bez deformací plodů. Jako další slibná se jeví
novošlechtění 1/05, 8/08 a BH-502, v jejichž listech byla zjištěna dvojnásobně vyšší relativní
koncentrace virového proteinu. Oproti tomu všechna ostatní testovaná novošlechtění měla 4-8
násobně vyšší koncentraci ZYMV v listech a dosáhly tak úrovně náchylné kontroly okurky
‘Melody F1’ (obr.1). Také tyto rostliny vykazovaly silné příznaky virové infekce s víceméně
deformovanými plody. Experimenty byly dvakrát opakovány se stejným výsledkem.
Obrázek 2: Relativní koncentrace virového proteinu ZYMV-H v listech okurek
nakládaček
5000
4000
3000
2000
1000
229
-5
02
M
el
od
y
F1
Li
li F
1
BH
15
/0
8
14
/0
8
13
/0
8
12
/0
8
11
/0
8
9/
08
8/
08
6/
08
5/
08
4/
08
3/
08
2/
08
12
/0
5
9/
05
0
1/
05
Relativní koncentrace ZYMV proteinu
6000
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
V testovaném novošlechtění okurek nakládaček vynikly svou odolností k ZYMV
novošlechtění 14/08 a 15/08. Přesto je ale ještě potřeba udělat spoustu šlechtitelské práce, než
bude k dispozici širší sortiment rezistentních okurek na stejné úrovni, jako je okurka ‘TMG1‘.
Dedikace
Provedený výzkum byl financován z výzkumného záměru MZE ČR 0002700604.
Autor děkuje Ing. B. Holmanovi za poskytnuté osivo novošlechtění okurek nakládaček.
Použitá literatura
Al-Saleh M. A., Al-Shahwan I. M. (1997). Viruses infecting cucurbits in Riyadh, Gassim and
Hail regions of Saudi Arabia. Arab Gulf Journal of Scientific Research 15 (1): 223- 254.
Ansanelli C., Giovannantonio C., Tomassoli L., Di-Giovannantonio C. (1997). Tolerant
varieties and reflective soil coverings to control viruses of courgette. Informatore Agrario
53 (11): 43-45.
Clark M. F., Adams A. N. (1977). Characteristic of the microplate method of enzyme-linked
immunosorbent assay for the detection of plant virus. Journal of General Virology 34: 5157.
Glasa M, Svoboda J, Nováková S (2007). Analysis of the Molecular and Biological
Variability of Zucchini yellow mosaic virus isolates from Slovakia and Czech Republic,
Virus Genes 35(2): 415-421.
Chod J., Jokeš M. (1991). Nález viru žluté mozaiky cukety v Československu. Ochrana
Rostlin 27: 111-115.
Mahgoub HA, Desbiez C, Wipf-Scheibel C, Dafalla G, Lecoq H (1997). Characterization and
occurrence of zucchini yellow mosaic virus in Sudan. Plant Pathology 46: 800-805.
Lecoq H., Pitrat M., Clément M. (1981). Identification et caractérisation d´un potyvirus
provoquant la maladie du rabougrissement jaune du melon. Agronomie 1: 827-834.
Lisa V., Boccardo G., D'Agostino G., Dellavalle G. and d'Aquilio M. (1981). Characterisation
of a potyvirus that causes zucchini yellow mosaic. Phytopathology 71: 667-672.
Lisa V., Lecoq H. (1984). Zucchini yellow mosaic virus. CMI/AAB Descriptions of Plant
Viruses No. 282, Unvin Brothers Press, Surrey (GB).
Mahgoub H. A., Desbiez C., Wipf-Scheibel C., Dafalla G., Lecoq H. (1997). Characterization
and occurrence of zucchini yellow mosaic virus in Sudan. Plant Pathology 46: 800- 805.
Petříková K., Nakvasil V., Pokluda R. (2005). Zhodnocení sortimentu okurek nakládaček na
rezistenci k ZYMV. In: Sborník přednášek ze semináře "Metodika pro integrovaný
systém ochrany polní zeleniny vůči škodlivým organismům", 30. listopadu 2005,
VÚRV Praha 6, p. 11-16.
Provvidenti R (1987). Inheritance of resistance to a strain of zucchini yellow mosaic virus in
cucumber. Hort. Science, 22: 102-103.
Sbírka fytopatogenních virů [www dokument]. [cit. 9. 2. 2012]. Dostupné na:
http://www.vurv.cz/collections/vurv.exe/search?org=VI.
Svoboda J, Polák J (2002). Distribution, Variability and Overvintering of Zucchini yellow
mosaic virus in the Czech Republic. Plant Protection Science, 38 (4): 125-130.
Kontaktní adresa:
Ing. Jiří Svoboda, Ph.D., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507,
161 06-Praha 6-Ruzyně, e-mail: [email protected]
230
„Úroda 12/2012, vědecká příloha časopisu“
VÝSKYT FYTOPATOGENNÍCH VIRŮ NA TYKVOVITÉ ZELENINĚ
PĚSTOVANÉ V ČESKÉ REPUBLICE
Occurrence of phytopathological viruses on cucurbitaceous vegetables
in the Czech Republic
Svoboda J., Leišová-Svobodová L.
Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, 161 06-Praha 6
Abstrakt
V minulých pěti letech byl proveden průzkum výskytu fytopatogenních virů na rostlinách čeledi
Cucurbitaceae v hlavních i okrajových oblastech pěstování plodových zelenin Čech a Moravy.
Celkem bylo odebráno a pomocí ELISA otestováno 610 vzorků listů tykvovitých zelenin na
přítomnost běžných a možných nových invazivních virů Cucurbit aphid-borne yellows virus
(CABYV), Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV), Melon
necrotic spot virus (MNSV), Papaya ring spot virus (PRSV), Squash mosaic virus (SqMV),
Watermelon mosaic 2 virus (WMV-2), Zucchini yellow fleck virus (ZYFV) a Zucchini yellow mosaic
virus (ZYMV). Ve vzorcích byla zjištěna přítomnost CABYV, CMV, SqMV, WMV-2 a ZYMV
s převládajícím výskytem ZYMV na jižní a střední Moravě.
Klíčová slova: CABYV, CMV, SqMV, WMV-2, ZYMV
Abstract
The survey of the presence of phytopathological viruses on plants of the family Cucurbitaceae was
carried out in both main and marginal fruit vegetables producing areas in the Czech Republic during
the last five years. Altogether 610 leaf samples of cucurbitaceous vegetables were collected and
examined by ELISA for the presence of common and new possible invasive viruses Cucurbit aphidborne yellows virus (CABYV), Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus
(CGMMV), Melon necrotic spot virus (MNSV), Papaya ring spot virus (PRSV), Squash mosaic virus
(SqMV), Watermelon mosaic 2 virus (WMV-2), Zucchini yellow fleck virus (ZYFV) and Zucchini
yellow mosaic virus (ZYMV). In the samples, there was detected the presence of CABYV, CMV,
SqMV, WMV-2 a ZYMV with the predominating occurrence ZYMV in southern and middle Moravia.
Key words: CABYV, CMV, SqMV, WMV-2, ZYMV
Úvod
Velké množství fytopatogenních virů napadá rostliny čeledi tykvovitých (Cucurbitaceae) po
celém světě a způsobuje nemalé ztráty na jejich výnosu. V Evropě, zejména ve Středozemí,
jsou běžně rozšířeny virus mozaiky okurky (Cucumber mosaic virus, CMV), virus zelené
skvrnité mozaiky okurky (Cucumber green mottle mosaic virus, CGMMV), virus nekrotické
skvrnitosti melounu (Melon necrotic spot virus, MNSV), virus kroužkovitosti papáji (Papaya
ring spot virus, PRSV), virus mozaiky tykve (Squash mosaic virus, SqMV), virus mozaiky
vodního melounu (Watermelon mosaic 2 virus, WMV-2), virus žluté skvrnitosti cukety
(Zucchini yellow fleck virus, ZYFV) a virus žluté mozaiky cukety (Zucchini yellow mosaic
virus, ZYMV; Descriptions of Plant Viruses, 2012). Ve Francii byl na tykvovitých zeleninách
v r. 1992 popsán nový Cucurbit aphid-borne yellows virus (CABYV; Lecoq et al., 1992). Dál
na sever Evropy není výskyt virových chorob tykvovitých zelenin tak široký; např.
v sousedním Polsku byly zjištěny jen CMV (Korbin a Kaminska, 1998), WMV-2 (Borodynko
et al., 2009) a ZYMV (Pospieszny et al., 2003).
Virové infekce často vyvolávají na nemocných rostlinách žloutnutí nebo mozaiku listů,
deformují plody, způsobují zakrslost rostlin a snižují celkový výnos. V přírodních
podmínkách jsou běžné směsné infekce několika viry současně, což působí silným
synergickým efektem na hostitelské rostliny, které pak vykazují výrazné příznaky virové
infekce a často neplodí vůbec.
231
„Úroda 12/2012, vědecká příloha časopisu“
Úkolem provedené práce bylo zjistit rozšíření a výskyt virových patogenů tykvovitých zelenin
v České republice (ČR).
Materiál a metody
Rostlinný materiál
Ve spolupráci se Státní rostlinolékařskou správou byly vytipovány pozemky na Moravě a v
Čechách, kde se pěstují tykvovité zeleniny. Z těchto lokalit byly opakovaně odebírány vzorky
listů okurek, tykví a melounů s možnými příznaky virové infekce. Pomocí ELISA v nich byla
zjišťována přítomnost jednotlivých virů.
ELISA
Pro identifikaci virových patogenů rostlin ve vzorcích listů byla použita imunoenzymatická
metoda DAS-ELISA popsaná Clarkem a Adamsem (1977), komerční protilátky a pracovní
postup podle návodů firmy Loewe Biochemica, Německo. Do každého testu byla zařazena
pozitivní a negativní kontrola pro zvýšení spolehlivosti testu. Výsledná barevná reakce byla
vyhodnocována na fotometru Dynatech MR 5000, Německo při vlnové délce 405 nm. Vzorky
s absorbancemi A405 > 0,150 byly brány jako pozitivní a vzorky s absorbancemi A405 < 0,030
byly brány jako negativní. Dosahované absorbance pozitivních kontrol byly přes 1,0 a
negativních kontrol do 0,025.
Elektronová mikroskopie
Vzorky listů zkoumaných rostlin byly homogenizovány v třecí misce s HEPES pufrem v
poměru 1 : 2. Homogenát byl filtrován přes silonové síto a negativně barven přídavkem
kyseliny fosfowolframové, pH 6,9 v poměru 1 : 1. Vzniklá směs byla adsorbována na
elektronmikroskopickou síťku a prohlížena transmisním elektronovým mikroskopem Philips
208 S, Holandsko. Nalezené virové částice byly měřeny a fotografovány.
Extrakce RNA
Celková RNA byla extrahována z listů rostlin pomocí RNeasy® Plant Mini Kit (Qiagen). RT
PCR je prováděna podle optimalizovaného protokolu s primery specifickými pro každý
detekovaný druh viru. Produkty PCR byly separovány elektroforeticky v 1,6% agarózovém
gelu.
Výsledky a diskuse
Průzkum výskytu virů
V průběhu posledních pěti let byly každý rok ve spolupráci s okresními pracovišti SRS a
Zelinářskou unií Čech a Moravy vytipovány lokality, kde se ve větší míře pěstují tykvovité
zeleniny nebo kde je podezření na výskyt virových chorob na nich. Jednalo se o pozemky
ležící jak v hlavních, tak i v okrajových pěstitelských oblastech. Na těchto lokalitách byly
hledány rostliny s příznaky možné virové infekce, ze kterých byly odebírány vzorky listů.
Celkem bylo otestováno 610 vzorků listů okurek, tykví a melounů z polních i skleníkových
porostů na přítomnost CGMMV, CMV, MNSV, PRSV, SqMV, WMV-2, ZYFV a ZYMV.
Každoročně byl ve vzorcích nejčastěji detekován ZYMV následovaný WMV-2 a CMV.
V roce 2009 bylo na jižní Moravě pozorováno žloutnutí listů tykví olejných (Cucurbita pepo
L. var. oleifera Pietsch). Na základě informací získaných od Dr. Lecoqua, INRA, Avignon,
Francie bylo pojato podezření na přítomnost v ČR nového CABYV. Pomocí specifického
antisera připraveného v INRA byly provedeny ELISA testy na detekci viru. Ve vzorcích listů
tykví olejných odebraných v blízkosti obcí Josefov, Prušánky a Rakvice (okr. Břeclav) byla
zjištěna jeho přítomnost. Nález byl potvrzen pozorováním odpovídajících virových částic pod
elektronovým mikroskopem a pomocí RT-PCR. Amplikony byly sekvencovány a na základě
232
„Úroda 12/2012, vědecká příloha časopisu“
sekvencí byla zjištěna blízká příbuznost českých izolátů viru se slovenskými izoláty. Jednalo
se o první nález CABYV v ČR (Svoboda at al., 2011).
V roce 2010 byla ve vzorcích listů tykví ozdobných (Cucurbita pepo L. convar. microcarpina
Grebenščikov) pěstovaných v blízkosti obce Tasovice (okr. Znojmo) zjištěna přítomnost
SqMV. Nález byl detekován metodou ELISA a potvrzen pomocí elektronového mikroskopu a
PCR. Amplikony PCR byly sekvenovány a byla určena jejich příbuznost s publikovanými
sekvencemi SqMV z USA a Číny. Zjištění SqMV představuje první nález v ČR (Svoboda a
Leisova-Svobodova, 2011). Nalezený český izolát viru je bezpříznakový, jeho přítomnost lze
však snadno odhalit pomocí ELISA nebo PCR.
Tabulka 1: Souhrnný přehled zjištěného výskytu virových chorob na tykvovitých
zeleninách v ČR
Virové choroby tykvovitých zelenin - ČR, 2007 - 2011
v ir us
poč e t po zi t i v n íc h v z.
% z 6 10 od e bra n ýc h v z.
ZYMV
360
59,0
WMV-2
93
15,2
CMV
72
11,8
CABYV
15
2,5
SqMV
2
0,3
Přehled nalezených virů na tykvovitých zeleninách s jejich četnostmi je uveden v tabulce 1.
Z tabulky je patrné, že na tykvovité zelenině se nejčastěji vyskytuje ZYMV následovaný
WMV-2 a CMV. Geografické rozložení výskytu virových chorob tykvovitých zelenin na
území ČR je znázorněno na obr.1. Negativní nálezy nejsou na obrázku vyznačeny, protože by
se obrázek stal nepřehledným. Analýzou výsledků bylo zjištěno, že fytopatogenní viry se na
tykvovitých zeleninách vyskytují v hlavních produkčních oblastech pěstování tykvovité
zeleniny jižní a střední Moravy (okresy Břeclav, Znojmo, Hodonín, Olomouc a Prostějov) a
Polabí (okresy Praha-východ a Mělník) každoročně od svého prvního nálezu. V okrajových
oblastech, jako jsou okresy Moravy (Blansko, Bruntál, N. Jičín, Ostrava, Opava) a Čech
(Beroun, Č. Budějovice, Písek, Tábor, Benešov, Jičín) byly fytopatogenní viry nalezeny
ojediněle, především v záhumencích na okrajích vesnic.
Izoláty jednotlivých virů byly uloženy do sbírky fytopatogenních virů VÚRV, v.v.i, Praha
(Sbírka fytopatogenních virů, 2012).
Závěr
Byl zjištěn výskyt fytopatogenních virů jak v hlavních oblastech pěstování tykvovitých
zelenin v Čechách a na Moravě, tak také v okrajových oblastech. Přítomnost sledovaných virů
představuje nebezpečí znehodnocení a snížení produkce tykvovitých zelenin v zamořených
oblastech a je nezbytné soustředit se na ochranu proti jejich šíření pomocí mšic a pěstovat
rezistentní odrůdy zelenin. Metodika ochrany před ZYMV je na vyžádání u autora příspěvku.
Dedikace
Provedený výzkum byl financován z výzkumného záměru MZE ČR 0002700604.
233
„Úroda 12/2012, vědecká příloha časopisu“
Obrázek 1: Výskyt virových chorob zjištěných na tykvovitých zeleninách v ČR,
2007-2011
CABYV:
CMV:
SqMV:
WMV-2:
ZYMV:
zelená značka
žlutá značka
fialová značka
modrá značka
červená značka
Použitá literatura
Borodynko, N., Hasiow-Jaroszewska, B., Rymelska, N. and Pospieszny, H. 2009.
Watermelon mosaic virus reported for the first time in Poland. Plant Pathology 58:783.
Descriptions of Plant Viruses [www document]. [cit. 12. 8. 2012]. Available in:
http://www.dpvweb.net/dpv/dpvnameidx.php.
Korbin, M. and Kaminska, M. 1998. Characterization of cucumber mosaic cucumovirus
isolates. Phytopathologia Polonica. 16:71-84.
Lecoq, H., Bourdin, D., Wipf-Scheibel, C., Bon, M., Lot, H., Lemaire, O. and Herrbach,
E. 1992. A new yellowing disease of cucurbits caused by a luteovirus, cucurbit aphidborne yellows virus. Plant Pathology 41:749-761.
Pospieszny, H., Cajza, M. and Plewa R. 2003. First report of zucchini yellow mosaic
virus in cucumber in Poland. Plant Disease 87:1399.
Sbírka fytopatogenních virů [www dokument]. [cit. 9. 2. 2012]. Dostupné na:
http://www.vurv.cz/collections/vurv.exe/search?org=VI.
Svoboda J., Leisova-Svobodova L. 2011. First Report of Squash Mosaic Virus in
Ornamental Pumpkin in the Czech Republic. Plant Disease 95:10, 1321-1321.
Svoboda J., Leisova-Svobodova L., Lecoq H. 2011. First Report of Cucurbit aphid-borne
yellows virus in squash in the Czech Republic. Plant Disease 95:2, 220-220.
Kontaktní adresa:
Ing. Jiří Svoboda, Ph.D., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507,
161 06-Praha 6-Ruzyně, e-mail: [email protected]
234
„Úroda 12/2012, vědecká příloha časopisu“
REGULACE PLEVELŮ U CIZRNY BERANÍ A HRACHORU SETÉHO
Weed control in chickpea (Cicer arietinum) and vetchling
(Lathyrus sativus)
Šmahel P., Kolaříková E.
Zemědělský výzkum, s.r.o.,Troubsko
Abstrakt
V letech 2006-2012 byly v Troubsku v polních pokusech zkoumány chemické i mechanické metody
regulace plevelů u vybraných netradičních luskovin. Jako lépe konkurenceschopná proti plevelům a
výnosnější plodina se projevil hrachor setý (odrůda Radim, výnosy cca 2-2,7 t/ha) oproti cizrně beraní
(Irenka, cca 0,2-0,9t/ha). Vláčení plecími branami nemělo dostatečný účinek na plevele s hlubšími
kořeny. Z použitých herbicidů se jako uspokojivě účinné a selektivní ukázaly jednak premergentní
aplikace linuronu cca 500-600 g/ha aktivní substance, u hrachoru v tankmixu s clomazonem cca 450540g/ha. Cizrna snášela naopak dobře oproti hrachoru S-metolachlor. Výrazně fytotoxické byly
pendimethalin, metribuzin a prosulfocarb, slabě účinný diflufenican a ethofumesate. V nových
pokusech se jeví jako poměrně nadějné hlavně využití S- dimethenamidu a dále aclonifenu.
Z postemergentních herbicidů, které snášel zpravidla výrazně lépe hrachor než cizrna, se kromě
graminicidů jevily jako vhodné jednak samotný bentazone, lépe selektivní bez aktivátoru, než
s aktivátorem. Na řadu plevelů účinnější, ale v doporučovaných dávkách někdy méně selektivní byl
imazamox, většinou doplněný pendimethalinem nebo bentazonem.
Klíčová slova: cizrna, hrachor, regulace plevelů, herbicidy, selektivita, účinnost
Abstract
The chemical and mechanical methods of weed control in pulse crops chickpea (variety Irenka) and
vetchling (Radim) were observed in field trials in Troubsko in 2006-2012. The vetchling was better
competitive to the weeds and herbicides and more profitable crop in the trials. The harrowing with rod
harrows had not sufficiant efficacy mainly to the weeds with a deep roots. Herbicide treatment with
linuron ca 500-600 g/ha active ingredience was good selective and effective to the brodleaf weeds by
the vetchling with clomazone too in the rate ca 450-540g/ha a.i. The preemergence aclonifen and
dimethenamid provided a bit better effectivity in the last trials. Vetchling tolerated good quite better
than chickpea the postemergence herbicides bentazone, imazamox with tween and imazamox with
pendimethalin or bentazone.
Key words: Chickpea, vetchling, weed control, herbicides, selectivity, efficacy
Úvod
Cizrna beraní a hrachor setý jsou staré kulturní rostliny, pěstované jako potraviny hlavně ve
středomoří. V souvislosti se současnými klimatickými tendencemi oteplování a suchých
period se dostávají znovu do oblasti zájmu pěstitelů, snažících se nabídnout pestřejší možnosti
stravy v rámci zdravé výživy. Pěstitelská doporučení, týkající se využití preemergentních
nebo postemergentních herbicidů, jsou v literatuře spíše z oblastí jiných podmínek, většinou
středomoří nebo Indie pro cizrnu (Kachhadiya SP, et al, 2009) nebo Severní Ameriky pro
příbuzný fazol (Hekmat, S., et al, 2008), (Sikkema, PH, et al, 2008). Indický pramen uvádí
možnost využití oxyfluorfenu preemergentně (u nás např. přípravek Goal 2E) a
postemergentně imazethapyru (Pivot), který u nás po jeho restrinkci nahrazuje imazamox,
dostupný zatím ve směsné formulaci s pendimethalinem (přípravek Escort Nový). Při
nevýznamných rozdílech mezi variantami dosáhli výnosů cizrny až cca 3t/ha. Severoamerické
resp. kanadské prameny u fazolu hodnotí jako potenciálně použitelné preemergentně
dimethenamid (u nás přípravek Outlook) nebo S-metolachlor (Dual Gold 960EC), již s větší
fytotoxicitou linuron (např. Afalon 45SC). I v Troubsku byly kolegou Tesařem prováděny
v 90. letech pokusy s těmito plodinami (pro registraci byl z nich doporučen do cizrny např.
metribuzin (Sencor) či postemergentně pyridate (Lentagran), které v souvislosti s novými
235
„Úroda 12/2012, vědecká příloha časopisu“
přípravky nebo dalšími možnostmi z jiných luskovin byly částečně využity při nových
pokusech. V Troubsku byly v minulých letech vyšlechtěny odrůdy cizrny a hrachoru a je
řešena i technologie jak v podmínkách ekologického, tak konvenčního hospodaření. Příspěvek
je zaměřen na pokusně zkoumané způsoby regulace plevelů.
Materiál a metody
Pro ověření způsobů regulace plevelů u cizrny a hrachoru byly v Troubsku prováděny polní
maloparcelové pokusy s přirozeným zaplevelením, jejichž součástí byly v některých ročnících
i plochy pro mechanickou kultivaci, zejména vláčení prutovými branami. Pokusy byly
prováděny v randomizovaném uspořádání podle mezinárodních metodik EPPO pro ověřování
biologické účinnosti herbicidů. Pokusy probíhaly v podmínkách řepařské výrobní oblasti a
jejich výsledky byly dosti závislé na průběhu počasí na jaře. Výsevy byly prováděny vždy cca
od začátku do poloviny dubna po výraznějším jarním oteplení, preemergentní aplikace do 3
dnů po zasetí a postemergentní podle růstu porostu začátkem nebo do poloviny května, po
vývinu min. 2-3 pravých listů plodin, na plevele v růstovém stádiu od děložních do cca 6 max. 8 pravých listů. V letech 2007, 2009 a 2012 bylo jaro s výrazným přísuškem, což
ovlivňovalo negativně zejména preemergentní tzv. „půdní“ herbicidy a také vzcházení a
počáteční růst porostu. Naopak normální příznivější podmínky s dostatkem srážek byly
v letech 2008 a 2011. Z jednotlivých variant ošetření, které byly aplikovány během let
ve velmi širokém souboru, byly do tohoto příspěvku a výsledků vybrány spíše potenciálně
vyhovující varianty s uspokojivou selektivitou a účinností. Pro informaci uvádíme alespoň
výčet zkoušených látek a přípravků, aplikovaných samostatně i v některých kombinacích.
Preemergentní ošetření: linuron (Afalon 45 SC), clomazone (Command 36CS), pendimethalin
(Stomp 400SC), imazamox +pendimethalin (Escort), S-metolachlor (Dual Gold 960EC),
diflufenican (Brodal), metribuzin (Sencor 70WG), S-dimethenamid (Outlook), aclonifen
(Chalenge). Postemergentní ošetření: bentazone (Basagran), bentazone+ aktivátor wettol
(Basagran Super), imazamox +adjuvant tween (Pulsar 40), imazamox +pendimethalin (Escort,
Pulsar 40+Stomp 400SC, Escort Nový), imazamox + bentazone (Pulsar 40+Basagran nebo
Basagran Super, BAS Corum), ethofumesate (Stemat super), pyridate (Lentagran WP). Dávky
jsou uvedeny ve výsledkové části. V pokusech byla hodnocena vizuálně selektivitu a účinnost
na plevele u jednotlivých variant ošetření v % ve vztahu k neošetřené kontrole (0%).
Výsledky a diskuze
Výsledky pokusů jsou uvedeny v následujících tabulkách, které obsahují účinnost použitých
variant ošetření na několik hlavních vyskytujících se druhů plevelů, fytotoxicitu (selektivitu)
v % oproti neošetřené kontrole a kde bylo možné výnosové údaje v t/ha. Pro snadnější
přehlednost a porovnatelnost jsou uvedeny pouze průměrné hodnoty všech údajů
v jednotlivých ročnících.
Tab. 1: Cizrna beraní (Irenka)
Účinnost a fytotoxicita herbicidů, výnos semen
Účinnost průměr v %
Laskavec
Merlík
Rdesno
Ježatka
Přípravek l/ha
AMARE
CHEAL
POLLA
ECHCG
8.6.
19.6.
t/ha
Kontrola (počet plevelů na 1m2)
6
7
2
10
0
0
0,34
2008
18
16
5
5
0
0
2009
1
31
14
3
0
0
2011
0
7
2
0
0
0
2012
45
20
2
140
0
0
0,29
Průměr
14,0
16,2
5,0
31,6
0,0
0,0
0,31
20
33
49
25
6
18
2007
2007
Afalon 1,4
236
Fytotoxicita %
Výnos
„Úroda 12/2012, vědecká příloha časopisu“
2008
2007
Afalon1,18+Command 36 CS 0,18
2008
2011
Stomp 400 3,5
2008
2007
Escort 2,9 preem.
2008
2011
Outlook 1l
2012
2007
Basagran 2
2008
2009
Basagran 1,9
2012
Basagran 2
45
21
24
31
21
52
55
6
16
75
100
87,5
94
85
95
100
40
47,5
30
33,75
42,5
62,5
87,5
57,5
15
12,5
35
76
66
44
6
14
65
100
100
62
53
44
38
71
45
61
16
14
89
100
99
73
54
43
0,31
*
87,5
95
100
32,5
25
65
47,5
37,5
50
11,25
15
0,34
83
90
100
10
16
16
0,78
56
73
45
11
0
80
41
33
28
81
90
60
100
0
40
47,5
0,18
65,9
93,7
18,3
25,0
22,8
0,48
Basagran Super 1,4
90
79
100
16
16
20
0,91
80
84
3
72
18
36
11
Basagran Super 1,6
51
35
31
29
58,8
80,9
86,0
23,3
19,6
17,1
0,91
85
63
45
49
0,69
58
15
1
2008
2009
98
77,2
Průměr
2007
95
Afalon 1,2 + Command 0,12
2012
2007
75
Průměr
2007
Pulsar 40 0,7
100
81
2008
Pulsar 40 0,53
93
45
2009
Pulsar 0,58
100
39
70
41
33
25
2009
Pulsar 0,7
100
43
65
55
26
21
98,1
52,1
73,3
54,0
29,6
24,1
0,69
88
80
43
49
0,77
66
19
9
Průměr
2007
Escort 1,8
93
95
2008
Escort 1,58
90
73
91,3
84,0
87,5
73,0
30,8
28,9
0,77
Průměr
2007
Pulsar 0,59+Stomp 400 0,83
100
69
100
56
43
49
0,73
2007
Pulsar 0,7+Stomp 400 1,05
100
91
91
81
49
58
0,68
2008
Pulsar 0,47+ Stomp 400 0,7
86
64
64
26
14
95
75
96
67
39
40
Průměr
2009
Escort Nový 1,4
100
64
69
63
33
29
2009
Escort Nový 1,58
100
70
60
63
23
20
2012
Escort Nový 1,2
100
87,5
90
52,5
36,25
27,5
100
74
73
60
30
25
Průměr
0,70
0,31
2007
Pulsar 0,58+ Basagran 1,75
100
100
98
65
25
33
0,90
2007
Pulsar 0,7 + Basagran 1,46
100
100
100
74
29
13
0,90
2008
Pulsar 0,53+Basagran 1,17
90
73
55
15
8
2009
Pulsar 0,55+Basagran 1
96
71
79
58
30
24
96,5
86,0
92,2
62,9
24,7
19,1
Průměr
2009
Pulsar 0,55+Basagran Super 0,9
89
83
73
31
36
29
2012
BAS Corum 1 + Dash HC 0,5
100
77,5
100
50
40
30
100,0
77,5
100,0
50,0
40,0
30,0
Průměr
237
0,90
0,35
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 2: Hrachor setý (Radim)
Účinnost a fytotoxicita herbicidů, výnos semen
Účinnost v %, průměr ročníku
Laskavec
Merlík
Rdesno
Ježatka
Přípravek l/ha
AMARE
CHEAL
POLLA
ECHCG
8.6.
19.6.
t/ha
4
7
2
10
0
0
0,89
2008
8
10
0
8
0
0
2,32
2009
0
36
17
0
0
0
2011
0
10
2
2
0
0
Průměr
3,0
15,8
5,3
5,0
0,0
0,0
1,61
51
30
46
45
8
16
*
100
100
*
46
24
8
16
19
2,34
63
68
33
100
21
19
*
2,29
2007
2007
Kontrola (počet plevelů na 1m
2)
Afalon 1,4
2008
2007
Afalon 1,25+Command 36 CS 0,175
Fytotoxicita % Výnos
2008
Afalon1,17+Command 36 CS 0,175
91
100
33
*
2011
Afalon 1,2l + Command 0,12l
*
95
85
100
40
18,5
*
2007
Stomp 400 3,5
61
73
46
61
18
24
*
94
100
*
100
51
39
2,13
86
70
46
68
19
21
*
100
100
*
98
39
34
2,15
2008
2007
Escort 2,9 preem.
2008
2011
Outlook 1l
*
77,5
100
100
32,5
16,25
*
2007
Basagran 1,9
85
95
95
83
16
13
2,50
2008
94
74
*
0
16
3
2,14
2009
46
53
*
*
33
29
Průměr
73,9
94
95,0
100
41,5
21
21,8
13
14,7
18
2,32
2,44
2,28
2007
Basagran Super 1,4
74,9
80
2008
Basagran Super 1,6
100
100
*
77
31
15
2009
61
75
*
*
24
20
Průměr
80,3
89,6
100,0
49,0
22,6
17,5
2,4
2007
Pulsar 40 0,7
99
95
99
76
20
16
2,22
2008
Pulsar 40 0,6
98
81
*
36
24
9
2,00
2008
Pulsar 0,7
99
84
*
82
29
15
2,20
66
55
*
*
20
22
*
65
100
*
25
15
90
76
99
65
24
15
2,14
2009
2011
Pulsar 0,5l
Průměr
2007
Escort 1,8
99
99
89
75
21
15
2,10
2008
Escort 1,75
95
90
*
80
29
15
2,11
97
94
89
78
25
15
2
Průměr
2007
Pulsar 0,6+ Stomp 400 0,9
95
79
95
70
18
14
2,56
2007
Pulsar 0,7+ Stomp 400 1,05
100
100
98
78
23
20
2,50
2008
Pulsar 0,6+ Stomp 400 0,9
100
91
*
93
19
9
2,31
98,3
90,0
96,3
80,3
19,6
14,2
2,46
Průměr
2009
Escort Nový1,4
49
73
*
*
35
34
2009
Escort Nový 1,6
74
61
*
*
30
23
2011
Escort Nový 1,25
*
90
97,5
87,5
7,5
7,5
61,5
74,7
97,5
87,5
24,2
21,4
Průměr
238
„Úroda 12/2012, vědecká příloha časopisu“
2007
Pulsar 0,58 + Basagran 1,75
100
100
99
74
23
19
2,51
2007
Pulsar 0,7 + Basagran 1,45
100
100
100
75
26
19
2,68
2008
Pulsar 0,58+ Basagran 1,16
100
98
*
98
21
11
2,27
2009
Pulsar 0,55+Basagran 1
63
64
*
*
18
12
91
90
99
82
22
15
73
74
*
*
26
21
Průměr
2009
Pulsar 0,55+Basagran Super 0,9
2011
BAS Corum 0,9l
*
72,5
100
*
12,5
10
Vysvětlivky k tabulkám: hranice u fytotoxicity – do 20% zeleně vcelku dobrá selektivita, do 29% žlutě
uspokojivá, 30 – 44 % oranžově zvýšená fytotoxicita, nad 45% červeně silná
Hranice u účinnosti – od 80% uspokojivá až dobrá zeleně, 66-79% nedostatečná žlutě, 50-65 slabá oranžově, do
49% velmi slabá červeně
*nebo prázdné políčko-nehodnoceno z důvodu slabého výskytu plevelů, u výnosů porost nebyl způsobilý ke
sklizni
U pokusů s herbicidy jsou zejména u těchto citlivějších plodin vlivy konkurence plevelů a
přímého působení herbicidů na plodinu (fytotoxicity) i dalších, zejména např. klimatických
vlivů často spojeny, proto jsou v tabulkách uvedeny společně. Snažili jsme se alespoň o
hrubší grafické rozlišení tabulek parametrů účinnosti a fytotoxicity podle barev (zelená pro
příznivější údaje, červená nepříznivé, žlutá a oranžová přechodné). Vhodné varianty pro
využití by měly mít v první řadě uspokojivou selektivitu a také účinnost alespoň na některé
významné druhy plevelů. Po dozrání porostu bylo u pokusů s nižším zaplevelením provedeno
sklizňové hodnocení. To se často nedařilo. Bylo to jednak vlivem slabé účinnosti řady
ošetření při vysokém tlaku plevelů, ale naopak aplikaci často redukovaných dávek herbicidů,
potřebných z hlediska dobré selektivity (zejm. u citlivější cizrny). U premergentních variant
pak docházelo ke značnému zaplevelení za sucha. Porosty trpěly i poškozením po zasetí
holuby a hlavně u cizrny i částečným spásáním zajícem polním.
Dosažené výsledky v jednotlivých ročnících jsou poměrně různorodé vlivem klimatických a
stanovišťnich podmínek, zejm. značných rozdílů v zaplevelení, postupných dílčích úprav
dávkování nebo i změn použitých přípravků kvůli jejich nevyhovující selektivitě nebo
účinnosti, případně kvůli změnám formulace výrobcem. Výsledky nejsou proto příliš vhodné
k podrobnějšímu detailnímu srovnávání a statistickému zpracování.
U cizrny i hrachoru v pokusech docházelo ke značným rozdílům z hlediska účinnosti na
plevele i selektivity zejména u preemergentních variant ošetření kvůli značné závislosti na
půdní vlhkosti. V suchých letech 2007, 2009 a 2012 byla účinnost preemergentních variant
vesměs slabá a hodnocení selektivity naopak příznivé, obě málo vypovídající. Při vlhčím
průběhu jara v letech 2008 a pak v roce 2011, oproti zahraničním poznatků z fazolu (Sikkema,
et al.,2008), které konstatují dobrou selektivitu spíše u dimethenamidu a horší u linuronu, byla
zjištěna u cizrny i hrachoru u variant linuronu (Afalon 45SC cca 1,1-1,5l/ha) poměrně
uspokojivá selektivita, s fytotoxicitou krátkodobě cca 20-30% (mírně opožděné vzcházení a
snížený růst). U hrachoru byla i přes možnost přechodné fytotoxicity až 40% hodnocena pro
významně lepší účinnost jako akceptovatelná i tankmix směs s clomazonem (Command
36CS 0,125-0,15l/ha), u cizrny zde docházelo již k poněkud výraznější zbrždění růstu 4050%, akceptovatelnému snad ve snížené dávce. V pozdějších pokusech v roce 2011, 2012 se
jako poměrně účinný na ježatku i dvouděložné a uspokojivě selektivní u obou plodin jevil
dimethenamid (Outlook cca 1-1,2l/ha) a dále aclonifen (Chalenge) cca 2-2,5l/ha (2012) jako
určitá alternativa linuronu na dvouděložné. Naopak silnou fytotoxicitu, projevující se
opožděným vzcházením a slabým růstem, působily u obou plodin pendimethalin (Stomp
400SC cca 3l, Escort preemergentně 2,9l/ha), a prosulfocarb (Boxer 800EC) a zejm. u cizrny
r. 2011 metribuzin (Sencor).
239
2,49
„Úroda 12/2012, vědecká příloha časopisu“
Postemergentní varianty sice měly poněkud stabilnější působení na plevele než premergentní,
ale spíše užší spektrum účinku a někdy výrazné, i když obvykle dočasné fytotoxické
působení, hlavně u citlivější cizrny. Z postemergentních herbicidů byl u obou plodin většinou
uspokojivě selektivní bentazone, lépe ve formulaci bez aktivátoru (Basagran). Fytotoxicita
byla u něj obvykle cca 10-25% u cizrny i hrachoru. Ve dvou pokusech však činila maximální
hodnota krátkodobě cca 35% a v roce 2012 u cizrny až 50%, a to dlouhodoběji. U samotného
imazamoxu (Pulsar 40) byla selektivita u cizrny s určitými výkyvy poměrně uspokojivá fytotoxicita krátkodobě cca 20-30 (maximální dílčí hodnota cca 50%). U hrachoru byla jeho
selektivita zřetelně lepší. Přípravek Pulsar 40 však v této formulaci zatím nebude výrobcem u
nás registrován a zřejmě dojde ke změně formulace kvůli slabšímu působení, zejména na
merlíky.
Ze směsných přípravků byly zkoumány hlavně směsi imazamoxu s pendimethalinem
(nejprve byl použit původní, nyní restringovaný přípravek Escort, později tankmix Pulsar
40+Stomp 400 s větším podílem imazamoxu oproti pendimethalinu a nakonec tomuto poměru
odpovídající nová originální formulace Escort Nový). U těchto směsí byla u cizrny
fytotoxicita v pokusech poněkud vyšší a dlouhodobější (cca 25-40%, maximální hodnota u
vyšší dávky až 60%). U hrachoru byla selektivita těchto přípravků opět zřetelně lepší.
Z jednotlivých formulací se lépe selektivní nakonec jevila nejnovější originální formulace. U
tohoto přípravku Escort Nový vzhledem k dobré účinnosti na většinu dvouděložných a
jednoděložných plevelů (zejména laskavce, ale i merlíky, svízel, rdesna a řadu dalších, z
jednoděložných na ježatku a oves hluchý) a jeho dostupnosti (proběhla registrace výrobcem
od sezóny 2012 v hrachu) je připravováno rozšíření jeho použití se sníženými dávkami. Směsi
imazamoxu s bentazonem (Pulsar 40+ Basagran nebo B. Super, nověji pak směsný přípravek
- experimentální ready mix BAS Corum) bývají na některé plevele účinnější (oproti Escortu
hlavně na heřmánkovité a oproti samotnému bentazonu na laskavce a další). Byly u cizrny
v některých ročnících hůře selektivní (fytotoxicita i přes 30%). U hrachoru byla jejich
selektivita vcelku dobrá, podobně jako v literatuře (Hekmat, et al, 2009) u fazolu a dle našich
poznatcích u některých jetelovin. U tankmixů imazamoxu a bentazonu bez aktivátoru i
připravovaného ready mixu však docházelo ke slabšímu působení na některé plevele, zejména
na merlíky. Proto se u readymixu (BAS Corum) navrhuje doplnění smáčedlem nebo případně
k bentazonu využít jako partnera spíš směsného Escortu, což vyžaduje další testování,
vzhledem ke přepokládané vyšší fytotoxicitě.
Závěr
Cizrna beraní Irenka se v pokusech projevila jako celkově méně konkurenceschopná plodina
z hlediska potlačování plevely, byla také spásána zajícem a mělce zasetá semena holuby.
Z hlediska integrované ochrany se jeví jako určitá možnost zlepšení konkurenceschopnosti
porostu zvýšení výsevku této odrůdy z doporučovaných 80-120kg/ha na min. 150kg/ha a
oplocení. Je u ní zřejmě vhodnější mechanická regulace plevelů, na menší ploše se osvědčilo
pěstování v širších řádcích a plečkování, při hlubším setí a dobrém zakořenění vláčení plecími
branami. Projevovala se u ní i obecně relativně vyšší citlivost na ošetření herbicidy.
Hrachor setý Radim se naopak ukázal jako dobře konkurenceschopná plodina vůči plevelům,
která při včasném, kvalitním zasetí a dobrém vzejití výrazně plevele potlačuje, hlubší setí je
důležité i proti vyzobávání holuby, kteří mohou vyzobávat i polehlý porost před sklizní. Je
zde možnost mechanické regulace plevelů, v širších řádcích plečkování, vláčení plecími
branami, v pozdější době poléhavá lodyha možnosti mechanické regulace omezuje a ztěžuje
sklizeň.
Možnosti herbicidních ošetření:
- z preemergentních herbicidů je u obou plodin uspokojivě selektivní i ve vlhčích ročnících
linuron (Afalon 45SC), spíše jen u hrachoru včetně směsi se sníženou dávkou clomazone
240
„Úroda 12/2012, vědecká příloha časopisu“
-
-
(Command 36CS), u cizrny je zase možno využít S- metolachlor ( Dual Gold 960EC), u
uvedených herbicidů bylo rozšířené použití již schváleno SRS
nově se jeví jako použitelný u obou plodin dimethenamid (Outlook) a u cizrny aclonifen
(Chalenge), který u hrachoru zatím nebyl zkoušen
naopak u metribuzinu (Sencor), již dříve zaregistrovaného u cizrny, se projevila za vlhka
silná fytotoxicita, podobně jako u pendimethalinu (Stomp), prosulfocarbu (Boxer) a
směsného Escortu, takže je k ošetření nelze doporučit
z postemergentních přípravků byl pro ošetření vybrán jako dostatečně selektivní u obou
plodin bentazone bez aktivátoru (Basagran), u hrachoru i s aktivátorem - Basagran Super –
zde bylo schváleno rozšíření použití
jako potenciálně možné se jeví použití imazamoxu, u samotného (Pulsar 40) však byla
v pokusech prokázána na některé významné plevele slabší účinnost a je avizována změna
jeho formulace
z účinnějších směsí imazamoxu s pendimethalinem se uvažuje o vyžití Escortu Nového,
který se vyznačoval poněkud zlepšenou selektivitou oproti starším formulacím a vcelku
dobrým působením na jednoleté plevele včetně jednoděložných, takže zde je zřejmě vhodné
navrhnout rozšíření použití
směsi imazamoxu s bentazonem mohou být někdy hůře selektivní u cizrny, uspokojivě u
hrachoru, mají slabší účinnost na některé plevele, zejm. na merlíky, ale jsou naopak účinné
na důležité heřmánkovité a další druhy, takže se s nimi počítá do dalšího zkoumání,
potřebnému i kvůli výrobcem avizované úpravě formulací přípravků a směsi
Dedikace
Projekt NAZV QG60130: Minoritní plodiny pro specifické využití v potravinářství
Použitá literatura
Hekmat, S., Soltani, N., Shropshire, C., Sikkema, PH.: Effect of imazamox plus bentazon on
dry bean (Phaseolus vulgaris L.). CROP PROTECTION, 2008, Vol. 27, No. 12, 1491-1494
s. ISSN 0261-2194.
Sikkema, PH., Robinson, DE., Nurse, RE., Soltani, N.: Pre-emergence herbicides for potential
use in pinto and small red mexican bean (Phaseolus vulgaris) production. CROP
PROTECTION, 2008, Vol. 27, No. 1, 124-129 s. ISSN 0261-2194.
Kachhadiya, SP., Savaliya, JJ., Bhalu, VB., Pansuriya, AG., Savaliya, SG.: Evaluation of
new herbicides for weed managment in chickpea (Cicer arietinum L.). LEGUME
RESEARCH, 2009, Vol. 32, No. 4, 293-297 s. ISSN 0250-5371.
Kontaktní adresa:
Ing. Petr Šmahel
Zemědělský výzkum, s.r.o.,
Zahradní 1, 664 41 Troubsko
[email protected]
241
„Úroda 12/2012, vědecká příloha časopisu“
Cicer arietinum L.
Lathyrus sativus L.
242
„Úroda 12/2012, vědecká příloha časopisu“
OBSAH GLUKOSINOLÁTŮ V ZELENÝCH ČÁSTECH ŘEPKY A
JEJICH VLIV NA VYBRANÉ ŠKŮDCE
Glucosinolate content (GSL) in green matter of rapeseed and their
influence on selected pests
Vrbovský V.1, Rychlá A1., Endlová L.1
1
OSEVA PRO s.r.o., odštěpný závod Výzkumný ústav olejnin Opava
Abstrakt
V listech a mladých šešulích řepky olejky ozimé (Brassica napus; Brassicaceae) byl analyzován
obsah glukosinolátů (GSL) metodou vysokoúčinné kapalinové chromatografie (HPLC). Celkový
obsah GSL v listech dosahoval v průměru 5,08 µmol/g, v šešulích 8,93 µmol/g sušiny. V listech
dominovala alifatická skupina GSL (66 % z celkových GSL), následovala aromatická (17 %) a
indolová (17 %) skupina. V mladých šešulích dominovaly alifatické (49 %) a indolové (47 %) GSL,
aromatická skupina tvořila 4 %. Současně byla stanovena velikost napadení analyzovaných genotypů
řepky pilatkou řepkovou (Athalia rosae, Hymenoptera) a bejlomorkou kapustovou (Dasineura
brassicae, Diptera). Byly stanoveny korelace mezi obsahem zjištěných GSL a napadením těmito
škůdci. Negativní vliv na napadení pilatkou byl zjištěn u gluconapoleiferinu (P>0,05). Pozitivní vliv
na napadení bejlomorkou vykazoval obsah glucoalyssinu (P>0,05).
Klíčová slova: řepka olejka, glukosinoláty, pilatka řepková, bejlomorka kapustová
Abstract
In leaves and young siliques of rapeseed (Brassica napus; Brassicaceae) was analyzed content of
glucosinolates (GSL). The used method was high performance liquid chromatography (HPLC). The
total content GSL in the leaves was 5,08 µmol/g d.m., in siliques was 8,93 µmol/g d.m.. In the leaves
dominated group of alifatic GSL (66 %), groups of aromatic and indolyl GSL were represented from
17%. In the young siliques dominated groups of alifatic (49 %) and indolyl (47 %) GSL, group of
aromatic GSL was represented by 4%. Simultaneously was determined damage of leaves of Athalia
rosae (Hymenoptera) and damage of siliques of Dasineura brassicae (Diptera). Correlations have
been established between the attack and GSL content. Gluconapoleiferin exhibited the significant
negative influence to the damages of A. rosae (P>0,05). Glucoalyssin exhibited the significant positive
influence to the damages of D. brassicae (P>0,05).
Key words: rapeseed, glucosinolates, Athalia rosae, Dasineura brassicae
Úvod
Glukosinoláty a jejich rozkladné produkty (isothiokyanáty, thiokyanáty, nitrily) se mimo jiné
podílejí na obranyschopnosti rostlin proti živočišným škůdcům. Účinnost této obrany je
prokázána u celé řady fytofágů. Někteří však dokáží přítomnost těchto látek využít pro
rozpoznání hostitelské rostliny a z GSL se tak stávají atraktanty. Obecně platí, že polyfágní,
méně specializovaní škůdci, jsou GSL odpuzováni, zatímco u některých škůdců
specializovaných na brukvovité tomu bývá naopak.
V rámci představovaného výzkumu bylo provedeno stanovení obsahu GSL v rostlinných
pletivech řepky olejky ozimé v různých vývojových fázích a částech rostliny u více linií
vzniklých šlechtitelskou činností organizace OSEVA PRO s.r.o., Výzkumný ústav olejnin
Opava.
Pro hodnocení vlivu obsahu GSL na napadení byla zvolena pilatka řepková a bejlomorka
kapustová. Housenice pilatek poškozují žírem listy a lodyhy, při vyšším tlaku dochází až
k holožíru. Bejlomorka kapustová je typický šešulový škůdce, kterého je často nutné
regulovat chemicky. Dospělci kladou vajíčka do mladých 1-2 cm velkých šešulí. Ty se
následně deformují, praskají a semena vypadávají.
243
„Úroda 12/2012, vědecká příloha časopisu“
Materiál a metody
S vybranými genotypy řepky byl založen maloparcelkový pokus s těmito parametry: výměra
parcel 10 m2, délka 9 m, šířka 1,125 m, počet řádků 9, meziřádková vzdálenost 12,5 cm,
zásev v agrotechnickém termínu maloparcelním secím strojem při výsevku 700 klíčivých
semen na 10 m2. Agrotechnické zásahy byly v souladu s běžnou pokusnickou praxí bez
insekticidního ošetření.
Vzorky listů pro analýzu GSL byly odebrány 25.10.2011 ve fázi řepky BBCH 19 (6 a více
listů vyvinuto) z 16-ti pilatkou kontrastně napadených genotypů. Při polním hodnocení
(21.10.2011) byla stanovena míra napadení pilatkou jako procento housenicemi poškozené
listové plochy.
Odběr vzorků mladých šešulí o velikosti do 2 cm pro analýzu GSL byl proveden 21.5.2012 ve
fázi BBCH 69 (dokvétání). Každá rostlina, ze které byl proveden odběr, byla označena a po
dozrání samostatně sklizena (2.7.2012) za účelem stanovení velikosti procentického napadení
šešulí bejlomorkou. Hodnoceno bylo 52 rostlin 9 genotypů.
Vzorky zelené hmoty byly bezprostředně po odběru analyzovány na obsah GSL. Metodika
jejich stanovení v zelené hmotě metodou vysokoúčinné kapalinové chromatografie (HPLC)
vychází z mezinárodní normy ISO 9167-1: 1992 (E). Pracovní postup zahrnuje úpravu
vzorků, extrakci GSL methanolem, jejich enzymatickou desulfataci na iontoměniči, končí
stanovením desulfoglukosinolátů metodou HPLC na koloně s reverzní fází za použití
gradientové eluce a detekce v UV oblasti. Ke kvantitativnímu stanovení GSL v zelené hmotě
byla použita metoda vnitřního standardu (KOLOVRAT 2005).
Výsledky a diskuze
Obsah GSL v různých částech rostlin
V listech řepky bylo identifikováno 12 GSL, v šešulích 13 GSL. Identifikované GSL, jejich
procentické zastoupení a celkové množství udává tabulka 1. V listech dominovala alifatická
skupina GSL (66 % z celkových GSL), následovala aromatická (17 %) a indolová (17 %).
V mladých šešulích dominovaly alifatické (49 %) a indolové (47 %) GSL, aromatická skupina
tvořila 4 %. Pro porovnání uvádíme průměrné obsahy GSL v semenech zjištěných po sklizni.
V semenech výrazně dominovala alifatická skupina (77 %), následována indolovou (20,5 %).
Aromatická skupina byla zastoupena jen ze 2,5 %.
Tab. 1: Zastoupení jednotlivých GSL v listech, šešulích a semenech řepky (průměrné
hodnoty z jednotlivých stanovení)
glucobrassicin
4methoxoglucobrassicin
neoglucobrassicin
11,4 33,6
13,1 5,2
17,0 4,5
4hydroxyglucobrassicin
3,7
4,2
2,3
glucotropaeolin
5,5
3,8
0,0
Indolová skupina (%)
gluconasturtiin
0,7
0,1
1,1
Aromatická
skupina (%)
glucoalyssin
11,7
22,8
51,3
glucobrassicanapin
gluconapoleifein
0,1
0,3
0,4
gluconapin
glucoraphanin
5,075
8,926
19,138
epi-progoitrin
Listy
Šešule
Semeno
GSL
celkem
(µmol/g
sušiny)
progoitrin
Rostlinná
část
glucoiberin
Alifatická skupina (% z celkových GSL)
5,3
1,4
2,0
11,9
2,3
0,6
0,0
0,0
is
1,2
7,4
19,0
15,2
38,5
1,2
0,0
0,1
0,1
1,3
0,6
0,4
Vliv GSL na napadení
Statistická analýza byla provedena pomocí programu STATISTICA Cz 10. Signifikantně
negativní vliv (P>0,05) na napadení rostlin pilatkou byl zjištěn v případě gluconapoleiferinu.
244
„Úroda 12/2012, vědecká příloha časopisu“
Rostliny, u nichž bylo v listech zjištěno vyšší procentické zastoupení tohoto GSL na
celkovém obsahu GSL, vykazovaly nižší míru poškození housenicemi pilatek (graf 1).
Pozitivní vliv (P>0,05) na napadení bejlomorkou kapustovou byl zjištěn u glucoallysinu.
Rostliny s vyšším zastoupením tohoto GSL v šešulích vykazovaly větší míru poškození
bejlomorkou (graf 2).
Graf 1: Napadení rostlin pilatkou řepkovou vs. obsah gluconapoleiferinu v listech:
Bodový graf: Gluconapoleiferin (%) vs. napadení (%) (Celé příp. vynech. u ChD)
napadení (%) = 36,643 - 3,235 * Gluconapoleiferin (%)
Korelace : r = -,5249
50
45
40
napadení (%)
35
30
25
20
15
10
5
0
1
2
3
4
5
6
Gluconapoleiferin (%)
7
8
0,95 Int.spol.
Graf 2: Napadení rostlin bejlomorkou kapustovou vs. obsah glucoalyssinu v šešulích:
Bodový graf: Glucoalyssin (%) vs. napadení bejlomorkou (%) (Celé příp. vynech. u ChD)
napadení bejlomorkou (%) = 9,8319 + 8,4761 * Glucoalyssin (%)
Korelace : r = ,68057
36
34
napadení bejlomorkou (%)
32
30
28
26
24
22
20
18
16
14
12
0,4
0,6
0,8
1,0
1,2
1,4
Glucoalyssin (%)
245
1,6
1,8
2,0
2,2
0,95 Int.spol.
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
Nejvyšší obsah celkových GSL byl identifikován v semeni, dále v mladých šešulích a nejnižší
v listech. Tento závěr koresponduje s údaji v literatuře. Pokles obsahu GSL během vývoje
rostliny je vysvětlován expanzí pletiv, kdy akumulace GSL výrazně zaostává za nárůstem
rostlinné hmoty (BROWN et al. 2003; PORTER et al. 1991). Vyšší obsah GSL v mladých
šešulích zřejmě souvisí s akumulací a transportem GSL do vyvíjejících se semen
(BILSBORROW et al. 1993).
Zjištěná korelace obsahu GSL a napadení pilatkou řepkovou odpovídá literárním údajům, kdy
byla prokázána citlivost tohoto hmyzu ke GSL a jejím rozkladným produktům (BARKER et
al. 2006). V rámci výzkumu představovaného v tomto příspěvku byl v předešlých letech
zjištěn signifikantní negativní vliv na velikost napadení řepky pilatkou u GSL glucobrassicinu
a gluconasturtinu (VRBOVSKÝ et. al. 2011). Také v případě vlivu GSL na napadení
bejlomorkou kapustovou odpovídají námi získané závěry publikovaným údajům. MURCHIE
et al. (1997) prokázal preferenci lapačů obsahujících rozkladné produkty GSL
(isothiokyanáty) bejlomorkou před lapači bez těchto látek. Je tedy možné, že se při
rozpoznávání hostitelské rostliny bejlomorky řídí obsahem GSL a jejich rozkladných
produktů.
Dedikace
Výsledky byly získány na základě řešení projektu č. QI111A075 „Využití biotechnologických
metod, nových výchozích materiálů a efektivních postupů ve šlechtění ozimé řepky“ (2011 –
2014), financovaného MZe prostřednictvím Národní agentury pro zemědělský výzkum.
Použitá literatura
Barker A. M. et al., 2006: Chemosensory and behavioural responses of the turnip sawfly,
Athalia rosae, to glucosinolates and isothiocyanates. Chemoecology, 16(4): 209-218.
Bilsborrow E., Murray F., Zhao F., 1993: Glucosinolate changes in developing pods of single
and double low varieties of autumn-sown oilseed rape Brassica napus. Annals of Applied
Biology, 122(1): 135-143.
Brown P., Tokuhisa J., Reichelt M., Gershenzon J., 2003: Variation of glucosinolate
accumulation among different organs and developmental stages of Arabidopsis thaliana.
Phytochemistry, 62(3): 471-481.
Kolovrat O., 2005: GSL – HPLC (zelená hmota řepky). Metodický návod. Oddělení chemické
laboratoře VÚOl Opava, nepublikováno.
Murchie A. K., Smart L. E., Williams I. H., 1997: Responses of Dasineura brassicae and its
parasitoids Platygaster subuliformis and Omphale clypealis to field traps baited with
organic isothiocyanates. Journal of Chemical Ecology, 23(4): 917-926.
Porter A., Morton A., Kiddle G., Doughty K., Wallsgrove R., 1991: Variation in the
glucosinolate content of oilseed rape Brassica napus L. leaves I. Effect of leaf age and
position. Annals of Applied Biology, 118(2): 461-468.
Vrbovský V., Rychlá A., Endlová L., 2011: Variabilita obsahu glukosinolátů obsažených
v zelené hmotě a jejich vliv na vybrané škůdce řepky. Úroda 12/2011, vědecká příloha s.
251–254.
Kontaktní adresa:
Mgr. Viktor Vrbovský
OSEVA PRO s.r.o., o. z. Výzkumný ústav olejnin Opava
Purkyňova 10, Opava 746 01
[email protected]
246
„Úroda 12/2012, vědecká příloha časopisu“
DRUHOVÉ SPEKTRUM PLEVELŮ OZIMÝCH PLODIN
V PROVOZNÍCH PODMÍNKÁCH
Species spectrum of weeds in the winter crops of chosen agricultural
enterprise
Winkler J., Blažková H.
Ústav agrosystémů a bioklimatologie,Mendelova univerzita v Brně
Abstrakt
Cílem této práce bylo vyhodnocení druhového spektra plevelů na pozemcích zemědělského podniku
ZEAS Lysice ve vybraných plodinách. Pozemky se nacházejí v nadmořské výšce od 350 do 650
m.n.m. a jedná se o obilnářskou výrobní oblast. Druhové zaplevelení bylo pozorováno v ozimé řepce,
ozimé pšenici a ozimém žitu, které jsou v tomto zemědělském podniku každoročně pěstovány.
Výsledky zaplevelení byly zpracovány mnohorozměrnou analýzou ekologických dat. Z výsledků
vyplývá, že se v porostu ozimé řepky nejvíce vyskytoval Stellaria media, Capsella bursa-pastoris,
Galeopsis tetrahit, Viola arvensis, Thlaspi arvense. V ozimém žitu se nejvíce vyskytovaly Veronica
persica, Viola arvensis, Taraxacum officinale, Sinapis arvense, Achillea millefolium, Poa annua.
V ozimé pšenici se nejčastěji nacházely Thlaspi arvense, Chenopodium hybridum, Anthemis arvensis,
Tripleurospermum maritimum.
Klíčová slova: plevele, plodina, druhová diverzita
Abstract
The aim of this work was to evaluate the spectrum of weed species on lands agricultural company
ZEAS Lysice in selected crops. These grounds are situated from 350 to 650 meters above sea level and
they are parts of a grain production area. Species weed infestation was observed on a perennial rape, a
perennial wheat and a perennial rye, which are grown in this agricultural company every year. The
results of weed infestation were processed by a multivariate analysis of ecological data. The results
showed that in the growth of a perennial rape mostly occurred Stelaria media, Capsella bursapastoris, Galeopsis tetrahit, Viola arvensis, Thlaspi arvense. In a perennial rye mostly occurred
Veronica persica, Viola arvensis, Taraxacum officinale, Sinapis arvense, Achillea millefolium, Poa
annua. In a perennial wheat were mostly found Thlaspi arvense, Chenopodium hybridum, Anthemis
arvensis, Tripleurospermum maritimum.
Key words: weeds, crops, species diversity
Úvod
V současné době je v ČR dle Křena a Valtýniové (2008) ekonomicky nejvíce ziskové
pěstování sladovnického ječmene, pšenice, řepky a máku; v případě dobrých prodejních
kontraktů ještě i brambor a cukrovky. Procento pěstovaných obilnin na orné půdě se pohybuje
v rozmezí přibližně 50 – 60 % a to zejména díky úbytku stavů skotu a omezení pěstování
víceletých pícnin. Výskyt plevelů v porostech kulturních rostlin je závislý na specifických
biologických vlastnostech všech složek agrofytocenózy. V ní se může vyskytovat určitý
rostlinný druh pouze tehdy, jestliže jednotlivé podmínky stanoviště vyhovují jeho nárokům,
nebo jestliže se dokáže měnícím se podmínkám přizpůsobit, jak uvádějí Hron, Kohout,
(1986).
Monitoring zaplevelení pozemků je důležitý pro navržení vhodné regulace plevelů na
konkrétní lokalitě.
Materiál a metody
Sledování zaplevelení bylo provedeno na pozemcích zemědělského podniku ZEAS Lysice.
Vybrané pozemky se nachází v Jihomoravském kraji okresu Blansko. Lokalita se rozkládá v
nadmořské výšce od 350 do 650 m n. m., jedná se o obilnářskou výrobní oblast. Z hlediska
klimatických poměrů se vyhodnocená oblast nachází v mírně teplém, vlhkém (MT 4)
247
„Úroda 12/2012, vědecká příloha časopisu“
klimatickém regionu. Hodnocení druhového spektra plevelů bylo provedeno početní metodou,
odpočtová plocha měla velikost 1 m2. Nejprve bylo provedeno určení daných druhů plevelů a
pak jejich počet. Jednotlivá sledování byla vybrána rovnoměrně na celé ploše pozemku a
v typickém porostu pro dané místo.
Termíny pozorování byly v letech 2010 a 2011 a to vždy v podzimním a jarním období. Ve
sledovaných plodinách byly aplikovány herbicidy po založení porostu nebo v průběhu
podzimního období. V porostech řepky byly použity přípravky Butisan 400 EC + Command
36 CS; Fusilade Forte 150 EC, v porostech pšenice a žita Maraton 4 + Glean 75 WG.
Celková sledovaná plocha byla 109 ha. V ozimé pšenici bylo celkem provedeno 24 sledování,
v řepce ozimé 60 sledování a žitu 30 sledování.
Ke zjištění vlivu sledovaných faktorů na jednotlivé druhy plevelů, které se vyskytovaly v
polním pokusu, byly použity mnohorozměrné analýzy ekologických dat. Byla použita
kanonická korespondenční analýza CCA (Canonical Correspondence Analysis). Při testování
průkaznosti pomocí testu Monte-Carlo bylo propočítáno 499 permutací. Data byla zpracována
pomocí počítačového programu Canoco 4.0. (Ter Braak, 1998).
Výsledky a diskuze
Celkem bylo zaznamenáno 62 druhů plevelů. Intenzita zaplevelení jednotlivými druhy plevelů
je uvedena v Tab.1.
Tab. 1 Průměrný počet jedinců plevelných druhů v letech 2010 - 2011 ve sledovaných
plodinách
Období sledování
Podzim
Druhy
Viola arvensis
Brassica napus
Chenopodium hybridum
Apera spica-venti
Thlaspi arvense
Anthemis arvensis
Capsela bursa pastoris
Polygonum aviculare
Triticum/Hordeum
Veronica persica
Chenopodium album
Stelaria media
Galium aparine
Polygonum maculata
Galeopsis tetrahit
Tripleurospermum maritimum
Atriplex patula
Papaver rhoes
Raphanus raphanistrum
Fumaria officinalis
Geranium pusillum
Fallopia convolvulus
Avena fatua
Lamium alpexicaule
Myosotis arvensis
Veronica agrestis
Galinsoga parviflora
Sinapsis arvensis
Cirsium arvense
Ozimá
pšenice
0,00
75,40
84,40
12,40
0,00
0,00
0,00
0,00
0,00
6,00
0,00
0,00
3,60
0,00
0,70
0,00
4,40
0,00
0,60
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,10
Ozimá řepka Ozimé žito
92,14
55,65
8,65
5,55
0,02
0,00
45,54
0,00
1,98
35,15
2,98
0,05
5,81
1,50
0,03
0,00
4,59
8,65
4,71
0,95
0,52
0,85
6,60
0,30
0,43
0,20
0,00
0,00
3,71
0,00
0,11
0,70
0,62
0,00
0,56
0,00
0,06
0,05
1,00
1,10
3,22
0,00
0,86
0,35
0,05
0,00
0,10
0,00
0,44
0,25
0,00
0,00
1,16
0,00
0,38
0,00
0,35
0,00
248
Jaro
Ozimá
pšenice
6,58
0,00
0,00
0,08
10,83
19,00
0,00
13,00
0,00
0,25
0,00
2,67
4,75
9,25
0,42
5,17
0,00
0,00
0,17
0,08
0,00
0,25
0,00
0,00
0,00
0,17
0,00
0,17
0,58
Ozimá řepka Ozimé žito
24,43
18,20
0,00
0,00
2,57
0,00
0,43
0,00
3,73
2,30
0,23
0,00
11,87
0,90
0,73
0,00
0,00
0,00
0,00
0,00
6,03
3,60
1,20
0,00
0,40
0,00
0,00
0,00
3,73
0,00
0,00
0,10
0,10
0,00
3,77
0,00
1,97
0,50
1,13
0,00
0,00
0,00
1,37
0,00
2,67
0,00
0,00
2,60
0,90
1,10
2,13
0,00
0,77
0,20
0,07
1,20
0,57
0,20
„Úroda 12/2012, vědecká příloha časopisu“
Veronica hederifolia
Euphorbia helioscopia
Taraxacum officinale
Malva neglecta
Poa annua
Atriplex sagitatta
Sisymbrium officinale
Cardaria draba
Convolvulus arvensis
Anagyllis arvensis
Agrostis capillaris
Matricaria recutita
Sonchus arvensis
Lamium purpureum
Arabidopsis thaliana
Achillea millefolium
Carduus acanthoides
Plantago major
Equisetum arvense
Silene latifolia
Trifolium dubium
Elytrigia repens
Cirsium arvense
Senecio vulgaris
Aphanes arvensis
Plantago lanceolata
Bromus arvensis
Echinochloa crus-galli
Bunias orientalis
Glechoma hederacea
Lapsana communis
Centarea cyanus
Alopecurus myosuroides
0,90
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,10
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,25
0,22
0,00
1,08
0,02
0,00
0,71
0,68
0,24
0,03
0,54
0,27
0,44
0,38
0,00
0,03
0,10
0,00
0,00
0,00
0,00
0,08
0,14
0,00
0,00
0,06
0,05
0,00
0,03
0,02
0,02
0,02
0,02
0,00
1,30
1,35
0,00
0,20
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,10
0,25
0,20
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,58
0,00
0,00
0,00
0,00
0,33
0,00
0,00
0,00
0,00
0,17
0,00
0,00
0,00
0,00
0,08
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,53
0,00
0,00
0,00
0,33
0,00
0,00
0,00
0,40
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,07
0,00
0,00
0,00
0,17
0,07
0,00
0,00
0,00
0,00
0,00
0,03
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,10
0,00
0,50
0,90
0,00
0,00
0,00
0,00
0,00
0,20
0,00
0,00
0,00
0,30
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
0,00
Výsledky zaplevelení byly zpracovány pomocí analýzy DCA, kdy byla pomocí této metody
nejprve vypočtena délka gradientu (Lengths of Gradient), která činila 3,739. Na základě
tohoto výpočtu byla k dalšímu zpracování zvolena i kanonická korespondenční analýza CCA.
Analýza CCA vymezuje prostorové uspořádání jednotlivých druhů plevelů a plodin na
základě dat o frekvenci výskytu plevelných druhů. Toto je následně graficky vyjádřeno
pomocí ordinačního diagramu Obr. 1. Druhy plevelů a plodin jsou zobrazeny body odlišného
tvaru a barvy. Výsledky analýzy CCA jsou signifikantní na hladině významnosti α = 0,002.
Na základě analýzy CCA je možné nalezené druhy plevelů rozdělit do 3 skupin. První
skupina plevelů se vyskytovala především v řepce a jsou to tyto druhy: Fumaria officinalis,
Chenopodium album, Myosotis arvensis, Capsella bursa-pastoris, Stelaria media atd. Druhá
skupina plevelů se vyskytovala v porostu pšenice ozimé, jedná se o následující druhy: Galium
aparine, Tripleurospermum maritimum, Brassica napus, Anthemis arvensis atd. Do třetí
skupiny patří druhy plevelů, které se vyskytovaly s porostem ozimého žita: Sinapis arvensis,
výdrol pšenice, Poa annua aj.
Závěr
Z výsledků vyplývá, že v druhovém spektru plevelů hodnocených plodin je výrazný rozdíl.
Nejvíce plevelných druhů se vyskytovalo v porostech řepky naopak nejméně druhů bylo v
žitu. Nejhojněji zastoupeným plevelem byla violka rolní (Viola arvensis). Do budoucna
můžeme předpokládat její další rozšiřování, pokud budou pěstitelské plochy sledovaných
plodin i nadále vysoké.
249
„Úroda 12/2012, vědecká příloha časopisu“
Pěstovaná plodina výrazně spoluutváří podmínky pro život jednotlivých druhů plevelů a tím
výrazně působí na druhové spektrum a může také přispět k rozšiřování některých druhů
plevelů. Monitoring zaplevelení je velmi důležitý pro navržení vhodné regulace plevelů na
konkrétní lokalitě. Tam, kde dochází k nadměrnému výskytu určitého druhu, je třeba volit
vhodný způsob regulace a také je potřeba klást větší důraz na preventivní opatření, např.
střídání plodin, kvalitní zpracování půdy a jiné dostupné opatření. Dalším výrazným
faktorem, který působí na zaplevelení je také průběh počasí v jednotlivých letech. Ovšem
k vyhodnocení tohoto složitého faktoru by bylo potřeba výsledků z dalších let sledování.
Obr. 1 Zastoupení jednotlivých plevelných druhů
v pozorovaných plodinách
Vysvětlivky zkratek použitých v ordinačním
diagramu:
Plodiny: Zito oz - žito ozimé, Repka oz - řepka
ozimá, Psenice oz - pšenice ozimá
Plevele: Agr capi – Agrostis capillaris, Ach mill –
Achillea millefolium,
Alo myos – Alopecurus myosuroides, Ana arve – Anagyllis
arvensis, Ant arve – Anthemis arvensis, Ape spic – Apera spica
venti, Aph arve – Aphanes arvensis, Ara tha – Arabidopsis
thaliana, Arr sagi – Atriplex sagitatta, Atr patu – Atriplex patula,
Ave fatu – Avena fatua, Bra napus – Brassica napus, Bro arve –
Bromus arvensis, Bun orie – Bunias orientalis, Cap bun – Capsella
bursa-pastoris, Car acan – Carduus acanthoides, Car drab –
Cardaria draba, Cen cyan – Centaurea cyanus, Cir arve - Cirsium
arvense, Con arve – Convolvulus arvensis, Ech crus – Echinochloa
crus-galli, Ely repe – Elytrigia repens, Equ arve – Equisetum
arvense, Eup heli – Euphorbia helioscopia, Fal conv – Fallopia
convolvulus, Fum offi – Fumaria officinalis, Gal apar – Galium
sarine, Gal parv – Galinsoga parviflora, Gal tetr – Galeopsis
tetrahit, Ger pusi – Geranium pusillum, Gle hede – Glechoma
hederacea, Che hybr – Chenopodium hybridum, Lam ampl –
Lamium amplexicaule, Lam purp – Lamium purpureum, Lap comm
– Lapsana communis, Mal negl – Malva neglecta, Mat recu –
Matricaria recutita, Myo arve – Myosotis arvensis, Pap rhoe –
Papaver rhoes, Pla lanc – Plantago lanceolata, Pla majo –
Plantago major, Poa annu – Poa annua, Pol avic – Polygonum
aviculare, Rap raph – Raphanus raphanistrum, Sen vug – Senecio
vulgaris, Sin arve – Sinapis arvensis, Sis offo – Sisymbrium
officinale, Son arve – Sonchus arvensis, Ste medi – Stelaria
media,Tar offi – Taraxacum officinale, Thl arve – Thlaspi arvense,
Tri dubi – Trifolium dubium, Tri mari – Tripleurospermum
maritimum, Ver hede – Veronica hederifolia, Ver pers – Veronica
persica
Práce vznikla jako výstup projektu Interní grantové agentury AF MENDELU číslo: TP 9/2012
“Inovace pěstitelských postupů v suchem ohrožených oblastech“.
Použitá literatura
Hron., F., Kohout, V. 1986: Polní plevele – obecná část. 1. vyd. Praha. Skriptum VŠZ Praha, 168 s.
Křen, J., Valtýniová, S. 2008: Czech Agriculture In The Period Of Transformation. Acta Agrophysica,
11(1), p. 101-116. ISSN 1234-4125
Ter Braak, C., J., F. Canoco – A Fortran program for canonical community ordination by [partial]
[detrended] [canonical] correspondence analysis (version 4.0.). Report LWA-88-02 Agricultural
Mathematics Group. Wageningen, 1998.
Kontaktní adresa:
Ing. Jan Winkler, Ph.D.,
Mendelova univerzita v Brně, Zemědělská 1, 613 00 Brno, [email protected]
250
„Úroda 12/2012, vědecká příloha časopisu“
SKRINING ANTIFUNGÁLNÍCH VLASTNOSTÍ VYBRANÝCH
ROSTLINNÝCH EXTRAKTŮ
Screening of antifungal properties of selected plant extracts
Žabka M., Pavela R., Sumíková T.
Výzkumný ústav rostlinné výroby, v.v.i. Praha-Ruzyně
Abstrakt
Methanolové extrakty celkem 27 léčivých rostlin byly užity při skríningové studii se zaměřením na
testování antifungálních vlastností. Inhibiční efekt byl testován na modelu čtyř vybraných patogenních
a toxinogenních houbových druhů: Aspergillus flavus, Aspergillus fumigatus, Fusarium oxysporum a
Fusarium verticillioides, v souladu s jejich ekonomickým významem. Možnost užít některé testované
rostlinné extrakty jako složku pesticidů na přírodní bázi byla indikována v případě pěti rostlinných
druhů. Nejvíce efektivními byly Asarum europaeum, Angostura trifoliata a především Alpinia
purpurata.
Klíčová slova: Rostlinný extrakt, antifungální aktivita, Patogenní houby, Toxinogenní houby,
Botanické fungicidy.
Abstract
Methanol extracts of twenty seven medicinal plants were used in screening assay for antifungal
activity. Growth inhibitory effect was tested against four very important pathogenic and toxinogenic
fungal species: Aspergillus flavus, Aspergillus fumigatus, Fusarium oxysporum and Fusarium
verticillioides in accordance with their health and economic significance. Possibility to use some of
plant extracts as a component of natural pesticide in a future was indicated in the case of five plant
species. The most effective were Asarum europaeum, Angostura trifoliata and especially Alpinia
purpurata extracts.
Keywords: Plant extract, Antifungal activity, Pathogenic fungi, Toxinogenic fungi, Botanical
fungicides.
Úvod
V oblasti produkce hygienicky nezávadných zemědělských komodit jsou mikromycety z rodu
Fusarium a Aspergillus největším problémem díky schopnosti produkovat většinu
nebezpečných mykotoxinů (Edwards et al. 2002; Niessen 2007; Palumbo et al. 2008). Obecně
jsou patogenní houby kontrolovány aplikací syntetických fungicidů. Syntetické fungicidy a
jejich rezidua však představují velké riziko díky své vysoké přímé či nepřímé toxicitě (Costa
et al. 2008; Nakanishi 2007; Scordino et al. 2008). Posklizňové ošetření produktu při
skladování může tak představovat riziko ještě vyšší. (Singh et al. 2009; Dalvie et al. 2006).
Krom otázek toxicity a reziduální aktivity pesticidů, lze zmínit i stále častější výskyt méně
citlivých či úplně rezistentních populací patogenních hub a to díky mnohdy v historii
jednostranné a necitlivé chemizaci. Na rozdíl od jiných škodlivých biogenních vlivů vyvstává
u houbových patogenů další rozměr škodlivosti, kterým je produkce toxických a extrémně
nebezpečných sekundárních metabolitů (aflatoxiny, trichotheceny, fumonisiny atd.). Tyto
nebezpečné metabolity, jejichž toxicita se může porovnávat s toxicitou moderních bojových
látek a jejichž biologická aktivita je stále předmětem výzkumu, jsou předmětem dnes již
samostatně profilované problematiky (Žabka et al., 2002; 2008). Pokrok v oblasti
environmentálně bezpečných fungicidů na bázi rostlinných extraktů nabývá v současnosti na
významu. Biologická aktivita těchto extraktů je způsobena a ovlivněna přirozeným obsahem
biologicky aktivních látek, zahrnujících např. přirozené terpenoidy, fenoly a alkaloidy, které
bývají obecně v rostlinách přítomny (Žabka et al., 2009). Jejich význam stoupá společně
s rostoucím uvědomováním si rizik spojených s plošným používáním syntetických pesticidů.
251
„Úroda 12/2012, vědecká příloha časopisu“
Materiál a metody
Inhibiční vlastnosti testovaných rostlinných extraktů na myceliární růst hub byly testovány
pomocí diluční metody. Rostlinné extrakty byly získány z vlastních zdrojů methanolickou
extrakcí nasbíraného materiálu. Každý extrakt byl důkladně rozpuštěn v bramboro
dextrózovém agaru (PDA) v přesně dané koncentraci 2 mg.ml-1, při teplotě pod 50°C.
Kontrolní sada byla připravena přidáním ekvivalentního množství methanolu. Připravené
Petriho misky (9 cm) byly sterilně naočkovány pomocí myceliárních disků (0,4 cm)
odebraných ze 7 denních povrchových kultur cílových hub. Kultivace probíhala po dobu 7
dní, při teplotě 21°C. Následné srovnání průměru kolonií v porovnání s kontrolními sety bylo
převedeno na procentuální vyjádření inhibičního potenciálu. Seznam vybraných rostlinných
druhů pro základní skríning je uveden v Tab. 1 včetně původu a výtěžku. Pro extrakci byla
použita nadzemní část rostlin. Testované cílové druhy hub spolu s původem izolace jsou
uvedeny v Tab. 2.
Tab. 1: Rostlinné druhy použité při základním skriningu antifungálních vlastností
Druh
Sbíraná část
výtěžek
(%)
Původ a místo sběru
Acer campestre L.
Acer capillipes Maxim.
Acer platanoides L.
Acinos arvensis (Lam.) Dandy
Ajuga chamaepitys (L.) Schreber
Alpinia purpurata
Angostura trifoliata
Asarum europaeum
Astragalus glycyphyllos L.
Campanula rotundifolia L.
Citrus aurantium L.
Citrus bergamia (Risso) Wright & Arn
Filipendula ulmaria (L.) Maxim.
Guaiacum officinale
Hypericum montanum L.
Lavandula angustifolia Mill.
Leuzea carthamoides
Levisticum officinale W. D. J. Koch
Orlaya grandiflora (L.) Hoffm.
Panax ginseng C. A. Mey
Petasites hybridus L.
Potentilla anserina L.
Potentilla fruticosa L.
Rumex acetosella L.
Salix alba L.
Stachys sylvatica L.
Withania somnifera L.
Leaves
Leaves
Leaves
Stem
Stem
Roots
Bark
Stem
Roots
Stem
Pericarp
Pericarp
Stem
Xylem
Stem
Stem
Roots
Roots
Stem
Roots
Rhizome
Stem
Stem
Stem
Bark
Stem
Roots
9,8
12,5
9,3
8,4
14,8
7,0
11,7
7,2
5,1
9,8
5,6
9,1
7,8
5,3
16,1
9,4
2,3
5,8
11,4
8,1
6,2
7,3
21,6
4,6
3,5
5,6
5,2
Prague, Czech Republic
Prague, Czech Republic
Prague, Czech Republic
Vranov nad Dyjí,
RepublicCzech Republic
Prague,
Číčenice, Czech Republic
Číčenice, Czech Republic
Vranov nad Dyjí,
Republic Czech Republic
Hodonín,
Vranov nad Dyjí,
Republic Czech Republic
Číčenice,
Číčenice, Czech Republic
Prague, Czech Republic
Číčenice, Czech Republic
Blatnica, Slovak Republic
Prague, Czech Republic
Číčenice, Czech Republic
Hodonín, Czech Republic
Prague, Czech Republic
Hodonín, Czech Republic
Hodonín, Czech Republic
Prague, Czech Republic
Prague, Czech Republic
Blatnica, Slovak Republic
Číčenice, Czech Republic
Vranov nad Dyjí,
Republic Czech Republic
Hodonín,
Czech
Czech
Czech
Czech
Tab. 2: Cílové patogenní a toxinogenní druhy hub
Houbový druh
Aspergillus flavus
Aspergillus fumigatus
Fusarium oxysporum
Fusarium verticillioides
Status a významnost houby
toxinogenní, kontaminant potravin
toxinogenní, lidský patogen, kontaminant
rostlinný patogen, toxinogen, kontaminant
rostlinný patogen, toxinogen, kontaminant
252
zdroj izolace
skladovaná kukuřice
skladovaná kukuřice
napadená kukuřice
napadená kukuřice
„Úroda 12/2012, vědecká příloha časopisu“
Výsledky a diskuse
Výsledky potvrzují, že v rámci testovaných rostlinných extraktů (Tab. 1.) většina prokázala
určitý stupeň inhibice radiálního růstu alespoň jednoho houbového patogenního druhu, která
však nepřesahovala efektivních 50%. Pro účely studie však bylo finálně označeno jako
efektivní a potenciálně využitelných 5 z celkového souboru 27 testovaných rostlinných
extraktů, jejichž inhibiční efekt vykazoval hladinu inhibice nad úroveň 50% (Tab. 3). Tyto
extrakty byly vybrány pro další výzkum, jehož výsledky budou uplatněny v dalších
experimentech. Jako nejvíce zajímavé považujeme extrakty prokazující efektivitu (nad 50%)
více než u poloviny cílových houbových patogenních druhů. Takovýto antifungální efekt byl
patrný u třech extraktů. Prvním byl extrakt z kůry Angostura trifoliata (angostura trojlistá).
Biologická aktivita této původem jihoamerické dřeviny, používané v lidové medicíně, bývá
v literatuře spojována nejvíce s obsahem chinolinových alkaloidů jako je např. galipin. Kromě
antimikrobiálních účinků bývá též využívána jako antimalarikum. (O'Byrne and Evans, 2008;
Rakotoson et al., 1998). Výzkum účinku na vláknité patogenní houby není zatím v literatuře
příliš popsán. Zatímco inhibiční aktivita v rámci modelových druhů rodu Fusarium zde byla
poměrně vyrovnaná, z obou druhů rodu Aspergillus došlo k účinné inhibici pouze v případě
A. fumigatus. Zde se nejspíše jedná o projev rozdílné mezidruhové citlivosti založené na
různých morfologických a metabolických vlastnostech. Toto zůstává otázkou pro další
experimenty. A flavus se v celém experimentu jevil jako nejméně citlivý patogen. Asarum
europeum (kopytník evropský) vykazoval efektivní inhibici na všechny testované patogeny
kromě A. flavus. U tohoto rostlinného druhu byl popsán obsah biologicky aktivních
fenolických látek jako je asaron, tedy látek strukturálně podobných antifungálnímu eugenolu
(Zabka et al., 2009). Z výsledků dále vyplývá, že nejvíce účinným byl extrakt Alpinia
purpurata (galgán nachový) a to nejen po stránce hladiny inhibičního efektu na jednotlivé
druhy, ale i po stránce šíře spektra inhibovaných patogenních hub, kdy byla efektivní inhibice
nad 50% pozorována u všech cílových patogenů. V případě F. oxysporum a A. fumigatus byla
u tohoto extraktu pozorována inhibice nad 72 %. Ve spojitosti s výraznými antifungálními
vlastnostmi A. purpurata bývají v literatuře nejčastěji uváděny polyfenolické látky jako je
flavonoid kumatakenin, který kromě antifungální aktivity vykazuje protizánětlivé účinky a
stejně tak například zajímavou aktivitu proti mycobacterium tuberculosis (původce
tuberculozy) (Afifi et al., 1991; Villaflores et al., 2010).
Tab. 3: Nejefektivnější rostlinné extrakty s inhibicí nad 50% růstu patogena
Testovaná rostlina
Alpinia purpurata
Angostura trifoliata
Asarum europaeum
Guaiacum officinale
Leuzea carthamoides
Inhibiční efekt nejúčinnějších rostlinných extraktů na růst patogenů
v dávce 2 mg.ml-1 (v %)
Aspergillus
flavus
50.86±0.05
16.67±0.19
42.86±0.00
5.13±0.00
18.75±0.00
Aspergillus
fumigatus
72.73±0.00
63.54±0.05
57.81±0.00
51.52±0.00
37.37±0.05
Fusarium
Fusarium
oxysporum verticillioides
75.20±0.00
65.93±0.17
59.19±0.05
51.67±0.00
63.43±0.05
60.75±0.00
64.02±0.05
47.41±0.05
55.03±0.09
37.78±0.14
Závěr
V této práci se z dvaceti sedmi testovaných druhů rostlin podařilo nalézt celkem pět
efektivních rostlinných extraktů schopných dostatečně inhibovat růst významných
patogenních hub. Z tohoto počtu efektivních extraktů tři prokázaly účinnost na většinu
testovaných patogenních druhů. V dalších experimentech se nyní zabýváme hlouběji
sledovanou antifungální aktivitou zkoumanou napříč daleko širším spektrem hub. Následné
práce by měly směřovat k přímé identifikaci a výzkumu samotných efektivních substancí
obsažených v těchto rostlinných extraktech a potenciálnímu vývoji složek komerčních
253
„Úroda 12/2012, vědecká příloha časopisu“
ekologicky přijatelných antifungálních preparátů s vysokou účinností na cílové patogeny a
vysokou bezpečností pro člověka a ekosystém.
Dedikace
Tato práce byla financována z následujících zdrojů MZE 0002700604 a ME 10140
Seznam použité literatury
Afifi, F.U., S. Alkhalil, B.K. Abdulhaq, A. Mahasneh, D.M. Aleisawi, M. Sharaf, L.K. Wong,
and P.L. Schiff. 1991. Antifungal Flavonoids from Varthemia-Iphionoides. Phytotherapy
Research 5:173-175.
Costa LG, Giordano G , Guizzetti M, Vitalone A (2008) Neurotoxicity of pesticides: a brief
review. Front Biosci 13:1240-1249.
Dalvie D, Smith E, Deese A, Bowlin S (2006) In vitro metabolic activation of thiabendazole
via 5-hydroxythiabendazole: Identification of a glutathione conjugate of 5hydroxythiabendazole. Drug Metab Disposition 34:709-717.
Edwards SG, O'Callaghan J, Dobson ADW (2002) PCR-based detection and quantification of
mycotoxigenic fungi. Mycol Res 106:1005-1025.
Nakanishi T (2007) Potential toxicity of organotin compounds via nuclear receptor signaling
in mammals. J Health Sci 53:1-9.
Niessen L (2007) PCR-based diagnosis and quantification of mycotoxin producing fungi. Int J
Food Microbiol 119:38-46.
O'Byrne, A., and P. Evans. 2008. Rapid synthesis of the tetrahydroquinoline alkaloids:
angustureine, cuspareine and galipinine. Tetrahedron 64:8067-8072.
Palumbo JD, O'Keeffe T L, Abbas, HK (2008) Microbial interactions with mycotoxigenic
fungi and mycotoxins. Toxin Rev 27:261-285.
Rakotoson, J.H., N. Fabre, I. Jacquemond-Collet, S. Hannedouche, I. Fouraste, and C. Moulis.
1998. Alkaloids from Galipea officinalis. Planta Medica 64:762-763.
Scordino M, Sabatino L, Traulo P, Gagliano G, Gargano M, Panto V, Gambino GL (2008)
LC/MS/MS detection of fungicide guazatine residues for quality assessment of commercial
citrus fruit. Eur Food Res Technol 227:1339-1347.
Singh P, Kumar A, Dubey NK, Gupta R (2009) Essential Oil of Aegle marmelos as a Safe
Plant-Based Antimicrobial Against Postharvest Microbial Infestations and Aflatoxin
Contamination of Food Commodities. J Food Sci 74:302-307.
Villaflores, O.B., A.P.G. Macabeo, D. Gehle, K. Krohn, S.G. Franzblau, and A.M. Aguinaldo.
2010. Phytoconstituents from Alpinia purpurata and their in vitro inhibitory activity against
Mycobacterium tuberculosis. Pharmacognosy Magazine 6:339-344.
Žabka M., Jegorov A. (2002): Návrat houby, jež dala vzniknout jménu trichotheceny,
Chemické listy 96: 607-610.
Žabka M. (2008): Less known secondary metabolites of pathogenic fungi: Vědecká příloha
časopisu Úroda–Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování
produktů, 317-321.
Žabka M., Pavela R., Slezakova L. (2009): Antifungal effect of Pimenta dioica essential oil
against dangerous pathogenic and toxinogenic fungi, Industrial Crops and Products 30:
250–253.
Kontaktní adresa:
Ing. Martin Žabka, Ph.D.
Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507, Praha6-Ruzyně
e-mail: [email protected]
254
„Úroda 12/2012, vědecká příloha časopisu“
ZAMEZENÍ VODNÍ EROZE PŮDY PŘI VYUŽITÍ MEZIPLODIN
Prevention of soil water erosin by utilization of intercrops
Badalíková B., Bartlová J.
Zemědělský výzkum, spol. s r.o., Troubsko
Abstrakt
V poloprovozních pokusech v bramborářské výrobní oblasti byla sledována půdoochranná funkce
meziplodin současně s různým zpracováním půdy. V průběhu tříletého sledování 2010 – 2012 bylo
zjištěno, že půdoochrannou funkci proti vodní erozi nejlépe splnila nevymrzající meziplodina žito
svatojánské, která dosahovala nejvyšší pokryvnosti povrchu půdy v jarním období, a to z 80–90 %. U
variant s meziplodinou žito nedocházelo k eroznímu smyvu půdy. Ke smyvu půdy došlo pouze u
varianty bez meziplodiny. Byl potvrzen význam meziplodin v protierozní ochraně půdy.
Klíčová slova: ochrana půdy, vodní eroze, meziplodiny, smyv půdy
Abstract
In a pilot experiment established in a potato growing region soil protection function with different soil
tillage was studied. During years 2010 – 2012 it was found that soil protection function against water
erosion best complied a winter-hardy intercrop ray - Secale cereale L. var. multicaule, METZG. ex
ALEF. This intercrop best covered the soil surface in the spring time namely 80–90 %. In the variants
using ray wasn't found the erosive washing away of soil. To soil washing - off got only in variant
without intercrops. It was confirmed meaning of intercrops in soil protection from erosion.
Key words: soil protection, water erosion, intercrops, soil washing-off
Úvod
Významnou úlohu v protierozní ochraně hrají meziplodiny především v tom, že se do půdy
dodává jejich prostřednictvím snadno rozložitelná organická hmota, ať už kořenovými zbytky
či nadzemními částmi rostlin, která stimuluje biologické pochody v půdě (Vach a kol., 2005).
Dále plní funkci ochrany půdy před vodní i větrnou erozí svou rozvinutou listovou plochou.
Pramanik a kol. (1998) zjistili, že vlivem meziplodin se nejen snížila eroze půdy, ale také tyto
plodiny přispěly ke zvýšení obsahu živin v půdě zejména N, P a K. Kořeny meziplodin
přispívají k zlepšování fyzikálního stavu půdy a příznivě působí na její strukturní stav.
Významnou roli sehrává pěstování meziplodin v ochranných pásech vodních zdrojů, zejména
v období, kdy dochází k významným ztrátám živin vyplavováním. Své místo zastávají
meziplodiny i jako přerušovače v osevních postupech, zejména s vyšším zastoupením zrnin.
Shrneme-li tyto poznatky, tak meziplodiny v rostlinné produkci mají funkci: pokryvnou,
zkypřující, výživnou, ozdravující.
Cílem řešení ochrany půdy je využití různých meziplodin pro snížení erozního smyvu půdy.
Materiál a metody
Pro zjištění ochrany půdy proti vodní erozi byl sledován v letech 2010 – 2012 smyv půdy na
poloprovozním polním pokusu v bramborářské výrobní oblasti, kde se pohybovala svažitost
terénu mezi 40 – 50. Ke zhodnocení půdních vlastností pokusné lokality byly sledovány
fyzikální i chemické vlastnosti, tzv. index pokryvnosti půdy, který vyjadřuje procento
pokryvu půdního povrchu meziplodinami nebo jejich zbytky. Pokryvnost půdy byla zjištěna
procenticky po vzejití meziplodiny na podzim spolu s počtem rostlin na m2 a na jaře, kdy byla
posuzována pokryvnost povrchu půdy rostlinnými zbytky vymrzlých rostlin a pokryv půdy
nevymrzlou meziplodinou. Pokryvnost půdy byla hodnocena z 10 měření v každém
opakování dílce varianty. Ke sledování smyvu půdy byly instalovány speciální záchytné
kapsy v šířce 1 m v dolní části svahu a ohraničeny bočnicemi. Délka sledovaného svahu byla
255
„Úroda 12/2012, vědecká příloha časopisu“
cca 100 m. Ze smyté půdy byly prováděny analýzy na obsah základních živin dle Melicha III,
výměnná půdní reakce pH byla stanovena z výluhu KCl potenciometricky, celkový obsah
humusu resp. oxidometrické stanovení půdní organické hmoty bylo provedeno metodou
Walkley-Black, modifikací Novák-Pelíšek.
Pokusné pozemky se nacházely v bramborářské výrobní oblasti, kde nadmořská výška je 513
m, dlouhodobý úhrn srážek 500 mm, z toho úhrn srážek za vegetační období 395 mm,
průměrná roční teplota dosahuje 6,8 0 C. Průběh dešťových srážek během vegetace za
sledované období znázorňuje graf 1.
Graf 1: Množství srážek během vegetace 2010–2012
Půdy na této lokalitě řadíme do hnědých půd lehkých, hlinitopísčitých, s hloubkou ornice
0,20 – 0,25 m, středně zásobené živinami a půdní reakcí slabě kyselou.
Na vybraném stanovišti byly založeny na podzim 3 varianty s meziplodinami a 1 varianta
kontrolní bez meziplodiny s klasickým zpracováním půdy:
Varianta 1 – podmítka, předseťová příprava, setí nevymrzající meziplodiny žito svatojánskétrsnaté (Secale cereale L. var. multicaule METZG. ex ALEF.) na jaře desikace, předseťová
příprava, setí kukuřice
Varianta 2 – podmítka, předseťová příprava, setí nevymrzající meziplodiny žito svatojánskétrsnaté, na jaře desikace, přímé setí kukuřice do zaschlého mulče
Varianta 3 – podmítka po sklizené předplodině, předseťová příprava, setí vymrzající
meziplodiny sléz krmný (Malva verticillata L.) nebo katrán etiopský (Crambe abyssinica
Hochst.), na jaře přímé setí kukuřice do vymrzlé předplodiny
Varianta 4 – kontrola - tradiční zpracování půdy, podmítka, střední orba nebo kypření, na jaře
předseťová příprava, setí kukuřice
Výsledky a diskuze
Ke smyvu půdy došlo opakovaně během vegetačního období v roce 2010 u varianty 4
(kontrolní, bez meziplodiny), jak ukazuje tabulka 2, tedy u varianty, kde bylo procentické
hodnocení pokryvnosti půdy nejhorší (tab. 1). Smyv půdy v roce 2010 probíhal opakovaně v
důsledku vytvoření erozní rýhy (tab. 2), takže při každých větších dešťových srážkách
docházelo k soustředěnému odtoku v této dráze. Začátkem června došlo dokonce k překroční
přípustné ztráty půdy, která má limit na těchto půdách 4 t.ha-1, a sice o 5,73 t.ha-1. Celkem
v roce 2010 došlo ke smyvu půdy během vegetace v množství 11,54 t.ha-1. V roce 2011
nedošlo ke smyvu půdy u žádné varianty a v roce 2012 došlo ke smyvu opět u varianty 4 –
kontrolní, 27.6. v množství 0,25 t.ha-1. Současně se smytou půdou došlo ke ztrátám živin a
půdního humusu, což způsobuje degradaci půdy a snížení její produkční schopnosti (tab. 3, 4).
256
„Úroda 12/2012, vědecká příloha časopisu“
Statistické hodnocení v tomto případě je zbytečné, neboť ke smyvu půdy došlo pouze u jedné
varianty, tudíž průkazně oproti ostatním variantám.
Tab. 1: Procentické hodnocení pokryvnosti půdy meziplodinami – Nárameč 2010–2012
varianta
1
2
3
4
Rok
2010
85
78
70
13
2011
100
100
46
0
2012
100
100
30
0
Tab. 2: Smyv půdy v suš. (t.ha-1) – Nárameč 2010
–2012
varianta
2010
2011
2012
1
2
3
0
0
0
0
0
0
0
0
0
4
11,54
0
0,25
Tab. 3: Obsah živin ve smyté půdě – Nárameč 2010
datum smyvu
3.6.
23.6.
19.7.
27.7.
10.8.
pH/KCl
P
(mg/kg)
K
(mg/kg)
Měřené prvky
Mg
(mg/kg)
Nc
(%)
COX
(%)
5,6
6,3
6,2
5,8
6,1
97
68
108
80
85
111
124
110
112
102
248
194
342
374
261
0,180
0,090
0,200
0,180
0,150
1,71
1,02
1,77
1,32
1,66
Humus
(%)
2,95
1,76
3,05
2,28
2,86
Tab. 4: Obsah živin ve smyté půdě – Nárameč 2012
datum smyvu
27.6.
pH/KCl
P
(mg/kg)
K
(mg/kg)
Měřené prvky
Mg
(mg/kg)
Nc
(%)
COX
(%)
Humus
(%)
4,7
316
154
184
0,350
2,83
4,88
Jak bylo zjištěno i jinými autory vlivem eroze dochází jak ke kvantitativním změnám, tak i ke změnám
vzájemných vztahů mezi jednotlivými fyzikálními vlastnostmi (Dumbrovský, 1992).
Z hlediska zpracování půdy je nejdůležitější při pěstování kukuřice udržení dobré půdní
struktury, která nám zaručuje ochranu před vodní erozí (Marko, 1996).
V grafu 2 jsou znázorněny hodnoty objemové hmotnosti redukované (OHr), což je jedna
z nejdůležitějších fyzikálních vlastností půdy ovlivňujících však vody (měřeno v dvouletém
intervalu). U varianty s meziplodinou byl zjištěn půdní profil méně utužený oproti variantě
bez meziplodiny. S nižší OHr se zvyšovaly hodnoty pórovitosti, což zlepšovalo vsakovací
schopnost půdy a vyšší provzdušněnost.
Při dlouhodobějším využívání meziplodin v osevních postupech lze očekávat příznivý vliv na
výnosy hlavních plodin a na půdní strukturu (Javůrek, Vach, 2009). Mnoha autory byla
zjištěna přímá spojitost mezi erozí a hospodařením na půdě (Zhang a kol., 2009). Autoři
zjistili, že půdoochranné technologie zpracování půdy snižují riziko eroze až o 63% oproti
konvenčnímu zpracování půdy. Je tedy podstatné, aby se v rámci pěstování kukuřice na svahu
dodržovaly zásady půdoochranných, protierozních technologií.
257
„Úroda 12/2012, vědecká příloha časopisu“
Graf 2: Objemová hmotnost redukovaná v různých hloubkách a u různých variant
Nárameč, 2010 a 2012
1,70
1,60
1,50
g.cm-3
1,40
1,30
2010
2012
1,20
1,10
1,00
0,90
0 - 0,1
0,1 - 0,2
0,2 - 0,3
s meziplodinou
0 - 0,1
0,1 - 0,2
0,2 - 0,3
bez meziplodiny
Závěr
Pokryv půdy meziplodinou se projevil pozitivně z hlediska ochrany půdy proti vodní erozi.
Výsledky ukázaly, že k největšímu smyvu půdy došlo u varianty orané bez vysetých
meziplodin vzhledem k nechráněnému povrchu půdy rostlinnými zbytky meziplodin.
Meziplodiny také zaručily nižší utuženost půdy díky lepšímu prokypření kořenovým
systémem, což následně vedlo k lepší infiltrační schopnosti půdy.
Dedikace
Výsledek byl získán za (částečné) institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace.
Použitá literatura
Dumbrovský, M.: Vliv eroze na produkční schopnost půd. Kandidátská disertační práce,
VÚMOP Praha-Zbraslav, 1992, 238 s.
Javůrek M., Vach M.: Význam meziplodin v pěstebních systémech rostlinné produkce. In
CD: Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování produktů,
vědecká příloha časopisu Úroda, 12/2009, s.367-372 ISSN 0139-6013
Marko, F. a kol.: Pestovanie kukurice. VÚRV Piešťany, 1996, 104 s.
Pramanik, SC, Sharma, TVRS, Raj, SM, Bandyopadhyay, AK: Studies on soil loss, nutrient
recycling and economics of plantation based intercropping systems in Bay Islands. In
Journal of the Andaman Science Association. 1998, 14: 1, 1-6, 5 ref.
Vach, M., Haberle, J., Javůrek, M., Procházka, J., Procházková, B., Suškevič, M., Neudert, L.:
Pěstování meziplodin v různých půdně- klimatických podmínkách České republiky.
Praha, ÚZPI, Zeměd. Inform., 2005, 36 s ISBN 80-7271-157-1
Zhang J.H., Su Z.A, Nie X.J.: An investigation of soil translocation and erosion by
conservation hoeing tillage on steep lands using a magnetic tracer. In: Soil & Tillage
research 105, 2009, 177-183 ISSN 0167-1987
Kontaktní adresa:
Ing. Barbora Badalíková
Zemědělský výzkum, spol. s r.o., Zahradní 1, 664 41 Troubsko
e-mail: [email protected]
258
„Úroda 12/2012, vědecká příloha časopisu“
VLIV ÚHOROVÉHO HOSPODAŘENÍ NA VODOSTÁLOST
PŮDNÍCH AGREGÁTŮ
The influence of fallow on water stability of soil aggregate
Bartlová J.
Zemědělský výzkum, spol. s r. o.
Abstrakt
V letech 2011-2012 byl sledován vliv různého agrotechnického hospodaření na změnu kvality ornice
černozemě. Kvalita půdy byla posuzována podle schopnosti půdních agregátů odolávat rozplavení.
Byly založeny dvě varianty zpracování půdy - diskování a úhorové hospodaření. Lokalita se nachází
poblíž obce Mikulov v kukuřičné výrobní oblasti. Na obhospodařovaném pozemku byl pěstován
ječmen ozimý a řepka ozimá. Během dvouletého sledování nebyl prokázán statisticky průkazný
rozdíl vodostálosti půdních agregátů mezi úhorovým hospodařením a diskováním.
Klíčová slova: černozem, úhor, diskování, vodostálost půdních agregátů
Abstract
In the years 2011-2012 the effect of different agronomy practices on quality changes in topsoil of
Chernozem was studied. Soil quality refers to the ability of soil aggregates to resist dispersion. Two
soil tillage treatments were established – disk tillage and three-field system. The locality is situated in
the territory of Mikulov in a maize-growing region. The crops growned on cultivate plot were winter
barley and rape. The results obtained over two years of studies of water stability of soil aggregates
showed that there were no statistically significant difference between disk tillage and fallow.
Key words: chernozem, fallow, disk tillage, water stability of soil aggregate
Úvod
Soudržnost půdních agregátů ovlivňuje půdní stabilitu a její schopnost vést plyny a kapaliny,
což jsou důležité funkce pro pěstování plodin a zdraví celého ekosystému. Protože je stabilita
agregátů indikátorem vitálních funkcí půdy, může být využívána k posuzování kvality půd
(Seybold a Herrick, 2001). Stabilita půdních agregátů je závislá na půdním typu a druhu, na
obsahu organických látek (Javůrek and Vach, 2009), biologické aktivitě půdy (Oades, 2005),
hnojení (Anabi et al., 2007) a také na zpracování půdy a vegetačním pokryvu.
Při různém zpracování půdy odpovídají rozdíly ve stabilitě agregátů intenzitě lidské činnosti a
kultivace půd. Nevhodné využívání půd může vést k rozpadu nestabilních agregátů
produkující jemnější a snadněji odnositelné částice a mikroagregáty (Zhang a kol., 2008).
Panayiotopulus a Kostopoulou (1989) konstatují, že přírodní půdy mají průkazně vyšší
agregátovou stabilitu než půdy kultivované. Kandeler a Murer (1993) sledovali effect
dočasného zatravnění ve srovnání s konvenčním zpracováním půdy. Zjistili, že po zatravnění
došlo díky vlivu zvýšeného množství mikrobiální biomasy ke zlepšení stability agregátů. Po
zornění tohoto zatravnění došlo k rychlému poklesu agregátové stability. Také Kogut a kol.
(2012) uvádějí, že vodostálost černozemní struktury závisí na jejím využívání a zhoršuje se
v následujícím pořadí: neposečený úhor > pšenice ozimá > permanentní úhor.
Jedním z cílů výzkumu bylo zjistit změnu kvality ornice při úhorovém systému hospodaření.
Materiál a metodika
V roce 2011 – 2012 probíhalo sledování poloprovozního pokusu v katastru obce Mikulov.
Lokalita se nachází v kukuřičné výrobní oblasti v nadmořské výšce 350 m na středně těžké
černozemi na spraši. Průměrná roční teplota je zde 9,6°C a průměrný roční úhrn srážek je 524
mm. Na lokalitě byly pěstovány plodiny v rámci osevního postupu: v roce 2011 ječmen ozimý
(Hordeum vulgare), v roce 2012 řepka ozimá (Brassica napus L.).
259
„Úroda 12/2012, vědecká příloha časopisu“
Na sledovaném pozemku byl spolu s obhospodařovanou částí založen úhor, který byl zcela
ponechán sukcesi, pouze se 1x ročně provedlo posečení narostlých plevelů.
Varianty pokusu:
1. půda bez zpracování (úhor)
2. diskování
Vzorky půdy pro stanovení vodostálosti půdních agregátů byly odebírány každý rok vždy na
jaře na začátku vegetačního období a na podzim na konci vegetačního období. Odběr byl
proveden vždy ze tří hloubek ornice (0-0,10 m, 0,10-0,20 m a 0,20-0,30 m) ze tří odběrných
míst.
Vodostálost půdních agregátů byla zjišťována metodou mokrého prosévání (Kandeler 1996).
Při této metodě se z půdního vzorku vyschlého při laboratorní teplotě oddělí pomocí sít frakce
1-2 mm. Vzorek o hmotnosti 4 g byl promýván na sítech po dobu 5 min. Poté byly vzorky
vysušeny při 105° C do konstantní hmotnosti a po vychladnutí v exsikátoru zváženy. Po
zvážení je přidán roztok pyrofosforečnanu sodného a vzorky jsou opět promývány, tak aby
byly vyplaveny všechny jílovité částice (zůstanou jen písčité částice nad 0,25 mm), vysušeny
a zváženy. Navážka půdních agregátů byla provedena ze směsného vzorku ve třech
opakováních.
Vodostálost půdních agregátů je vyjádřena jako procento stabilních agregátů z celkového
množství agregátů po odečtení obsaženého písku podle vzorce:
% SAS = ((M2 – M3) / W – (M3 – M1)) . 100
% SAS
procento stabilních půdních agregátů
M1
hmotnost misky (g)
M2
hmotnost misky, stabilních agregátů a písku (g)
M3
hmotnost misky a písku (g)
(M2 – M3) hmotnost stabilních agregátů
(M3 – M1) hmotnost písku
W
navážka vzorku (g)
Data byla statisticky hodnocena více faktorovou analýzou variance a následné testováním
jednoduchých kontrastů metodou dle Tukeye (tab.2, 3). Ke statistické analýze byl využit
program Statistica 7.1.
Výsledky a diskuze
V prvním roce sledování byla v obou obdobích zjištěna nejvyšší hodnota vodostálosti půdních
agregátů u varianty s diskováním, kromě povrchové vrstvy (0 – 0,10 m) u varianty s úhorem.
Zde došlo v podzimním období ke značnému snížení vodostálosti u varianty s diskováním
(tab. 1). Hodnoty vodostálosti dosažené u varianty s úhorovým hospodařením byly celkově
nižší (23,36 %), než u varianty s diskováním (26,79 %). V jarním období byly hodnoty
vodostálosti celkově vyšší (28,62 %) než v podzimním období (21,52 %).
V druhém roce sledování došlo v jarním období v povrchové vrstvě u varianty
se zpracováním k poklesu vodostálosti oproti úhorovému hospodaření. Také v podzimním
období došlo ve všech hloubkách u varianty bez zpracování ke značnému zvýšení hodnot
vodostálosti. Hodnoty vodostálosti dosažené u varianty s úhorovým hospodařením byly
celkově vyšší (o 2,41 %), než u varianty s diskováním. V jarním období byly hodnoty
vodostálosti celkově nižší (o 14.73 %) než v podzimním období .
260
„Úroda 12/2012, vědecká příloha časopisu“
Tab. 1: Průměrné hodnoty vodostálosti půdních agregátů (%) v jednotlivých letech
rok
2011
2012
varianta
0 - 0,10 m
27,78
36,34
27,26
26,04
úhor
diskování
úhor
diskování
jaro
0,10 - 0,20 m
25,55
29,23
27,64
35,01
0,20 - 0,30 m
23,81
29,03
25,09
25,58
0 - 0,10 m
27,88
18,48
48,69
41,80
podzim
0,10 - 0,20 m
19,95
24,88
46,01
38,98
0,20 - 0,30 m
15,17
22,75
43,33
36,17
Výsledky z hodnocení za dvouleté sledování ukázaly, že nejvyšší hodnoty vodostálosti byly
dosaženy v podzimním období u varianty s úhorovým hospodařením (graf 1). V jarním
období byly zjištěny vyšší hodnoty vodostálostí u varianty s diskováním, v podzimním období
u varianty s úhorem.
Graf 1: Průměrné hodnoty vodostálosti půdních agregátů (%) v letech 20011-2012
Mikulov
45,00
40,00
35,00
%
30,00
25,00
úhor
20,00
diskování
15,00
10,00
5,00
0,00
0 - 0,10 m
0,10 - 0,20 m
0,20 - 0,30 m
0 - 0,10 m
jaro
0,10 - 0,20 m
0,20 - 0,30 m
podzim
Ačkoliv různí autoři (Badalíková a Procházková, 2002; Caravaka a kol., 2004) konstatují, že
při vyšší intenzitě zpracování půdy dochází ke snižování množství vodostálých agregátů,
v našem pokusu nebyl při celkovém hodnocení zjištěn statisticky průkazný rozdíl mezi
variantami (tab. 2, 3). Také Eynard.a kol. (2004) srovnávali stabilitu půdních agregátů na
travních porostech a při různých zpracováních půdy, ale nezjistili významné rozdíly.
V podzimním období bylo dosaženo statisticky průkazně vyšších hodnot vodostálosti než
v jarním období (tab. 2, 3). Podle Hlušičkové a Lhotského (1994) je stabilita půdní struktury
ovlivňována mnoha faktory, které se neustále během roku mění. Většinou je stabilita vyšší
v pozdním létě a na podzim (díky stimulované činnosti mikroorganismů) a nejnižší bývá v
předjaří (nízká teplota, málo lehce rozložitelné hmoty, přesycení půdy vodou, negativní vliv
odtékajícího sněhu).
Tab. 2: Analýza variance pro stabilitu půdních agregátů (v letech 2011 - 2012)
Efekt
Abs. Člen
Rok
Období
Hloubka
Varianta
Chyba
Stupně volnosti
1
1
1
2
1
33
PČ
43495,49***
1214,52***
174,33***
77,2***
3,12 n.s.
8,78
*** P = 0,001; **P = 0,01; *P = 0,05; n.s. neprůkazné
Tab. 3: Tukeyův HSD test
období
varianta
jaro
podzim
úhor
diskování
prům.
28,2 a
32,01 b
29,08 abcd
30,36 abcd
Průměrné hodnoty indikované různými písmeny jsou statisticky rozdílné (P = 0,05)
261
„Úroda 12/2012, vědecká příloha časopisu“
Závěr
Během dvouletého sledování nebyl prokázán statisticky průkazný rozdíl vodostálosti půdních
agregátů mezi úhorovým hospodařením a diskováním. V podzimním období bylo u obou
variant dosaženo statisticky průkazně vyšších hodnot vodostálosti než v jarním období.
Dosažené výsledky naznačují možnost změny kvality ornice při úhorovém systému
hospodaření, avšak k projevení významnějších rozdílů je zapotřebí delšího sledování.
Dedikace
Výsledek byl získán za (částečné) institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace.
Použitá literatura;
Annabi M., Houot S., Francou C., Poitrenaud M., Le Bissonnais Y., 2007 : Soil aggregate
stability improvement with urban composts of different maturities. Soil Sci. Soc. Am. J.,
71 (2): 413 – 423.
Badalíková, B., Procházková, B., 2002: Desagregace půdní hmoty vlivem různého
hospodaření se slámou. Pedologické dny 2002, Praha, s.147-149.
Cavaraca F., Lax A., Albaladejo J., 2004: Aggregate stability and carbon characteristics of
particle-size fractions in cultivated and forested soils of semiarid Spain. Soil and Tillage
Research, 78 (1): 83 - 90.
Eynard A., Schumacher T. E., Lindstrom, M. J., Malo D. D., 2004: Aggregate sizes and
stability in cultivated South Dakota prairie ustolls and usterts. Soil Sci. Soc. Am. J. 68:
1360-1365.
Hlušičková, J., Lhotský, J., 1994: Metodika: Ochrana půdní struktury před technogenní
degradací. Ústav zemědělských a potravinářských informací, Praha, 40 str.
Javůrek M., Vach M., 2009: Vliv dlouhodobého uplatňování půdoochranné technologie na
sekvestraci uhlíku a dusíku a související charakteristiky ve středně těžké půdě typu luvisol.
Úroda, scientific attachment of the journal, 12: 361 - 365.
Kandeler, E., Murer, E., 1993: Aggregate stability and soil microbial processes in a soil with
different cultivation. International workshop on methods of research on soil structure/soil
biota interrelationships, 56 (1-4): 503-513.
Kogut, B. M., Sysuev, S. A., Kholodov, V. A., 2012: Water stability and labile humic
substances of typical chernozems under different land uses. Eurasian soil science, 45 (5):
496-502.
Oades J. M., 2005: Soil organic matter and structural stability: mechanisms and implications
for management. Plant and Soil, 76 (1-3): 319 - 337.
Panayiotopoulos K. P., Kostopoulou S., 1989: Aggregate stability dependence on size,
cultivation and various soil constituents in Red Mediterranean soils (Alfisols). Soil
Technology, 2 (1): 79 – 89.
Seybold, C. A., Herrick, J. E., 2001: Aggregate stability kit for soil quality assessments.
Catena, 44: 37-45.
Zhang, Z., Wei, C. F., Xie, D. T., Gao, M., Zeng, X. B., 2008: Effects of land use patterns on
soil aggregate stability in Sichuan Basin, China. Particuology, 6 (3): 157–166.
Kontaktní adresa:
Ing. Bartlová Jaroslava
Zemědělský výzkum, spol. s r. o.
Zahradní 1, 664 41 Troubsko
[email protected]
262
„Úroda 12/2012, vědecká příloha časopisu“
MONITORING PŮDNÍ RESPIRACE V CHKO ŽĎÁRSKÉ VRCHY
V LETECH 2008 – 2010
Monitoring soil respiration The Zdarske Vrchy protected area
from 2008 to 2010
Brtnický M. 1, Kučerová J. 1, Kynický J. 2, Janzová A. 2, Pokorný E. 1
1
2
Mendelova univerzita v Brně, Agronomická fakulta
Mendelova univerzita v Brně, Lesnická a dřevařská fakulta
Abstrakt
V této práci byla sledována půdní respirace v CHKO Žďárské vrchy. Půdní respiraci zde charakterizují
bazální respirace a potenciální respirace (fyziologická využitelnost půdního dusíku N:B a poměr G:N,
který nám popisuje vzájemný poměr využitelného uhlíku a dusíku v půdě). Sledování probíhalo
v letech 2008 až 2010 a týkalo se tří různých porostů (lesní porost, orná půda a trvalý travní porost).
Ze zjištěného vyplývá, že bazální respirace dosahovala nejvyšších hodnot na lesních lokalitách a
nejnižších na trvalém travním porostu. Fyziologická využitelnost půdního dusíku (N:B) byla u všech
lokalit vyrovnaná a pohybovala se okolo hodnoty 1, což značí jeho dostatek. Vyrovnaný vzájemný
poměr uhlíku a dusíku (G:N) je roven hodnotě 5 – většina sledovaných lokalit vyrovnaný poměr
těchto dvou prvků nevykazovala.
Klíčová slova: půdní respirace, CHKO Žďárské vrchy
Abstract
In this work was studied soil respiration in the Zdarske Vrchy protected area. Soil respiration are
characterized by basal respiration and potential respiration (Physiological availability of soil nitrogen
N:B ratio and G:N, which we describe the ratio of available carbon and nitrogen in the soil).
Monitoring was carried out in the years 2008 to 2010 and covered the three different stands (forest
vegetation, arable land and permanent grassland). From established that the basal respiration is longest
on forest sites and lowest in the meadow. Physiological availability of soil nitrogen (N:B) was
balanced in all locations and moved around a value of 1, which indicates its enough. Ratio of available
carbon and nitrogen in soil (G:N) is equal to 5 - most of the monitoring sites balanced ratio of these
two elements did not show.
Key words: Soil respiration, The Zdarske Vrchy protected area
Úvod
V této práci jsou sledovány vybrané biologické vlastnosti na lokalitách v chráněné krajinné
oblasti Žďárské vrchy. Lokality se nacházejí v okrese Žďár nad Sázavou. Vybranými
variantami jsou lesní porost, trvalý travní porost (dále jen TTP) a orná půda.
Přes polovinu rozlohy CHKO pokrývají kambizemě. Na zvoleném území se vyskytují vedle
kambizemí také gleje, pseudogleje a stagnogleje.
Půdní biologii reprezentují podzemní části rostlin a edafon, jež se podílejí na vzniku a vývoji
kvality/zdraví půdy. Tesařová (1992) řadí k hlavním funkcím živé mikrobní složky půd
rozklad širokého spektra organických látek, syntézu humusu, tvorbu půdní struktury,
zpřístupnění živin rostlinám, detoxikaci cizorodých látek a produkci biologicky aktivních
látek. Společenstvo půdních mikroorganismů pak charakterizuje jako nejreaktivnější složku
biotické části ekosystému reagující na mnohé faktory vnějšího prostředí. Respirace půdy je
uvolňování CO2 živými, metabolizujícími komponenty půdy – kořeny, půdními živočichy
a mikroorganismy. Pokud je však měřena v laboratorních podmínkách u homogenizovaného
vzorku, reprezentuje především respiraci půdních mikroorganismů a zahrnuje v sobě jejich
263
„Úroda 12/2012, vědecká příloha časopisu“
množství i aktivitu (Úlehlová, 1989). Vybranými vlastnostmi biologických charakteristik je
bazální a potenciální respirace.
Materiál a metody
Oblast CHKO Žďárské vrchy zaujímá severovýchodní kulminační část Českomoravské
vrchoviny s centrálním masivem Žďárských vrchů a navazujícími částmi sousedních
pahorkatin. Přes polovinu rozlohy CHKO pokrývají kambizemě.
Námi vybrané lokality se nacházejí severně od obce Lhotka v horní části povodí potoka
Staviště zejména ve třetí zóně CHKO. Malá část zkoumané plochy se nachází v zóně první.
Na zvoleném území se vyskytují kambizemě, gleje, pseudogleje a stagnogleje.
Sledování probíhalo v letech 2008 až 2010 a týkalo se tří různých porostů (lesní porost, orná
půda a trvalý travní porost).
Přístroj Vaisala GMT220, který jsme na laboratorní podmínky respirometrického testu
(Novák, Apfelthaler, 1964) přizpůsobili (Foukalová, Pokorný 2006; Foukalová, 2011) měřil
oxid uhličitý ve čtyřech variantách přidaných látek (destilovaná voda, dusík v podobě síranu
amonného, glukóza a dusík s glukózou v poměru 1:1).
Byla zde sledována bazální respirace a potenciální respirace (fyziologická využitelnost
půdního dusíku N:B – je-li v půdě využitelného dusíku dostatek, přídavek dalšího dusíku již
respiraci nezvyšuje a hodnota N:B je blízká 1; a poměr G:N – dává představu o vzájemném
poměru využitelného uhlíku a dusíku v půdě. Při vyrovnaném fyziologickém poměru obou
těchto elementů poměr G:N roven přibližně 5. Při nižších hodnotách tohoto koeficientu jsou
půdní mikroorganismy z půdního vzorku relativně lépe vyživovány organickými látkami než
dusíkem. Při vyšších hodnotách daného koeficientu je tomu naopak.
Výsledky a diskuze
Vybrané biologické vlastnosti (bazální a potenciální respirace) byly sledovány na lokalitách
CHKO Žďárské vrchy. Monitorování probíhalo v letech 2008 až 2010 a týkalo se tří různých
porostů (lesní porost, orná půda a trvalý travní porost).
Byla zde sledována bazální respirace a potenciální respirace (fyziologická využitelnost
půdního dusíku N:B a poměr G:N – vzájemný poměr využitelného uhlíku a dusíku v půdě).
Obr. 1: Bazální respirace [mg CO2.100 g–1.h–1] v letech 2008 až 2010 u tří porostů (lesní
porost, orná půda a trvalý travní porost)
Bazální respirace [mg CO2.100 g–1.h–1]
0,700
LESNÍ POROST
ORNÁ PŮDA
TRVALÝ TRAVNÍ POROST
0,600
0,500
0,400
0,300
0,200
0,100
0,000
B jaro08
B léto08
B
B jaro09
podzim08
B léto09
B
B jaro10
podzim09
B léto10
B
podzim10
Bazální respirace měla nejvyšší hodnoty na lokalitách lesního porostu (Obr. 1) Nejnižší
hodnoty byly naměřeny na trvalém travním porostu. Společenstvo půdních mikroorganismů
264
„Úroda 12/2012, vědecká příloha časopisu“
podílejících se na přeměnách a mineralizaci organické hmoty je závislé především na teplotě,
vlhkosti, obsahu snadno rozložitelných látek v půdě a rostlinném pokryvu (Rychnovská,
1993). Petrášová et al. (2009) potvrzuje nižší hodnoty u TTP oproti orné půdě. Ke snížení
respirace může dojít i v případě, kdy významná část daného mikrobiálního společenstva není
schopna adaptace na stresové podmínky. Mikrobiální aktivita je ve většině půd limitována
nedostatkem snadno dostupného uhlíkatého substrátu (Fallih and Wainwright, 1996).
Obr. 2: Fyziologická využitelnost půdního dusíku (N:B) v letech 2008 až 2010 u tří
porostů (lesní porost, orná půda a trvalý travní porost)
LESNÍ POROST
ORNÁ PŮDA
TRVALÝ TRAVNÍ POROST
N:B
1,600
1,400
1,200
1,000
0,800
0,600
0,400
0,200
0,000
N:B jaro08 N:B léto08
N:B
N:B jaro09 N:B léto09
N:B
N:B jaro10 N:B léto10
N:B
podzim08
podzim09
podzim10
Z Obr. 2 je zřejmá vyrovnanost hodnot využitelného dusíku v půdě, kdy dostatek dusíku
vyjadřuje hodnota poměru kolem 1. Tuto hodnotu výrazněji přesahuje pouze lokalita lesního
porostu na podzim 2009 a lokality orné půdy z letního termínu 2008 – to ukazuje na
nedostatek fyziologicky využitelného dusíku u těchto dvou lokalit.
Obr. 3: Vzájemný poměr využitelného uhlíku a dusíku v půdě (G:N) v letech 2008 až
2010 u tří porostů (lesní porost, orná půda a trvalý travní porost)
G:N
9,000
LESNÍ POROST
ORNÁ PŮDA
TRVALÝ TRAVNÍ POROST
8,000
7,000
6,000
5,000
4,000
3,000
2,000
1,000
0,000
G:N jaro08 G:N léto08
G:N
G:N jaro09 G:N léto09
G:N
G:N jaro10 G:N léto10
G:N
podzim08
podzim09
podzim10
Poměr G:N (Obr. 3) udává představu o vzájemném poměru využitelného uhlíku a dusíku
v půdě. Při vyrovnaném fyziologickém poměru obou těchto elementů je poměr G:N roven
přibližně 5. Při nižších hodnotách tohoto koeficientu jsou půdní mikroorganismy z půdního
vzorku relativně lépe vyživovány organickými látkami než dusíkem a to se týká většiny
265
„Úroda 12/2012, vědecká příloha časopisu“
lokalit, kdy nejvýznamněji je tomu u lesního porostu. Při vyšších hodnotách daného
koeficientu je tomu naopak – půdní mikroorganismy jsou lépe vyživovány dusíkem než
organickými látkami a tato situace nastala u lokalit orné půdy.
Závěr
Na lokalitách CHKO Žďárské vrchy byla sledována bazální respirace a potenciální respirace
Sledování probíhalo v letech 2008 až 2010 a týkalo se tří různých porostů (lesní porost, orná
půda a trvalý travní porost).
Bazální respirace měla nejvyšší hodnoty na lokalitách lesního porostu. Nejnižší hodnoty byly
naměřeny na trvalém travním porostu. Ke snížení respirace může dojít v případě, kdy
významná část daného mikrobiálního společenstva není schopna adaptace na stresové
podmínky.
U poměru N:B je zřejmá vyrovnanost hodnot využitelného dusíku v půdě, kdy dostatek
dusíku vyjadřuje hodnota poměru kolem 1. Tuto hodnotu výrazněji přesahuje, a tím značí
nedostatek dusíku, pouze lokality lesního porostu na podzim 2009 a lokality orné půdy
z letního termínu 2008.
Poměr G:N udává představu o vzájemném poměru využitelného uhlíku a dusíku v půdě. Při
vyrovnaném fyziologickém poměru je poměr G:N roven přibližně 5. Při nižších hodnotách
tohoto koeficientu jsou půdní mikroorganismy z půdního vzorku relativně lépe vyživovány
organickými látkami než dusíkem – to se týká většiny lokalit, nejvíce lesního porostu. Při
vyšších hodnotách daného koeficientu je tomu naopak – půdní mikroorganismy jsou lépe
vyživovány dusíkem než organickými látkami a tato situace nastala u lokalit orné půdy.
Dedikace
Poděkování: Příspěvek byl zpracován s podporou Výzkumného záměru č. MSM6215648905
uděleného Ministerstvem školství, mládeže a tělovýchovy České republiky a projektů NAZV
QI91C054 a QJ1230066 udělených MZe ČR.
Použitá literatura
Fallih A.B.K.& Wainwright M., 1996. Microbial and enzyme activity in soils amended with
natural source of easily available carbon, Biology and Fertility of Soils 21: 177–183.
Foukalová J., Pokorný E., 2006: Agroekologické limity vybraných biologických vlastností
ornic černosolů v oblasti střední Moravy In: Mendelnet´06 Agro, Mendelova zemědělská
a lesnická univerzita v Brně, s. 1–11. ISBN 80-7157-999-8
Foukalová J., 2011: Agroekologické limity vybraných biologických vlastností ornic černozemí
v oblasti Moravy. Disertační práce. Mendelova univerzita v Brně, 2011
Novák B., Apfelthaler R. 1964: Příspěvek k metodice stanovení respirace jako
indikátoru mikrobiologických pochodů. Rostlinná výroba, ročník 10, č. 2: 145–150.
Petrášová V., Pospíšilová L., Pokorný E.: Biological and chemical properties of eutric cambisol
In: Mendelnet´09 Agro, Mendelova univerzita v Brně, 1-6.
Rychnovská M. (ed.) 1993. Structure and functioning of seminatural meadows. Academia, Praha.
Tesařová M. 1992: Biomasa mikroorganismů v půdě In Metody stanovení mikrobní biomasy
v půdě – sborník referátů ze semináře, ÚPB ČSAV České Budějovice
Úlehlová B. 1989: Nitrogen Cycle in Grass Ecosystems. Academia, Praha: 26–42.
Kontaktní adresa:
Ing. Martin Brtnický
Agronomická fakulta
Mendelova univerzita v Brně, Zemědělská 1, 613 00 Brno
[email protected]
266
„Úroda 12/2012, vědecká příloha časopisu“
TECHNIKY ZPRACOVÁNÍ PŮDY A JEJÍ VLIV NA ZHUTNĚNÍ
Soil Treatment Equipment And Its Influence On Compaction
Červinka J., Pospíšil J., Svoboda M.
Mendelova univerzita v Brně
Abstrakt
Na stanovišti v Lesonicích byly sledovány v letech 2008 – 2011 možnosti různé intenzity zpracování
půdy při zakládaní porostů. Byly hodnoceny tři různé varianty (orba, mělké kypření, hluboké kypření)
a byl posouzen jejich vliv na penetrometrický odpor, který je indikátorem zhutnění půdy. Z výsledků
vyplynulo, že varianty kypřením mají menší náchylnost ke zhutnění, mají vyšší pórovitost a jsou
schopny zadržet více vláhy.
Klíčová slova: půda, penetrační odpor, objemová hmotnost, zhutnění
Abstract
The aim of study was monitored different options of the soil tillage during plantation establishment in
the habitat Lesonice since years 2008 till 2011. There were evaluated three diffrent variants
(ploughing, shallow loosening and deep loosening) and were assess their effect on the penetration
resistence, which is an indicator of soil compaction. The results showed that the variants with the
loosening are prone to compaction less, have higher porosity and are able to hold more moisture.
Keywords: soil, penetration resistance, porosity, bulk density, compaction
Úvod
Zemědělské technika ovlivňuje zhutnění půdy zejména působením podvozků na půdu
prostřednictvím pneumatiky nebo pásu. Odvalující se pneumatika způsobí deformací
plastického podloží. Lhotský (2000) uvádí, že zhutněním dochází k poškozování půdní
struktury, k růstu objemové hmotnosti půdy a tím k poklesu její pórovitosti. Z hlediska
intenzity zhutnění je rozhodující kontaktní tlak pneumatiky na půdu, který je dán napětím
mezi půdou a pneumatikou, které působí kolmo na povrch půdy v ploše otisku. Grečenko
(1994) uvádí, že se vzrůstajícím tlakem huštění u stejně zatížené pneumatiky roste i tlak na
půdu. Při zvětšené vlhkosti půdy se zatížení přenáší až do podloží, kde způsobuje trvalé
deformace. Použití moderních pneumatik a možnosti proměnlivého huštění je jednou
z technických řešení snižování technogenního utužení. Další cestou je uplatnění moderních
pěstebních technologií, které ovlivňuji strukturu půd danou stupněm zpracování a počtem
pojezdů po půdě (Javůrek, 2008).
Materiál a metody
V rámci výzkumného projektu byl sledován vliv různých způsobů zpracování půdy na
penetrometrický odpor půdy ve vybraných lokalitách České republiky, v tomto příspěvku
konkrétně v Lesonicích - zemědělská výrobní podoblast B3. Při měření byly také zjišťovány
objemová hmotnost redukovaná, celková pórovitost a vlhkost půdy. Byly sledovány varianty
zpracování půdy s orbou do hloubky 220 mm –var. 1, mělké kypření do hloubky 150 mm –
var. 2 a hluboké kypření do hloubky 350 mm – var. 3. Penetrometrický odpor (odpor vniknutí
kužele do půdy) byl měřen přístrojem PM–10 pro hloubky 40 – 500 mm v intervalu po 40
mm. Měření se provádělo u každé varianty v jarním a podzimním období v pěti opakováních.
Výsledky sledování byly statisticky zpracovány analýzou rozptylu v programu STATISTICA
267
„Úroda 12/2012, vědecká příloha časopisu“
CZ. Výsledky sledování v letech 2008–2011 na lokalitě Lesonice jsou uvedeny v grafické
podobě v grafech 1–4.
Výsledky a diskuze
Zhutnění orniční vrstvy, především podloží, omezuje růst kořenů a snižuje prosakování vody.
Úrodnost půdy je snížena vlivem omezeného pronikání vzduchu (snížením pórovitosti).
Zhutnění se ve svém důsledku projevuje zvýšením redukované objemové hmotnosti a tím
zvýšení penetračního odporu půdy. V grafu 1 je vidět, že v jednotlivých letech je
penetrometrický odpor největší u varianty 3 - minimalizace, v letech 2008–2011 se pohyboval
v intervalu od 2,9–3,4 MPa, což je podle Arshalda et. al. (1996) vysoký odpor (Arshald uvádí
2–4 MPa), podle Lhotskejho (2000) je u hlinité půdy hranice zhutnění 3,7–4,2 MPa což tato
varianta nedosahuje. Srovnáme-li varianty jarního a podzimního měření (graf 1 a 2) vidíme,
že v roce 2009 dosahovaly všechny varianty extremních hodnot, které byly ovlivněny suchem
v dané lokalitě. V podzimním měření viz graf 2, se ukazuje, že v roce 2010 a 2011 se varianty
3 a 1 vyrovnaly a z hlediska penetrometrického odporu nebyly výrazné rozdíly. Na grafu 3 je
průměrná hodnota penetrometrického odporu v jednotlivých hloubkách u jednotlivých
variant. Vezmeme-li referenční hloubku h= 280 mm, tak u orby – var. 1 je v této hloubce
rozpětí odporu od 1,9–3,4 MPa, varianty 2 a 3 nepřesáhly hodnotu 3,1 MPa.
Graf 1. Průměrný penetrometrický odpor v letech 2008–2011 (jaro)
Průměrný penetrometrický odpor - Lesonice (jarní měření)
4,0
3,8
3,6
3,4
3,2
MPa
3,0
2,8
2,6
2,4
2,2
2,0
1,8
1,6
2008
2009
2010
rok
v arianta: orba
v arianta: podrýv ání
268
v arianta: minimalizace
2011
„Úroda 12/2012, vědecká příloha časopisu“
Graf 2. Průměrný penetrometrický odpor v letech 2008–2011 (podzim)
Průměrný penetrometrický odpor - Lesonice (podzimní měření)
7
6
5
MPa
4
3
2
1
0
2008
2009
varianta: orba
2010
rok
varianta: podrývání
2011
varianta: minimalizace
Graf 3. Průměrný penetrometrický odpor v jednotlivých hloubkách a variantách
Průměrný penetrometrický odpor - Lesonice (v letech 2008 - 2011, za jarní i podzimní
měření)
5,5
5,0
4,5
4,0
[MPa]
3,5
3,0
2,5
2,0
1,5
1,0
0,5
podrývání
orba
minimalizace
varianta
hloubka 80
hloubka 200
hloubka 320
hloubka 440
hloubka 120
hloubka 240
hloubka 360
hloubka 480
269
hloubka 160
hloubka 280
hloubka 400
hloubka 520
„Úroda 12/2012, vědecká příloha časopisu“
Penetrometrický odpor půdy byl korigován podle vlhkosti půdy zjištěné v době měření
odporu (tab. 1).
Tab. 1 Průměrné hodnoty momentálního objemu vody (%obj.) při různém zpracování
půdy, Lesonice 2008–2011
var. 1
var. 2
var. 3
2008
20,41
22,57
21,12
2009
20,57
23,78
23,85
2010
25,87
27,88
27,92
2011
25,44
27,08
27,22
Závěr
Pro technogenní zhutnění jsou rozhodující limitní hodnoty penetrometrického odporu a
kontaktních tlaků. Limitní hodnoty penetrometrického odporu závisí na druhu půdy. Výsledky
čtyřletého sledování ukázaly závislosti na měnících se klimatických podmínkách. Přesto
varianta s podrýváním a varianta s minimalizací může úspěšně nahradit orbu, aniž by
z hlediska penetrometrického odporu došlo k výraznému navýšení hodnot a tím
v k výraznému zhoršení podmínek pro růst a pěstování rostlin. Hranice 1 MPa je odstranitelná
následnou agrotechnikou. Zhutnění větší a do větších hloubek musíme odstranit samostatnou
operací – kypření a provzdušnění půdy hloubkovým kypřičem. Uvedené výsledky prokázaly
nutnost posuzování zhutnění půdy vždy z několika úhlů. Kromě penetrometrického odporu a
objemové hmotnosti je nutno sledovat obsah vody, a to vše konfrontovat s výnosy plodiny.
Také organická hmota u těchto variant působí pozitivně na půdní vlhkost a na zhutnění.
Nahrazení orby zpracováním půdy bez převracení skývy (podrýváním, kypřením) nesmí ale
snížit výslednou kvalitu sklízeného produktu a nesmí snížit půdní úrodnost.
Dedikace
Příspěvek vznikl na základě řešení projektu MZe ČR NAZV č. QH 72039 „Stanovení stupně
degradačních změn v půdě vlivem antropogenní činnosti v souvislosti s pěstováním plodin“
řešený na Mendelově univerzitě v Brně a na ZV s.r.o. Troubsko.
Přehled literatury
Arshad, M. A., Lowery, B., Grossman, B., 1996: Physical tests formonitoring soil quality. In:
Doran, W., Jones, J. (Eds.), Methods for Assessing Soil Quality, Madison, WI, 1996. Soil
Sci. Soc.Am. 49, 123–141
Grečenko,A. (1994). Vlastnosti terénních vozidel, ES VŠZ Praha, 1994, 183s.
Javůrek.M.,Vach, (2008): negativní vliv zhutnění půd a soustava opatření k jejich odstranění.
Metodika pro praxi, VURV, v, vi., 24s. ISBN 978-80-87011-57-7.
Lhotský,J.(2000): Zhutnění půd a opatření proti němu. Studijní zpráva UZPI Praha , 61s.
Kontaktní adresa:
doc. Ing. Jan Červinka, CSc.
Ústav zemědělské, potravinářské a evironmentální techniky
AF, Mendelova univerzita v Brně
Zemědělská 1, 613 00 Brno
email: [email protected]
270
„Úroda 12/2012, vědecká příloha časopisu“
HODNOCENÍ GENETICKÉ VARIABILITY AUTOCHTONNÍCH
POPULACÍ JILMU
Evaluation of genetic diversity of autochthonous elm populations
Dědouchová M.1, Kubátová B.1, Cvrčková H.2, Máchová P.2, Vortelová L.2
1
2
Jihočeská univerzita v Českých Budějovicích
Výzkumný ústav lesního hospodářství a myslivosti, v.v.i., Jíloviště
Abstrakt
Příspěvek se zabývá posouzením mezipopulační a vnitropopulační diverzity u autochtonních populací
jilmu, přičemž úkolem je najít zdroje genetické diverzity, které by poskytly materiál vhodný pro
doplnění stávající genové banky explantátů uchovávané VÚLHM ve Strnadech. Práce si uvědomuje
důležitost detekce genetické variability, která je předpokladem pro schopnost druhu reagovat na
pozměněné životní podmínky a zachovat tak svou existenci, a ke stanovení její úrovně využívá v ČR
pro tyto účely dosud opomíjených metod molekulární biologie. Jako nástroje pro zjištění genetické
struktury vybraných populací jilmu byla využita metoda AFLP (amplified fragment length
polymorphism). Výsledky získané s využitím vybraných AFLP markerů ukazují na vhodnost tohoto
přístupu k ho