Výzkumný ústav pícninářský, spol. s r.o. Troubsko
Zemědělský výzkum, spol. s r.o. Troubsko
Pícninářská komise ORV ČAZV, Odbor rostlinolékařství
ČAZV
a
mediální partner Profi Press, s.r.o. Praha
AKTUÁLNÍ POZNATKY
V PĚSTOVÁNÍ,
ŠLECHTĚNÍ, OCHRANĚ
ROSTLIN
A ZPRACOVÁNÍ PRODUKTŮ
Úroda 12/2011, vědecká příloha časopisu
Výzkumný ústav pícninářský, spol. s r.o. Troubsko
Zemědělský výzkum, spol. s r.o. Troubsko
a
Pícninářská komise Odboru rostlinné výroby ČAZV
Odbor rostlinolékařství ČAZV
a
mediální partner Profi Press, s.r.o. Praha
Aktuální poznatky v pěstování, šlechtění,
ochraně rostlin a zpracování produktŧ
Úroda 12/2011, vědecká příloha časopisu
Editor:
Ing. Barbora Badalíková
Ing. Jaroslava Bartlová
Organizační výbor:
Ing. Barbora Badalíková - předseda
Ing. Jaroslava Bartlová
Ing. Pavel Kolařík
Ing. Jaroslav Lang
Ing. Karel Vejraţka, Ph.D
Mgr. Tomáš Vymyslický
Vědecký výbor:
RNDr. Jan Nedělník, Ph.D. - předseda
Ing. Barbora Badalíková
doc. Ing. Bohumír Cagaš, CSc.
Ing. Jaroslav Čepl, CSc.
RNDr. Jan Hofbauer, CSc.
Ing. Miroslav Hochman
Ing. Pavel Kolařík
Ing. Slavoj Palík, CSc.
Ing. Jan Pelikán, CSc
Ing. Karel Vejraţka, Ph.D.
Příspěvky byly recenzovány členy vědeckého výboru
Doporučná citace příspěvkŧ:
Autoři příspěvků: Název příspěvku. Úroda 12, 2011, vědecká příloha, s. od – do
ISSN 0139-6013
OBSAH
Nedělník J.: Úvodní slovo ...................................................................................................... 9
Sekce „Šlechtění“
Dotlačil L., Stehno Z., Faberová I.: Vyuţití genetických zdrojů rostlin ve šlechtění .......... 11
Řepková J., Nedělník J., Jakešová H., Hampel D., Hofbauer J.: Mezidruhoví hybridi
Trifolium pratense x Trifolium medium jako zdroj nové diverzity ......................................... 21
Sekce „Rostlinolékařství“
Hnízdil M.: Změny v koncepci rostlinolékařské péče .................................................................. 25
Cagaš B.: Jaká je vlastně škodlivost dusivé plísňovitosti trav (Epichloë typhina) v travním
semenářství? .......................................................................................................................... 31
Šefrová H., Laštŧvka Z.: Rovnokřídlí (Orthoptera) na experimentální ploše u Hodonína –
bioindikace a rostlinolékařský význam .................................................................................. 37
Matušinsky P., Leišová-Svobodová L., Tvarŧţek, L.: Stanovení rezistence
ke strobilurinovým fungicidům u Ramularia collo-cygni ...................................................... 43
Kolařík. P, Rotrekl J.: Výskyt a škodlivost bázlivce kukuřičného (Diabrotica virgifera
virgifera) na vybraných lokalitách jiţní Moravy.................................................................... 47
Sekce „Technologie pěstování plodin a ekologie“
Křen J.: Moţnosti optimalizace pěstebních technologií polních plodin ................................ 53
Burg P., Zemánek P.: Porovnání rovnoměrnosti rozmístění částic kompostu při různých
způsobech zapravení .............................................................................................................. 59
Kusá H., Rŧţek P., Vavera R.: Nové postupy při hnojení řepky ozimé dusíkem a sírou ..... 65
Vymyslický T., Fabšičová M., Entová M. a Kŧrová J.: Význam úhorů v zemědělské
krajině.................................................................................................................................... 71
Krausová, A., Hrabě, F., Rosická, L., Hejduk, S.: Rozdíl v sukcesi druhové skladby
porostu při řízeném a samovolném uvedení orné půdy do klidu ............................................ 77
Hejduk S., Sochorec M.: Vliv vybraných plodin na tvorbu povrchových odtoků
v podmínkách Českomoravské vrchoviny ............................................................................. 81
Huňady I., Hochman M., Poníţil A.: Vyuţití luskovino-obilních směsek v ekologickém
zemědělství ............................................................................................................................ 85
Ehrenbergerová J., Pluháčková H., Bradáčová M., Březinová Belcredi N., Benešová K.,
Vaculová K.: Obsah vitamínu E v obilkách geneticky odlišných odrůd ječmene jarního
ze stresových podmínek ......................................................................................................... 91
Sekce „Kvalita a zpracování produktů“
Bárta J., Bártová V., Čurn V.: Kvalita rostlinných produktů – současnost a budoucnost ... 97
Dostálová R., Horáček J.,Trojan R., Hasalová I.: Změny obsahu rezistentního škrobu
u hrachu ............................................................................................................................... 105
Pluháčková H., Ehrenbergerová J., Kocourková B., Fojtová J.: Obsah silic a jejich
jednotlivých sloţek ve vybraných odrůdách chmele ............................................................ 111
Martinek P., Vyhnánek T., Podhorná J., Novotná P., Vaculová K., Kadlíková M., Jirsa O.,
Kurečka R.: Pšenice s odlišným zabarvením zrna a moţnost jejich vyuţití v potravinářství .......... 117
Hofbauer J. , Vejraţka K.: Rezidua akaricidů ve včelím vosku ........................................ 125
Kučerová J., Šottníková V.: Kvalita chleba ovlivněná podílem ţitné mouky .................... 129
3
Vavreinová S., Ouhrabková J., Rysová J., Fiedlerová V., Holasová M., Laknerová I.,
Winterová R., Prokeš J., Hartman I.: Nutriční hodnocení sladů z obilovin a pseudoobilovin
............................................................................................................................................ 133
Sekce „Šlechtění“
Bláha L., Stehno Z., Konvalina P.: Porovnání vlivu ekologicky certifikovaných,
konvenčních a farmářských osiv obilnin na následnou generaci .......................................... 137
Bláha L., Vyvadilová M., Klíma M.: Vliv genotypových rozdílů v parametrech kořenového
systému na suchovzdornost a výnos řepky ozimé ................................................................ 141
Brabcová A., Bárta J., Bártová V., Horáčková V.: Studium proteinových profilů hlíz
vybraných genotypů kulturních druhů brambor pomocí čipové elektroforesy ..................... 145
Bradová J., Štočková L.: Variabilita gluteninů v sortimentu odrůd pšenice pěstovaných
v ČR .................................................................................................................................... 149
Haberle J., Raimanová I., Svoboda P., Matějková Š.: Srovnání vybraných ukazatelů
evropských a čínských odrůd jarního ječmene ..................................................................... 153
Hanzalová A., Bartoš P.: Rezistence ozimého tritikale ke rzi pšeničné (Puccinia triticina)
............................................................................................................................................ 157
Hermuth J., Janovská D., Dvořáček V., Prohasková A., Stehno Z.: Diversita českých a
slovenských odrůd pšenice seté ........................................................................................... 161
Cholastová T., Bučánková A.: Molekulární identifikace kryptických druhů: jednoduchý
způsob odlišení problematických druhů čmeláků ................................................................ 165
Knotová D., Vymyslický T.: Stanovení podobností v kolekci odrůd vojtěšky seté ............ 169
Konečná E., Smýkal P., Hanáček P.: Geny rezistence hrachu k virové mozaice hrachu
přenosné semenem (PSbMV) a jejich vyuţití ve šlechtění ................................................... 173
Papoušková L., Bradová J., Milec Z.: Vyuţití elektroforetických stanovení ke studiu waxy
pšenic .................................................................................................................................. 177
Pelikán J., Knotová D.: Porovnání některých morfologických a výnosových charakteristik
planých druhů rodu Onobrychis s odrůdou višňovský vícesečný ......................................... 181
Raab S., Pelikán J.: Zhodnocení některých výnosových a morfologických charakteristik
v kolekci druhu Anthyllis vulneralia .................................................................................... 185
Sochorec M., Knot P.: Úprava osiva metodou iSeed a její vliv na klíčení a počáteční vývoj
lipnice luční a kostřavy červené ........................................................................................... 189
Štočková L.: Identifikace HMW- a LMW- gluteninových podjednotek metodou HPLC/UV
pro účely určování odrůd pšenice ........................................................................................ 193
Ullmannová K., Chloupek O., Pávková Z.: Co ovlivňuje vitalitu obilek ječmene? .......... 197
Vaculová K., Ehrenbergerová J., Smutná P.: Hodnocení hospodářských znaků a ukazatelů
nových donorů nesladovnického ječmene pro potravinářské a krmné vyuţití ...................... 201
Sekce „Rostlinolékařství“
Beran P., Mráz I.: Návrh a testování specifických primerů pro detekci karanténní bakterie
Xanthomonas vesicatoria..................................................................................................... 205
Hakl, J., Mášková, K., Šantrŧček, J.: Polní odolnost českých odrůd vojtěšky seté
k chorobám kořene v poloprovozních podmínkách – lokalita Loděnice u Opavy ................ 209
Kamenová A., Bártová V., Bárta J.: Antifungální potenciál nízkomolekulárních proteinů a
peptidů hlíz bramboru (Solanum tuberosum L.) ................................................................... 213
Kmoch M., Šafránková I., Polišenská I., Pokorný R.: Vliv hybridu na infekci obilek
kukuřice (Zea mays L.) houbami rodu Fusarium ................................................................. 217
4
Kokošková B., Mráz I., Pouvová D., Beran P.: Průzkum bakteriálního vadnutí rajčete v ČR
a spolehlivost detekce Clavibacter michiganensis subsp. Michiganensis z rajčat různými
diagnostickými technikami .................................................................................................. 221
Koláčková A., Kmoch M., Šafránková I., Krédl Z., Pokorný R.: Hodnocení stupně
napadení rostlin pomocí programu Assess 2.0 ..................................................................... 225
Kolařík, P, Rotrekl, J.: Nové způsoby ochrany proti nosatčíkům rodu Apion v porostech
jetele lučního ....................................................................................................................... 231
Krejzar V., Pánková I., Kŧdela V., Hausvater E., Doleţal P.: Reakce odrůd bramboru
na pektinolytickou bakterii Erwinia carotovora subsp. atroseptica ..................................... 235
Leišová-Svobodová L., Matušinsky P., Kučera L.: Variabilita populace Ramularia collocygni na území České republiky .......................................................................................... 239
Novotná K., Staňková B., Víchová J., Vejraţka K., Pokorný, R.: Účinnost
dvousloţkových fungicidů na vybrané izoláty Colletotrichum acutatum ............................. 243
I Pánková I., Krejzar V., Kŧdela V., Ackermann P.: Indukce mrazového poškození révy
vinné INA+ bakteriemi ve spojitosti s následnou tumorogenezí vyvolanou bakteriemi rodu
Agrobacterium ..................................................................................................................... 247
Poslušná J., Plachká E.: Výskyt fomové hniloby (Leptosphaeria maculans, L. Biglobosa)
na severní Moravě (Šumpersko, Opavsko) v posledních letech ........................................... 251
Rohrer M., Břusková H., Hanáček P., Reinöhl V.: Konstrukty pro indukci rezistence vůči
virům a poţerovému hmyzu u hrachu .................................................................................. 255
Sapáková E., Šefrová H.: Škodlivost květilky cibulové (Delia antiqua) a krytonosce
cibulového (Oprohinus suturalis) na česneku kuchyňském v různých nadmořských výškách
............................................................................................................................................ 259
Seidenglanz M., Havel J., Hrudová E.: Vliv termínu aplikace na účinnost vybraných
insekticidů na stonkové krytonosce (C. pallidactylus; C. napi) v řepce ozimé .................... 263
Středa T., Středová H., Roţnovský J.: Predikce aktivity bázlivce kukuřičného v závislosti
na teplotách půdy................................................................................................................. 269
Středová, H., Středa, T., Roţnovský, J., Chuchma, F.: Výskyt vybraných škodlivých
činitelů ovocných dřevin v ČR v závislosti na teplotních podmínkách ................................ 273
Sumíková T., Ţabka M., Kučera L., Chrpová J.: Produkce mykotoxinů a genetická
variabilita druhu Fusarium graminearum v České republice ............................................... 277
Svoboda J.: Účinnost metody kříţové ochrany při ochraně vybraných odrůd okurek
před silně virulentním kmenem zymv .................................................................................. 281
Svoboda J. , Leišová-Svobodová L.: Závislost intenzity výskytu virových chorob paprik
na území České republiky na populaci mšic v daném roce .................................................. 287
Tóth P., Hrudová E., Sapáková E., Seidenglanz M., Poslušná J.: Druhové spektrum a
poměrné zastoupení blýskačků rodu Meligethes na vybraných lokalitách v ČR v roce 2010
............................................................................................................................................ 291
Víchová J., Kokošková B., Milosavljevic V.: Rezistence odrůd rajčete k bakteriální
skvrnitosti ............................................................................................................................ 295
Vrbovský V., Rychlá A., Endlová E.: Variabilita obsahu glukosinolátů obsaţených v zelené
hmotě a jejich vliv na vybrané škůdce řepky ....................................................................... 299
Winkler J., Neischl A., Zelená V., Hledík P.: Porovnání zaplevelení ozimé pšenice a jarního
ječmene pěstovaných v rozdílných osevních postupech....................................................... 303
Ţabka M., Sumíková T., Pavela R.: Skrining antifungálních vlastností vybraných
rostlinných extraktů ............................................................................................................. 307
5
Sekce „Technologie pěstování plodin a ekologie“
Badalíková B., Bartlová J.: Vliv zapravení kompostu na utuţení půdy ............................. 311
Badalíková B.: Moţnosti řešení problému dobrého zemědělského a enviromentálního stavu
půdy..................................................................................................................................... 315
Bartlová J.: Makrostrukturální změny v ornici a podorničí při vyuţití různých technologií
zpracování ........................................................................................................................... 319
Bártová V., Bárta J., Diviš J., Brabcová A.: Vliv pěstitelské technologie na relativní
abundanci patatinových bílkovin v hlízách bramboru (Solanum tuberosum L.) ................... 323
Běhal R., Hřivna L., Gregor T.: Dynamika příjmu ţivin a tvorba výnosu zrna ječmene.. 327
Brtnický M., Foukalová J., Pokorný E., Kynický J.: Sledování bazální respirace půd
střední Moravy .................................................................................................................... 331
Červinka J., Bačák J., Pospíšil J.: Vliv energetických a mechanizačních prostředků
na zhutnění půdy.................................................................................................................. 335
Dvořák P., Tomášek J., Hajšlová J., Schulzová V., Krtková V.: Vliv povrchového
mulčování brambor na kvalitu hlíz ...................................................................................... 339
Foukalová J., Brtnický M., Vlček V., Záhora J., Pokorný E.: Potenciální respirace půd
okresu Prostějov – organické látky v půdě........................................................................... 343
Frydrych J., Lošák M., Cagaš B., Volková P., Martínková K., Barták M.,
Krupauerová A.: Výsledky výzkumu biodiverzity hmyzu se zaměřením na mulčovaný a
nemulčovaný travní systém ................................................................................................. 347
Houšť M., Neudert L., Procházková B.: Vliv různé intenzity zpracování půdy na její
fyzikální vlastnosti............................................................................................................... 351
Javŧrek M., Mikanová Olga, Vach M.: Hodnocení dlouhodobého efektu půdoochranných
technologií na výnosy ozimé pšenice a vlastnosti půdy typu Luvisol .................................. 355
Knot P., Hrabě F., Vrzalová J.: Vliv formy a dávky dusíku na hmotnost sklizené biomasy
u parkového trávníku ........................................................................................................... 359
Koprna R., Spíchal L., Strnad M.: Výsledky aplikací cytokininového deriváu INCYDE
na polních plodinách………………………………………………………………………...363
Lang J.: Produkce suché hmoty u jetelovin ve třech uţitkových letech .............................. 367
Lang J.: Porovnání produkce sušiny a kvality píce ve dvou pěstebních cyklech v systémech
hnojení CULTAN a LAV .................................................................................................... 371
Lukas V., Kubíček P., Kozel J.: Agrometeorologická měření pomocí bezdrátových
senzorových sítí ................................................................................................................... 375
Madaras, M., Jiřič, M., Lipavský, J.: Pěstování brambor a tritikale v osevním sledu
s převahou dočasného travního porostu v horské výrobní oblasti ........................................ 379
Macháč R.: Moţnosti pěstování jílku mnohokvětého jednoletého na semeno v ekologickém
zemědělství – předběţné výsledky....................................................................................... 383
Mühlbachová G.: Vliv přídavku sedimentů do půd na mikrobiální aktivity ....................... 387
Mühlbachová G., Káš M.: Interakce mezi přijatelnými obsahy ţivin v půdách a rostlinách
při různém způsobu hnojení na dlouhodobých pokusech ..................................................... 391
Pernicová A., V. Smutný, M. Janeček: Vliv různé intenzity zpracování půdy na výnos a
obsah dusíkatých látek v zrnu jarního ječmene .................................................................... 395
Pospíšilová L., Jandák J.: Obsah a dynamika humusu u regozemě arenické ..................... 399
Pospíšilová L., Formánek P., Drápelová I.: Frakcionace humusových látek u intenzivně
obhospodařovaných luvizemí .............................................................................................. 403
Procházka J., Novosádová I.: Vliv meziplodin na obsah minerálního dusíku v půdě ........ 407
Procházková B., Dryšlová T., Filipský T., Houšť M.: Vliv pěstování strniskových
meziplodin na výnosy jarního ječmene ................................................................................ 411
6
Raimanová, I.: Vliv teploty na příjem a vyuţití nitrátové formy dusíku u jarního ječmene
............................................................................................................................................ 415
Rŧţek P., Kusá H., Dvořáček, V.: Vyuţití hnojiv s inhibitory ureasy a nitrifikace
při pěstování ozimé pšenice s různými poţadavky na kvalitu zrna ...................................... 419
Semanová I., Ševčíková M.: Vliv termínu sběru semen regionální směsi z druhově bohatých
luk na její druhové sloţení ................................................................................................... 423
Straková M., Jankŧ Ľ., Straka J.: Ovlivnění listové plochy vybraných druhů trav aplikací
pomocných půdních látek .................................................................................................... 427
Svoboda P.: Riziko úniku dusíku do spodních vrstev půdy z polních hnojišť a kompostů .. 431
Svobodová M., Slimáková, V.: Vliv mechanické zátěţe na pokryvnost tréninkových
fotbalových trávníků AC Sparta Praha ................................................................................ 435
Šafář J.: Opuštěné jabloňové sady versus konvenční, aneb poušť versus prales – případ
biodiverzity nočních motýlů (Lepidoptera) ......................................................................... 439
Tomášek J., Dvořák P.: Vliv ošetření sadby na výnos a skladovací ztráty brambor v systému
ekologického zemědělství .................................................................................................... 443
Vach M., Javŧrek M., Hýsek J.: Vliv efektivních technologií zaloţení porostů a účinek
biofungicidů na produkci a výskyt patogenů ozimé pšenice ................................................ 447
Zemánek P., Burg P.: Hodnocení nákladovosti při aplikaci vyšších dávek kompostů ....... 451
Sekce „Kvalita a zpracování produktů“
Bárta J., Stýblová J., Bártová V.: Izolace bílkovin ze semen vybraných druhů luskovin . 457
Cwiková O.: Mikrobiologická kvalita mouky pouţívané pro výrobu pekařských a
cukrářských produktů .......................................................................................................... 463
Gregor T., Feigerl L., Šusta J., Los J., Cwiková O.: Problematika Gushingu ve sladovně
Rajhrad ................................................................................................................................ 467
Eichlerová E., Kovářová V., Gabrovská D., Erban V.: Vybrané druhy fermentovaných
zeleninových šťáv jako zdroj potenciálně probiotických mikroorganismů........................... 471
Hamouz K., Lachman J., Hejtmánková K., Cimr J., Pivec V., Vacek J.: Vliv barvy
duţniny na antioxidační aktivitu hlíz brambor ..................................................................... 475
Holasová M., Fiedlerová V., Dostálová R., Horáček J.: Vliv zralosti na obsah karotenoidů
v dřeňovém hrachu (PISUM SATIVUM L. SSP. SATIVUM VAR. MEDULLARE) ......... 479
Hřivna L., Burešová I., Šottníková V., Gregor T., Radoch T.: Vliv výţivy dusíkem a sírou
na kvalitu zrna ječmene ....................................................................................................... 483
Jiroušková Z., Moudrý J. sr., Moudrý J. jr.: Emise skleníkových plynů při produkci
brambor ............................................................................................................................... 487
Jirsa O., Vaculová K.: Moţnosti potravinářského vyuţití netradičních genotypů pšenice a
ječmene ............................................................................................................................... 491
Laknerová I., Mašková E., Ouhrabková J., Erban V., Balounová M.: Vliv sloţení surovin
na senzorickou a nutriční jakost chleba................................................................................ 495
Macháň P., Ehrenbergerová J., Klímová E., Benešová K.: Obsah β-glukanů v odrůdách a
liniích ječmene jarního ........................................................................................................ 499
Moudrý J. jr., Jiroušková Z., Plch R., Moudrý J., Konvalina P., Hyšpler R.: Emisní zátěţ
při pěstování a zpracování pšenice....................................................................................... 503
Neugebauerová J., Raab S., Pijáková H.: Hodnocení obsahu silic i vybraných druhů rodu
Salvia L.. ............................................................................................................................. 507
Prohasková A., Dvořáček V., Hermuth J., Papoušková L., Faměra O.: Vztah relativní
viskozity k vybraným parametrům technologické kvality pšenice ....................................... 511
Rysová J., Stehno Z., Martinek P.: Obsah aminokyselin ve vybraných odrůdách pšenice 515
7
Šottníková V., Kučerová J., Hřivna L.: Kvalita pekařských výrobků ze špaldy vypěstované
konvenčně a v bio produkci ................................................................................................. 519
Švec I., Hrušková M., Karas J.: Mlynářská kvalita vybraných odrůd pšenice ze tří ročníků
sklizně ................................................................................................................................. 523
8
„Úroda 12/2011, vědecká příloha―
Úvodní slovo
Vědecká příloha časopisu Úroda 12/2011
V měsíci říjnu 2011 proběhla na Ministerstvu zemědělství ČR významná mezinárodní
akce pod hlavičkou EURAGRI, jejímţ hlavním cílem bylo diskutovat význam zemědělského
výzkumu pro budoucí vývoj a rozvoj zemědělství. Jedním z hlavních závěrů plenárních
zasedání i panelových diskuzí vedených odborníky z více neţ 20 evropských zemí, OECD,
DG AGRI a mnohých evropských ministerstev byl poţadavek na rychlý transfer výsledků
zemědělského aplikovaného výzkumu do praxe. Předkládaná vědecká příloha časopisu Úroda,
která je nedílnou součástí čísla 12/2011, je dle názoru editora jednou z velmi efektivních
moţností jak k transferu přispět. Více neţ 120 příspěvků zahrnuje výsledky mnohých
výzkumných projektů na široké disciplinární bázi. Vyuţití genetických zdrojů rostlin pro
šlechtění, nová legislativa EU pro osiva a sadbu, aktuální změny v koncepci rostlinolékařské
péče, moţnosti optimalizace pěstebních technologií polních plodin či aktuální pohled na
kvalitu rostlinných produktů jsou pouze některými tématy, které jsou ve vědecké příloze
uvedeny. Z výše uvedeného je patrné, ţe tématicky je vědecká příloha členěna na oblast
šlechtění, oblast rostlinolékařství a dále na oblasti technologie pěstování rostlin a kvalitu a
zpracování produktů. Editor spolu se všemi autory doufá, ţe mnohé příspěvky si najdou svoje
čtenáře a mnohé výsledky najdou uplatnění v praktických aplikacích ať uţ přímo v praxi nebo
prostřednictvím poradenských aktivit. Vzhledem k počtu příspěvků byla zvolena po dohodě
s vydavatelstvím profi Press, s.r.o. a redakcí časopisu Úroda distribuce v elektronické formě.
Všechny příspěvky byly recenzovány. Distribuce několika tisíc CD umoţňuje širokému
okruhu čtenářů udělat si obrázek o zaměření zemědělského aplikovaného výzkumu. Motorem
všech inovací musí být ale nutně zpětná vazba, všichni účastníci tvorby a zadávání
výzkumných zakázek by se měli podílet i na formulování základních výzkumných směrů.
Pokud jsou do výzkumu investovány veřejné zdroje, musí být i zpětná kontrola jejich alokace.
Doufám, ţe tato vědecká příloha k takovéto zpětné vazbě přispěje.
Jan Nedělník
9
„Úroda 12/2011, vědecká příloha―
10
„Úroda 12/2011, vědecká příloha―
VYUŢITÍ GENETICKÝCH ZDROJŦ ROSTLIN VE ŠLECHTĚNÍ
Utilization of plant genetic resources in breeding
Dotlačil L., Stehno Z., Faberová I.
Výzkumný ústav rostlinné výroby v.v.i., Praha
Abstrakt
Šlechtění se od počátku minulého století významně podílelo na zvyšování výnosů zemědělských
plodin a v posledních 3 desetiletích se stalo u mnoha plodin faktorem rozhodujícím. Vzhledem ke
skutečnosti, ţe nelze počítat s rozšiřováním zemědělské půdy ani zvyšováním vstupů minerálních
hnojiv, a pesticidů je šlechtění rostlin základním nástrojem pro zajištění potřeb rostoucí lidské
populace, při rychlém zvyšování spotřeby potravin na hlavu. Podmínkou úspěchu šlechtění je
uchování a studium genetických zdrojů rostlin jako nenahraditelného zdroje nové genetické diversity a
aplikace biotechnologických metod při studiu genofondů a v procesu šlechtění. Vedle výnosů a kvality
produkce je významným předpokladem setrvalého pokroku ve šlechtění zabezpečení širokého
genetického základu odrůd, pro zajištění jejich stability a adaptace k měnícím se podmínkám
prostředí.
Klíčová slova: výnosy plodin, šlechtitelský pokrok, genetické zdroje, genetická eroze
Abstract
Since the beginning of last century the breeding has a significant share on the yields´ increase of
agricultural crops and this effect of breeding became deciding in many crops in the last 3 decades.
With respect to the limits in area of agricultural land as well as in a further increase of inputs of
fertilizers and pesticides, the breeding remains the only fundamental tool to meet the future needs of
growing human population and increasing demands on food consumption per capita. Plant genetic
resources are an irreplaceable source of a new genetic diversity for breeding and their conservation,
study and effective utilization are necessary for a further crop improvement. The new diversity and
application of biotechnology are necessary preconditions to reach the breeding goals. Beside
improvement of yields and quality of products the maintenance of a broad genetic base of cultivars is
important for a sustainable progress in breeding and adaptation of cultivars to the changing
environment.
Key words: crop yields, progress in breeding, genetic resources, genetic erosion
Úvod
Vývoj zemědělství byl po tisíciletí spjat zejména s kultivací nových plodin, zatímco ke
zlepšování technologií pěstování a zejména produktivity plodin docházelo jen pozvolna a
intenzivní zemědělství je aţ produktem moderní doby (Hamilton, 2009). V Evropě se
významné změny v zemědělství realizovaly od středověku a souvisely zejména s opouštěním
úhorového hospodaření a zaváděním osevních postupů a pouţíváním pluhu. S těmito
změnami spojené pěstování leguminóz a zvýšení stavů skotu významně přispělo ke
zlepšování půdní úrodnosti a růstu výnosů. Podíl genetického zlepšování zemědělských
plodin je (spolu s uţíváním průmyslových hnojiv, pesticidů a dalších agrochemikálií)
posledním a zásadním krokem při zvyšování zemědělské produkce, její kvality a stability. Jak
uvádí Tilman (1996), světová produkce obilnin, kořenových a hlíznatých plodin se mezi léty
1961 a 1996 téměř zdvojnásobila, za cenu obrovských nárůstů vstupů (u N téměř
sedminásobně), zavlaţovaných ploch (1,7 x) a obhospodařované plochy (1,1 x ). Zachování
tohoto trendu není reálné s ohledem na přírodní prostředí, dostupnost neobnovitelných
zdrojů i ekonomiku. Potřeby potravin a obnovitelných surovin rychle rostoucí světové
populace a rostoucí osobní spotřeby v bohatnoucích zemích Asie a Jiţní Ameriky tedy jiţ
nemůţe zajistit zvyšování vstupů a rozšiřování zemědělské půdy (jejíţ plocha na hlavu
naopak mezi léty 1961 a 2009 klesla téměř o polovinu). Klíčem k řešení potřeb lidstva při
11
„Úroda 12/2011, vědecká příloha―
udrţení setrvalého rozvoje a ochraně ţivotního prostředí, vodních zdrojů a biodivrsity je
genetické zlepšování zemědělských plodin, zaloţené na vyuţívání biodiversity, nejnovějších
poznatků vědy a biotechnologiích. Od znovuobjevení mendelových zákonů a počátků
vědecky zaloţeného šlechtění uplynulo jedno století a šlechtění za tuto obdu dosáhlo
mimořádných úspěchů. Všechny šlechtitelské techniky jsou však závislé na dostupnosti a
vyuţití nové genetické diversity, nalézané ať jiţ v rámci druhu či přenesené z druhů jiných.
První revoluční pokrok ve šlechtění některých cizosprašných plodin (zejména u kukuřice a
čiroku) znamenal objev a vyuţití heteroze; např. šlechtěním hybridních odrůd se výnosy
kukuřice v USA v posledních 70 letech zvýšily pětinásobně (Hamilton, 2009). ―Zelená
revoluce― v šedesátých a sedmdesátých létech, vyuţívající nových genů pro zkrácení stébla
obilnin (zejména pšenice a rýţe), sníţení citlivosti k fotoperiodě a zlepšení rezistence ke
stresům znamenala u pšenice ve světovém měřítku trojnásobné výnosy. Od osmdesátých let
jsme potom svědky strmého rozvoje biotechnologií, zejména molekulární genetiky, a jejich
stále většího uplatnění ve šlechtění-zejména při poznávání a vyuţití genomu plodin ,
získávání a přenosu
nové genetické diversity z často velmi rozdílných organismů
(transgenoze) a při racionalizaci selekce s vyuţitím genetických markerů. Zavedení a
vyuţívání těchto metod je začátkem nové éry šlechtění, která nejen urychlí a zefektivní tvorbu
nových odrůd, ale umoţní dosáhnout i zcela nových šlechtitelských cílů. Pro plné uplatnění
přínosů nových odrůd a technologií a zajištění potřeb lidstva je ovšem potřebné i jejich
globální rozšíření a vyuţívání i v rozvojovém světě. Jak uvádí FAO (2011), v současné době
pokrývá produkce pouze 30 plodin 95% energetické potřeby lidstva, z toho čtyři plodiny
(rýţe, pšenice, kukuřice a brambory) pokrývají 60% této potřeby. Velmi úzký druhový základ
světové potravinové bezpečnosti vyţaduje uchování a efektivní vyuţívání obrovské
vnitrodruhové diversity těchto plodin, ale i širší vyuţívání diversity mezidruhové (opomíjené
plodiny, nové druhy plodin).
Materiál a Metody
Práce přináší stručný přehled o genetických zdrojů rostlin v ČR; vychází z analýzy
dostupných dat a relevantních informací které poskytla řešitelská pracoviště Národního
programu konzervace a vyuţití genetických zdrojů rostlin a agro-biodiversity. Data o
genetických zdrojích rostlin (GZ) ve světě lze nalézt zejména ve II. Zprávě FAO o stavu
světových genetických zdrojů rostlin (FAO, 2010) a v dalších citovaných pracích.
V opakovaných víceletých pokusech ve VÚRV Praha byly v létech 1998 aţ 2009 hodnoceny
dva soubory krajových a starých odrůd pšenice (121 kultivarů v souboru I. a 101 kultivarů v
souboru II.) spolu s moderními odrůdami jako kontrolami. Z těchto odrůd byly izolovány linie
s definovanými HMW-glu alelami a dale zkoušeny ve stejném pokusném designu. Během
vegetace byly zjišťovány agronomické znaky, v době zralosti bylo odebráno 30 stébel pro
analýzy produktivity klasu a zjištění sklizňového indexu. Byly rovněţ zjišťovány základní
znaky kvality zrna. Produktivita 31 vybraných krajových a starých odrůd byla následně
hodnocena v polních pokusech na šesti stanovištích; čtyři moderní odrůdy byly pouţity jako
kontroly. Byl hodnocen výnos zrna, jeho stabilita a odezva na podmínky pěstování. Pokusy
byly zakládány v Praze-Ruzyni a ve VÚRV Piešťany. Reakce odrůd na prostředí byla
zjišťována regresní analýzou podle Eberharda Russel, 1996). Analýza a identifikace HMWglu alel byla prováděna s vyuţitím SDS PAGE, podle Pyne a Lawrence (1983).
12
„Úroda 12/2011, vědecká příloha―
Výsledky a diskuze
Šlechtitelský pokrok
Aţ do šedesátých let minulého století byl nárůst světové produkce potravin spjat především
s rozšiřováním ploch orné půdy (Evans,1997)- potom se však tento proces vyčerpal a dnes
jsme svědky opačného trendu; další potřeby lidstva bude tedy nezbytné zajistit zvyšováním
výnosů plodin. Chloupek et al. (2004) analyzovali výnosová data publikovaná oficiálně v ČR
(1920-2000), zejména po roce 1960. Vysoké průměrné meziroční nárůsty výnosů uvádějí u
lnu (2,15%), kukuřice (1,61%) a pšenice (1,53%). Podobné průměrné meziroční nárůsty
výnosů u globálních dat (2,5 -2,6 %) u rýţe, pšenice a kukuřice uvádí Cassman (1999).
Uvedené nárůsty výnosů jsou však vedle inovace odrůd podmiňovány celým komplexem
vstupů. Pro získání objektivních dat je potřebné srovnání starých a nových odrůd ve stejných
podmínkách. Zásadní podíl šlechtění na zvyšování výnosů zemědělských plodin v Anglii
uvádí Mackay et al., 2011). Šlechtění se zde po II. Světové válce stalo rozhodujícím vstupem
při zvyšování výnosů a v období let 1982-2007 činil jeho přínos u obilnin a řepky 88%,
zbývající podíl připadl na agronomické inovace. Na druhé straně ve stejném období se u
kukuřice na siláţ a cukrovky podílely oba faktory na růstu výnosů s podobným efektem. Jak
uvádí Mac Key (1993) inovace odrůd ozimé pšenice ve Švédsku zvýšíla od počátku minulého
století do devadesátých let výnosy o 49%; u skandinávských odrůd jarní pšenice uvádí (Ortiz
et al., 1998) meziroční nárůsty výnosů 18,5 kg/ha/rok. V našich pokusech se starými a
moderními odrůdami jsme dospěli k podobným výsledkům; moderní odrůdy ozimé pšenice
překonávaly odrůdy z let 1910-1930 v průměru o 51% (Dotlačil et al., 2000). Výnosový
nárůst byl podmíněn zejména větším počtem zrn v klásku a zahuštěním porostů (coţ umoţnilo
zkrácení stébla)- tedy větším počtem zrn z plochy; hmotnost zrna se prakticky nezměnila.
Šlechtění na výnos vedlo u pšenice rovněţ k větší variabilitě výnosů moderních odrůd
v závislosti na prostředí. Tato variabilita ovšem souvisí i s lepší odezvou na příznivé
podmínky prostředí (―response‖) u moderních odrůd, jak ukazují i výsledky regresní analýzy
v garfu 1.
Graf 1: Průměrné výnosy 4 moderních a 31 starých odrůd ozimé pšenice v šesti prostředích
(3 roky x 2 stanoviště)- Dotlačil et al., 2008.
O poklesu stability výnosů moderních odrůd ozimé pšenice referuje např. Calderini and Slafer
(1999); u dat z posledních 30 let zaznamenal tento trend zejména v Evropě, zatímco rozdíly
v Austrálii a Argentině nejsou patrné. Zvýšení produktivity a dalších hospodářsky
významných znaků při zachování genetické diversity , výnosové stability a adaptace k
místním podmínkám je cílem tzv. „participačního šlechtění―, doporučovaného zejména pro
podmínky rozvojových zemí (Almekinders et al., 2001). Spolupráce šlechtitelů a farmářů by
měla vycházet z místních materiálů a vyuţívat selekce v regionálních podmínkách (místní
13
„Úroda 12/2011, vědecká příloha―
farmy). Také kvalita produkce byla šlechtěním výrazně ovlivněna; zpravidla se ji podařilo
nejen zlepšit, ale i diverzifikovat pro různé specifické způsoby zpracování a vyuţití.
Jednostranné šlechtění na výnos však mohlo mít i negativní důsledky. U pšenice dokládají
např. Cox et al. (1989) zhoršení mlynářské a pekařské kvality moderních odrůd, coţ
dokumentují na souboru 40 odrůd, které reprezentují vývoj šlechtění v USA za předchozích
70 let. Zaznamenali významný pokles obsahu proteinu; tento trend se však zlepšuje od
poloviny osmdesátých let. Jak ukazují výsledky našich pokusů v Tab. 1. u pšenice vedlo
šlechtění na výnos a zkrácení stébla k výraznému sníţení obsahu proteinu oproti krajovým
odrůdám. Postupně nabývalo na významu šlechtění na vysokou pekařskou jakost, té se však o
moderních odrůd dosahuje zejména zlepšenými technologickými vlastnostmi lepku. Mezi
krajovými a starými odrůdami a z nich vybranými liniemi jsou GZ s velmi vysokým obsahem
proteinu, který má i dobré technologické vlastnosti (např. kultivar EszterhaziMindenes, viz.
Tab. 1). Takové materiály mohou naléz vyuţítí v současném šlechtění pšenice na kvalitu.
Tab. 1: Hodnoty znaků u HMW –glu linií vybraných z krajových a starých odrůd ozimé
pšenice a dvou kontrolních odrůd (tříleté průměry).
Plant
Protein Zeleny GI
Cultivar
Line
height
HI
(%)
test
(%)
(cm)
Mindeszentpusztai 44/B
131
0,39
18,3
38,0
54,6
Szekacz 19
37/B
128
0,42
18,3
42,0
55,0
EszterhaziMindenes 117/C
125
0,38
18,3
54,0
55,8
Bartweizen
16/B
135
0,40
18,0
29,5
50,7
Bergland
18/B
134
0,46
17,8
25,5
36,8
Ostka Czerwona
111/C
136
0,41
17,8
32,0
53,2
Slovenska 2
63/A
134
0,46
17,6
28,5
37,3
Mos 4
105/A
132
0,40
17,5
40,5
41,2
Bartweizen
16/C
122
0,38
17,5
39,5
61,7
Ilona
Kontrola 85
0,52
13,7
40,0
67,8
Sarka
Kontrola 87
0,52
13,4
36,5
74,9
Genetické zdroje rostlin
Genetické zdroje (GZ) reprezentují existující vnitrodruhovou genetickou diversitu druhů
(plodin). Jako genetické zdroje rostlin je označován široký soubor biologických materiálů,
který zahrnuje šlechtěné a krajové odrůdy, šlechtitelské a experimentální linie a plané
příbuzné druhy; tyto materiály tvoří genofond druhu (plodiny). GZ mají pro lidstvo
mimořádnou hodnotu, ať jiţ jsou vyuţívány v tradičním zemědělství, tradičním či moderním
šlechtění nebo v genovém inţenýrství a v biotechnologiích obecně; jsou jedinečným a
nenahraditelným zdrojem genů pro další zlepšování biologického a hospodářského potenciálu
zemědělských plodin a zachování agrobiodiversity (FAO, 2010).
Nejširší genetickou diversitu lze nalézt u příbuzných planých druhů a primitivních forem
zemědělských plodin; jsou proto stále více vyuţívány pro získání nových genů (např.
rezistence) a rozšiřování genetického základu odrůd. Jejich význam stoupá s rostoucí
potřebou vyuţití nové genetické diversity ve šlechtění a s technologickým pokrokem, který
umoţňuje cílený přenos cenných genů , bez jiné neţádoucí genetické výbavy.
Další kategorii genetické diversity reprezentují krajové odrůdy, které zpravidla vznikaly
jednoduchým empirickým výběr pod dlouholetým působením specifických (regionálních)
půdních a klimatických podmínek a pěstebních technologií (Maxted et al., 2011).. Krajové
odrůdy jsou proto dobře adaptované k vyskytujícím se stresům a pěstitelským podmínkám,
14
„Úroda 12/2011, vědecká příloha―
jsou však i zdrojem některých cenných genů, které jiţ nejsou zastoupeny u šlechtěných odrůd
(např. v důsledku negativní vazby s výnosem, který je dlouhodobě hlavním šlechtitelským
kriteriem). Jejich význam pro šlechtění se proto zvyšuje (adaptace k prostředí a abiotickým
stresům, výnosová stabilita, specifická kvalita) a lze očekávat zájem zejména s rozvojem
genomiky a poznáním jejich genetické výbavy (ve světových genofondech je shromáţděno
7,4 mil. GZ, z toho krajové odrůdy reprezentují 44%).
Šlechtěné odrůdy a genetické linie reprezentují jiţ uţší genetickou diversitu, která odpovídá
šlechtitelskému výběru na několik nejvýznamnějších znaků a poţadavkům na uniformitu
moderních odrůd. Vzhledem k vysokému výnosovému potenciálu jsou zpravidla základními
výchozími materiály ve šlechtitelských programech, ale i donory specifických znaků.
V ČR má práce s GZ dlouhou tradici, sahající do počátku minulého století. Od roku 1993 je
péče o GZ rostlin garantována MZe ČR v rámci Národního programu konzervace a vyuţití
genofondu rostlin a agrobiodiverzity (NP), který vychází ze zákona č. 148/2003 Sb., a
uzavřených mezinárodních dohod o GZ ( Dotlačil et al., 2008). Na řešení NP se podílí 14
institucí (Tab. 2.), v jejich kolekcích je shromáţděno přes 51 tis. poloţek GZ, s převládajícím
podílem obilnin, zelenin, pícnin, luskovin a ovocných rostlin. Semeny mnoţené kolekce
představují 81,4% a vegetativně mnoţené druhy 18,6% GZ. VÚRV v.v.i. Praha zajišťuje
koordinaci NP, dále sluţby genové banky (GB) a informačního systému GZ EVIGEZ.
Tab. 2: Přehled pracovišť Národního programu a struktury kolekcí genetických zdrojů .
Počet poloţek
Počet vegetativně mnoţených
zařazených
poloţek - podrobně podle typu
v kolekci
konzervace
z toho
Polní GB
Účastník NP
mnoţených
in vitro Kryo
krátko GB v Banka
celkem
Dlou
ústavu (dupli
vegeta genera
dobá
ho
řešitele citně)
tivně
tivně
(1-2
dobá
roky)
VÚRV Praha-Ruzyně-GB
15832
15832
ZVÚ Kroměříţ
5 706
5 706
AGRITEC Šumperk
4990
4990
VÚB Havlíčkův Brod
2349
2349
2349
58
CHI Ţatec
343
343
343
75
21
VÚRV-prac.Olomouc
10152
928
9224 157
796
0
60
VŠÚO Holovousy
2 313 2 313
0 2 313
0
44
98
VÚKOZ Průhonice
1804
1550
254 779
771
213
VÚP Troubsko
2078
2078
OSEVA PRO-VST Zubří
2232
158
2074
OSEVA PRO-VÚO Opava
1414
1414
VÚRV- VSV Karlštejn
274
274
274
24
MZLU Lednice
1251
955
296 937
38
0
0
BU AV Průhonice
392
392
392
AMPELOS Znojmo
286
286
286
Celkem
51416
9548 41868 5481
1605
2705
237
České kolekce se kaţdoročně rozšiřovaly o 1-2 tis. nových GZ, z toho asi polovina vzorků je
získávána z domácích zdrojů. V IS EVIGEZ jsou u všech GZ evidována pasportní data
15
„Úroda 12/2011, vědecká příloha―
(celkem 51 127 záznamů), z toho podíl volně dostupných GZ je 75% a dostupných po dohodě
s řešitelem kolekce dalších 6%. V popisné části EVIGEZu jsou vloţeny informace o cca 35
tis. GZ (68% všech shromáţděných GZ). Značná pozornost je věnována hodnocení GZ (polní
pokusy, laboratorní testy) a jejich charakterizaci s vyuţitím genetických markerů, s cílem
zvýšit hodnotu GZ pro uţivatele. Počet hodnocených znaků je druhově rozdílný, v průměru
do třiceti znaků. V genové bance je uloţeno 40 tis. semeny mnoţených GZ (tj. 93% všech
generativně mnoţených GZ). Konzervace semen v GB jejich vysušením a uloţením při
teplotě -18oC. Vegetativně mnoţené druhy GZ jsou uchovávány v polních kolekcích
(genofondové sady, vinice, chmelnice), v in vitro kulturách (brambory, některé okrasné
rostliny); u vybraných druhů se začíná uplatňovat metoda kryokonzervace. Uţivatelům je
kaţdoročně bezplatně poskytováno 3-5 tis. GZ; vzorky GZ jsou poskytovány pro nekomerční
vyuţití bezplatně (šlechtění, výzkum, vzdělávání). Jak ukazuje Tab. 3., u GZ rozesílaných
genovou bankou v roce 2010 převládají uţivatelé z oblasti výzkumu, zatímco šlechtitelům
bylo zasláno jen 13,8% vzorků. Poměr GZ vyţádaných těmito uţivateli se v posledním
desetiletí výrazně mnění a lze očekávat, ţe zhodnocené genetické zdroje a vytvořené
šlechtitelské polotovary se budou často dostávat do šlechtění prostřednictvím výzkumu, popř.
společných výzkumných projektů. Tuto statistiku ovlivňuje i skutečnost, ţe získávání nových
odrůd (o které především má šlechtitel zájem) od zahraničních a mezinárodních
šlechtitelských firem je pro genové banky stále obtíţnější. Pro výběr vhodných GZ šlechtitel
stále více potřebuje podrobnou a spolehlivou informaci o jejich genetickém zaloţení a
znacích, aby mohl vybrané donory efektivně vyuţít ve šlechtitelských programech. K tomu je
potřeba rozšířit charakterizaci a hodnocení genetických zdrojů v genových bankách, zejména
ve spolupráci s výzkumem a při aktivní účasti šlechtitelů; tímto směrem se (v rámci
finančních limitů) orientuje i práce s genofondy v ČR.
Tab. 3: Účel vyuţití vzorků GZ zasílaných uţivatelům z Genové banky v roce 2010
Uţivatel
Počet vzorků Celkem %
Výzkumné ústavy
772
51,8
Regenerace, klíčivost 297
19,9
University
176
11,8
Šlechtitelské instituce 207
13,8
Expozice, skanzeny
39
2,7
Celkem
1491
100
Genetická eroze
Ztráta či zuţování genetické diversity (genetická eroze) je s různou intenzitou probíhajícím
procesem , který ohroţuje bezpečnou konzervaci GZ a adaptabilitu odrůd, a můţe mít
negativní důsledky pro další šlechtění. Genetická eroze se např. výrazně projevila
v minulosti při náhradě krajových odrůd moderními šlechtěnými odrůdami a později jako
následek jednostranně zaměřeného moderního šlechtění. Van Wouw et al. (2009) doporučují
definovat genetickou erozi jako redukci škály alel v pěstovaných odrůdách a genetických
zdrojích. Obecně lze usuzovat, ţe u běţně se vyskytující alel ztráta nehrozí- na rozdíl od řídce
se vyskytujících. Ztráta či zisk řídce se vyskytujících alel je v populacích jev běţný, má však
negativní důsledky v případě ztráty hospodářsky cenných alel. Často se vyskytující alely
jsou zřejmě cenné pro adaptaci odrůd a kladně korelují se zaměřením selekce. Krajové
odrůdy (s dlouhou historií adaptace) mohou být důleţitým zdrojem takových alel, ale i alel
vzácně se vyskytujících. Příkladem můţe být srovnání výskytu vzácných alel HMWgluteninů u souboru „core― kolekce ozimé pšenice se zastoupením pouze 19 % krajových
odrůd (Tab. 4.). Přes minoritní zastoupení krajových odrůd v souboru byla frekvence výskytu
16
„Úroda 12/2011, vědecká příloha―
vzácných HMW-glu alel srovnatelná či vyšší neţ u zbávajících 81% souboru (tedy cca 5 x
vyšší).
Tab. 4: Řídce se vyskytující HMW-Glu alely (soubor 31 krajových a 130 šlechtěných odrůd
ozimé pšenice)
HMW –glu
%
Kra Šlech
alely
výskytu jové
těné
1B-22
1
2
0
1B-20
2,5
3
1
1B-17+18
2,5
1
3
1D 3+10
0,5
0
1
1D 3+12
1
1
1
1D 4+12
2
1
2
Jak uvádějí van Wouw et al. (2009) jistou redukci genetické diverzity odrůd lze zaznamenat
v 60. letech, následně se ale diversita zvýšila (zřejmě s vyuţíváním vyuţíváním širší škály
GZ, včetně planých druhů). Genetická eroze byla dosud studována zejména na regionální
úrovni- globální stav ukáţe aţ budoucí analýza u jednotlivých plodin. Riziko genetické eroze
lze rovněţ očekávat u málo šlechtěných plodin, opomíjených a okrajových plodin.
Biotechnologie pro management genetických zdrojů a vyuţití ve šlechtění rostlin
Aplikace biotechnologických metod je základním nástrojem pro efektivní vyuţití genetických
zdrojů a pro další rychlý pokrok ve šlechtění. V obou případech biotechnologie doplňují a
zefektivňují konvenční metody. Při práci s genofondy jsou biotechnologie nezastupitelné při
charakterizaci genetických zdrojů, která umoţňuje jejich jednoznačnou identifikaci ,
prokázání přítomnosti hospodářsky významných genů a stanovení míry genetické diversity v
rámci kolekcí GZ , coţ je důleţité pro uţivatele. Pro tento účel se uplatňují zejména
genetické markery. Genetické markery jsou dědičné a identifikovatelné DNA sekvence
specificky lokalizované na chromozomu, které vykazují polymorfismus (Lidder a Sonino,
2011). Tyto markery nejsou ovlivňovány prostředím (na rozdíl např. od rovněţ uţívaných
morfologických znaků). DNA markery mohou být selekčně neutrální (vyuţitelné např. při
studiu populací) nebo jsou ve vazbě s funkčními geny, coţ umoţňuje jejich uplatnění při
genetických studiích a zejména při výběru donorů a asistované selekci. K dispozici je několik
systémů DNA markerů, zaloţených na polymorfismu délky restrikčních fragmentů DNA
(RFLP), náhodně amplifikované polymorfní DNA (RAPD) a polymorfismu DNA
mikrosatelitů (SSR) či jednotlivých nukleotidů (SNPs). Ţádný systém DNA markerů není
univerzálně vhodný pro všechny účely a pro praktické vyuţití je potřebné vyuţívat získaná
data spolu s jinými typy informací (např. fenotypovými znaky, popisnými daty), Peter et al.,
(2007). Zásadní význam pro výběr vhodných GZ a další pokrok ve šlechtění mají genomické
studie, které vedou k popisu genomu organismu na úrovni DNA. Výsledky sekvencování
genomu dále zhodnocují studie exprese a funkce genů, jako je transkriptomika, proteomika a
metabolomika; komplex těchto „omic― technologií se stává základním nástrojem pro řešení
efektivity práce s genofondy a další pokrok ve šlechtění (Allendorf et al., 2010). Pro zvládnutí
a vyuţití obrovského mnoţství dat produkovaných vysoce výkonnými ―omic‖ technologiemi
je zcela nezbytná bioinformatika, která se věnuje zpracování, analýze, integraci a interpretaci
získaných komplexních dat. K tomu vyuţívá výzkumu, vývoje a aplikací výpočetních a
statistických metod a postupů zpracování informací. Nástrojů bioinformatiky lze pouţít při
studiu a vyuţití markerů, predikcích výsledků sekvencování DNA a interpretaci výsledků
―omic‖ technologií obecně. Významným nástrojem pokroku a aplikací biotechnologií je řada
vzniklých a volně přístupných specializovaných mezinárodních databází. Pro rozvoj šlechtění
17
„Úroda 12/2011, vědecká příloha―
a dosaţení kvalitativně nových šlechtitelských cílů má zásadní význam uplatnění
transgenoze, která s vyuţitím postupů genetického inţenýrství umoţňuje přenos genů i ze
zcela nepříbuzných organismů. Tato metoda nejen urychlí šlechtitelský pokrok měřený
výnosy produkce a její kvalitou, ale umoţní i získání kvalitativně nových produktů a adaptaci
plodin k nepříznivým faktorům či pěstitelským systémům. Vyuţití genomiky a transgenoze
jsou a zřejmě i budou alternativními a doplňujícími se přístupy k inovaci šlechtění a jsou
jednou ze základních technologií pro zabezpečení potravin a obnovitelných surovin v
budoucnosti. Jejich přínose pro pěstování plodin se však bude realizovat zejména v kontextu
šlechtitelských postupů.
Závěr
Ve dvacátém století se šlechtění zemědělských plodin postupně stalo rozhodujícím faktorem
růstu výnosů a nástrojem zlepšování dalších hospodářsky významných znaků. Jeho význam a
efektivita rostou stále rychlejším tempem, mj. i v důsledku rychlého vývoje a aplikací
biotechnologií, existence ekonomických a environmentálních limitů pro vstupy minerálních
hnojiv, pesticidů a energií; je rovněţ nezbytné pro zajištění adaptace plodin ke klimatickým
změnám. Při konfrontaci moţností zemědělství a růstu potřeb lidstva je šlechtění rostlin
rozhodujícím nástrojem pro zajištění těchto potřeb bez negativních dopadů na ţivotní
prostředí. Základní podmínkou pro další pokrok ve šlechtění je však uchování a studium
světových genofondů rostlin , poznání vnitrodruhové i mezidruhové genetické diversity
plodin a výběr cenných genetických zdrojů pro efektivní šlechtitelské vyuţití. Je rovněţ
nezbytné zajistit volný přístup šlechtitelů a dalších uţivatelů ke genofondům, včetně sdílení
prospěchu z vyuţívání GZ, ve smyslu mezinárodních dohod o genetických zdrojích. K tomu
je nezbytná národní i mezinárodní podpora konzervace a hodnocení genofondů, geneticko šlechtitelského výzkumu , rozvoje biotechnologií a vlastního šlechtění, která by měla být
chápána jako strategická investice do zajištění potravinové bezpečnosti a obnovitelných
surovin.
Dedikace
V této práci jsou vyuţity výsledky výzkumu získané v průběhu řešení projektů NAZV MZe
ČR QH72251 a QH91184.
Pouţitá literatura
Allendorf, F.W., Hohenlohe, P.A., and Luikart, G. (2010) Genomics and the future of
conservation genetics. Nat. Rev. Genet. 11(10): 697-709.
Almekinders1, C.J.M. & Elings A., 2001: Collaboration of farmers and breeders:
Participatory crop improvement in perspective. Euphytica 122: 425–438, 2001.
Calderini, D.F., Slafer, G.A. 1999: Has yield stability changed with genetic improvement of
wheat yeld ? Euphytica 107: 51–59, 1999.
Cox T. S., Shogren M.D., Sears R.G., Martin T., J., Bolte L., C. 1989: Genetic Improvement
in Milling and Baking Quality. Cop Science 29: 626-631.
Dotlačil L., Hermuth J., Tisová V., Brindza J., Debre F., 2000: Yield Potential and Stability in
Selected Winter Wheat Landraces and Obsolete Cultivars of European Origin. Rostlinná
výroba, 46, (4), p. 153-158
Dotlačil L., Faberová I., Stehno Z. , 2008 , Plant genetic resources in the Czech Republic ,
Czech J. Genet. Plant Breed. 44(4): 129-139
Evans, L. T., 1997:Adapting and improving crops: the endless task. Phil. Trans. R. Soc.
Lond., 901-906.
18
„Úroda 12/2011, vědecká příloha―
Evenson, R. E., 2003: Modern Variety Production: a Synthesis, p. 427-447. In. Cop Variety
Impr. and its Effects on Productivity, FAO 2003, 521 pp. ISBN 0 85199 549 7
FAO, 1998: The state of the world‘s plant genetic resources for food and agriculture. FAO,
Rome, 510 pp.
Eberhard, S. A., Russel, W. A.1966: Stability parameters for comparising varieties. Crop
Science, No. 6., p. 36 - 40.
FAO 2010: The Second Report on the State of the World‘s Plant Genetic Resources for Food
and Agriculture. Rome. 370 pp, ISBN 978-92-5-106534-1
FAO, Commission on Genetic Resources for Food and Agriculture, 2011: Plant Genetic
Resources-Use them or Lose them. 2pp.
Hamilton, R. 2009: Agriculture´s Sustainable Future: Breeding Better Crops. Scientific
American, June 2009, 63-75.
Chloupek O., Hrstkova P., Schweigert P., 2004: Yield and its stability, crop diversity,
adaptability and response to climate change, weather and fertilisation over 75 years in the
Czech Republic in comparison to some European countries. Field Crops Research. 85: 2/3,
167-190.
Lidder P. , Sonnino A., 2011: Biotechnologies for the Management of Genetic Resources for
Food and Agriculture. FAO, Commission on Genetic Resources for Food and Agriculture,
2011: Background Study Paper No. 52, 153 pp.
Mac Key, J. 1993: Demonstration of genetic gain from Swedish cereal breeding. Sveriges
Utsadesforenings Tidskrift, 103, 1, p. 33 - 43.
Mackay I., Horwell A., Garner J., White J., McKee J. , Philpott H. (2011): Reanalyses of
the historical series of UK variety trials to quantify the contributions of genetic and
environmental factors to trends and variability in yield over time. Theor. Appl. Genet.
122:225–238
Maxted N, Kell S..and Brehm J. M., 2011: On –farm management and In situ conservation
of Plant Genetic Resources for Food and Agriculture. FAO, Commission on Genetic
Resources for Food and Agriculture. Background Study Paper No. 51, 31 pp.
Peter, C., Bruford, M., Perez, T., Dalamitra, S., Hewitt, G. Erhardt, G. and the ECONOGENE
Consortium (2007) Genetic diversity and subdivision of 57 European and Middle-Eastern
sheep breeds. Animal Genetics 38: 37-44.
Ortiz, R. Madsen, S. Andersen, S. B., 1998: Diversity in Nordic spring wheat cultivars (190193). Acta Agriculturae Scandinavica. Section B, Soil and Plant Science. 1998. 48: 4, 229238.
Pyne P.I., Lawrence G.J.: Catalogue of alleles for the complex gene loci, Glu-1, Glu-B1, GluD1, which code for high molecular weight subunits of Glutenins in hexaploid wheat.
Cereal Res. Commun., 1983, 11: p. 29–35.
Tilman, D. 1999: Global environmental impacts of agricultural expansion: The need for
sustainable and efficient pract. Proc Natl Acad Sci USA. 1999 May 25; 96(11): 5995-6000.
van Wouw M., Kik C., van Hintum T., van Treuren R., Visser B. 2009: Genetic erosion in
crops: concept, research results and challenges. Plant Genetic Resources: Characterization
and Utilization 8(1); 1–15. NIAB 2009, ISSN 1479-2621
Kontaktní adresa:
Ing. Ladislav Dotlačil, CSc.
Výzkumný ústav rostlinné výroby v.v.i., 161 06 Praha 6-Ruzyně, Drnovská 507
[email protected]
19
„Úroda 12/2011, vědecká příloha―
20
„Úroda 12/2011, vědecká příloha―
MEZIDRUHOVÍ HYBRIDI TRIFOLIUM PRATENSE X TRIFOLIUM
MEDIUM JAKO ZDROJ NOVÉ DIVERZITY
Interspecific hybrids Trifolium pratense x Trifolium medium as the source
of new diversity
Řepková J.1, Nedělník J.2, Jakešová H.3, Hampel D.4, Hofbauer J.2
1
Oddělení experimentální biologie, Masarykova univerzita Brno
2
Zemědělský výzkum, spol. s r.o. Troubsko
3
Ing.Hana Jakešová, CSc., šlechtění, Hladké Ţivotice
4
ÚKZÚZ, Brno
Abstrakt
Trifolium pratense je vysoce kvalitní pícnina dávající vysoké výnosy, ale má nízkou vytrvalost, coţ je
moţné překonat mezidruhovou hybridizací s druhy, které tvoří oddenky. Cílem práce bylo vyhodnotit
16 znaků u hybridních rostlin získaných z F1 generace po kříţení T. pratense a T. medium a srovnat je
se znaky rodičovských původů. Ve třech ročnících byly znaky hodnoceny u 500, 745 a 112 hybridů.
Téměř ve všech analyzovaných znacích byly zjištěny statisticky významné rozdíly mezi hybridy a T.
pratense. Počet lodyh na rostlinu byl významně vyšší u hybridů neţ u obou rodičů, coţ můţe mít
pozitní dopad na výnos. Ve druhém roce sklizně byly u některých hybridů pozorovány krátké
podzemní výběţky. Tento znak bude sledován z hlediska zvýšené vytrvalosti rostlin. U výsledných
genotypů se podařilo významně zvýšit variabilitu rostlin vyuţitelnou ve šlechtění.
Klíčová slova: morfologické znaky; oddenky; Trifolium pratense; Trifolium medium; vytrvalost
Abstract
Trifolium pratense is a high-yielding and high-quality fodder crop but shows a low persistency, which
may be overcome by hybridisation with species that produce rhizomes. The aim of this study was to
evaluate 16 characteristics in the hybrid plants derived from F 1 hybrids between T. pratense and T.
medium and in both of the parental genotypes. The characteristics were evaluated in 500, 745 and 112
hybrid plants in three years. There were significant differences between the hybrids and T. pratense in
nearly all of the analysed characteristics. The stem number per plant was significantly higher in the
hybrids compared to both parental species, which could have a positive impact on the yield. Short
rhizomes were observed in the hybrids after the harvest of the plants in the second harvest year. This
trait will be studied from the viewpoint of improved persistency. The variability useful in breeding
was significantly increased in resulting genotypes.
Keywords: morphological traits; persistence; rhizomes; Trifolium pratense; Trifolium medium
Úvod
Zlepšování uţitkových vlastností kulturních plodin naráţí na omezené a často časově náročné
moţnosti klasických metod šlechtění. Nové moţnosti nabízejí současné biotechnologické a
genomické postupy vycházející ze studia celých genomů rostlin a navazující na klíčové
projekty sekvenování genomů, expresní studie a identifikaci funkcí rostlinných genů. Z tohoto
hlediska je mezidruhová hybridizace s vyuţitím navazujících metod molekulární genetiky
perspektivní pro získání kvalitativně nového rostlinného materiálu odpovídajícího
poţadavkům šlechtění a praxe při vyuţití širokého genofondu planých druhů.
Víceleté pícniny včetně jetelů mají nezastupitelnou funkci na orné půdě i při krajinotvorbě. Je
všeobecně uznávána jejich vysoká předplodinová hodnota, příznivý vliv na obsah minerálního
dusíku v půdě, nízké nároky na přísun minerálních hnojiv a tím i na ekologičtější
zemědělskou výrobu. Víceleté pícniny mají své nezastupitelné místo i v moţnostech
nezemědělského vyuţití. Toto široké spektrum vyuţití vyţaduje široký genetický základ
výchozích genotypů vyuţitých pro šlechtění. V letech 1990 aţ 1997 byl ve VÚP Troubsko
21
„Úroda 12/2011, vědecká příloha―
získán originální rostlinný materiál mezidruhovou hybridizací Trifolium pratense (2n = 4x =
28) a T. medium (Řepková et al. 1991; Nedbálková et al. 1995) s předpokládanou kombinací
genů a znaků obou rodičovských druhů. V letech 2004 aţ 2008 byla získána populace rostlin
volným sprášením hybridů F2 s T. pratense cv. Amos po pět generací. Flowcytometrické
hodnocení rostlin umoţnilo identifikaci rostlin s odlišným obsahem DNA ve srovnání s
tetraploidním T. pratense. Koncentrace DNA se ve srovnání s referenčním vzorkem
pohybovala v rozmezí 30 aţ 44 chromozomů. Bylo získáno 442 rostlin s 30 chromozomy, 3
rostliny s 42 chromozomy a 3 rostliny s 44 chromozomy (Řepková et al. 2003). Cílem dalšího
výzkumu bylo srovnání morfologických a agronomických znaků obou rodičovských druhů a
potomstva odvozeného z hybridů F1. Pozornost byla také zaměřena na hodnocení znaků
souvisejících s vytrvalostí rostlin.
Materiál a metody
Hybridi T. pratense x T. medium generace F3 byly v kmenových školkách ponecháni volnému
sprášení s rostlinami tetraploidní odrůdy T. pratense cv. Amos po pět generací (1992–2004).
V roce 2005 byli hybridi a rodičovské rostliny pěstovány v kmenové školce Švancerovo
(Hladké Ţivotice), druhá školka (Válkovo, Hladké Ţivotice) byla zaloţena roku 2007 ze
semen nejlepších rostlin školky Švancerovo. Morfologické a agronomické znaky byly
hodnoceny v prvním roce sklizně - 2006 (Švancarovo) a 2008 (Válkovo), a ve druhém roce
sklizně - 2009 (Válkovo). Roku 2006 bylo hodnoceno 500 hybridů T. pratense x T. medium,
60 rostlin jetele lučního a 36 rostlin jetele prostředního. 2008 bylo hodnoceno 746 hybridů a
65 rostlin od kaţdého rodiče, 2009 bylo hodnoceno 112 hybridů a 65 rostlin od kaţdého
rodiče.
Celkem bylo hodnoceno 16 znaků jednak na zelených rostlinách 14 dní po plném kvetení a
pak po sklizni rostlin a vysušení (Tab. 1). Výskyt podzemních stonků byl hodnocen u T.
medium, T. pratense a hybridů 2007 ve druhém roce sklizně. Všechny získané hodnoty ve
třech letech byly analyzovány pomocí lineárního modelu se dvěma faktory (rok a genotyp) na
hladině významnosti 95%. Byl vyuţit software GenStat 13.
Výsledky a diskuze
Hodnocení znaků u hybridní populace ve třech ročnících (2006 aţ 2009) potvrdilo vysoce
statisticky průkazné rozdíly mezi hybridy a oběma rodiči v hmotnosti a délce lodyhy, délce a
šířce prostředního lístku, tloušťce stonku a průměrné listové ploše, dále v délce rostliny, počtu
lodyh na rostlinu, počtu hlávek na lodyhu, hmotnosti semen na hlávku a rostlinu (Tab. 1).
Statisticky významný rozdíl mezi hybridy a jedním rodičem T. pratense byl pozorován
v počtu internodií a sušinou na lodyhu. Téměř všechny znaky byly u hybridů intermediální,
počet lodyh na rostlinu byl statisticky významně vyšší u hybridů ve srovnání s oběma rodiči
(Tab. 1). U rostlin hybridní populace byly identifikovány krátké podzemní výběţky, které
nemá T. pratense. Jde o znak introdukovaný z T. medium (Obr. 1). Tento znak určuje nejen
charakter trsu (souvislost s počtem lodyh na rostlinu a počtem hlávek na rostlinu), ale je i
vhodným kritériem pro vyšší vytrvalost rostlin a vyšší výnosy zelené hmoty a semen. Díky
rozšířené variabilitě byl získán šlechtěním originální materiál pocházející z těchto hybridů,
který byl r. 2010 přihlášen do státních odrůdových zkoušek k udělení ochranných práv
k odrůdě.
Práce s geneticky i morfologicky variabilním materiálem je časově náročná na testování
jednotlivých rostlin. Pro aplikaci markery asistované selekce, která by výběry z velkých
populací rostlin usnadnila, je nejdůleţitějším poţadavkem vývoj vysycených genetických map
zaloţených na vysoce informativních DNA markerech. Genetické mapy jetele lučního s
různými typy DNA markerů a s různou úrovní vysycenosti jsou k dispozici a začínají být
22
„Úroda 12/2011, vědecká příloha―
vyuţívány k lokalizaci jednotlivých konkrétních genů kvalitativních i kvantitativních. Jsou tak
vytvořeny reálné předpoklady pro zavádění markery asistované selekce umoţňující
pyramidování genů kvalitativních znaků v nových šlechtitelských materiálech. Avšak
přenositelnost DNA markerů pro jiné genotypy komplikuje cizosprašnost jetele lučního, a
proto ideálním přístupem je vývoj DNA markerů přímo pro genotypy, se kterými se pracuje.
Dalším posunem při aplikaci molekulární genetiky ve šlechtění je konstrukce DNA čipů, které
umoţní mnohonásobnou analýzu testovaných vzorků prostřednictvím sond, které jsou
součástí čipu. Konstrukci takových čipů je moţné zaměřit na vyuţití při selekci rostlin s
kombinací několika uţitkových kvantitativních znaků.
Obr. 1: Kompaktní kořenový systém Trifolium pratense 4n (A) ve srovnání s kořenovým
systémem hybrida T. pratense x T. medium – mladá rostlina po vyklíčení (B), rostlina v
prvním (C) a druhém (D) roce. Šipky označují charakteristické větvení kořenů.
Závěr
Široké moţnosti při zlepšení uţitkových vlastností jetele lučního nabízejí současné metody
introdukce cizích genů prostřednictvím vzdálené hybridizace. Při tvorbě nových materiálů se
zlepšeným komplexem znaků a vlastností je důraz kladen na nové techniky s vyuţíváním
genomických nástrojů. Selekce rostlin na znaky jak kvalitativní tak kvantitativní za pomoci
DNA markerů nebo DNA čipů mění klasické představy o šlechtění a tvoří mnohem
efektivnější přístup při selekci určitých parametrů neţ tradiční metody. Významný efekt
těchto technologií můţe být dosaţen především u cizosprašných plodin, kde kaţdý cyklus
selekce trvá několik let a kde lze významně sníţit tento časový cyklus. Uvedený metodický
přístup je rozpracováván u rodu Trifolium.
Dedikace
Výzkum je součástí projektu QI111A019 Ministerstva zemědělství ČR a projektu
MSM0021622415 Ministerstva školství, mládţe a tělovýchovy ČR.
Pouţitá literatura
Nedbálková B., Řepková J., Bartošová L. (1995): Germplasm TBZP1, TBZP2, TBZP3,
TBZP4 of interspecific Trifolium hybrids. Scientific Studies Res. Inst. Fodder Plants 13:
129–131.
23
„Úroda 12/2011, vědecká příloha―
Řepková J., Nedbálková B., Holub J. (1991): Regeneration of plants from zygotic embryos
after interspecific hybridization within the genus Trifolium and electrophoretic evaluation
of hybrids. Scientific Studies Res. Inst. Fodder Plants 12: 7–14.
Řepková J., Jungmannová B., Jakešová H. (2003): Interspecific hybridisation prospects in the
genus Trifolium. Czech J. Genet. Plant Breed. 39 (Special Issue): 306–308.
Tab. 1: Výsledky hodnocení morfologických a agronomických znaků mezidruhových hybridů
Trifolium pratense x T. medium a jejich rodičů T. pratense 4n a T. medium.
Znak
Zelené rostliny
Hmotnost lodyhy (g)
Délka lodyhy (cm)
Počet internodií
Délka prostředního lístku1
(mm)
Šířka prostředního lístku1
(mm)
Poměr délka/šířka listu
Tloušťka lodyhy (mm)
Průměrná plocha listu (cm2)
Suché rostliny
Hmotnost rostliny (g)
Délka rostliny (cm)
Počet lodyh/rostlina
Počet hlávek/rostlina
Počet hlávek/lodyha
Hmotnost semen/hlávka (g)
Hmotnost semen/rostlina (g)
Sušina/lodyha (g)
Hybrid
T.pratense
T.medium
P
LSD
P
LSD
P
LSD
P
LSD
P
LSD
P
LSD
P
LSD
P
LSD
20.33
25.15*
1.704
73.93*
1.679
1.954*
0.06573
44.91*
1.306
28.01*
0.7963
1.637
0.04773
4.530*
0.2155
16.32*
0.6821
8.79*
1.631
32.02*
1.613
1.844
0.06674
32.86*
1.255
16.00*
0.765
2.153*
0.04586
2.449*
0.2071
8.06*
0.6529
P
LSD
P
LSD
P
LSD
P
LSD
P
LSD
P
LSD
P
LSD
P
LSD
179.6
183.7
6.59
66.35*
1.280
44.48*
2.253
247.6
10.74
5.733*
0.1822
0.03822*
0.001534
9.251*
0.4768
4.382*
0.1249
111.00*
13.20
30.42*
2.580
40.30*
4.511
86.9*
21.47
2.027*
0.3709
0.00623*
0.003122
0.295*
0.9549
2.751
0.2541
67.37
1.881
42.82
27.19
1.598
4.164
13.42
65.68
70.66
241
3.54
0.02879
7.025
2.644
trojlístku na 4. internodiu pod hlávkou; P Prediction – odhad průměrné hodnoty; LSD Least significant
differences of predictions (P = 0.05) – statisticky významná odchylka mezi hybridem a T. pratense, hybridem a
T. medium
* hladina významnosti pro P = 0.05
1
Kontaktní adresa:
Doc. RNDr. Jana Řepková, CSc., Kampus Bohunice, Kamenice 5, 625 00 Brno, Česká
republika, e-mail: [email protected]
24
„Úroda 12/2011, vědecká příloha―
ZMĚNY V KONCEPCI ROSTLINOLÉKAŘSKÉ PÉČE
Changes in policy of plant health care
Hnízdil M.
Ministerstvo zemědělství ČR
Abstrakt
Změny v přístupu k zajištění rostlinolékařské péče lze posuzovat v mezinárodním, evropském a
národním kontextu. Česká národní koncepce rostlinolékařská péče musí respektovat celosvětový a
evropský trend a její zaměření lze charakterizovat těmito principy: širším záběrem rostlinolékařské
péče, preferencí metod ochrany proti škodlivým organismům s co nejniţším rizikem pro necílové
organismy a prostředí, přesunem většího podílu odpovědnosti za fytosanitární bezpečnost rostlin
uváděných na trh ze strany státu na pěstitele a výrobce a návaznými změnami v kompetencích státních
orgánů odpovědných za rostlinolékařskou péči a snahou o stabilizaci a koordinaci rostlinolékařského
poradenství, zázemí a výzkumu, o větší osvětu a vyšší motivaci rostlinolékařského vzdělávání.
Přestoţe v současnosti neexistuje v ČR koncepce rostlinolékařské péče, výše uvedené principy by
měly být vzaty v úvahu při restrukturalizaci řízení institucí v rámci resortu ministerstva zemědělství
ČR.
Klíčová slova: rostlinolékařská péče, koncepce rostlinolékařské péče, udrţitelné pouţívání pesticidů,
národní akční plán, fytosanitární bezpečnost.
Abstract
Changes in approach to ensure of plant health care can be considered in international, European and
national context. The Czech national plant health policy should follow the international and the
European trend and its direction can be described by these key elements: broader scope of plant health
care, preference of plant protection methods with a minimal risk for non-targeted organisms and
environment, moving larger part of responsibilities for a phytosanitary security of marketed plants
from government to stakeholders and subsequent changes in responsibilities of plant health official
authorities and efforts to ensure consolidation and coordination of plant health advisory service,
technical background and research, greater publicity and motivating plant health education.
Despite no plant health strategy in the Czech Republic has been finalised till yet, the key abovementioned elements should be taken into account in the framework of the ongoing reorganization of
the authorities under the Czech Ministry of Agriculture.
Key words: plant health care, plant health strategy, sustainable usage of pesticides, national action
plan, phytosanitary security.
Co je rostlinolékařská péče
V současnosti se pravděpodobně nepodaří nalézt v některém českém (právně či jinak)
závazném dokumentu vysvětlení, co se pod pojmem rostlinolékařská péče přesně rozumí.
Zatímco ve starším jiţ neplatném zákoně č. 147/1996 Sb., o rostlinolékařské péči a změnách
některých souvisejících zákonů, je rostlinolékařská péče řádně i kdyţ trochu vágně
definována, v současných obecně platných právních rostlinolékařských předpisech nic
takového nenajdeme. Podobně není tento pojem vysvětlen či definován např. v encyklopedii
Wikipedia nebo v dokumentech České společnosti rostlinolékařské. Mezinárodní fytosanitární
terminologie vytvořená pod záštitou Mezinárodní úmluvy o ochraně rostlin (IPPC) přímo
tento pojem nepouţívá (Anonym: International Standards for Phytosanitary Measures, 2006).
V publikaci Česko-anglická rostlinolékařská terminologie (Kůdela, V., Braunová, M. a kol.,
2007) se pod pojmem „péče o zdraví rostlin (syn. rostlinolékařská péče)― uvádí, ţe jde o
soustavné úsilí o vytváření podmínek, které zajišťují zdraví rostlin a jeho uchování. Jsou zde
zahrnuty péče o půdní úrodnost, výţiva, genetika a šlechtění rostlin, pěstitelská opatření a
ochrana před škodlivými organismy rostlin i abiotickými vlivy. Tato definice vychází
25
„Úroda 12/2011, vědecká příloha―
z Mezinárodní organizace pro biologickou a integrovanou ochranu před škodlivými ţivočichy
a rostlinami (IOBC).
Pro účely tohoto příspěvku se pragmaticky přikloníme k definici uvedené v zákoně č.
147/1996 Sb., totiţ ţe rostlinolékařská péče je „souhrnem právních, technických,
organizačních a odborných opatření za účelem uchování zdraví rostlin―. Takto široce zaloţená
definice poskytuje větší „manévrovací moţnosti― při přípravě koncepce a strategie
rostlinolékařské péče.
Koncepce rostlinolékařské péče
Rostlinolékařská péče musí jako biologická vědní disciplína i jako soubor praktických
opatření permanentně reagovat na změny vyvolané přirozenými faktory jako jsou adaptační
změny v druhovém rozšíření a struktuře populací škodlivých organismů rostlin. Současně se
rychle mění technologie ochranných zásahů proti škodlivým organismům. V neposlední řadě
dochází kontinuálně ke změnám vyvolaným umělými faktory, zejména neustále se
globalizující mezinárodní obchod s rostlinami a s rostlinnými produkty.
Je proto logické, ţe přístupy, jak zajistit uchování zdraví rostlin, se průběţně mění jak na
mezinárodní (celosvětové) úrovni, regionální (evropské) úrovni (zejména jde o přístup
Evropských společenství), tak na národní (české) úrovni.
Změny v mezinárodním přístupu k zajištění rostlinolékařské péče
V celosvětovém rámci zastupuje rostlinolékařské zájmy z hlediska významu zřejmě nejvíce
Mezinárodní úmluva o ochraně rostlin (International Plant Protection Convention = IPPC),
která vznikla a působí pod záštitou FAO. Z koncepce IPPC totiţ vychází nejen struktura a
zásady regionálních organizací ochrany rostlin (pro Evropu Evropská a středozemní
organizace ochrany rostlin - European and Mediterranean Plant Protection Organization =
EPPO), ale zejména má IPPC dopady na utváření závazné národní legislativy svých
smluvních stran.
Přestoţe IPPC byla prvoplánovitě vytvořena s cílem pokrývat pouze oblast fytosanitární, lze
na aktuálně probíhajícím dění v IPPC dobře demonstrovat současné změny v chápání
mezinárodního významu rostlinolékařské péče. V roce 2011 byl formulován a schválen
Strategický rámec činnosti IPPC na období 2012 - 2019, podle něhoţ bude hlavním posláním
IPPC ochrana světových rostlinných zdrojů před škodlivými organismy rostlin. Mezi čtyřmi
hlavními cíli činnosti pak dominuje:
 zachování udrţitelného zemědělství a zvýšení celosvětové bezpečnosti potravin
zabráněním šíření škodlivých organismů;
 ochrana ţivotního prostředí, lesů a biologické rozmanitosti před škodlivými organismy.
Lze tak vysledovat snahu smluvních stran IPPC o mnohem širší záběr mezinárodně
koordinované rostlinolékařské péče, která by neměla zahrnovat jen aspekty čistě fytosanitární,
ale rovněţ i ochranu nezemědělských zájmových oblastí včetně ochrany ţivotního prostředí a
zdraví konzumentů potravin.
Změny v evropském přístupu k zajištění rostlinolékařské péče
V roce 2004 přistoupilo k IPPC rovněţ Evropské společenství rozhodnutím Rady č.
2004/597/ES, přičemţ předmět činnosti IPPC se tím stal záleţitostí jak Evropského
společenství jako takového (zastupovaného Evropskou komisí), tak jeho členských států. Je
tak logické, ţe přístup Evropské komise (dále „Komise―) k tvorbě unijní legislativy je tímto
stavem ovlivněn a unijní rostlinolékařská legislativa bude respektovat schválenou strategii
IPPC.
26
„Úroda 12/2011, vědecká příloha―
To se aktuálně projevilo při přípravě nové fytosanitární legislativy, jejíţ priority byly
schváleny Komisí v roce 2011 a nyní je připravován vlastní návrh textu nového právního
předpisu. Je vhodné si tyto priority připomenout podrobněji, neboť je zjevné, ţe budou také
mottem národní právní úpravy členských států, včetně ČR:
 posílení preventivních opatření před zavlékáním škodlivých organismů místo nařizování
následných opatření po jejich zavlečení a rozšíření,
 lepší koordinace mezi agendou rostlinolékařskou a agendami úzce souvisejícími
(karanténa rostlin, certifikace osiv a sadby, ochrana ţivotního prostředí před invazními
organismy apod.),
 účinnější ochrana vnější hranice Společenství před zavlékáním škůdců a původců chorob
rostlin zavedením citlivějších metod jejich detekce v zásilkách rostlin a lepší spoluprací
s celními úřady,
 větší odpovědnost pěstitelů a zpracovatelů rostlin za zajištění fytosanitární bezpečnosti
při uvádění jimi vypěstovaných rostlin a vyrobených rostlinných produktů na trh (např.
zaváděním podnikových preventivních opatření proti škodlivým organismům) a
odpovídající unijní finanční solidarita při řešení rostlinolékařských epidemií a kalamit.
Kromě výše popsaného trendu k posílení ochrany nezemědělských atributů před poškozením
škodlivými organismy rostlin se Komise výrazně angaţovala při přípravě tzv. „pesticidního―
právního balíčku, kterým byly harmonizovány podmínky pro uvádění přípravků na ochranu
rostlin (dále „POR―) na trh a jejich pouţívání v rozsahu, který minimalizuje neţádoucí účinky
POR na prostředí a necílové organismy včetně konzumentů potravin a krmiv. Vznik „balíčku―
je důsledkem realizace podobných národních strategií některých „starých― členských států EU
jako reakce na rostoucí poţadavky konzumentů na bezpečnost a nezávadnost potravin a na co
nejmenší narušování ţivotního prostředí, necílových organismů a zdraví lidí při pouţívání
POR.
Konkrétně se jedná o dvě nařízení a jednu rámcovou směrnici Evropského parlamentu a
Rady, které vstoupily či vstoupí v platnost do konce roku 2011. Zejména rámcová směrnice
2009/128/ES (dále „směrnice―) stanoví obecné zásady pro tzv. udrţitelné pouţívání pesticidů
s ohledem na minimalizaci jejich vedlejších neţádoucích účinků na zdraví lidí, zvířat a na
sloţky ţivotního prostředí a nejvíce tak ovlivní širší veřejnost. Všechna ustanovení těchto
unijních předpisů jsou přitom pro členské státy EU a potaţmo pro jejich zemědělce závazná.
Při přípravě praktického naplnění článků směrnice (implementaci) se jiţ nyní ukazuje, ţe
některá její ustanovení jsou natolik obecně formulována, ţe mohou vznikat jejich velmi
rozdílné výklady a tím také odlišný způsob jejich realizace v různých členských státech.
Komise také hodlá zahrnout některé prvky směrnice jako kontrolované oblasti při tzv.
kontrole podmíněnosti (cross-compliance) u evropských zemědělců. Tyto aspekty vyvolávají
proto ţivou diskuzi jak v rámci jednotlivých členských států tak také mezi státy a Komisí.
Změny v českém národním přístupu k zajištění rostlinolékařské péče
S odkazem na výše provedenou analýzu celosvětového a evropského přístupu
k rostlinolékařské péči lze konstatovat, ţe převládá úsilí rozšířit náplň rostlinolékařské péče
také mimo zemědělskou oblast a zároveň omezit rizika negativního působení POR. Tento
trend s sebou však z národního pohledu přináší jednak obavu zemědělců, ţe nebudou
dostatečně zajištěny podmínky pro konkurenceschopné pěstování plodin, jednak potřebu
přehodnotit kompetence i strukturu úřadů odpovědných v členských státech EU za zajištění
rostlinolékařské péče.
Stejně tomu je i v České republice, kde je ústředním orgánem rostlinolékařské péče a smluvní
stranou IPPC Ministerstvo zemědělství (dále „MZe―), a úřední organizací ochrany rostlin
podle IPPC a úřadem odpovědným za plnění fytosanitární legislativy EU Státní
27
„Úroda 12/2011, vědecká příloha―
rostlinolékařská správa (dále „SRS―). Rostlinolékařskou národní právní úpravu představuje
zejména zákon č. 326/2004 Sb., o rostlinolékařské péči a o změně některých souvisejících
zákonů, ve znění pozdějších předpisů (dále „zákon―), který je v současné době novelizován
právě v souvislosti s transpozicí unijního „pesticidního― právního balíčku.
Při formulaci národní strategie rostlinolékařské péče v ČR je třeba vycházet z následujících
principů, které na sebe navazují a ovlivňují se navzájem:
1) Širší záběr rostlinolékařské péče.
Rostlinolékařská péče zahrnuje nejen ochranu zemědělských plodin a vypěstovaných
rostlinných produktů slouţících k výrobě potravin, krmiv i průmyslových a technických
komodit (včetně dřeva) před škodlivými organismy, ale rovněţ ochranu za jiným účelem
cíleně vysazených (např. okrasných) i planě rostoucích rostlin před škodlivými organismy.
Smyslem rostlinolékařské péče je však také podpořit zachování biologické rozmanitosti
zejména cíleným vyuţíváním rutinních nástrojů k potlačování škodlivých organismů rostlin
také k omezování šíření invazních organismů, které samy nejsou rostlinám škodlivé.
Tyto úkoly vyţadují mnohem vyšší nároky na komplexnost rostlinolékařské národní strategie,
neţ tomu bylo v minulosti.
2) Pouţívání metod ochrany proti škodlivým organismům s co nejniţším rizikem pro
necílové organismy a prostředí.
Podmínkou pro povolení i pouţití reálných metod a prostředků ochrany před škodlivými
organismy rostlin musí být posouzení, zda jde za daných okolností o metody a prostředky s co
nejniţším rizikem vedlejších negativních účinků. Ekologické hledisko však nemůţe být
upřednostněno na úkor ekonomické únosnosti zvolených metod ochrany rostlin pro farmáře.
Kromě toho je nutno vyloučit rizika negativního vlivu metabolitů škodlivých organismů
(např. mykotoxinů) na zdraví konzumentů.
Řešením by tak mělo být zachování stávajících osvědčených postupů a poţadavků, které
rozumně omezují pouţívání POR s ohledem na jejich rizika. Strategie rostlinolékařské péče
proto musí obsahovat nástroje, které takový postup umoţňují resp. podporují.
3) Delegování většího podílu odpovědnosti za fytosanitární bezpečnost rostlin a
rostlinných produktů uváděných na trh ze strany státu na pěstitele a výrobce.
Koncepce rostlinolékařské strategie v ČR by měla respektovat odpovědnost producentů
rostlin a produktů z nich nejen za kvalitu, ale i za fytosanitární bezpečnost tohoto zboţí
uváděného na trh. Příslušné garance nepřítomnosti např. i karanténních škodlivých organismů
musí v prvé řadě zajistit ten, kdo příslušné rostliny na trhu nabízí. Státní orgány pak musí
zajistit vyváţený a odborný dozor (supervizi) v rozsahu, který odpovídá míře rizika výskytu
škodlivých organismů na úrovni regionu, ale i podniku.
Tento princip by se nevztahoval na dovozy rostlin ze třetích zemí, pokud nejsou známy
vnitřní systémy fytosanitárních záruk vyváţejících zemí. Obdobně nelze příliš měnit systémy
fytosanitární certifikace rostlin při vývozu do třetích zemí, neboť jsou stanoveny IPPC.
4) Úprava kompetencí státních orgánů odpovědných za rostlinolékařskou péči.
Rostlinolékařská koncepce se musí vyrovnat s poţadavkem na široký rozsah rostlinolékařské
péče (viz princip 1), a musí reagovat na unijní snahu o větší odpovědnost producentů za
zdravotní stav rostlin (viz princip 3). Je proto třeba analyzovat výhody většího propojení
souvisejících agend jako je karanténa rostlin, certifikace osiv a sadby, registrace rezistentních
odrůd, ochrana lesa apod. jak v rámci zemědělského resortu, tak ale i meziresortně (např.
ochrana před šířením invazních rostlin, zachování zdravého genofondu planě rostoucích
28
„Úroda 12/2011, vědecká příloha―
rostlin). Větší propojení lze pak realizovat buď soustředěním podobných či duplikujících se
kompetencí v jedné instituci nebo přímo organickým sloučením dvou či více institucí.
Ve vztahu k pěstitelům a výrobcům je pak třeba rozhodnout, v jakém rozsahu a hlavně za
jakých podmínek budou některé dosud státem plně poskytované záruky za zdravotní stav
rostlin převedeny na producenty (např. jde o systém rostlinolékařských pasů). Současně je
nutno přesně specifikovat, jaké rostlinolékařské (odborné) kompetence v takových
podmínkách zůstanou státním úřadům či jiným státním institucím a to alespoň v rozsahu,
který jim umoţní provádět (stále ještě) odbornou kontrolu resp. dozor.
Obecně lze doporučit - i dle zkušeností řady dalších členských států EU - aby veškeré
koncepční rozhodování a vystupování na úseku rostlinolékařské péče - včetně zahraničních
výstupů - bylo soustředěno na MZe. Ostatní státní úřady a instituce musí zastávat úlohu
dozorovou a výkonnou (jen v rámci odborných kompetencí, které státu zůstanou).
5) Stabilizace a koordinace odborného rostlinolékařského poradenství, zázemí a
rostlinolékařského výzkumu.
Jde o jeden z nejdůleţitějších a zároveň nesnadno realizovatelných principů nové
rostlinolékařské koncepce. Pokud dojde k přesunu odborného rozhodování v oblasti ochrany
rostlin ze státu více na komerční sféru (viz princip 3) a zavedení povinnosti pouţívat metody
ochrany rostlin s nízkým rizikem pro ţivotní prostředí a necílové organismy (viz princip 2),
lze očekávat větší poptávku pěstitelů po odborných informacích a terénním poradenství „on
the spot―.
Konkrétně půjde zejména o poradenství, jak v konkrétních polních podmínkách uspořit POR
jejich efektivnějším pouţitím nebo částečnou náhradou za (levnější) nechemické metody
ochrany rostlin, a tím dosáhnout i ekonomicky pozitivního efektu na straně nákladů při
pěstování plodin. Producenti rostlin musejí mít dále dostatečné odborné zázemí (monitoring
škodlivých /i karanténních/ organismů s podporou laboratorní diagnostiky na ţádost podniku).
V ČR existuje setrvalý nedostatek těchto odborných kapacit, které by byly jednak komerčně
dostupné zemědělcům a jednak dostatečně objektivní a schopné poskytovat klientům také
odpovídající záruky za své sluţby. Proto bude jistě obtíţné rozhodnout, kdo, za jakých
podmínek a případně s jakou podporou státu bude hrát roli „prostředníka― mezi státními úřady
a komerční zemědělskou sférou.
Nicméně nová rostlinolékařská koncepce bude muset tento problém vyřešit včetně zajištění
koordinace mezi podniky, poradci a sluţbami, státem, ale také rostlinolékařským výzkumem.
Nový systém by měl usnadnit rychlejší zavádění výsledků rostlinolékařského výzkumu do
praxe a podpořit pravidelné hodnocení praktického vyuţívání výsledků výzkumu v Česku.
Koordinace je zásadní také pro pruţnější výměnu odborných informací, společnou identifikaci
prioritních praktických problémů ochrany rostlin a fytosanitární bezpečnosti v ČR a
v neposlední řadě pro zlepšení rostlinolékařské osvěty veřejnosti (viz princip 6).
6) Větší rostlinolékařská osvěta a vyšší motivace rostlinolékařského vzdělávání.
Současná rostlinolékařská osvěta v ČR dosud nezajišťuje dostatečně zvyšování povědomí
odborné i laické veřejnosti o rostlinolékařské péči v ČR. Veřejnost můţe přitom velmi účinně
pomoci prosazovat řešení prioritních problémů rostlinolékařské péče, pokud je s nimi včas a
přístupnou formou seznámena a vezme je „za své―. Velkou výzvou je tak nejen moţnost více
oslovit veřejnost jako konzumenta potravin, ale také v souvislosti s očekávaným širším
záběrem rostlinolékařské péče více apelovat např. na její přínos pro ochranu ţivotního
prostředí.
Přestoţe v ČR existuje systém středoškolského a vysokoškolského vzdělávání
rostlinolékařských specialistů, v posledních letech se zdá, ţe se motivace potenciálních
studentů sniţuje. Objektivním důvodem mohou být dopady hospodářské krize a větší obtíţe
29
„Úroda 12/2011, vědecká příloha―
při hledání uplatnění takto úzce zaměřených expertů. Určitou nadějí by snad mohla být
stabilizace rostlinolékařsky specializovaných poradců v Česku (viz princip 5) a tlak na větší
samostatné odborné rozhodování na straně zemědělských producentů (viz princip 3).
Příprava národního akčního plánu v České republice
Členské státy EU jsou povinny do konce roku 2012 v souvislosti s implementací
„pesticidního― právního balíčku zpracovat národní akční plán (NAP), ve kterém popíší cíle,
kterých chtějí na národní úrovni v oblasti sníţení rizik pesticidů dosáhnout, harmonogram
jejich plnění a opatření, kterými má být cílů dosaţeno. V lednu 2011 byla proto v gesci MZe
vytvořena koordinační pracovní skupina pro přípravu NAP ze zástupců rezortů zemědělství,
zdravotnictví a ţivotního prostředí, ale také zástupců rostlinolékařského výzkumu, školství,
distributorů POR, SRS, zástupců zemědělců a některých nevládních organizací. Sloţení KPS
a zápisy ze všech jejích jednání lze nalézt na internetové stránce MZe:
http://portal.mze.cz/public/web/mze/zemedelstvi/udrzitelne-pouzivani-pesticidu.
Dosud byly formulovány dva hlavní cíle českého NAP:
 omezení rizik vycházejících z pouţívání POR, a to v oblastech zdraví lidí, ochrany
vod a ochrany ţivotního prostředí, a

sníţení závislosti zemědělské produkce na pouţívání POR při zachování jejího
rozsahu a kvality, a to zaváděním a podporou nechemických metod ochrany rostlin a
metod ochrany s nízkými vstupy POR.
Takto obecně stanovené hlavní cíle budou rozpracovány do dílčích jiţ konkrétních cílů včetně
potřebných nástrojů pro jejich plnění, termínů a hlavně měřitelných indikátorů plnění. NAP
tedy bude zahrnovat nejen legislativní nástroje (úpravy zákonů a vyhlášek), ale zejména
nelegislativní prostředky, které podpoří uplatňování co nejméně rizikových metod ochrany
rostlin a postupů nakládání s POR (např. osvěta, zaměření výzkumu a vzdělávání apod.).
Finální verzi NAP bude schvalovat vláda svým usnesením.
Závěr
Závěrem je nutno konstatovat, ţe v současné době neexistuje na centrální úrovni schválená
koncepce či strategie rostlinolékařské péče v ČR, která by reflektovala výše uváděné
(nadnárodní) trendy rostlinolékařské péče ani principy zaloţené na těchto trendech. Určitý
pokrok můţe představovat schválení národního akčního plánu k zajištění udrţitelného
pouţívání pesticidů v ČR.
MZe přitom jiţ představilo záměr provést modernizaci a restrukturalizaci řízení institucí v
rámci svého resortu včetně SRS, který vláda vzala na vědomí svým usnesením č. 488 ze dne
22.6.2011. Tato restrukturalizace je ţádoucí nejen z hlediska ekonomických úspor, ale měla
by respektovat také potřebu věcné změny koncepce české rostlinolékařské péče. Zástupci
všech dotčených zájmových skupin by proto měli na tyto záměry reagovat a vyjádřit se k nim.
Kontaktní adresa:
Ing. Michal Hnízdil
Ministerstvo zemědělství ČR, Těšnov 17, 117 05 Praha 1
[email protected]
30
„Úroda 12/2011, vědecká příloha―
JAKÁ JE VLASTNĚ ŠKODLIVOST DUSIVÉ PLÍSŇOVITOSTI TRAV
(EPICHLOË TYPHINA) V TRAVNÍM SEMENÁŘSTVÍ?
How is actually the harmfulness of choke (Epichloë typhina) in grasses
grown for seed?
Cagaš B.
OSEVA vývoj a výzkum s. r. o.
Abstrakt
Sledování tvorby stromat dusivé plísňovitiosti trav (Epichloë typhina) u dvaceti vorků srhy laločnaté
cv. Amera v polních podmínkách v letech 2009 – 2011 ukázalo, ţe pouze u 10 % došlo ke zvýšení
počtu napadených fertilních stébel a u 70 % ke sníţení ve srovnání s výchozím stavem. Napadená
fertilní stébla netvořila květenství, přenos onemocnění semeny nebyl prokázán.
Klíčová slova: Epichloë typhina; srha laločnatá; semena; přenos
Abstract
The monitoring of incidence of choke (Epichlë typhina) in twenty samples of orchardgrass cv. Amera
in field conditions in the years 2009 – 2011 shown: the increase of attacked tillers in 10 % of samples
and decrease of stroma incidence in 70 % of samples in comparison with the first year of observation.
The attacked fertile tillers were not able to create the inflorescence. The transmission of the disease
through the seeds was not confirmed.
Key words: Epichloë typhina; orchardgrass; seeds; transmission
Úvod
Dusivá plísňovitost trav se stává v posledních letech významným faktorem, který ovlivňuje
výnos i ekonomiku výroby semen u některých trav. Její výskyt byl sice zaznamenán
inspektory ÚKZÚZ v posledních pěti letech pouze na 0,5 – 3,8 % semenářských ploch, ale
podle Cagaše a Svobodové (2011) lze očekávat v následujících letech mírné zvýšení výskytu.
Původce onemocnění, endofytní houba E. typhina (Pers.:Fr.)Tul. znemoţňuje metání
fertilních stébel vytvářením válcovitého mycelia (stroma) zprvu bílé, později ţluté barvy, kde
dochází ke tvorbě askospor. Vývojový cyklus houby není příliš jasný - spóry vystřelené ze
stromatu se dostávají přes řezné plochy do těla hostitele, kde mycelium osidluje části rostliny
a v době sloupkování kolonizuje některé odnoţe. Mezi stromaty dochází v době zralosti
k výměně informací a po oplození, na kterém se podílejí i mimo hmyzu (Botanophilla spp.) i
plţi, vznikají pohlavní cestou askospóry. E. typhina napadá plané i kulturní trávy, z nichţ
nejvýznamnějšími hostiteli jsou srha laločnatá a bojínek luční, případně bojínek hlíznatý.
Ochrana vůči tomuto onemocnění (s ohledem na endofytní způsob ţivota) není známa.
Odrůdová náchylnost nebyla zjištěna (i kdyţ některé odrůdy vykazovaly v polních
podmínkách vysoký stupeň napadení), větší napadení bylo pozorováno u starších porostů
(Cagaš 2008). Semenářské i pícninářské vyuţití porostu s výskytem rostlin napadených
dusivou plísňovitostí je omezeno vyhláškami č. 384/2006 a 369/2009. Cílem příspěvku je
diskutovat proměnlivý výskyt dusivé plísňovitosti v jednotlivých letech, zjistit moţnost
přenosu patogena semeny a navrhnout zmírnění dopadu výše uvedených vyhlášek.
Materiál a metody
V roce 2009 (30. 6.) bylo odebráno ze silně napadeného porostu srhy laločnaté Amera ( 56
stromat ve 100 m2 porostu ve II. sklizňovém roce) na lokalitě Haňovice (okr. Olomouc)
dvacet vzorků (monolity rozměrů cca 25 cm x 25 cm zahrnující kořenovou i nadzemní část
včetně fertilních stébel), které byly zasazeny na polní stanoviště Výzkumné stanice
31
„Úroda 12/2011, vědecká příloha―
travinářské v Zubří. V letech 2009 – 2011 byla u jednotlivých trsů (vzorků) sledována tvorba
stromat dusivé plísňovitosti a vyhodnocen počet plodných stébel tvořících semena i počet
napadených odnoţí.
Výsledky a diskuse
Hodnocení výskytu dusivé plísňovitosti trav u dvaceti vzorků srhy laločnaté cv. Amera ve
třech uţitkových letech ukázalo na značné kolísání počtu fertilních stébel, u kterých se
objevila stromata této endofytní houby (Graf 1). U 70 % vzorků (trsy č. 2, 3, 5, 6, 7, 8, 10, 11,
12, 13, 15, 18, 19, 20) došlo ve srovnání s výchozím stavem v roce 2009 k poklesu výskytu
napadených fertilních stébel dusivou plísňovitostí. Úroveň napadení na stejné úrovni byla
pozorována u 20 % vzorků (trsy č. 1, 9, 14, 17) a pouze u 10 % vzorků (trsy č. 4 a 16) se
počet napadených fertilních stébel oproti výchozímu stavu zvýšil. Nebyla tedy pozorována
obecně citovaná tendence zvyšování napadení dusivou plísňovitostí se vzrůstajícím stářím
porostu (Cagaš 2008). Podle Wennströma (1996) lze kolísání výskytu vysvětlit působením
environmentálních faktorů, zejména rozdílné výţivy a půdní vlhkosti.
Rostlinné vzorky odebrané v Haňovicích a sledované v Zubří (které byly odebrány z jiţ
zapojené řádkové kultury ve 2. uţitkovém roce) představují shluk několika plně vyvinutých
rostlin, které obsahují jak odnoţe napadené (kontaminované endofytní houbou Epichloë
typhina), tak odnoţe zdravé. Je to typické nejen pro rod Epichloë, ale také Neotyphodium.
Navenek nelze před vznikem stromatu kontaminaci odnoţe nijak vizuelně zjistit. Odhad
výskytu dusivé plísňovitosti na začátku vegetace je tedy velmi spekulativní.
V průběhu tří let nebyla pozorována tvorba květenství a následně i vyvinutých semen u
fertilních stébel, které byly dusivou plísňovitostí napadeny (Tabulka 1). Nebyl tedy dokázán
přenos semeny. Pfender a Alderman (1997) konstatují, ţe choroba přenosná semeny není, i
kdyţ ve velmi malém mnoţství by to mohlo být moţné. Toto konstatování je velmi podstatné
pro uznávání semenářských porostů trav, u kterých byla dusivá plísňovitost zjištěna.
Poslední stanovisko k této záleţitosti je formulováno ve vyhlášce č. 369/2009 Sb., kde u
semenářských porostů trav v generaci SE (superelita) a elita (E)zůstává „hraniční― hodnotou 5
napadených rostlin ve 100 m2 porostu, u certifikovaného rozmnoţovacího materiálu (C) je
hraniční hodnotou 20 napadených rostlin ve výše uvedené ploše. Znamená to tedy, ţe porosty
s pěti , resp.dvaceti a více a více napadenými rostlinami nejsou uznány, osivo je neprodejné a
porost musí být zrušen. Obě vyhlášky (starší z r. 2006 i současná) hovoří o napadených
rostlinách. V řádkovém, dobře zapojeném porostu, jaké většinou trávosemenné porosty
bývají, je „identifikace― jednotlivých rostlin nemoţná, spíše by se mělo hovořit o stéblech či
odnoţích. S ohledem na malou pravděpodobnost přenosu dusivé plísňovitosti trav semeny a
zároveň vzniklou diskriminaci pěstitele v důsledku neuznání porostu a tím i osiva (které nelze
vyuţít jinak) by mělo dojít k revizi tohoto opatření.
Zrušení porostu, které nesplňuje normu danou vyhláškou vyplývá ze skutečnosti, ţe napadené
rostliny tvoří alkaloidy námelové povahy a zkrmování píce by mohlo způsobit dietetické
potíţe u přeţvýkavců. Pfender a Alderman (2008) však uvádějí velmi nízké hodnoty
ergovalinu a lolitremu B zjištěné v napadených rostlinách srhy laločnaté. Celá záleţitost však
vyţaduje další šetření.
Závěr
Dusivá plísňovitost trav je významným onemocněním některých druhů trav pěstovaných na
semeno a můţe způsobit značné hospodářské ztráty. Pfender a Alderman (2004) odhadují
ztráty na výnosu semen) způsobené dusivou plísňovitostí na porostech srhy laločnaté
v Oregonu v r. 2004 ve výši cca 9 milionů amerických dolarů.V posledních letech byl
zaznamenán zvýšený výskyt tohoto onemocnění u bojínku lučního a srhy laločnaté. Vyhláška,
32
„Úroda 12/2011, vědecká příloha―
která formuluje způsob nakládání s osivem z porostu s vyšším výskytem tohoto onemocnění
by však měla být upravena. Přenos dusivé plísňovitosti trav semeny je totiţ velmi
nepravděpodobný.
Dedikace
Výsledky byly získány v rámci řešení projektu „Intenzivní výroba travních semen v ČR―
podporovaného Sdruţením pěstitelů travních a jetelových semen.
Pouţitá literatura
Cagaš B. (2009): Bude dusivá plísňovitost ohroţovat v budoucnu naše semenářské porosty
trav ? Pícninářské listy 2008, 15: 13 – 14.
Cagaš B., Svobodová M. (2011): The main topics of resistence breeding in grasses in the
Czech Republic (EUCARPIA Proceedings, Dublin 2011, v tisku).
Pfender W. F. , Alderman S. C. (1997): Choke disease of orchardgrass in Oregon. In: W. C.
YOUNG III (Ed.) 1997 Seed Production Research at Oregon State University USDA-ARS
Cooperating:41 – 42.
Pfender W. F. , Alderman S. C. (1998): 1998 Geographical Distribution and Severity of
Orchardgrass Choke in the Willamette Valley. In: W. C. YOUNG III (Ed.) 1998 Seed
Production Research at Oregon State University USDA-ARS Cooperating:33 – 35.
Pfender W. F. , Alderman S. C. (2004): Prevalence of Orchardgrass Choke disease, 1998 –
2003, and Estimated Regional Yield Loss. In: W. C. YOUNG III (Ed.) 2004 Seed
Production Research at Oregon State University USDA-ARS Cooperating:16 – 17.
Wennström A. (1996):The distribution of Epichloë typhina in natural plant populations of the
host plant Calamagrostis purpurea. Ecography 19 (4): 377 – 381.
Tabulka 1: Výskyt napadení dusivou plísňovitostí trav u vzorků srhy laločnaté cv. Amera
v letech 2009 - 2011
Vorek Rok
č.
1
2
3
4
5
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
Celkem
10
8
92
9
10
86
17
7
52
8
16
133
12
Fertilní stébla
Napadená
Bez
napadení
3
2
32
3
10
86
6
6
52
3
16
40
1
Netvoří
semena
7
6
60
6
0
0
11
1
0
5
0
93
11
33
Tvoří semena
Napadená
fertilní stébla
(%)
0
0
0
0
0
0
0
0
0
0
0
0
0
70
75
65
67
0
0
64
14
0
63
0
70
92
„Úroda 12/2011, vědecká příloha―
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
2009
2010
2011
20
129
8
14
153
8
6
66
10
61
43
10
20
81
7
31
23
10
12
86
15
35
135
7
19
122
13
31
125
10
18
92
13
34
85
12
41
74
20
40
72
15
24
57
16
6
nehodnoceno
13
110
1
14
127
2
6
66
1
61
43
5
14
43
3
20
16
2
11
86
2
30
120
2
19
122
3
18
29
3
18
92
2
30
2
4
40
36
4
40
72
5
22
57
5
6
-
7
19
7
0
26
6
0
0
9
0
0
5
6
38
4
11
7
8
1
0
13
5
15
5
0
0
10
13
96
7
0
0
11
4
83
8
1
38
16
0
0
10
2
0
11
0
34
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
-
35
15
88
0
17
75
0
0
90
0
0
50
30
47
57
35
30
80
0,8
0
87
14
11
70
0
0
77
42
77
70
0
0
85
12
98
67
2,5
51
80
0
0
67
0.8
0
68
0
0
„Úroda 12/2011, vědecká příloha―
Graf 1: Kolísání výskytu dusivé plísňovitosti trav u vzorků srhy laločnaté Amera v letech
2009 - 2011
100
2009
2010
2011
90
Napadená fertilní stébla (%)
80
70
60
50
40
30
20
10
0
1
2
3
4
5
6
7
8
9
10
11
Vzorek č.
Kontaktní adresa:
doc. Ing. Bohumír Cagaš, CSc.
OSEVA vývoj a výzkum s.r.o.
Hamerská 698
756 54 Zubří
e-mail: [email protected]
35
12
13
14
15
16
17
18
19
20
„Úroda 12/2011, vědecká příloha―
36
„Úroda 12/2011, vědecká příloha―
ROVNOKŘÍDLÍ (ORTHOPTERA) NA EXPERIMENTÁLNÍ PLOŠE
U HODONÍNA – BIOINDIKACE A ROSTLINOLÉKAŘSKÝ VÝZNAM
Orthoptera at the experimental area near Hodonín – bioindication and
plant protection importance
Šefrová H. 1, Laštŧvka Z. 2
1
Ústav pěstování, šlechtění rostlin a rostlinolékařství AF MENDELU Brno
Ústav zoologie, rybářství, hydrobiologie a včelařství AF MENDELU Brno
2
Abstrakt
Na experimentální ploše nedaleko Hodonína bylo v letech 2008–2011 sledováno druhové sloţení a
změny početnosti rovnokřídlých (Orthoptera). K odchytu byly pouţity zemní pasti. Celkem bylo
odchyceno 3346 jedinců 11 druhů. Nejvyšší dominanci dosahovaly druhy Gryllus campestris (42 %),
Nemobius sylvestris (39 %) a Calliptamus italicus (14 %), ale hodnoty podobnosti (Jaccardův index)
mezi odběrovými plochami byly poměrně nízké (36, 56 a 63 %). Rovněţ hodnoty Shannon-Wienerova
indexu diversity a ekvitability byly nízké v důsledku výrazné dominance několika druhů, částečně
kvůli zvolené metodice odchytu (H´= 0,49; 0,73 a 0,92; E = 0,24; 0,41 a 0,47). Vysoká početnost
Calliptamus italicus ukazuje schopnost tohoto druhu dobře prospívat v extrémních teplotních a
vlhkostních podmínkách, coţ můţe při oteplování a aridizaci klimatu představovat mírné
rostlinolékařské riziko.
Klíčová slova: druhy, extrémní polní podmínky, Orthoptera, početnost
Abstract
Species composition and changes in abundance of Orthoptera were studied at the experimental area
near Hodonín (southern Moravia). The captures were realized by means of pitfall traps in 2008–2011.
Totally, 3346 specimens of 11 species were recorded. The most dominant species were: Gryllus
campestris (42%), Nemobius sylvestris (39%) and Calliptamus italicus (14%), but the values of
similarity (Jaccard index) between individual plots were relatively low (36, 56, 63%). The values of
Shannon-Wiener diversity index and equity were also low owing to the distinct dominance of several
species, partly to the capture method (H´= 0.49; 0.73; 0.92; E = 0.24; 0.41; 0.47). The high abundance
of Calliptamus italicus demonstrates the ability of this species to prosper in extreme warm and
drought which could be a moderate risk in plant protection with the climate warming and aridization.
Key words: abundance, extreme field conditions, Orthoptera, species
Úvod
V rámci modelového projektu zaměřeného na studium vlivů aridních podmínek na růst
vybraných druhů bylin a dřevin (blíţe viz např. Straková et al., 2009) byl hodnocen také
výskyt a početnost některých skupin bezobratlých. Rozhodující pozornost byla zaměřena na
důleţité skupiny epigeické fauny, ale pouţitá metodika odchytu (zemní pasti) umoţnila získat
materiál i dalších významných taxonů. Jedním z nich jsou rovnokřídlí (Orthoptera), kde
poměrně obsáhlý materiál dovolil jeho podrobnější vyhodnocení.
Rovnokřídlí, jako atraktivní i prakticky významná skupina hmyzu, jsou předmětem různě
zaměřených výzkumů od druhé poloviny 19. století (kompletní bibliografii uvádějí Kočárek et
al. 2005). Některé druhy, zvláště velkých sarančí působí značné škody zejména v teplejších
částech světa, údaje o škodlivém působení těchto druhů v Evropě a na našem území
v uplynulém tisíciletí shrnuje např. Obenberger (1926). Jednotlivé druhy rovnokřídlých mají
různě vyhraněné nároky na obývané prostředí (vlhkost, oslunění, struktura a výška porostu,
míra narušení) a jsou novodobě vyuţívány k biocenologické a typizační charakteristice
biotopů (např. Gavlas 2001, Holuša 1995, 2000), k hodnocení narušení prostředí a obecně
37
„Úroda 12/2011, vědecká příloha―
bioindikačním účelům (např. Fedor 2001, Holuša & Kočárek 2002), při zoogeografických a
faunistických analýzách (např. Chládek 1995, Holuša 1997) apod. V současnosti jsou druhy
některých biotopů sledovány ve vztahu ke změně klimatu a moţnému posunu areálů
některých z nich (např. Deván 1995, Krištín et al. 2009). Rovnokřídlí jsou také velmi
důleţitým článkem potravních řetězců.
Rozhodujícím cílem studia rovnokřídlých na ploše s extrémními teplotními a vlhkostními
podmínkami bylo vyhodnotit druhové sloţení, dominanci a další základní synekologické
charakteristiky přítomné taxocenózy a posoudit, které druhy mohou v těchto podmínkách
zdárně prospívat, jak se mění jejich početnost od zaloţení studijní plochy a zda některé z nich
mohou mít perspektivně rostlinolékařský význam.
Materiál a metody
Experimentální plocha se nachází na písčitých půdách severně od Hodonína (48° 52´ 40´´N,
17° 7´ 50´´E) v nadmořské výšce 200 m. Ze značné části je obklopena agrocenózami, dále
borovou monokulturou (Pinus sylvestris), navazující na smíšený les se zastoupením
autochtonních i nepůvodních dřevin, který je oddělen úzkým lemem s nelesní psamofilní
vegetací. K malé části obvodu přiléhá rozlohou nevelký porost vzrostlých vlhkomilných
dřevin (svaz Salicion albae, příp. Alnion glutinosae) (viz téţ Laštůvka et al. 2010).
V průběhu výzkumu byla věnována rozhodující pozornost výskytu vybraných skupin
epigeické fauny, proto byly k odchytu pouţity zemní pasti (viz např. Absolon et al., 1994),
konzervační tekutinou byl 4% formalín. Tato metoda není standardně vyuţívána k odchytu
rovnokřídlých (srv. Kočárek et al. 2005). Jedna linie pěti pastí byla umístěna přibliţně
uprostřed experimentální plochy, nejméně 50 m od sousedních trvalých biotopů (dále uváděná
jako plocha 3). Další dvě linie byly instalovány do okolních biotopů, do okraje porostu
vlhkomilných dřevin (plocha 1) a do xerotermofilního travinného lemu na okraji borové
monokultury (plocha 2). Pasti byly v roce 2008 instalovány počátkem července, v dalších
letech v průběhu dubna. Vybírány byly v termínech: 5.8., 25.8., 18.9.2008, 28.4., 19.5., 3.6.,
2.7., 31.7., 28.8., 30.9.2009, 11.5., 4.6., 29.6., 3.8., 6.9., 8.10.2010, 3.6. a 8.7.2011. Získaný
materiál byl převeden do 70% etanolu a následně obvyklým způsobem roztříděn a zpracován.
Determinace byla provedena podle Kočárka et al. (2005).
Ze synekologických charakteristik byla vyhodnocena druhová dominance, Jaccardův index
podobnosti, Shannon-Wienerův index diversity a hodnoty ekvitability (blíţe k výpočtům např.
Odum 1977).
Výsledky a diskuze
1. Celkové zhodnocení
Během tří vegetačních období bylo zaznamenáno 11 druhů rovnokřídlých v celkovém počtu
3346 jedinců (Tab. 1, 2). Nešlo o tři ucelené sezóny, protoţe odběry začaly v červenci 2008 a
skončily v červenci 2011. Do celkového hodnocení jsou zahrnuty údaje za celé období, ale
v grafu 1 není uveden rok 2011, protoţe většina druhů rovnokřídlých se vyvíjí od jara a
početněji jsou odchytávány aţ během léta a počátkem podzimu. Neúplná data z roku 2011 by
v grafu 1 zkreslila případné trendy ve vývoji početnosti. Druhové zastoupení a početnost na
jednotlivých plochách jsou zřejmé z tab. 1 a 2. Spektrum zjištěných druhů je výrazně
ovlivněno pouţitou metodikou odchytu, tj. omezeno na druhy pohybující se alespoň občas po
povrchu půdy. Výrazně dominantní (eudominantní aţ subdominantní ve smyslu Tischlera
1965) byli Gryllus campestris (42 %), Nemobius sylvestris (39 %), Calliptamus italicus (14
38
„Úroda 12/2011, vědecká příloha―
%) a Chorthippus brunneus (3,3 %) se zřetelnými rozdíly mezi plochami. Početnost druhů
Gryllus campestris, Calliptamus italicus a Chorthippus brunneus vykazovala na vlastní
experimentální ploše v průběhu výzkumu vzestupný trend, který by mohly potvrdit výsledky
za rok 2011. Zbývajících 7 druhů bylo zaznamenáno v méně neţ 1 % jedinců a všechny lze
zařadit do kategorie subrecedentních druhů (Tab. 1).
Tab. 1. Celkové počty jedinců a hodnoty dominance jednotlivých druhů za celou dobu
výzkumu; plocha 1 – porost vlhkomilných dřevin, plocha 2 – okraj borového lesa, plocha 3 –
vlastní studijní plocha
Taxon
Calliptamus
italicus
(Linnaeus, 1758)
Chorthippus
brunneus
(Thunberg, 1815)
Chorthippus
parallelus
(Zetterstedt, 1821)
Gryllus
campestris
Linnaeus, 1758
Metrioptera
roesellii
Hagen, 1822
Nemobius sylvestris
(Bosc, 1792)
Oecanthus
pellucens
(Scopoli, 1763)
Pholidoptera griseoaptera
(De Geer, 1773)
Platycleis
albopunctata
(Goeze, 1778)
Tetrix subulata
(Linnaeus, 1758)
Tetrix undulata
(Sowerby, 1806)
Σ
N
Plocha 1
D [%]
N
Plocha 2
D [%]
N
Plocha 3
D [%]
N
Σ
D [%]
2
0,3
17
1,8
456
27,0
475
14,2
2
0,3
13
1,4
96
5,7
111
3,3
-
-
-
-
3
0,2
3
0,1
67
9,2
261
28,1
1084
64,3
1412
42,2
-
-
-
-
1
0,06
1
0,03
639
87,5
618
66,5
44
2,6
1301
38,9
1
0,1
-
-
-
-
1
0,03
15
2,1
6
0,7
-
-
21
0,6
-
-
15
1,6
2
0,1
17
0,5
2
0,3
-
-
-
-
2
0,06
2
730
0,3
930
-
1686
-
2
3346
0,06
2. Výskyt druhŧ a faunistická podobnost ploch
Mezi dílčími plochami byly zaznamenány poměrně velké rozdíly, hodnota Jaccardova indexu
podobnosti byla nejniţší (36 %) mezi porostem vlhkomilných dřevin (plocha 1) a vlastní
experimentální plochou (plocha 3), nejpodobnější byly naopak plochy 2 a 3 (63 %). Mezi
plochami 1 a 2 byla 56% shoda. To je zcela v souladu s celkovým charakterem biotopů i
ekologickými nároky zjištěných druhů. Pouze 4 druhy byly společné (Calliptamus italicus,
Chorthippus brunneus, Gryllus campestris a Nemobius sylvestris), ale i v těchto případech
byly mezi plochami zřetelné rozdíly v početnosti. Rozdíly jsou dobře patrné z grafu 1. Sucho
a teplomilná saranče vlašská (Calliptamus italicus) výrazně dominovala na ploše 3, obdobně
jako ekologicky tolerantnější druhy, saranče Chorthippus brunneus a cvrček polní (Gryllus
campestris), obývající středně vlhká aţ suchá, teplejší otevřená stanoviště. Naopak cvrček
lesní (Nemobius sylvestris), vyţadující mírný zástin a ţijící ve světlých lesích a na jejich
okrajích, výrazně dominoval na plochách 1 a 2. Dva druhy byly zjištěny současně na dvou
plochách. Kobylka Pholidoptera griseoaptera byla odchycena na ploše 1 a 2, coţ je v souladu
s její vazbou na vyšší byliny, keře a okraje lesů, a její početnost je jistě pouţitou metodikou
odchytu podhodnocena. Naopak kobylka Platycleis albopunctata je sucho a teplomilná a
39
„Úroda 12/2011, vědecká příloha―
preferuje spíše otevřená stanoviště s niţší vegetací, která nachází na plochách 2 a 3.
Zbývajících 5 druhů bylo odchyceno pouze na jediné ploše. Oba druhy marší Tetrix subulata
a T. undulata obývají nejčastěji vlhčí místa, břehy kaluţí apod. a nález v porostu
vlhkomilných dřevin (plocha 1) odpovídá jejich nárokům. Odchyt ojedinělého jedince
cvrčivce révového (Oecanthus pellucens) do zemní pasti je patrně náhodný, druh se zdrţuje
na vyšších bylinách a keřích. Totéţ pravděpodobně platí pro široce rozšířené a poměrně
tolerantní druhy, saranči Chorthippus parallelus a kobylku Metrioptera roesellii.
Tab. 2. Počty jedinců odchycené v jednotlivých letech; vymezení ploch viz tab. 1 nebo
metodika
Taxon
Rok
Calliptamus
italicus
Chorthippus
brunneus
Chorthippus
parallelus
Gryllus
campestris
Metrioptera
roesellii
Nemobius
sylvestris
Oecanthus
pellucens
Pholidoptera
griseoaptera
Platycleis
albopunctata
Tetrix subulata
Tetrix undulata
Σ
Plocha 1
10
11
08
09
-
-
2
-
-
-
Plocha 2
10
11
08
09
-
8
1
5
2
-
-
10
-
-
-
-
24
-
43
-
-
-
0
12
265
1
Plocha 3
10
11
08
09
3
6
144
189
117
2
1
6
27
34
29
-
-
-
-
-
-
3
85
85
91
-
211
82
724
67
-
-
-
0
-
-
-
1
-
294
68
13
260
231
114
22
20
2
-
-
-
-
-
-
-
-
-
-
-
-
-
4
10
1
-
4
1
1
-
-
-
-
37
1
270
2
353
1
70
1
107
5
365
3
333
6
125
1
246
273
950
1
217
3. Index diverzity a ekvitabilita taxocenózy
Hodnota Shannon-Wienerova indexu diverzity je na všech plochách poměrně nízká (v pořadí
ploch H´= 0,49; 0,73; 0,92), stejně jako ekvitabilita (E = 0,24; 0,41; 0,47). Je to způsobeno
celkově nízkým počtem zjištěných druhů a výraznou dominancí několika z nich. Soustředění
dominance je poněkud niţší na ploše 2 a zvláště 3, proto se v pořadí ploch hodnoty indexu
diverzity i ekvitability zvyšují a nejvyšší jsou na vlastní experimentální ploše. Hodnoty těchto
charakteristik pro celé sledované území jsou H´= 1,2 a E = 0,5, ze stejných důvodů poměrně
nízké.
4. Prognózy pro ochranu rostlin
Z rostlinolékařského hlediska je významný velmi početný výskyt saranče vlašské
(Calliptamus italicus). Celkově byla v pořadí třetím nejpočetnějším druhem (14 %) a na
vlastní experimentální ploše dokonce druhým, s dominancí 27 %. Tato saranče patří do
skupiny gregarických druhů, které se mohou přemnoţovat a působit lokální škody. Škody
způsobené sarančí vlašskou byly v minulosti vícekrát zaznamenány i na našem území
40
„Úroda 12/2011, vědecká příloha―
(Obenberger 1926, Kočárek et al. 2005). Je moţné, ţe s růstem teploty a lokálním nedostatku
sráţek můţe význam tohoto druhu narůstat, ale při současném způsobu hospodaření a
moţnostech vcelku snadné regulace sarančí je riziko větších škod nízké.
Graf 1. Vývoj početnosti čtyř druhů s nejvyšší dominancí na jednotlivých plochách; plocha 1
– porost vlhkomilných dřevin, plocha 2 – okraj borového lesa, plocha 3 – vlastní
experimentální plocha
Závěr
Na výzkumné ploše nedaleko Hodonína na JV Moravě bylo při studiu epigeické fauny
(metoda zemních pastí) zjištěno také 11 druhů rovnokřídlých (Orthoptera). Mezi dílčími
plochami byly poměrně velké rozdíly v druhovém sloţení i početnosti jednotlivých druhů. Jen
čtyři druhy byly společné, ale i ty se zřetelně lišily početností. Výsledky dokládají dobré
indikační vlastnosti této skupiny hmyzu. Vysoká početnost saranče vlašské (Calliptamus
italicus) ukazuje na schopnost tohoto druhu dobře prospívat na velmi teplých a suchých
stanovištích. Při změně klimatu můţe růst rostlinolékařský význam tohoto druhu, ale při
současných metodách a moţnostech ochrany rostlin výraznější riziko nehrozí.
Dedikace
Příspěvek byl zpracován v rámci řešení projektů MŠMT ČR 2B08020 a výzkumného záměru
MSM6215648905.
Pouţitá literatura
Absolon K., Benda P., Chrudina Z., Klaudisová A., Martiško J., Pařil P. & Řičánek M., 1994:
Metodika sběru dat pro biomonitoring v chráněných územích. ČSOP, Praha, 70 s.
41
„Úroda 12/2011, vědecká příloha―
Deván P., 1995: Prienik teplomilných druhov do Bielych Karpát – prejav skleníkového
efektu? Chránené územia Slovenska, 26: 18.
Fedor P. J., 2001: Bioindikačný význam rovnokrídlého hmyzu (Ensifera et Caelifera) vo
vzťahu k zmenenej krajine v okolí Vodného diela Gabčíkovo. Folia Faunistica Slovaca, 6
(Suppl. 1): 5–91.
Gavlas V., 2001: Faunistic-ecological evaluation of bush crickets (Ensifera) and grasshopers
(Caelifera) of the Belianske Tatry Mts. Ekológia (Bratislava), 20 (Suppl. 4): 89–95.
Holuša J., 1995: Orthoptera náplavových štěrkovišť řeky Ostravice a Morávky. Klapalekiana,
31: 91–99.
Holuša J., 1997: Druhové spektrum sarančí (Caelifera) a kobylek (Ensifera) údolí potoka
Dinotice (Vsetínské vrchy). Klapalekiana, 33: 11–16.
Holuša J., 2000: K poznání sarančí (Caelifera) a kobylek (Ensifera) Moravskoslezských
Beskyd. Klapalekiana, 36: 41–70.
Holuša J. & Kočárek P., 2002: Významný bioindikační druh mokřadních luk: saranče
Stethophyma grossum. Ochrana Přírody, 57: 240–241.
Chládek F., 1995: Ensifera and Caelifera, s. 121–128. In: ROZKOŠNÝ R. & VAŇHARA J.
(eds), Terrestrial invertebrates of the Pálava Biosphere Reserve of UNESCO I. Folia Fac.
Sci. Natur. Univ. Masarykianae Brunensis, Biologia, 92: 1–206.
Kočárek P., Holuša J. & Vidlička Ľ., 2005: Blattaria, Mantodea, Orthoptera & Dermaptera
České a Slovenské republiky. Kabourek, Zlín, 349 s.
Krištín A., Kaňuch P. & Fabriciusová V., 2009: Piesky ako zrkadlo otepľovania? Čo na to
afromediteránne druhy Orthoptera? S. 111. In: BRYJA J., ŘEHÁK Z. & ZUKAL J. (eds),
Zoologické dny Brno 2009. Sborník abstraktů z konference 12.–13. února 2009, 255 s.
Laštůvka Z., Purchart L. & Šefrová H., 2010: Druhová diverzita střevlíkovitých (Carabidae)
v extrémních podmínkách na experimentální ploše u Hodonína. Úroda, vědecká příloha,
58 (12): 127–132.
Obenberger J., 1926: Rovnokřídlý hmyz (Orthoptera a Dermaptera) republiky
Československé. Česká akademie věd a umění, Praha, 234 s.
Odum E. P., 1977: Základy ekologie. Academia, Praha, 733 s.
Straková M., Salaš P., Kohut M., Pekař M., Ševčíková M. & Pelikán J., 2009: Modelový
projekt zamezení biologické degradace půd v podmínkách aridního klimatu, s. 4–9. In:
SALAŠ P. (ed.), Trávníky 2009. Sborník semináře, Hodonín, 15.–16.10.2009, 88 s.
Tischler W., 1965: Agrarökologie. Gustav Fischer Verlag, Jena, 499 s.
Kontaktní adresa:
Doc. Ing. Hana Šefrová, Ph.D.
Ústav pěstování, šlechtění rostlin a rostlinolékařství
AF MENDELU Brno
Zemědělská 1, 613 00 Brno
[email protected]
42
„Úroda 12/2011, vědecká příloha―
STANOVENÍ REZISTENCE KE STROBILURINOVÝM FUNGICIDŦM
U RAMULARIA COLLO-CYGNI
Assessment of Ramularia collo-cygni resistance to strobilurin fungicides
Matušinsky P.1, Leišová-Svobodová L.2, Tvarŧţek, L.1
1
Agrotest fyto, s.r.o., Kroměříţ
Výzkumný ústav rostlinné výroby, v.v.i., Praha 6 – Ruzyně
2
Abstrakt
Ramularia collo-cygni (RCC) napadá jarní i ozimý ječmen a způsobuje onemocnění s názvem
endofytická tmavohnědá skvrnitost ječmene. Strobiluriny vykazovaly v prvních letech po objevení se
ramuláriové skvrnitosti velmi dobrou účinnost, ovšem velmi brzy se u RCC vyvinula rezistence
k fungicidům z této skupiny. Cílem práce bylo detekovat strobilurin-rezistentní izoláty RCC pomocí
technik molekulární biologie.
Klíčová slova: endofytická tmavohnědá skvrnitost ječmene, skvrnitosti ječmene, QoI
Abstract
Ramularia collo-cygni (RCC) is a fungal pathogen infecting both spring and winter barley and causing
Ramularia leaf spot (RLS). Fungicides based on strobilurin initially provided one of the best chemical
solutions to manage the disease, but resistance in RCC to strobilurin developed quickly. The aim of
this work was to identify a resistant isolates of Ramularia collo-cygni, using molecular methods.
Key words: Ramularia leaf spot, barley diseases, QoI
Úvod
Ramularia collo-cygni (Cav.) Sutton & Waller (RCC) napadá jarní i ozimý ječmen.
Způsobuje onemocnění s názvem endofytická tmavohnědá skvrnitost ječmene projevující se
nekrotickými skvrnami na listech. Nekrotické skvrny se objevují v pozdějších růstových
fázích ječmene obvykle během mléčně voskové zralosti a později. Následkem poškození
asimilační plochy listů dochází ke sníţení výnosu a kvality zrna. Závaţnost choroby spočívá
ve velmi rychlém rozvoji skvrnitosti za účasti toxinů (rubelinů), které vznikají jako
sekundární metabolity ramularie.
Strobiluriny vykazovaly v prvních letech po objevení se ramuláriové skvrnitosti velmi dobrou
účinnost, ovšem velmi brzy se u RCC vyvinula rezistence k fungicidům z této skupiny.
U strobilurin-rezistetních izolátů RCC je přítomna bodová mutace mitochondriálního genu
cytochromu b v kodonu 143 vedoucí ke změně aminokyseliny glycinu (GGT) na alanin
(GCT) (Fountaine a Fraaije, 2009). Je to stejná mutace, která jiţ byla dříve popsána u
rezistentních populací patogenů např. Blumeria graminis a Mycosphaerella graminicola
(Sierotzki et al., 2000; Fraaije et al., 2005; Gisi et al., 2002).
Materiál a Metody
Sekvence standardní alely cytochromu b (strobilurin fungicide QoI-sensitive, G143)
(FN552765.1) a mutantní alely (strobilurin fungicide QoI-resistant, A143) (FN552766.1) byly
vybrány v databázi GenBank (http://www.ncbi.nlm.nih.gov). Na základě těchto sekvencí, byla
navrţena sada primerů a označena jako RCCcytobF/R (Matusinsky et al. 2010). Primery byly
navrţeny pomocí software Primer3Plus software (Untergasser et al. 2007)
(http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) a analyzovány pomocí
Net Primer software (http://www.premierbiosoft.com).
43
„Úroda 12/2011, vědecká příloha―
Nejprve je nutno pomocí standardní PCR (polymerázová řetězová reakce) amplifikovat část
cytochromu b a poté specifickou restrikční endonukleázou tento úsek štěpit. PCR se provádí v
reakčním objemu 20 μl obsahujícím 0.2 mM kaţdého nukleotidu dNTP, 0.2 μM obou primerů
(RCCcytobFGGATGATTAATACGTTACTTACACTC
a
RCCcytobRGTTACCTGATCCTGCGCTGT), 1 U Taq polymerázy, 2.5 mM MgCl2, 1 x PCR pufr a 10
ng DNA izolované z mycelia monosporického izolátu RCC. Reakční podmínky: úvodní
jednorázová denaturace při 94 °C po dobu 5 min., dále 35 cyklů: denaturace při 94 °C po
dobu 1 min., annealing při 55 °C po dobu 45 sec. a syntéza při 72 °C po dobu 2 min;
závěrečná inkubace při 72 °C po dobu 5 min. Poté je 5 μl roztoku výsledného PCR produktu
inkubováno spolu s 1 U restrikční endonukleázy AluI (Fermentas, Lithuania; sequence:
AG^CT) (Fountaine a Fraaije, 2009) a 1x příslušným pufrem Tango (Fermentas) v celkovém
objemu 20 μl po dobu 16 hodin při teplotě 37 °C. Výsledné fragmenty restrikční analýzy jsou
separovány metodou horizontální elektroforézy v 1.7 % agarózovém gelu.
Výsledky a diskuze
Po PCR s primery RCCcytobF/R získáme amplikon o velikosti 406 bp. Tento amplikon je po
inkubaci s restrikční endonukleázou AluI u strobilurin-senzitivních izolátů RCC rozštěpen na
3 fragmenty (249, 102 a 55 bp), zatímco u strobilurin-rezistentních izolátů je rozštěpen
na 4 fragmenty (144, 105, 102 a 55 bp). Na obrázku 1 je zobrazen pro názornost
polyakrylamidový gel, ale separaci je moţno provádět na agarozovém gelu s tím, ţe fragment
DNA o velikosti 249 bp je přítomen pouze u senzitivních izolátů a u rezistentních je rozštěpen
na dva fragmenty o velikosti 144 bp a 105 bp, přičemţ fragmenty 102 and 105 bp se na
agarózovém gelu překrývají. Pro ověření správnosti výsledků je moţno provést kultivační test
s odstupňovanými koncentracemi azoxystrobinu (Obr. 2).
Obr. 1 Polyakrylamidový gel po
separaci
fragmentů
DNA
získaných po PCR s primery
RCCcytobF/R
a
následným
štěpením
restrikční
endonukleázou AluI. M1-Ultra
Low Range DNA Ladder, Rrezistentní izoláty RCC, Ssenzitivní izoláty RCC
Obr. 2 Růst mycelia u rezistentního a
senzitivního
izolátu
RCC
na
PDA
(bramborovo-dextrozový agar) za přítomnosti
odstupňované koncentrace azoxystrobinu (ve
sloupcích).
44
„Úroda 12/2011, vědecká příloha―
Závěr
Pomocí primerů RCCcytobF/R lze amplifikovat část cytochromu b RCC, který po následném
rozštěpení specifickou restrikční endonukleázou indikuje standardní (G143) či mutantní (A143)
alelu. Tato metoda umoţňuje rozlišit senzitivní a rezistentní izoláty RCC ke strobilurinovým
fungicidům.
Dedikace
Tento výzkum byl podpořen finančními prostředky projektu NAZV č. QH91054.
Pouţitá literatura
Fountaine J & Fraaije BA, 2009. Development of QoI resistant alleles in populations of
Ramularia collo-cygni. In: Oxley S, Brown J, Foster V V & Havis N (Eds.) 2009: The
Second European Ramularia Workshop. 7–8 April, 2009, Edinburgh, Scotland. Aspect
Appl Biol 92, 123-126.
Fraaije BA, Cools HJ, Fountaine J, Lovell DJ, Motteram J, West JS & Lucas JA, 2005. Role
of ascospores in further spread of QoI-resistant cytochrome b alleles (G143A) in field
populations of Mycosphaerella graminicola. Phytopathology 95, 933-941.
Gisi U, Sierotzki H, Cook A, McCaffery A, 2002. Mechanisms influencing the evolution of
resistance to Qo inhibitor fungicides. Pest Manag Sci 58, 859-862.
Matusinsky P, Leisova-Svobodová L, Marik P, Tvaruzek L, Stemberkova L, Hanusova M,
Minarikova V, Vysohlidova M, Spitzer T, 2010. Frequency of a mutant allele
of cytochrome b conferring resistance to QoI fungicides in the Czech population
of Ramularia collo-cygni. Journal of Plant Diseases and Protection, 117, 248–252.
Sierotzki H, Wullschleger J & Gisi U, 2000a. Point-mutation in cytochrome b gene conferring
resistance to strobilurin fungicides in Erysiphe graminis f.sp. tritici field isolates. Pestic.
Biochem. Phys. 68, 107-112.
Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R & Leunissen JAM, 2007.
Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 35, 71-74.
Kontaktní adresa:
Mgr. Pavel Matušinsky, Ph.D.
Agrotest fyto, s.r.o.
Havlíčkova 2787
Kroměříţ 767 01
[email protected]
45
„Úroda 12/2011, vědecká příloha―
46
„Úroda 12/2011, vědecká příloha―
VÝSKYT A ŠKODLIVOST BÁZLIVCE KUKUŘIČNÉHO (DIABROTICA
VIRGIFERA VIRGIFERA) NA VYBRANÝCH LOKALITÁCH
JIŢNÍ MORAVY
Occurrence and harmfullness of corn rootworm (Diabrotica virgifera
virgifera) in selected localities of south Moravia
Kolařík P., Rotrekl J.
Zemědělský výzkum, spol. s r.o. Troubsko
Abstrakt
V letech 2009 aţ 2011 jsme na vybraných lokalitách jiţní Moravy sledovali pomocí feromonových
lapáků dospělce bázlivce kukuřičného. Z výsledků je patrné, ţe početnost tohoto škůdce se na všech
lokalitách neustále zvyšuje. V roce 2010 jsme poprvé zaznamenali první příznaky poškození palic
kukuřice ţírem dospělců. V následném roce pozorování jsme na jedné lokalitě zaznamenali i škody
způsobené ţírem larev na kořenech kukuřice s následným poléháním a hynutím poškozených rostlin.
Klíčová slova: ochrana;hmyzí škůdci;kukuřice; bázlivec kukuřičný;
Abstract
The occurrence of corn rootworm (investigated by pheromone traps) in maize fields of South Moravia
was evaluated in years 2009 - 2011. The results shown that the abundance of this pest in all location is
increasing. In year 2010 we first noticed the damage by the adults of corn rootworm on cobs. In 2011
we first noticed in one location the damage caused by the larvae of corn rootworm with subsequence
lodging and during daying plants.
Keyword: plant protection, insect pests; maize; corn rootworm
Úvod
V České republice patří kukuřice setá (Zea mays) k nejpěstovanějším polním plodinám.
Mohlo by se zdát, ţe vlivem dramatického sniţování stavu hospodářských zvířat budou
plochy stagnovat či rapidně klesat, ale není tomu tak. Vyuţití kukuřice se přesunulo od tvorby
siláţí k jinému vyuţití a to především v důsledku velkého rozvoje a výstavby bioplynových
stanic. S velkým rozšířením pěstování souvisí zvýšený výskyt škodlivých organismů u této
plodiny, v tomto případě především hmyzích škůdců. Na území České republiky byl v minulé
století zaznamenáván pouze jediný významný škůdce a to zavíječ kukuřičný (Ostrinia
nubilalis L.). V posledním desetiletí byl zaznamenán zcela nově se vyskytující hmyzí škůdce
– bázlivec kukuřičný (Diabrotica virgifera virgifera LeConte).
Původním areálem rozšíření tohoto škůdce je v severní Americe, kde společně se zavíječem
kukuřičným způsobuje velmi významné škody. V České republice byl poprvé zaznamenán v
roce 2002, kdy došlo k přirozenému šíření z oblastí Slovenska. Od tohoto roku se postupně
šíří na našem území a dnes se jiţ pravidelně vyskytuje na celém území Moravy a lokálně na
některých místech v Čechách.
Bázlivec kukuřičný je ţlutě zbarvený brouk s černými krovkami velký asi 4 – 7 mm. Samičky
lze od samečků velmi dobře rozeznat podle kratších tykadel a tří podélných pruhů na
krovkách. Kresba na krovkách samečků je téměř slitá v jeden celek. Hlavním rozlišovacím
znakem je však sklerotizovaný útvar na zadečku, který je u samečků menší a zaoblenější,
zatímco u samiček je uţší a delší, vyčnívající z pod krovek (Kolařík, Rotrekl 2011).
Hospodářské škody způsobují jak larvy (obr. 1), tak i dospělci (obr. 2).
47
„Úroda 12/2011, vědecká příloha―
Obr. 1. Larvy bázlivce u kořenů kukuřice Obr.2. Dospělci bázlivce při ţíru v palici kukuřice
Bázlivec kukuřičný přezimuje v půdě jako vajíčko, v jarním období se z něj líhnout larvičky,
které migrují ke kořenům rostlin kukuřice. Larvy na vyvíjejících se kořenech rostliny
způsobují poţerky, při silném napadení dochází k destrukci celého kořenového systému
rostliny, coţ má za následek vyvrácení rostliny či přímo jejich úhynu. Dospělci se ţiví
bliznami a pylem, v pozdějších vývojových fázích můţe dojít i k napadení palic (mohou
způsobit nepravidelnou hluchost klasu) a listů kukuřice ((Meinke et al. 1998). Ochrana
kukuřice proti bázlivci se provádí především proti jeho larvám. Spočívá v pozdějším termínu
setí, mořením osiva, rotací plodiny v osevním postupu, aplikaci půdních granulovaných
přípravků a kapalných insekticidů pro postřik. Účinnost insekticidních mořidel nebývá
dostatečná z důvodu opoţděného a rozvleklého líhnutí larev po vysetí osiva. Přípravky na
bázi půdních insekticidů mívají vyšší účinnost neţ mořidla, je zde ale velmi vysoké riziko pro
ţivotní prostředí. Ochrana proti dospělcům není příliš častá a provádí se pouze u kukuřice
pěstované na zrno, osivo či u cukrové kukuřice, kdyţ při vizuálním hodnocení v době před
květem a v období kvetení zjistíme 3 – 6 dospělců na klas u kukuřice pěstované na osivo nebo
9 a více dospělců u kukuřice na zrno. V monokulturách kukuřice je nutné regulovat početnost
brouků jedním či dvěma postřiky při dosaţení prahu 35 a více brouků na 1 lapák za 14 dní
(Anonymus 2008). V České republice jsou registrovány přípravky jak proti dospělcům, tak i
proti larvám. Jedná se o Karate se Zeon technologií 5 CS (úč.l. lambda-cyhalothrin) v dávce
0,4 l/ha, Decis Mega (úč.l. deltamethrin) v dávce 0,2 – 0,25 l/ha a přípravek Biscaya 240 OD
(úč.l. thiacloprid) v dávce 0,3 l/ha. Proti larvám je registrováno mořidlo Cruiser 350 FS (úč.l.
thiamethoxam) v dávce 9,0 l/t + 4 l/t vody a nově také granulovaný půdní insekticid Force 1,5
G (úč.l. tefluthrin) 93,3 g/100 m řádku.
Materiál a metoda
Pro monitoring bázlivce kukuřičného jsme pouţili feromonové lapače typu Csalomon PAL
(Ústav ochrany rostlin, Maďarská akademie věd). K vlastnímu monitoringu zde slouţí
feromonový atraktant k zachycení samečků bázlivce kukuřičného na lepovou desku. V rámci
monitorování jsme se zaměřili na lokality jiţní Moravy, kde byly v roce 2002 poprvé
zaznamenány první výskyty bázlivců. V této oblasti jsou také nejvhodnější podmínky pro
pěstování kukuřice. Jiţní Morava se v rámci České republiky řadí k oblastem s nejvyšší
průměrnou roční teplotou a velmi nízkým ročním úhrnem sráţek. Monitoring byl prováděn
v provozních plochách kukuřice s různým způsobem pěstování – kukuřice pěstována
v osevním postupu a kukuřice pěstována v monokultuře v několikaletých cyklech. Lokality
48
„Úroda 12/2011, vědecká příloha―
byly v roce 2009: Ţabčice, kukuřice pěstovaná sedmým rokem po sobě a dále pak na
lokalitách Troubsko (osevní postup), Velké Němčice (monokultura druhým rokem), Uherčice
(monokultura třetím rokem) a Starovičky (osevní postup). V roce 2010: Ţabčice (kukuřice
v monokultuře 8. rok), dále pak na lokalitách Troubsko (osevní postup), Uherčice
(monokultura čtvrtým rokem), Dolní Dunajovice (kukuřice prvním rokem) a Brno Medlánky
(kukuřice třetím rokem). V roce 2011: Ţabčice (kukuřice v monokultuře 9. rok), dále pak na
lokalitách Troubsko (osevní postup), Bratčice (kukuřice druhým rokem), Dolní Dunajovice
(kukuřice druhým rokem) a Brno Medlánky (kukuřice čtvrtým rokem). Feromonový lapák byl
instalován na jednotlivé lokality vţdy v poslední dekádě měsíce června. Na přelomu července
a srpna byl vyměněn za nový, který na daném stanovišti setrval většinou aţ do prvního týdne
začátku září, kdy byl vlastní monitoring ukončen. Vyhodnocování náletu brouků bázlivce
bylo děláno průběţně v intervalu 7-14 dní podle moţného náletu. Na přelomu července a
srpna jsme většinou prováděli odpočty v kratším časovém intervalu, abychom zachytili vrchol
náletu. V roce 2011 jsme na základě výsledků z předchozích let doplnili sledování o
zjišťování moţného poškození palic dospělci, kořenů larvami a v některých termínech jsme
vyhodnotili početnost dospělců na 5 x 10 rostlinách.
Výsledky a diskuze
Na třech z celkem pěti sledovaných lokalit v roce 2009 (tabulka 1) byli první jedinci
zaznamenáni 13. července. V Troubsko, kde byla kukuřice pěstována v prvním roce, se
dospělci bázlivce objevili aţ 29.7., tedy téměř 2 týdny po zjištěném prvním výskytu
v porovnání s jiţnějšími lokalitami a zároveň i s lokalitami s pěstovanou kukuřicí po sobě. Na
této lokalitě se v okolí nevyskytoval téměř ţádný jiný porost kukuřice. Bázlivcům tak trvalo
dlouhou dobu neţ tento porost našli. Dynamika záchytu byla v Troubsku velmi
pozvolná, vrchol náletu byl 12.8. a s celkem 115 zachycenými jedinci za celé období patřila
tato lokalita k nejniţším se zaznamenaným počtem bázlivců. Opakem byla naopak lokalita
Ţabčice. Po počátečním zaznamenání prvních jedinců na počátku července početnost
dramaticky rostla. Na konci července bylo během pouhých pěti dnů zaznamenáno na
feromonovém lapáku 348 jedinců. Při hodnocení za dalších 8 dní bylo zjištěno 222 jedinců,
coţ značí o velmi vysoké početnosti bázlivce na této lokalitě v roce 2009. V dalším období
početnost klesala, ale ve srovnání s ostatními lokalitami byla nadále velmi vysoká.
V porovnání lokalit s kukuřicí v monokultuře (Němčice a Hustopeče) s lokalitou Starovičky,
kde byla kukuřice pěstována v osevním postupu, celkový záchyt bázlivců nevykazoval téměř
ţádné rozdíly. Můţe to být ale zapříčiněno především krátkou vzdáleností mezi uvedenými
stanovišti. Feromonový lapák tak lákal samce bázlivců z širokého okolí, kde se vyskytoval
v daleko větší početnosti.
Tabulka 1
Početnost dospělců bázlivce kukuřičného na lokalitách jiţní Moravy v roce 2009
počet dospělců bázlivce kukuřičného na feromonovém lapáku
lokalita/datum 13.7. 21.7. 29.7. 4.8. 12.8. 19.8.
25.8.
1.9.
celkem
Němčice
0
0
87
142
75
17
5
15
341
Ţabčice
5
11
36
348
222
86
49
30
787
Hustopeče
2
2
63
92
38
30
19
16
262
Starovičky
3
0
4
88
65
19
34
36
249
Troubsko
0
0
2
13
49
32
14
5
115
V roce 2010 (tabulka 2) byl první výskyt bázlivce zjištěn na lapáku dne 12.7. na lokalitě
Ţabčice. Na ostatních lokalitách pro rok 2010 nemáme přesné údaje prvního zaznamenaného
49
„Úroda 12/2011, vědecká příloha―
výskytu, ale podle předchozích údajů se lze domnívat, ţe termín bude přibliţně podobný jako
v Ţabčicích. Výjimkou je lokalita Troubsko, kde byli první jedinci zachyceni aţ 27.7., tedy v
porovnání s rokem 2009 opět velmi pozdě. Je to dáno především tím, ţe na okolních
provozních plochách bylo menší zastoupení pěstované kukuřice. Vrchol náletu byl v roce
2010 zaznamenán 10.8., kdy byla zjištěna velmi vysoká početnost na všech sledovaných
lokalitách pohybující se od 193 jedinců v Troubsku do 278 jedinců zjištěných na stanovišti
Brno-Medlánky. Kdyţ se budeme zabývat porovnáním vrcholu náletu u dvou odlišných
technologií pěstování tak se nepotvrdili údaje z minulých let. Při zjišťování početnosti bylo
v minulých letech moţno lehce rozeznat, kde je kukuřice pěstována v monokultuře a kde
v osevním postupu. V roce 2010 na lokalitě Dolní Dunajovice početnost převyšovala počet
bázlivců v kukuřici pěstovanou v monokultuře. Celkem za sledované období roku 2010 bylo
zaznamenáno velké mnoţství bázlivců na všech lokalitách před i po vrcholu náletu. Průměrný
výskyt bázlivců u kukuřice v monokultuře byl za celé sledované období 685 a v osevním
postupu 461,5 jedinců. Při jednotlivých odběrech, zvláště pak při vrcholu náletu, byly
v porostech kukuřice bázlivci volně viditelní. Při důkladné kontrole jednotlivých rostlin
kukuřice byly patrné i důsledky ţíru dospělců bázlivce. Bázlivec svým ţírem zcela zničil
blizny a vrcholovou část palice vyţíráním jednotlivých zrn. To v předchozích letech sledování
nebylo nikdy zjištěno. Bázlivci se volně vyskytovali ale škody způsobené ţírem dospělců
nebyly nikdy zaznamenány.
Tabulka 2
Početnost dospělců bázlivce kukuřičného na lokalitách jiţní Moravy v roce 2010
počet dospělců bázlivce kukuřičného na feromonovém lapáku
lokalita/datum
2.7. 12.7. 27.7. 3.8. 10.8. 17.8. 26.8. 3.9. 10.9. celkem
Ţabčice
0
1
93
77 264 115
157
34
93
834
Uherčice
0
0
48 115 276
53
20
15
46
573
Dolní Dunajovice
0
0
17
32 274
70
37
24
66
520
Troubsko
0
0
3
23 193
93
37
18
36
403
Brno-Medlánky
0
0
10
50 278 139
86
56
20
639
V roce 2011 byly feromonové lapáky na jednotlivé lokality rozmísťovány od 20.6.-23.6.
s tím, ţe první bázlivci byli zjištěni v Dolních Dunajovicích jiţ 27.6. (tabulka 3). V porovnání
s minulými roky je to téměř o 14 dní dříve. V následných termínech hodnocení početnost
zaznamenaných bázlivců prudce narůstala na všech lokalitách s výjimkou Troubska, kde byl
tak jako v minulých letech zjišťován pozvolný nárůst v početnosti. Velmi zajímavou se
v tomto roce stala lokalita Brno-Medlánky. Poprvé za celou dobu sledování zde byly
zaznamenány důsledky ţíru larev. V prostřední části provozní plochy kukuřice byl pozorován
silně mezerovitý porost s polehlými rostlinami kukuřice (obr. 3).
Dne 17.6. při BBCH 15 byly odebrány vizuálně poškozené rostliny s kořenovým balem. Byly
zde zaznamenány larvy bázlivců. Tyto odebrané rostliny měly poškozený kořenový systém
s různým stupněm poškození (obr. 4). V důsledku toho docházelo u rostlin k naklánění,
polehání a některé mladé rostliny měly kořeny zcela zničeny a následně uhynuly. Na celkem
deseti rostlinách bylo v tomto termínu na kořenech zaznamenána 1 larva bázlivce. Při
následném odběru rostlin dne 20.6. celkem 3 larvy bázlivce a 27.6. celkem 13 larev na 10
rostlin. V tomto roce jsme se rozhodli z důvodu takových zjištění vyhodnotit na všech
lokalitách i početnost dospělců bázlivce odpočtem na jednotlivých rostlinách. V Medlánkách
byl proveden ve dvou termínech a to 27.7. a 3.8. V tomto druhém termínu byly bázlivci
spočítáni i na ostatních lokalitách. V prvním termínu bylo v Medlánkách zjištěno 3,7
dospělců/rostlinu, v dalším termínu 5,5 dospělců/rostlinu. Na ostatních lokalitách početnost
50
„Úroda 12/2011, vědecká příloha―
dospělců nebylo tak vysoká, pohybovala se od 0,3 dospělců v Troubsko do 1 dospělce
v Bratčicích. Od 15.7. byly na kukuřicích pozorování pářící se bázlivci.
Obr.3. Polehlé rostliny kukuřice
Obr.4. Poškozený kořenový systém kukuřice
Tabulka 3.
Početnost dospělců bázlivce kukuřičného na lokalitách jiţní Moravy v roce 2011
počet dospělců bázlivce kukuřičného na feromonovém lapáku
lokalita/datum 27.6.
11.7.
18.7.
27.7.
3.8.
celkem
Dolní
Dunajovice
4
372
198
168
564
1306
Ţabčice
0
373
170
152
406
1101
Brno-Medlánky
0
8
32
282
332
654
Bratčice
0
83
159
280
316
838
Troubsko
0
3
18
48
76
145
Početnost v roce 2011 jiţ v polovině monitorovacího období převyšovala na všech lokalitách
(s výjimkou Troubska) celkovou početnost zaznamenaných v minulých letech za celé
pozorovací období. Výrazně se také liší ve dvou odlišných technologiích pěstování kukuřice,
kdy početnost u kukuřice v osevním postupu je několikanásobně niţší neţ při pěstování
kukuřice v monokultuře.
Závěr
Z našeho monitoringu i podle dostupných informací nebyly na území České republiky do roku
2010 zjištěny ekonomické škody způsobené larvami bázlivce kukuřičného. V roce 2010 byly
na území jiţní Moravy pozorovány v porostech kukuřice viditelné škody způsobené dospělci.
Bylo zaznamenáno především oţírání blizen a vyţírání nejmladších zrn, coţ způsobilo ztrátu
ozrnění ve vrcholové části palice a napadání palice houbovými chorobami. V tomto roce byla
pozorována i velmi vysoká početnost bázlivců na sledovaných lokalitách. V následném roce
2011 byla škodlivost dospělců zjištěna podle dostupných informací jiţ na více lokalitách celé
Moravy. V tomto roce byla na lokalitě Brno-Medlánky poprvé zaznamenána i škodlivost
způsobená ţírem larev, kdy docházelo k typickým příznakům u kukuřice tzv. husím krkům.
Larvy v počátečních fázích vývoje kukuřice poškodily kořenový sytém v důsledku toho se
51
„Úroda 12/2011, vědecká příloha―
mladé rostliny vyvracely a některé měly kořenový systém poničen tak, ţe došlo k uhynutí celé
rostliny. Výsledky z tohoto roku jsou uvedeny pouze do poloviny obvyklé pozorovací doby a
jiţ v červenci byly dosaţeny v takové početnosti jako za celé pozorovací období z minulých
let. Z našich pozorování vyplývá, ţe se v následujících letech můţeme s typickými příznaky
poškození rostlin setkávat stále častěji.
Dedikace
Výsledek byl získán za institucionální podpory na dlouhodobý koncepční rozvoj výzkumné
organizace.
Literatura
Anonymus (2008) Metodická příručka ochrany rostlin proti chorobám, škůdcům a plevelům.
Česká společnost rostlinolékařská, ISBN 978-80-02-02087-05, 504s
Meinke L.J., Siegfried B.D., Wright R.J., Chandler L.D. 1998: Adult susceptibility of
Nebraska western corn rootworm (Coleoptera: Chrysomelidae) populations to selected
insecticides. Journal of Economical Entomology, Vol 91: p. 594-600
Kolařík, Rotrekl, (2011) Bázlivec kukuřičný - reálná hrozba?, Agromanuál 6, 28-29
Kontaktní adrtesa:
Ing. Pavel Kolařík
Agriculture Research , Ltd. Troubsko
664 41 Troubsko, Zahradní 1
[email protected]
52
„Úroda 12/2011, vědecká příloha―
MOŢNOSTI OPTIMALIZACE PĚSTEBNÍCH TECHNOLOGIÍ
POLNÍCH PLODIN
Possibilities of crop management practices optimisations
Křen J.
Ústav agrosystémů a bioklimatologie AF MENDELU
Abstrakt
S vyuţitím dlouhodobých zkušeností v aplikovaném výzkumu a poradenství v rostlinné produkci jsou
vyhodnoceny moţnosti optimalizace pěstebních technologií polních plodin. Teoretickým základem je
interakce G x P x T, která je povaţována za jednotné východisko pro rozvoj šlechtění i pěstování
polních plodin. Je vyhodnocen význam a naznačeny moţnosti praktického vyuţití jednotlivých sloţek
tohoto systému. Jsou charakterizovány základní problémy, které je třeba řešit při rozvoji pěstebních
technologií polních plodin v podmínkách ČR.
Klíčová slova: pěstební technologie plodin, interakce G x P x T, sortiment odrůd, rentabilita
Abstract
Using long-term experience in applied research and extension in crop production are evaluated
possibilities to optimize field crops management practices. The theoretical basis is the interaction of G
x E x M, which is considered to be a uniform basis for the development of breeding and growing of
field crops. The importance of the practical use of the individual components of this system is
indicated and evaluated. Fundamental problems are characterized, that need to be solved in
improvement of field crop management practices in the CR conditions.
Key words: crop management practices, interaction G x E x M, variety assortment, profitability
Úvod
Příspěvek vznikl na základě dlouhodobé výzkumné práce autora na úseku pěstebních
technologií obilnin, výuky, poradenské a konzultační činnosti pro zemědělskou praxi.
Záměrem je zobecnění pohledu na problematiku pěstebních technologií polních plodin a
upozornění na problémy jejího rozvoje v podmínkách ČR.
Motto
Nikde na ţádném úseku lidské činnosti
není třeba brát v úvahu tolik rozmanitých podmínek
pro dosaţení úspěchu,
nikde není třeba tolik mnohostranných informací
a nikde přecenění jednostranného přístupu
nemůţe způsobit tak velký neúspěch jako v zemědělství.
Kliment Arkadijevič Timirjazev
V naučném slovníku zemědělském (Kolektiv, 1987) je technologie definována jako věda o
kvalitativních a kvantitativních změnách, k nimţ dochází na pracovních předmětech
v průběhu výroby jednotlivých výrobků (např. obilovin, technických plodin, chovných a
uţitkových zvířat, mléka, vajec). Dřívější empirické poznatky jsou nahrazovány vědeckými
poznatky, které umoţňují nejen detailnější a přesnější poznání změn na pracovních
předmětech vloţených do výroby, ale i jejich cílevědomé ovlivňování, regulování a nakonec i
řízení.
V jiném pojetí (Kolektiv 1994) je termín technologie pouţíván ve významu výrobní postup,
např. technologie pěstování jednotlivých druhů polních plodin.V anglosaské terminologii je
technologií míněna aplikace vědeckých poznatků pro praktické vyuţití. Tomu je také nejbliţší
53
„Úroda 12/2011, vědecká příloha―
chápání termínu pěstební technologie v tomto příspěvku, tj. aplikace vědeckých poznatků ve
výrobním postupu při pěstování polních plodin.
Výrobní procesy v rostlinné produkci se vyznačují následujícími zvláštnostmi:
- závislostí na geneticky podmíněných vlastnostech odrůd pěstovaných plodin,
- závislostí na průběhu počasí,
- závislostí na půdě, která je nepřemístitelná a její vlastnosti jsou ovlivňovány průběhem
počasí a způsobem hospodaření.
Úspěšné uplatnění technologií v kontextu setrvalého rozvoje zemědělství vyţaduje rozsáhlé
znalosti i zkušenosti, jasnou koncepci pro jejich praktické vyuţívání včetně řešení často
protichůdného působení biologických či agronomických a ekonomických poţadavků.
Obecné úvahy
Pěstební technologie by měla zajistit efektivní vyuţívání vegetačních a produkčních faktorů i
biologického potenciálu odrůd. To je podmíněno stejnosměrnými aktivitami pěstitelů i
šlechtitelů polních plodin, tj. jednotnou teorií tvorby výnosu umoţňující objasňování vztahů v
interakci genotypu x prostředí. I kdyţ oba směry (pěstování i šlechtění) vycházejí z jednotné
teorie, liší se v jejím praktickém vyuţívání.
Šlechtitel hodnotí (při standardní pěstební technologii) velké mnoţství materiálů (genotypů) v
podmínkách daných lokalitou a ročníkem. Nekontrolovatelnost povětrnostních vlivů ve
spojení s agroekologickými zvláštnostmi lokality vede k jedinečnému projevu interakce.
Ověřování správnosti výběru je proto ve vyšších fázích procesu novošlechtění prováděno
hodnocením materiálů na více lokalitách a ve více letech. Z tohoto důvodu je pro šlechtitele
cenná informace o způsobu reakce genotypu na dané prostředí, z níţ je moţné usuzovat na
úroveň vyuţívání biologického výnosového potenciálu, tj. na adaptaci genotypu. Vychází se
přitom z předpokladu, ţe genotyp (druh, odrůda) nejlépe vyuţívá svůj biologický potenciál i
produkční faktory lokality v podmínkách, na které je adaptován. V konečné fázi tohoto
procesu jsou výsledky hodnocení adaptace a adaptability vyuţívány pěstiteli pro rajonizaci
druhů a odrůd.
Pěstitel, na rozdíl od šlechtitele, nehodnotí vhodnost odrůdy pro dané půdně-klimatické
podmínky (dané lokalitou nebo regionem), ale vytváří nejvhodnější prostředí registrovaným a
rajonovaným odrůdám. Nepouţívá výsledky interakce k výběru nejvhodnějšího genotypu jako
šlechtitel, ale v průběhu celého vegetačního období se snaţí modifikovat pěstební opatření a
zabezpečit co nejefektivněší vyuţívání produkčních faktorů.
Cílem šlechtitele je vytvořit odrůdu s vysokým a stabilním výnosovým potenciálem a
vysokou kvalitou produkce. Cílem pěstitele je tento biologický potenciál realizovat. Stabilitu
výnosu a kvality dosahuje šlechtitel homeostází odrůdy a pěstitel zajištěním stability
prostředí, tj. modifikací způsobu hospodaření a optimalizací pěstební technologie.
Hlubší pohled na tyto vztahy umoţní vyčlenění pěstebních technologií ze sloţky prostředí,
coţ lze vyjádřit jako G x P x T, kde:
- G = odrůda a její biologický potenciál,
- P = pěstitelem neovlivnitelné nebo málo ovlivnitelné sloţky prostředí biologickofyzikálního (půdně-klimatické podmínky lokality a počasí), ekonomického (ceny
vstupů a výstupů),
- T = pěstitelem ovlivnitelná (vytvářená) sloţka prostředí (pěstební technologie jako
soubor pěstitelských opatření v průběhu vegetace plodiny modifikovaný podle
poţadavků odrůdy, podmínek lokality, průběhu počasí, intenzity hospodaření, způsobu
vyuţití produkce, cen vstupů a výstupů atd.)
Optimalizace tohoto systému (sladění všech sloţek na základě jejich významu a funkcí) by
měla být zaměřena na:
54
„Úroda 12/2011, vědecká příloha―
- maximální realizaci biologického potenciálu výnosu a kvality produkce,
- co nejvyšší rentabilitu vstupů,
- omezení negativních dopadů hospodaření na ţivotní prostředí.
Při praktickém provádění se jedná o volbu správné odrůdy a o rozhodování o na sebe
navazujících pěstebních opatřeních, která by měla být prováděna:
- na správném místě,
- ve správný čas,
- správnou intenzitou.
Všechny tyto činnosti jsou v konečném výsledku v zemědělské praxi hodnoceny
ekonomickými ukazateli (trţby z jednotky plochy, zisk, rentabilita, příspěvek na úhradu). Při
výzkumu pěstebních technologií to klade poţadavky na:
- potřebu vyjadřování ekonomických efektů jednotlivých pěstebních opatření a pěstební
technologie jako celku,
- nezbytnost chápání pěstební technologie jako integrálního celku odrůdy a k ní
prováděných pěstebních opatření modifikovaných pro konkrétní situaci danou
půdními podmínkami, průběhem počasí a cenami vstupů a výstupů.
Význam odrŧdy a odrŧdové skladby (G)
Podobně jako volba plodin v rámci dobře postaveného osevního postupu, je správná volba
odrůd významným racionalizačním opatřením rostlinné produkce. Přináší ekonomické efekty
aniţ by vyţadovala podstatné zvyšování nákladů. Vyuţití agronomických předností pevných
osevních postupů je v současné době v praxi omezeno potřebou pruţně reagovat na situaci na
trhu skladbou pěstovaných plodin. Volba odrůdové skladby proto nabývá na významu jako
důleţitý faktor optimalizace, zajištění heterogenity a stabilizace systémů rostlinné produkce.
Především platí, ţe výběr odrůd a tvorba odrůdové skladby je odborně náročné rozhodování.
Vyţaduje široké agronomické zkušenosti, znalosti půdně-klimatických podmínek lokality a
objektivní informace o agrobiologických zvláštnostech odrůd. I při splnění uvedených
podmínek je nutné brát v úvahu omezenou předvídatelnost průběhu počasí v jednotlivých
ročnících a s tím spojené riziko výskytu škodlivých činitelů - abiotických (vyzimování, sucho,
intenzivní sráţky, poléhání) a biotických (choroby a škůdci). Výběr pěstovaných odrůd je
proto z hlediska předpokládaného rizika a jeho omezení důleţité a odpovědné podnikatelské
rozhodnutí.
Vhodná kombinace odrůd při tvorbě odrůdové skladby umoţňuje sníţení rizika nepříznivého
průběhu povětrnosti a vlivu biotických škodlivých činitelů na tvorbu výnosu a kvality zrna.
Výběr odrůd by proto neměl být podceňován a neměla by být uplatňována jednostranná
hlediska, ke kterým vede výběr odrůd pouze podle:
- jednoho nebo několika málo znaků,
- výsledků jednoho nebo dvou let,
- výsledků z lokalit s odlišnými půdně-klimatickými podmínkami.
K těmto nesprávným a zjednodušujícím postupům zemědělskou praxi svádí:
- zvyšující se počet nabízených odrůd (registrovaných v ČR a z evropského katalogu) u
většiny polních plodin a obtíţnost znalostně obsáhnout informace o jejich
agrobiologických zvláštnostech,
- snaha o rychlé uplatnění „novinek―, které by pomohly kompenzovat jiné obtíţně řešitelné
problémy hospodaření, především nedostatek finančních prostředků na kvalitní výţivu a
ochranu porostů,
- obdobný průběh počasí (zimního období) v předcházejících několika letech.
Je třeba mít stále na zřeteli, ţe i přes určité změny klimatu projevující se v posledních letech,
je pro naše území typické přechodné klima s moţnými většími výkyvy počasí. Výběr odrůd
55
„Úroda 12/2011, vědecká příloha―
by proto neměl být ovlivněn výjimečnými výsledky, které nejsou potvrzeny v letech
s dostatečným projevem škodlivých faktorů v polních pokusech nebo laboratorními testy. Ani
při víceletém zkoušení odrůd nemusí být jejich odolnost ke škodlivým činitelům potvrzena,
pokud se v polních podmínkách zřetelně neprojevily.
Zemědělská praxe má proto u nově registrovaných odrůd často k dispozici převáţně pouze
firemní charakteristiky vytvořené na základě podkladů získaných při ověřování odrůd
v zemích jejich původu. Tyto údaje mnohdy nejsou dostatečně ověřeny a potvrzeny v půdněklimatickým podmínkám jednotlivých výrobních oblastí našeho státu. Na vyuţívání odrůd má
u nás stále významný vliv způsob a úroveň propagace prováděné firmami, které ne vţdy
vyuţívají objektivní argumenty.
Pěstitelé by si měli být vědomi odpovědnosti za riziko, vyplývající z výběru pěstovaných
odrůd. Kritéria, která by měla být brána při výběru odrůd v úvahu:
- adaptace na dané půdní a klimatické podmínky (vycházet z výsledků více let a extrémních
ročníků). Adaptované odrůdy ve víceleté řadě lépe vyuţívají vegetační faktory lokality a v
daných podmínkách dosahují stabilnějších hospodářských výsledků.
- kvalita odpovídající záměru uplatnění produkce. Také ukazatele kvality by měly být
prověřeny v rozdílných půdně-klimatických podmínkách a ročnících.
- odolnost proti abiotickým a biotickým škodlivým činitelům,
- vhodnost pro daný způsob hospodaření (struktura pěstovaných plodin, předplodina,
způsob zpracování půdy a zakládání porostů, termín setí, intenzita hnojení atd.).
Odrůdová skladba by měla být zaloţena na odrůdách adaptovaných pro danou výrobní oblast
a vhodných pro pouţívaný osevní sled a intenzitu hospodaření. Pro mikrorajonizaci na
jednotlivé hony vyuţívat rozdíly v dalších vlastnostech (kombinace odrůd s rozdílným
genetickým zaloţením rezistence proti chorobám, raností a vyuţitelností pro rané nebo
pozdní setí). To umoţňuje rozloţení rizika působení škodlivých činitelů a odstranění
pracovních špiček.
Neovlivnitelná a málo ovlivnitelná část prostředí (P)
Jedná se o část prostředí, která by měla být brána v úvahu (respektována) při práci šlechtitelů i
pěstitelů. Moţnosti optimalizace jednotlivých sloţek shrnuje následující tabulka.
Sloţka neovlinitelného nebo Moţnosti optimalizace
málo ovlivnitelného prostředí šlechtěním
pěstováním
půdně-klimatické podmínky tvorba
a
rajonizace modifikace pěstební technologie
lokality
adaptovaných odrůd
podle úrodnosti lokality
počasí
tvorba
a
vyuţívání ročníkové pěstební technologie
adaptabilních odrůd
ekonomické prostředí – ceny tvorba a vyuţívání odrůd podle rozhodování
o
pěstebních
vstupů a výstupů
způsobu vyuţití produkce a opatřeních s cílem dosaţení co
moţností uplatnění na trhu
nejvyšší rentability vstupů a
zisku z jednotky plochy porostu
Je třeba upozornit, ţe především v této oblasti se v zemědělské praxi prosazují ekonomické
efekty na úkor agronomických. Jako příklady lze uvést:
- pěstování řepky i v teplejších lokalitách (kukuřičná výrobní oblast),
- pěstování potravinářských odrůd pšenice na 2/3 plochy i kdyţ se k potravinářským
účelům vyuţívá pouze 1/3 celkové produkce,
- selektivní výkup odrůd ječmene sladovnami,
- orientace na ranější odrůdy brambor.
56
„Úroda 12/2011, vědecká příloha―
Ovlivnitelná část prostředí – pěstební technologie (T)
Rozhodování o pěstitelských opatřeních a tvorba pěstebních technologií polních plodin je
stěţení náplní při hospodaření na půdě. Realizací pěstebních technologií stráví zemědělci
největší část pracovní doby. Potýkají se přitom s řadou agronomických, ekonomických a
administrativních problémů:
- dodrţování agrotechnických termínů v závislosti na průběhu počasí (je zapotřebí
mechanizačních prostředků jejichţ vyuţití je pouze krátkodobé – secí stroje, sklízecí
mlátičky),
- dosaţení dobrých cen vstupů a produkce,
- splnění všech evidenčních a administrativních poţadavků.
Pěstební technologie tak představují ekonomicky realizované agronomické znalosti
v převáţně nekontrolovatelném prostředí (charakterem se tato činnost podobá umění).
Základní problém, který je při tom řešen je vyváţenost produkčních faktorů v prostoru a
v čase, tj. zajištění jejich dostupnosti podle potřeb vyvíjejících se porostů.
Výzkum v oblasti pěstebních technologií polních plodin by měl být schopný řešit problémy
současné praxe, ke kterým patří:
- navrhnout a realizovat pěstební technologii jako optimalizovaný celek pěstebních opatření
pro konkrétní stanovištní podmínky a způsob vyuţití produkce. Důleţitá je operativnost
při diagnostice stavu porostu a následné modifikaci pěstebních zásahů. V zemědělské
praxi v současnosti převládají odborné akce pořádané výrobci agrochemikálií a
mechanizace na nichţ je prioritně řešeno uplatnění jejich produktů, které však představují
obvykle pouze dílčí pěstitelské vstupy.
- objektivizace doporučování odrůd („pěstební technologie pro odrůdy― nebo "odrůdy pro
pěstební technologie"). Pro mnoţství odrůd se kterými lze u hlavních polních plodin na
našem území obchodovat prakticky nelze vypracovat kvalitní pěstební technologie.
Objektivní podklady lze získat z pokusů pro seznam doporučených odrůd (SDO).
Vzhledem k pravidlům a způsobu financování SDO se však řada odrůd dostává do praxe
bez širšího ověření jejich agrobiologických zvláštností v našich podmínkách.
- stanovení ekonomicky efektivní intenzity pěstování (ucelených pěstebních technologií pro
konkrétní podmínky) v závislosti na měnících se cenách osiv, agrochemikálií, zemědělské
techniky a produkce. Kritériem jsou ekonomické ukazatele rentabilita nákladů, zisk
z hektaru, případně příspěvek na úhradu.
- tvorba podkladů pro „rozumná― pravidla GAEC a pěstitelských postupů umoţňujících
jejich dodrţování a naplňování.
Epilog
Jako námořník vybavený kompasem a mapou volí vţdy nejvhodnější směr,
aby šťastně doplul ke svému cíli,
se liší od pobřeţního plavce, který nesmí ztratit břeh s očí,
tak se liší racionální (vědecký) zemědělec vyuţívající nové vědecké poznatky
od zemědělce řemeslného (mechanického).
Albrecht Thaer
Dedikace
Poděkování: Příspěvek byl zpracován s podporou projektu MZe ČR QH 91051 „Efektivní
pěstební technologie obilnin― a Výzkumného záměru č. MSM6215648905 „Biologické a
57
„Úroda 12/2011, vědecká příloha―
technologické aspekty udrţitelnosti řízených ekosystémů a jejich adaptace na změny
klimatu―, uděleného MŠMT ČR.
Pouţitá literatura
Kábrt, B.: Poznámky ku šlachteniu pšenice ozimej. Referát na semináři mladých šlechtitelů
OSEVY a SLOVOSIVA, Kralice na Hané, 8. a 9. 6. 1982.
Kolektiv: Naučný slovník zemědělský. Díl 11 T-U, SZN Praha, 1987, s. 66.
Kolektiv: Slovník spisovné češtiny pro školu a veřejnost. ACADEMIA Praha, 1994.
Křen, J.: Volba odrůdy a odrůdová skladba při pěstování obilovin. Úroda, 1993a, č. 6, příloha
Rolník, s. 3 - 5.
Křen, J.: Vliv technologií na rostlinnou produkci v České republice. Sborník z konference
„České a slovenské zemědělství na přelomu tisíciletí―, Luhačovice 26. září 1997, Nadace
A. Švehly Praha, ČAZV Praha, TOKO a.s., s. 61-70.
Křen, j. Spitzer, T.: Porovnání pěstebních technologií pšenice ozimé na DLG-Feldtage´2010
v Německu. Úroda, č. 7, 2011, s. 58-61.
Rabbinge, R.: The bridge function of crop ecology. Neth. J. agric. Sci., 34, 1986, s. 239 251.
Wit, C.T. de: On the efficiency of resource use in agriculture. Preprint of festschrift für Prof.
Dr. K.B., Wageningen, 1991.
Kontaktní adresa:
Prof. Ing. Jan Křen, CSc.
Ústav agrosystémů a bioklimatologie
AF MENDELU, Zemědělská 1, 613 00 Brno
e-mail: [email protected]
58
„Úroda 12/2011, vědecká příloha―
POROVNÁNÍ ROVNOMĚRNOSTI ROZMÍSTĚNÍ ČÁSTIC
KOMPOSTU PŘI RŦZNÝCH ZPŦSOBECH ZAPRAVENÍ
The comparing of uniformity by placement of compost particles
by different methods of plough
Burg P., Zemánek P.
Mendelova univerzita v Brně, Zahradnická fakulta Lednice
Abstrakt
Práce porovnává tři různé varianty zapravení kompostu do půdního profilu v dávce 50 t.ha-1. Ze
vzájemného srovnání hodnocených variant vyplývá, ţe do hloubky 0,2 m je rovnoměrnost u
radlicového i rotačního kypřiče srovnatelná. Dosaţení větší pracovní hloubky u rotačního kypřiče je
spojeno se značnými technickými obtíţemi a s vyšší energetickou náročností Pouţití radlicového
kypřiče pro hloubky od 0,2 do 0,35 m je zcela reálné a navíc přispívá k rozrušení hlubších vrstev
půdního profilu. Zapravení vyšších dávek kompostu radličnými pluhy a radlicovými kypřiči s ohledem
na niţší rovnoměrnost bude dostatečné v případech pěstitelských technologií, u kterých se budou ještě
uplatňovat další operace spojené se zpracováním půdy.
Klíčová slova: půda, půdní profil, částice kompostu, zemědělská mechanizace
Abstract
This paper compares three different variants plough of compost to the soil profile at dose 50 t.ha -1.
From the comparison of solutions shows that the depth of 0,2 meters is the uniformity of the rotary
and plough-share cultivator comparable. Achieving greater depth of operating of the rotary cultivator
is associated with considerable technical difficulties and higher energy demand. Using plough-share
cultivator for the depth from 0,2 to 0,35 m is quite realistic and also helps to discompose the deeper
layers of the soil profile. Defray of higher doses of compost by plows and plough-share cultivators
with consideration of lower equable will be sufficient for production technology, which will apply
other operations associated with tillage.
Key words: soil, soil profile, compost elements, machines
Úvod
Zhutnění orné půdy je negativním jevem, který omezuje pohyb vody v půdě, sniţuje infiltraci
vody do půdy a můţe vést ke zvýšenému povrchovému odtoku, zvýšení půdní eroze a tím i
většímu transportu splavenin do povrchových vod.
Zlepšení půdní struktury a retenční schopnosti půdy, především pak infiltraci sráţkové vody
do půdy, je moţné zvýšit realizací její komplexní ochrany a organizovaným způsobem
hospodaření (JANEČEK a kol., 2002). V pozitivním směru mohou vlastnosti půdy ovlivnit
vyšší dávky organické hmoty, dnes hlavně kompostů, aplikovaných do půdního profilu
(DUMBROVSKÝ a kol., 2006). Organická hmota v půdě zásadním způsobem ovlivňuje
fyzikální vlastnosti půdy tvorbou mikropórů i úpravou vodního a vzdušného reţimu. Má vliv i
na mikrobiální ţivot v půdě podporou rozvoje edafonu. Určitý obsah organické hmoty je
nezbytný pro její dobrou funkci při pěstování plodin. Při tom záleţí na dávce, hloubce
zapravení a především na jejím rozloţení v půdním profilu. Z tohoto hlediska je významný
způsob aplikace a zapravení kompostů.
U vyšších dávek kompostů vzniká při jejich aplikaci, vlivem zapravení pomocí různých
technických prostředků, značný rozdíl v rovnoměrnosti rozptylu částic v půdě. Snahou je
dosáhnout při zapravení dobré homogenity v půdním profilu (ŠIMEK, 2004).
Hlavní faktory ovlivňující homogenitu směsi jsou fyzikálně-mechanické vlastnosti částic,
poměr míchaných sloţek a technické parametry homogenizujícího ústrojí (LAPŠIN a kol.,
1980).
59
„Úroda 12/2011, vědecká příloha―
Rovnoměrnost zapravení organické hmoty v půdním horizontu má vliv na retenční schopnost
půdní vrstvy. Při hodnocení zapravení organické hmoty různými druhy mechanizačních
prostředků jsou částice rozmístěny v různé hloubce s různou rovnoměrností (BADALÍKOVÁ,
HRUBÝ, 2007).
Řada autorů se rovněţ zabývala vypracováním metod rovnoměrnosti zapravení posklizňových
zbytků do půdy (MAŠEK, 2005). Hodnocením rovnoměrnosti zapravení organické hmoty do
půdního profilu se jiţ dříve zabýval např. FIALA (1983). Pro detekci jednotlivých částic po
zapravení vyuţíval kombinaci ionizačních látek a infrazáření. V současné době se hledají
různé moţnosti hodnocení rovnoměrnosti rozptylu s vyuţitím optoelektronických
softwarových systémů.
Cílem polně–laboratorních experimentů bylo posoudit moţnosti zapravení kompostu do různé
hloubky a vyhodnotit rovnoměrnost rozmístění částic při různých způsobech zapravení.
Materiál a metody
Termín a místo měření
Polně–laboratorní experiment za účelem posouzení rovnoměrnosti zapravení částic kompostu
do půdního horizontu byl realizován v první polovině října 2010. S ohledem na dostupnou
mechanizaci (radličný pluh, radlicový kypřič, rotační kypřič) byla sledování provedena na
polních pozemcích v k.ú Velké Bílovice o ploše 20 m2 u kaţdé varianty.
Stanovištní podmínky
Půdní typ na pokusném stanovišti je podle bonitačně půdně ekologických jednotek (BPEJ)
označen jako 0.06.01, coţ představuje typickou karbonátovou černozem na slínitých a
jílovitých substrátech. Jedná se tedy o těţkou půdu s lehčí ornicí a těţkou spodinou, občasně
převlhčenou. Půda byla s nepatrnou příměsí skeletu. Vlhkost půdy se v době měření
pohybovala na úrovni 16,0 % hm. Stanoviště se nachází v nadmořské výšce 175 m n. m., s
dlouhodobým průměrem sráţek 510 mm a dlouhodobou průměrnou teplotou 9,4 0C.
Vlastnosti kompostu
Před vlastním měřením byl na pokusném pozemku rozvrstven kompost v dávce 50 t.ha-1 (5,0
kg.m-2). Kompost byl vyroben na ZF v Lednici, technologií kompostování v unifikovaných
plastových kompostérech o objemu 700 l. Hlavními surovinami pro výrobu kompostu byly
zbytky ze zeleniny, matolina, dřevní štěpka a chlévský hnůj. Objemová hmotnost kompostu
činila 0,822 t.m-3. S ohledem na poţadavek snadné identifikace částic kompostu při
experimentu po jejich zapravení v půdním horizontu, byl kompost obarven vápenným
hydrátem. V době aplikace byla vlhkost kompostu 19 % hm.
Mechanizační prostředky pro zapravení kompostu
Zapravení kompostu do půdního horizontu bylo provedeno ve třech variantách různými
mechanizačními prostředky:
 Var.1: souprava traktor Deutz-Fahr AGRO 50 + radlicový kypřič OSTRATICKÝ 1,6
 Var.2: souprava traktor Deutz-Fahr AGRO 50 + rotační kypřič KUHN EL 62–140
 Var.3: souprava traktor Deutz-Fahr AGRO 50 + dvouradličný pluh (B–0,8 m)
Pro zapravení kompostu byla nastavena pracovní hloubka u radlicového kypřiče 0,15 m, u
rotačního kypřiče 0,19 m a u radličného pluhu 0,27 m.
60
„Úroda 12/2011, vědecká příloha―
Hodnocení rovnoměrnosti zapravení
Pro vyhodnocení rovnoměrnosti zapravení kompostu v půdním horizontu byla vyuţita metoda
analýzy obrazu. Tato metoda je zaloţena na analýze světlých a tmavých bodů snímku
konkrétního řezu půdního horizontu na fotografii vymezené části půdního horizontu. Vlastní
snímek je prováděn tak, ţe po aplikaci organického hnojiva a jeho zapravení průjezdem
soupravy, se do půdního horizontu zahloubí průhledná přepáţka a z jedné její strany se půda
odstraní.
Snímek je následně analyzován pomocí počítačového softwaru (Photoshop), díky němuţ lze
určit rozmístění kontrastních částic kompostu v jednotlivých vrstvách profilu při různých
způsobech jeho zapravení. Určuje se procentický podíl světlých bodů na snímku v příslušné
vrstvě a vizuálně se posuzuje rovnoměrnost jejich rozmístění. Snímkování půdního profilu
bylo provedeno v pěti opakováních (sondách) u kaţdé ze tří hodnocených variant. Získané
hodnoty byly statisticky vyhodnoceny a procenticky vyjádřeny.
Výsledky a diskuze
V tab.1–3 jsou uvedeny zjištěné hodnoty podílu částic kompostu v jednotlivých vrstvách
půdního horizontu.
Tab.1: Var.1 – zapravení radlicovým kypřičem
Hloubka
Opakování
profilu
1
2
3
4
(mm)
0–100
4,32
3,90
3,90
4,11
100–200
3,69
1,59
2,77
2,24
200–300
0,2
0
0
0
300–400
0,01
0,01
0
0
Suma
8,22
5,50
6,67
6,35
Tab.2: Var.2 – zapravení rotačním kypřičem
Hloubka
Opakování
profilu
1
2
3
4
(mm)
0–100
2,80
2,73
2,84
2,98
100–200
2,50
2,48
2,36
2,42
200–300
0,60
0,53
0,10
0,20
300–400
0,05
0,01
0
0,01
Suma
5,95
5,75
5,3
5,61
Tab.3: Var.3 – zapravení radličním pluhem
Hloubka
Opakování
profilu
1
2
3
4
(mm)
0–100
2,99
3,13
2,89
2,8
100–200
2,92
2,70
3,12
2,76
200–300
1,72
1,99
2,01
2,60
300–400
0,61
0,80
0,30
0,34
Suma
8,24
8,62
8,32
8,5
61
5
4,00
2,78
0,01
0
6,79
5
3,01
2,99
0
0
6,00
5
3,09
2,95
2,01
0,10
8,15
Průměr
Směrodatná
odchylka
4,05
2,61
0,04
0,00
0,18
0,77
0,09
0,01
Průměr
Směrodatná
odchylka
2,87
2,55
0,29
0,01
0,12
0,25
0,27
0,02
Průměr
Směrodatná
odchylka
2,98
2,89
2,07
0,43
0,14
0,17
0,32
0,28
Podíl
částic
(%)
60,33
38,98
0,63
0,06
Podíl
částic
(%)
50,19
44,56
5,00
0,24
Podíl
částic
(%)
35,62
34,54
24,70
5,14
„Úroda 12/2011, vědecká příloha―
Na obr. 1 (viz níţe) je pro ukázku znázorněn snímek zachycující půdní profil po zapravení
kompostu pomocí rotačního kypřiče.
Obr.1: Rozmístění částic kompostu po zapravení rotačním kypřičem
U rotačního kypřiče je hloubka zapravení dána nastavením pracovní hloubky (0,19 m), kvalita
a rovnoměrnost zapravení je pak ovlivněna poměrem obvodové rychlosti noţů kypřiče a
pojezdové rychlosti soupravy. Limitujícím aspektem zůstává hloubka zapravení, kterou nelze
s ohledem na konstrukci kypřiče, energetickou náročnost operace a v řadě případů také
stanovištní podmínky výrazněji zvětšovat nad hranici 0,2 m. Přenos hnací síly traktoru musí
být zajištěn dostatečným kontaktním tlakem ve styčné ploše hnacích kol a velká tahová síla
vyţaduje často velkou hmotnost traktoru, která však má opět za následek utuţení půdy pod
koly a zhoršení její retenční schopnosti (JANEČEK a kol., 2002; PLASTER, 2009). Ze
získaných výsledků vyplývá, ţe částice kompostu jsou při tomto způsobu zapravení
rozmístěny nejrovnoměrněji. V horizontu v hloubce 0–100 mm je uloţeno 50 % a v horizontu
v hloubce 100–200 mm 44 % částic kompostu. Tento stav odpovídá intenzivnějšímu
promísení částic při zpracování půdy rotačním kypřičem.
Při vyuţití radličného pluhu je sice dosaţeno větší hloubky zapravení, kdy v horizontu 200–
300 mm je umístěno téměř 25 % všech částic, ale ze snímků je patrná značná nerovnoměrnost
rozmístění v ostatních vrstvách.
ŠIMEK (2003) uvádí, ţe zvolený způsob kultivace půdy můţe výrazně ovlivnit obsah
organické hmoty v půdním profilu. S ohledem na charakter zásahu a hloubku zpracování
půdního profilu jsou ovlivněny také její fyzikálně-chemické a biologické vlastnosti.
Ze vzájemného srovnání hodnocených variant zapravení vyplývá, ţe do hloubky 0,2 m je
rovnoměrnost u radlicového i rotačního kypřiče srovnatelná. Dosaţení větší pracovní hloubky
u rotačního kypřiče je spojeno se značnými technickými obtíţemi a s vyšší energetickou
náročností (PLASTER, 2009). Naproti tomu pouţití radlicového kypřiče pro hloubky 0,2–
0,35 m je zcela reálné a navíc přispívá k rozrušení hlubších vrstev půdního profilu (BOELS,
DAVIES, JOHNSTON, 1980; WHITE, 1997). Zapravení vyšších dávek kompostu radličnými
pluhy a radlicovými kypřiči bude vyhovovat u pěstitelských technologií, které pouţívají další
operace spojené se zpracováním půdy.
62
„Úroda 12/2011, vědecká příloha―
Závěr
Získané výsledky napovídají, ţe při praktických úvahách je nutné volbu způsobu zapravení
kompostu podřizovat stanovištním podmínkám (např. půdní druh, hloubka půdního profilu,
přítomnost skeletu), ale také moţnostem dalších operací v technologickém postupu. U
technologií, kde po zapravení následují operace spojené s intenzivní předseťovou přípravou
půdy a často několika kultivačními zásahy, bude dostatečně vyhovovat zapravení pomocí
radličných pluhů.
U technologií, kde půdní horizont není dále intenzivně ošetřován (zaloţení travních porostů,
výsadba dřevin apod.) je nutné zohlednit poţadavek rovnoměrného zapravení organické
hmoty vhodnějšími mechanizačními prostředky.
Dedikace
Příspěvek vychází z řešení výzkumného projektu NAZV č. QH 81200 "Optimalizace vodního
reţimu v krajině a zvýšení retenční schopnosti krajiny uplatněním kompostů z biologicky
rozloţitelných odpadů na orné půdě i trvalých travních porostech".
Pouţitá literatura
Badalíková B., Hrubý J., 2007: Zhodnocení protierozní ochrany půdy u různých variant
zakládání porostu kukuřice s vyuţitím meziplodin. (The evaluation of soil erosionprotection
in maize at different variants with catch crops). In Sb.: Aktuální poznatky v pěstování,
šlechtění, ochraně rostlin a zpracování produktů, Brno, s.243-246
Boels, D., Davies D.B., Johnston, A.E., 1980: Soil Degradation: Proceedings of the Land Use
Seminar on Soil Degradation, Wageningen, 13-15 October 1980
Dumbrovský, M. a kol., 2006: Metodická doporučení pro optimalizaci vodního reţimu v ploše
povodí. Opava: Ekotoxa Opava s.r.o., prosinec 2006. 100 s.
Fiala, J., 1983: Závěrečná zpráva výzkumného úkolu. VÚZT Praha - Řepy
Janeček, M. a kol., 2002: Ochrana zemědělské půdy před erozí. ISV Praha, 201s.
Lapšin, L. M., In Kejík, C., Groda, B., 1980: Technika a mechanizace ţivočišné výroby II.
Brno:VŠZ. 1. vyd. 296 s.
Mašek, J., 2005: Hospodaření s rostlinnými zbytky. Farmář. Profi Press s.r.o. – Praha. č. 6,
roč. 2005, s. 60-63, ISSN 1210-9789
Plaster, J. E., 2009: Soil Science And Management. Cengage Learning, Inc. , 512 p., 5th edit.
ISBN-13: 9780538758031
Šimek, M., 2003: Základy nauky o půdě – biologické procesy a cykly prvků. České
Budějovice: JČU, Biologická fakulta. 1. vyd. 151 s. ISBN 80-7040-630-5
Šimek, M., 2004: Základy nauky o půdě – degradace půdy. České Budějovice: JČU,
Biologická fakulta. 1. vyd. 225 s. ISBN 80-7040-667-4
White, R.E., 1997: Principles and practice of soil science. Oxford: Blackwell Science. 348 p.
Kontaktní adresa:
doc. Ing. Patrik Burg, Ph.D.,
MENDELU v Brně, Zahradnická fakulta
Ústav zahradnické techniky
Valtická 337, Lednice, Česká republika
[email protected]
63
„Úroda 12/2011, vědecká příloha―
64
„Úroda 12/2011, vědecká příloha―
NOVÉ POSTUPY PŘI HNOJENÍ ŘEPKY OZIMÉ DUSÍKEM A SÍROU
New methods in winter rape nutrition by nitrogen and sulphur
Kusá H., Rŧţek P., Vavera R.
Výzkumný ústav rostlinné výroby, v.v.i. Praha
Abstrakt
V letech 2008-11 byl v polních pokusech v Lukavci u Pacova (bramborářská výrobní oblast, 620 m n.
m., průměrná roční teplota 6,8°C, roční úhrn sráţek 686 mm, kambizem) sledován vliv hnojení N a S
na výnos a olejnatost semen řepky ozimé. Na jarní růst řepky a odběr dusíku rostlinami mělo pozitivní
vliv podzimní přihnojení (říjen) hnojivem UREAstabil v dávce 40 kg N/ha. Při aplikaci N hnojiv
v jarním období ve 2 dělených dávkách byly dosaţeny stejné nebo vyšší výnosy semen neţ při aplikaci
3 dělených dávek. Odběr síry rostlinami během počátečního jarního růstu byl nízký, nadzemní hmotou
rostlin (BBCH 51) bylo přijato 3,6 – 7,8 kg S/ha (2010 a 2011). Aplikace N+S hnojiv ve srovnání
s aplikací N-hnojiv měla v roce 2011 příznivý vliv na dosaţené výnosy semen, v letech 2009 a 2010
neměla vliv na výnosy semen, olejnatost ani odběr dusíku semeny. Vyšší obsah dusíku v semenech
řepky se u většiny variant hnojení projevil niţším obsahem oleje.
Klíčová slova: řepka ozimá, hnojení N a S, inhibitory ureasy, UREAstabil
Abstract
The effect of N and S fertilization on winter rape seeds yield and oil content was studied in field trial
in 2008-11 in Lukavec near Pacov (potato prod. area; 620 m above sea; annual temp. 6.8°C; annual
precipitation 686 mm; Cambisol). Fall application of 40 kg N/ha (UREA stabil) affected positively
spring regeneration of plants and nitrogen uptake. Spring application of N fertilizers in 2 split doses
gave the same or higher seeds yield than 3 split doses. Sulphur uptake by plants during early spring
growth was low. Only 3.6 – 7.8 kg S/ha was uptaken by the above ground biomass of plants up to
BBCH 51 (in 2010 and 2011). In 2011 higher seeds yield was reached after application of N+S
fertilizers than N-fertilizers only. In 2009 and 2010 no significant differences in yield, oil content or
nitrogen uptake were observed. The higher N content in seeds the lower oil content, almost.
Key words: winter rape, N and S fertilizers, urease inhibitors, UREAstabil
Úvod
Při intenzivním pěstování řepky ozimé jsou dusíkatá hnojiva aplikována v několika dělených
dávkách podle potřeby porostu, coţ zpravidla vede k vyššímu vyuţití dusíku z hnojiv a
k omezení nepříznivých vlivů hnojení na ţivotní prostředí. Byla publikována řada výsledků
ohledně vyuţití ţivin z hnojiv obilninami, ale dostupných dat o ozimé řepce není mnoho.
Sieling and Beims (2007) dosáhli vyuţití dusíku ozimou řepkou z minerálních hnojiv v
širokém rozsahu 31 – 70%. Sledovali příjem dusíku rostlinami ozimé řepky z hnojiv
(prostřednictvím izotopu 15N; dusičnan amonný 15NH415NO3) aplikovaných na počátku jarní
vegetace, ve fázi prodluţovacího růstu a tvorby šešulí. Dusík aplikovaný v pozdějších fázích
byl rostlinami přijímán rychleji, coţ vedlo k jeho vyššímu vyuţití. Pozdější aplikace dusíku
však nemusí přinést poţadovaný efekt při nedostatku sráţek v následujícím období.
Nejčastěji je publikováno 30 – 50% vyuţití aplikovaného dusíku rostlinami ozimé řepky.
Jensen et. al. (1997) dosáhli 34 – 41 % návratnosti dusíku rostlinami řepky ozimé, přičemţ
vyuţití dusíku klesalo s jeho rostoucí dávkou (100 – 200 kg N/ha). Ozimá řepka je rostlina
náročná na dusík a dávky dusíkatých hnojiv aplikované v zemědělské praxi často přesahují
200 kg N/ha. Vhledem k výše uvedené nízké efektivnosti hnojení N zůstává často po sklizni
vysoké mnoţství nitrátového dusíku v půdě, který se můţe podílet na znečištění vod.
Kromě dusíku patří řepka k plodinám náročnějším na výţivu sírou. Při nedostatku síry
dochází v rostlinách k narušení metabolismu N, kumulaci nepřeměněných nitrátů v listech při
65
„Úroda 12/2011, vědecká příloha―
srovnatelném celkovém obsahu dusíku v rostlinách (McGrath a Zhao, 1996). Hnojení
dusíkem pak nepřináší poţadovaný efekt. V naší práci jsme se zaměřili na ověření nových
dusíkatých hnojiv s inhibitory ureasy nebo se sírou (UREAstabil, DAM+Stabiluren,
močovina+S) a jejich uplatnění v nových postupech při hnojení řepky ozimé (např. podzimní
aplikace hnojiva UREAstabil).
Materiál a metody
Polní výţivářské pokusy s ozimou řepkou po jarním ječmeni byly zaloţeny na stanovišti
v Lukavci u Pacova (bramborářská výrobní oblast, 620 m n. m., průměrná roční teplota 6,8°C,
roční úhrn sráţek 686 mm, kambizem písčitohlinitá) v letech 2008-2011. Po sklizni
předplodiny bylo na slámu před orbou aplikováno hnojivo NPK 15-15-15 v dávce 40 kg N/ha.
Setí řepky bylo provedeno secí kombinací Amazone s vibračními branami (2008 a 2009
odrůda Californium, 2010 DK Secure; výsevek 0,55 MKS; velikost parcely 30 m2). Aplikace
pesticidů v průběhu vegetace byla prováděna dle výskytu plevelů, chorob a škůdců. Sklizeň
byla provedena maloparcelkovým kombajnem v termínech uvedených v tab. 1.
Tab. 1: Termíny agrotechnických operací v jednotlivých ročnících pokusu
Ročník
2008 - 09
2009 - 10
2010 - 11
Sklizeň předplodiny
12. 8. 08
19. 8. 09
15. 8. 10
Orba
19. 8. 08
21. 8. 09
17. 8. 10
Setí
24. 8. 08
24. 8. 09
26. 8. 10
I. aplikace hnojiv
31. 3. 09
27. 3. 10
15. 3. 11
Odběr vzorků
14. 4. 10
8. 4. 11
II. aplikace hnojiv
9. 4. 09
17. 4. 10
11. 4. 11
III. aplikace hnojiv
24. 4. 09
1. 5. 10
25. 4. 11
Sklizeň
27. 7. 09
10. 8. 10
4. 8. 11
Var.
Hnojivo
1
2
3
4
5
6
7
8
9
10
11
LAV
LAV
Močovina
Močovina+S
LAV
DAM
DAM+S
DAM+Stabiluren
UREAstabil
UREAstabil
UREAstabil
aplikace v říjnu
UREAstabil
Tab. 2: Varianty hnojení ozimé řepky
dávka
Hnojivo
dávka
Hnojivo
kg N/ha
kg N/ha
80
LAV
50
LAV
80
DASA
80
80
Močovina
50
Močovina
80
Močovina+S
50
Močovina+S
80
DAM
50
DAM
80
DAM
50
DAM
80
DAM+S
50
DAM+S
80
DAM+Stabiluren 50
DAM+Stabiluren
stabil
80
UREA
50
UREAstabil
80
UREAstabil
80
40
60
UREAstabil
dávka
kg N/ha
30
30
30
30
30
30
30
30
60
Celková dávka dusíku aplikovaná k ozimé řepce činila 160 kg N/ha. Různá dusíkatá hnojiva
či dusíkatá hnojiva s obsahem síry byla aplikována ve dvou či třech dělených dávkách, na
počátku jarní vegetace, v prodluţovacím růstu a u některých variant také ve fázi butonizace.
Výjimkou je varianta 11, kde byla první dávka hnojiva UREAstabil ve výši 40 kg N/ha
66
„Úroda 12/2011, vědecká příloha―
aplikována jiţ v říjnu, a další dvě na jaře spolu s ostatními variantami (tab. 2.). Byla pouţita
běţná dusíkatá hnojiva LAV (27% N), močovina (46,2% N), DAM (30 % N); hnojiva
s přídavkem inhibitoru ureasy: DAMst = DAM v kombinaci se Stabilurenem (2 l Stabilurenu
na 1000 l DAMu), UREAstabil (46 % N, obsah inhibitoru ureasy NBPT 0,06 % hmot., NBPT =
(N-(n-butyl)-thiophosphorictriamid) a hnojiva obsahující dusík a síru: DASA (26% N, 13%
S), močovina+S (33% N, 12% S) a DAM+S (27% N, 3% S).
U vybraných variant byly odebírány vzorky rostlin a půd během vegetace (v prodluţovacím
růstu, fáze BBCH 51), vyjma roku 2009 s extrémně suchým a teplým obdobím následujícím
po aplikaci regenerační dávky N (duben: +5,2°C; -45,4 mm vzhledem k dlouhodob. normálu).
Byl sledován obsah Nanorg. (extrakce 1% K2SO4; kolorimetrické stanovení analyzátorem
SANplus-Skalar) a S (vodný výluh 1:5, stanovení ICP-OES) v půdě (0-30, 30-60 cm), příjem N
a S rostlinami řepky. U sklizených semen řepky byl zjištěn výnos, obsah oleje, obsah N a S.
Výsledky byly hodnoceny metodou T-test s hladinou významnosti P<0,05. Průběh teplot a
sráţek v jednotlivých letech ve srovnání s dlouhodobým normálem je znázorněn na grafu 1.
Graf 1: a: Průběh teplot a sráţek v letech 2009-2011 ve srovnání s dlouhodobým normálem
b-d: Průběh teplot a sráţek v jarním období jednotlivých ročníků s vyznačením
termínů aplikace hnojiv
V
VI
-4
VII
-6
14.5.
6.5.
28.4.
24.4.
20.4.
16.4.
8.4.
12.4.
II. apl.
10.5.
odběr vzorkŧ
teplota (°C)
20
18
III. apl.
16
14
12
10
8
6
4
2
0
-2
2.5.
15. 3 - 15.5 2010
4.4.
31.3.
27.3.
23.3.
19.3.
15.3.
sráţky (mm)
22
20
sráţky (mm)
18
t (°C)
16
14
12
10
8
I. apl
6
4
2
0
sráţky (mm)
22
20
18
16
14
12
I. apl.
10
8
6
4
2
0
1. 3. - 15. 5. 2011
II. apl.
odběr vzorkŧ
III. apl.
14.5.
IV
6.5.
III
teplota (°C)
20
18
16
14
12
10
8
6
4
2
0
-2
10.5.
II
2.5.
I
-60
28.4.
-40
24.4.
-2
20.4.
-20
III. apl.
II. apl.
16.4.
0
8.4.
2
0
15. 3 - 15.5 2009
12.4.
4
20
4.4.
40
31.3.
6
27.3.
60
sráţky (mm)
22
sráţky (mm)
20
18
t (°C)
16
14
12
10
8
6
4
I. apl
2
0
23.3.
8
19.3.
80
15.3.
srážky 2011
t: 2011
teplota (°C)
20
sráţky (mm) 18
16
t (°C)
14
12
10
8
6
4
2
0
-2
1.3.
5.3.
9.3.
13.3.
17.3.
21.3.
25.3.
29.3.
2.4.
6.4.
10.4.
14.4.
18.4.
22.4.
26.4.
30.4.
4.5.
8.5.
12.5.
srážky 2010
t: 2010
Teplota (°C)
Srážky(mm)
srážky 2009
t: 2009
Výsledky a diskuze
Z dosaţených výsledků znázorněných na grafech 2 a 3 vyplývá, ţe na jarní růst řepky a odběr
dusíku rostlinami mělo pozitivní vliv podzimní přihnojení (říjen) hnojivem UREAstabil v
dávce 40 kg N/ha. U této varianty pokusu bylo k rostlinám do jarního odběru aplikováno 40
kg N/ha na podzim a 60 kg N/ha na začátku jarní vegetace, zatímco u ostatních variant byla
aplikována dusíkatá hnojiva v dávce 80 kg N/ha na začátku jara. Účelem podzimního hnojení
je podpořit slabší, často později zaseté, porosty řepky a vytvořit lepší podmínky pro jarní
intenzivní růst. Z variant s jarním hnojením v dávce 80 kg N/ha byly v obou letech dosaţeny
velmi dobré výsledky po aplikaci kapalného hnojiva DAM 390 3-otvorovými tryskami
v kombinaci s přípravkem Stabiluren. Ve Stabilurenu je účinnou látkou inhibitor ureasy
NBPT, který zpomaluje hydrolýzu močoviny v DAMu a tím prodluţuje dobu, kdy můţe být
nepřeměněná močovina po sráţkách transportována ke kořenům rostlin. Sieling and Beims
67
„Úroda 12/2011, vědecká příloha―
(2007) zjistili slabý příjem dusíku aplikovaného na počátku jarní vegetace ve srovnání
s dávkami aplikovanými během prodluţovacího růstu a ve fázi tvorby šešulí. Pozdější dávky
také více přispěly k obsahu dusíku v semenech, kde však bylo zjištěno maximálně 25%
dusíku aplikovaného v minerálních hnojivech. V podmínkách ČR je při pozdějších dávkách
dusíku k ozimé řepce riziko, ţe při nedostatku sráţek nemusí být N z aplikovaných hnojiv
rostlinami vyuţit. To potvrzují i výnosové výsledky (graf 5), kdy u variant hnojení řepky ve
třech dávkách UREAstabil nebo LAV s pozdní aplikací N (před květem) byly většinou zjištěny
stejné nebo niţší výnosy semene neţ při aplikaci hnojiv jen ve 2 dávkách na začátku jarního
růstu. Při jarním hnojení ozimé řepky ve 2 dávkách je vhodné pouţít pro druhou dávku
hnojivo s pozvolnou účinností jako např. UREAstabil, ale i DASA, u které zůstává po aplikaci
poměrně dlouhou dobu amoniakální forma dusíku vázána v horní vrstvičce půdy.
Odběr síry rostlinami během počátečního jarního růstu byl nízký a v odebrané nadzemní
hmotě rostlin bylo v letech 2010 – 11 zjištěno jen 3,6 – 7,8 kg S/ha (graf 4). Přitom aplikace
první jarní dávky dusíkatých hnojiv s obsahem síry zvýšila obsah síry v rostlinách o 2,4 – 2,5
kg S/ha (močovina + S), resp. o 0,7 – 1,2 kg S/ha (DAM + S) ve srovnání s močovinou a
DAM bez S. Vyšší obsah síry v rostlinách po aplikaci hnojiv se sírou neměl v počátečních
fázích jarního růstu řepky vliv na růst nadzemní hmoty rostlin a odběr dusíku rostlinami,
přestoţe v roce 2011 při odběrech rostlin byly u variant nehnojených sírou jiţ na listech
patrné příznaky nedostatku síry. Ty se projevily nejvíce u variant s větším nárůstem nadzemní
hmoty rostlin a odběrem dusíku (zejména varianty s podzimním přihnojením N a po aplikaci
kapalného hnojiva DAM+Stabiluren). V literatuře jsou uváděny různé ukazatele pro predikci
deficitu síry během vegetace řepky. Nejčastěji je zmiňován poměr N/S v rostlinách na
počátku kvetení (např. Matula, 2007). McGrath a Zhao (1996) povaţují za přesnější ukazatel
koncentraci síry v listech na počátku kvetení. Za kritickou povaţují hodnotu 3,8 mg S/g.
Analýza rostlin v našich pokusech byla prováděna jiţ během prodluţovacího růstu.
Koncentrace síry v rostlinách dosahovala 4-6,5 mg/g u variant s jarním hnojením. U varianty
s podzimní aplikací hnojiva UREAstabil (var. 11), která vytvořila jiţ v podzimním období větší
mnoţství nadzemní hmoty a i na jaře nejrychleji regenerovala, byly na porostu patrné projevy
nedostatku síry a zjištěná koncentrace dosahovala 3,65 mg/g, tedy deficitní hodnotu dle
zmíněného hodnocení. To dokazuje, ţe porostům s rychlým počátečním jarním růstem je
třeba věnovat zvýšenou pozornost.
Pozitivní vliv hnojení sírou na výnosy semen řepky byl zjištěn jen v roce 2011 (graf 5), kdy
jiţ ve fázi prodluţovacího růstu byly na rostlinách zřetelné projevy nedostatku síry. Aplikace
dusíkatých hnojiv s obsahem síry v letech 2009 a 2010 neměla ve srovnání s aplikací Nhnojiv bez síry vliv na dosaţené výnosy semen řepky, jejich olejnatost ani odběr dusíku
semeny (grafy 5-7). Vyšší obsah dusíku v semenech řepky se u většiny variant hnojení
projevil niţším obsahem oleje. Ověřovaná dusíkatá hnojiva se sírou měla ve srovnání
s hnojivy bez síry větší podíl dusíku v amoniakální formě, která působí pozvolna a na začátku
jarní vegetace je rostlinami málo vyuţívána. Proto je vhodnější, a to zejména při pozdějším a
rychlém nástupu jara, aplikovat hnojivo DASA. McGrath a Zhao (1996) na písčitohlinité půdě
aplikací 40 kg S/ha společně se 180 kg N/ha postupně ve třech dávkách dosáhli průkazného
zvýšení výnosu semen ozimé řepky v průměru o 0,7 t/ha (tj. o 42% vzhledem k variantě bez
S). Největší výnosová odezva byla zjištěna u prvních 10 kg S/ha, další zvyšování dávky síry
jiţ nemělo takový přínos. Zvyšování dávky dusíku nad 180 kg N/ha vyvolalo dokonce sníţení
výnosu semen pokud nebyla zároveň aplikována síra, naopak síra neovlivnila pozitivně výnos,
pokud bylo aplikováno pouze malé mnoţství dusíku (do 100 kg N/ha). Interakce mezi
dusíkem a sírou však byly statisticky průkazné pouze v jednom roce ze tří.
68
„Úroda 12/2011, vědecká příloha―
Graf 2: Nadzemní hmota rostlin řepky při odběru v prodluţovacím růstu (fáze BBCH 51)
LAV
DAM+S
MO
DAMst
2,0
Suchá hmota t/ha
ab
DAM
Us podz+jaro
a
ab
1,5
MO+S
Us
a
ab
b b b
b
b
1,0
ab
ab
ab
ab
a
ab
0,5
0,0
2010
2011
90
80
70
60
50
40
30
20
10
0
LAV
DAM+S
MO
DAMst
DAM
Us podz+jaro
a
ab
ab ab ab ab
MO+S
Us
Graf 4: Mnoţství S v rostlinách odebraných
ve fázi BBCH 51
a
ab
b
ab ab ab
ab ab
b
2010
ab
Odběr S kg/ha
Odběr N kg/ha
Graf 3: Mnoţství N v rostlinách odebraných
ve fázi BBCH 51
9
8
7
6
5
4
3
2
1
0
2011
LAV
MO
MO+S
DAM
DAM+S
DAMst
Us
Us podz+jaro
a
b
ab
a
a
ab
b
b
2010
2011
Graf 5: Výnos semen ozimé řepky při různém hnojení dusíkem a sírou
Výnos semen t/ha
5
4
LAV
LAV+DAM
Us 3x
a ab
a
ab ab
ab ab
ab
LAV+DASA
DAM
Us 2x
MO
DAM+S
Us podz+jaro
MO+S
DAMst
a ab
b
ab ab
3
ab ab
b
ab
a ab ab ab ab
2
1
2009
2010
2011
Odběr N semeny kg/ha
Graf 6: Odběr dusíku semeny ozimé řepky po různém hnojení dusíkem a sírou
130
120
110
100
90
80
70
60
50
LAV
LAV+DAM
Us 3x
a ab
LAV+DASA
DAM
Us 2x
ab
b
ab
ab a
MO
DAM+S
Us podz+jaro
a
ab
b b
2009
2010
69
ab
MO+S
DAMst
b
ab
b
„Úroda 12/2011, vědecká příloha―
Olejatost semen %
Graf 7: Obsah oleje v semenech ozimé řepky po různém hnojení dusíkem a sírou
48
47
46
45
44
43
42
41
40
LAV
LAV+DAM
Us 3x
LAV+DASA
DAM
Us 2x
2009
MO
DAM+S
Us podz+jaro
MO+S
DAMst
2010
Závěr
Z dosaţených výsledků vyplývá, ţe na jarní růst řepky a odběr dusíku rostlinami mělo
pozitivní vliv podzimní přihnojení (říjen) hnojivem UREAstabil v dávce 40 kg N/ha.
Po regeneračním hnojení řepky ozimé kapalným hnojivem DAM 390 aplikovaným damovými
tryskami spolu s přípravkem Stabiluren (obsahuje inhibitor ureasy) byl zjištěn lepší nebo
stejný růst rostlin a odběr dusíku jako po aplikaci běţně pouţívaných pevných hnojiv (LAV,
močovina, UREAstabil ).
Při dělené aplikaci dusíkatých hnojiv do 2 dávek v jarním období byly dosaţeny stejné nebo
lepší výnosy řepky neţ při aplikaci ve 3 dávkách.
Aplikace dusíkatých hnojiv s obsahem síry ve srovnání s aplikací N-hnojiv bez síry měla
příznivý vliv na dosaţené výnosy semen jen v roce 2011, v letech 2009 a 2010 neměla vliv na
výnosy semen řepky, jejich olejnatost ani odběr dusíku semeny.
Vyšší obsah dusíku v semenech řepky se u většiny variant hnojení projevil niţším obsahem
oleje.
Dedikace
Výsledky byly získány s finanční podporou MZe ČR (výzkumný záměr 00027006004).
Pouţitá literatura
Jensen, L.S., Christensen, L., Mueller, T., Nielsen, N.E. 1997. Turnover of residual 15Nlabelled fertilizer N in soil following harvest of oilseed rape (Brassica napus L.). Plant and
Soil 190: 193-202
Matula, J. 2007. Výţiva a hnojení sírou. Metodika pro praxi. VÚRV, v.v.i., 39 stran
McGrath, S. P., Zhao, F.UJ. 1996. Sulphur uptake, yield responses and the interactions
between nitrogen and sulphur in winter oilseed rape ( Brassica napus). The Journal of
Agricultural Science 126: 3-62
Sieling, K., Beims, S. 2007. Effects of 15N Split-application on Soil and Fertiliser N Uptake
of Barley, Oilseed Rape and Wheat in Different Cropping Systems. J. Agronomy & Crop
Science 193: 10-20
Kontaktní adresa:
Ing. Helena Kusá, Ph.D.
VÚRV, v.v.i.; Drnovská 507, 161 06 Praha 6
[email protected]
70
„Úroda 12/2011, vědecká příloha―
VÝZNAM ÚHORŦ V ZEMĚDĚLSKÉ KRAJINĚ
The importance of barrens in agricultural landscape
Vymyslický T.1, Fabšičová M.2, Entová M.3 a Kŧrová J.4
1
Zemědělský výzkum, spol. s r. o., Troubsko
2
Botanický ústav AV ČR, Brno
3
Katedra botaniky, Přírodovědecká fakulta, Univerzita Karlova v Praze
4
Ústav botaniky a zoologie, Přírodovědecká fakulta, Masarykova univerzita v Brně
Abstrakt
V příspěvku je věnována pozornost uměle zaloţeným úhorům v Národním parku Podyjí. Tyto úhory
jsou studovány jako moţnost zvýšení biodiverzity v travních porostech. Byly zaloţeny trvalé plochy v
a) periodicky narušovaném úhoru, b) ploše ponechané spontánní sukcesi a c) sousední
obhospodařované louce. Potvrdilo se, ţe úhory pomáhají mnoha rostlinným druhům při reprodukci z
půdní semenné banky a při uskutečnění jejich ţivotního cyklu. Výsledky analýz fytocenologických
snímků ukazují rozdíly jak v druhovém sloţení, tak i v počtu druhů mezi druhově chudými a bohatými
plochami. Významné rozdíly byly také nalezeny mezi plochami nacházejícími se v různých
sukcesních stadiích. Z pohledu ochrany přírody je pozitivní, ţe nebyl zjištěn masivní výskyt invazních
nebo expanzivních druhů rostlin. Na úhorech převaţovaly druhy běţně se vyskytující v kulturní
krajině, na okrajích polí a na mezích. Podařilo se ale taky nalézt druhy, které v NP Podyjí byly
nezvěstné po mnoho let.
Klíčová slova: travní porosty, úhory, sukcese, vegetace, diversita, management.
Abstract
Artificially established barrens in the Podyjí National Park are studied as one of the sustainable ways
how to increase biodiversity in grasslands. Permanent plots in a) periodically disturbed barren site, b)
plot with spontaneous succession and c) neighbouring managed meadow were established. We
confirmed that barren sites help many plant species to reproduce from the soil seed bank and finish
their life-cycles. The results of analyses of phytosociological relevés show differences in both the
species composition and the number of species between nutrient-poor and nutrient-rich sites.
Significant differences were also found among plots in different successional stages. From the point of
view of nature conservation, no massive occurrence of invasive and expansive species was found.
Species commonly found in cultivated landscapes, field margins and balks prevailed, but we found
also plant species that had been missing in the national park for many years.
Keywords: grasslands, barrens, succession, vegetation, diversity, management.
Úvod
Během posledního století byly přirozené trávníky v Evropě poznamenány úbytkem své
rozlohy a zvyšující se izolací ještě zachovalých a přeţívajících fragmentů, upuštěním od
vhodného hospodaření a zvýšeným přísunem ţivin (Pärtel et al. 2005). Silný pokles
biodiverzity polopřirozených trávníků, křovin, mezí, polních kazů a malých stepních ploch je
spojen s intenzifikací zemědělství a upuštěním od tradičního managementu. Fragmentace
porostů vedla ke ztrátě provázanosti biotopů, měla silný vliv na pokles druhové bohatosti,
změny v dostupnosti ţivin, ale na druhé straně vedla ke zvýšené depozici opadu a k redukci
dostupnosti světla na úrovni společenstev (Soons 2003). To vše vede k poklesu semenné
produkce a klíčivosti semen, genetickému driftu, ale i k nízkému výskytu opylovačů, jakoţto
výsledek genetické eroze uvnitř malých populací rostlin i ţivočichů. Stáří, historie
hospodaření na lokalitě a izolace trávníků od lidského vlivu hrálo stěţejní roli v současném
stavu druhové bohatosti jak nadzemní (aktuální vegetace) tak podzemní (semenná banka). Na
71
„Úroda 12/2011, vědecká příloha―
druhé straně bylo zaznamenáno rozšiřování některých extenzivních druhů zemědělské krajiny
do biotopů úhorů a lad. Ale pouze několik málo prací se zabývalo touto tematikou (Chytrý et
al. 2001, Hofmann & Isselstein 2004).
Materiál a metodika
Národní park Podyjí, nacházející se západně od Znojma, byl vybrán jako výzkumné místo.
Bylo zaloţeno deset experimentálních ploch v odlišných vegetačních typech – suché
(Koelerio-Phleion phleoidis Korneck 1974) a mezofilní trávníky (Arrhenatherion elatioris
Koch 1926). V letech 2009 a 2010 byly hodnoceny tři zásahy: (A) kaţdoroční orba, (B) orba
jen na počátku experimentu a pak ponechání spontánní sukcesi; (C) kontrolní plocha – kosená
louka. V kaţdém opatření bylo zaloţeno 5 trvalých ploch o velikosti 4 x 4 m. Na těchto
plochách byly dvakrát ročně v květnu a v srpnu zapisovány fytocenologické snímky. Pro
jejich zápis byla pouţita sedmičlenná Braun-Blanquetova stupnice. Fytocenologické snímky
byly zapsány do databáze v programu TURBOVEG (Hennekens & Schaminee 2001). Snímky
byly rozděleny na jarní a letní, a byly porovnány. V programu CANOCO (Ter Braak &
Šmilauer 2002) byla provedena kanonická korespondenční analýza. Lokalita byla vybrána
jako kovariáta, jako faktory prostředí byly vybrány zásahy A,B,C (viz výše). Bylo vybráno
499 permutací a redukovaný model. Nomenklatura rostlinných taxonů je sjednocena podle
Klíče ke květeně ČR (Kubát et al., 2002).
Výsledky a diskuze
Výsledky jsou prezentovány v jarním a letním CCA ordinačním diagramu (Obrázek 1 a 2).
Jak je patrné, v získaných datech je velká variabilita. Byly zaznamenány rozdíly mezi jarními
a letními snímky. Orané plochy (zásah A) byly charakterizovány výskytem druhů jako
Raphanus raphanistrum, Thlaspi arvense, Sinapis arvensis, Lamium amplexicaule,
Chenopodium album agg., atd. V létě přibyly další druhy: Echinochloa crus-gallii, Persicaria
lapathifolia, Setaria viridis, Polygonum aviculare agg., atd. Jedná se o typické polní plevele.
Spontánní sukcese (zásah B) byla charakteristická druhy jako Rumex acetosa, Stellaria
graminea, Convolvulus arvensis. V létě byly zaznamenány další druhy, jako např. Rumex
obtusifolius, Lamium album, Agrostis gigantea, Potentilla argentea, Elytrigia repens. To jsou
druhy uţ pokročilejších sukcesních stadií. Luční plochy (zásah C) byly charakterizovány
výskytem lučních druhů: Avenula pubescens, Festuca ovina, Ranunculus acris, Lotus
corniculatus, Plantago media, Trifolium pratense, Poa pratensis, Calamagrostis epigejos,
Trisetum flavescens, Dactylis glomerata, Hieracium sabaudum, Veronica chamaedrys agg.,
atd.
Byl zaznamenán rychlý rozvoj bylinného patra, v květnu dosahovala pokryvnost bylinného
patra 60%, v srpnu uţ byla aţ 95%. Významný rozdíl byl zaznamenán také mezi počtem
druhů v ploše (16-45) a jejich pokryvností (květen 30-60%, srpen 60-95%) mezi ţivinami
chudými a bohatými plochami. Nebyl zjištěn masivní výskyt invazních nebo expanzivních
druhů rostlin. Na úhorech převaţovaly druhy běţně se vyskytující v kulturní krajině, na
okrajích polí a na mezích. Lada a úhory pomáhají mnoha efemérním rostlinným druhům
v reprodukci a umoţňují dokončení ţivotního cyklu. Po vytvoření úhoru se na našich
lokalitách znovu objevily některé vzácné a ohroţené druhy, které přeţívaly v půdní semenné
bance: Thymelaea passerina, Adonis flammea, Bupleurum rotundifolium, Valerianella
rimosa, Tordylium maximum, Filago lutescens, Alcea biennis, Ajuga chamaepitys,
Hyoscyamus niger, atd. Kriticky ohroţený druh Pseudognaphalium luteoalbum byl nalezen
(vyklíčil z půdního vzorku odebraného ze semenné banky) jako zcela nový druh pro NP
Podyjí. Kdyţ srovnáme počty druhů na plochu, najdeme významné rozdíly ve prospěch
narušovaných ploch, zejména v letním termínu. Bylo zaznamenáno mnoho charakteristických
72
„Úroda 12/2011, vědecká příloha―
druhů pro dané vegetační typy (viz výše). Na základě výše zmíněných výsledků lze
konstatovat, ţe úhory mají jednoznačný pozitivní efekt na biodiverzitu krajiny.
Závěr
V našem příspěvku se prokázal význam úhorů, jakoţto důleţitého útočiště rostlinných a
ţivočišných druhů v zemědělské krajině. Vegetace úhorů je během roku značně proměnlivá a
byly zaznamenány signifikantní rozdíly mezi jarní a letní vegetací. Úhory umoţňují
především jednoletým (efemérním) a dvouletým rostlinným druhům, aby se reprodukovaly
z půdní semenné banky a uskutečnily svůj ţivotní cyklus. Po disturbanci byl pozorován
rychlý vývoj bylinného patra, v závislosti na klimatických podmínkách v dané sezóně.
Signifikantní rozdíly byly zaznamenány v počtu druhů a jejich pokryvností mezi jednotlivými
zásahy, zejména pak v letním termínu. Na úhorech převaţovaly druhy běţně se vyskytující
v kulturní krajině, na polních okrajích a mezích, zatímco výskyt invazních nebo expanzivních
druhů byl pouze minimální, coţ je fakt z hlediska ochrany přírody i zemědělství velmi
pozitivní. Závěrem lze poukázat na význam úhorů pro biodiverzitu organismů vázaných na
zemědělskou krajinu. Bohuţel, v současnosti není jejich tvorba podpořena ţádným dotačním
titulem.
Dedikace
Příspěvek vznikl částečně za institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace „Zemědělský výzkum, spol. s r. o.―, za finanční podpory MŠMT ČR
(výzkumný záměr MSM 2629608001) a AVČR (výzkumný záměr AV0Z 60050516).
Pouţitá literatura
Chytrý M., Sedláková I. & Tichý L. (2001): Species richness and species turnover in a
successional heathland. Applied Vegetation Science 4: 89-96.
Hennekens S. M. & Schaminee J. H. J. (2001). Turboveg, a comprehensive database
management system for vegetation data. Journal of Vegetation Science 12: 589–591.
Hofmann M., Isselstein J. (2004): Seedling recruitment on agriculturally improved mesic
grassland: the influence of disturbance and management schemes. Applied Vegetation
Science 7: 193-200.
Kubát K., Hrouda L., Chrtek J. jun., Kaplan Z., Kirschner J., Štěpánek J. (eds.) (2002): Klíč
ke květeně České republiky. Academia, Praha.
Pärtel M., Bruun H. H. & Sammul M. (2005): Biodiversity in temperate European grasslands:
origin and conservation. Grassland Science in Europe, 10: 1-14.
Soons M. (2003): Habitat fragmentation and connectivity. Spatial and temporal characteristics
of the colonization process in plants. Ph. D. Thesis, Utrecht, 129 pp.
Ter Braak, C. J. F. et Šmilauer, P. (2002): CANOCO Reference Manual and CanoDraw for
Windows User‘s Guide: Software for Canonical Community Ordination (version 4.5). Microcomputer Power, Ithaca.
Kontaktní adresa:
Mgr. Tomáš Vymyslický
Zemědělský výzkum, spol. s r. o.
Zahradní 1, 664 41, Troubsko
e-mail: [email protected]
73
„Úroda 12/2011, vědecká příloha―
1.0
Obrázek 1: CCA analýza jarních fytocenologických snímků (P=0.0020, F=9.48). Červené
trojúhelníky označují pozici jednotlivých zásahů v dvourozměrném prostoru grafu. Modré
trojúhelníky označují pozici rostlinných druhů, číslice 6 označuje bylinné patro. Zkratky
druhů jsou uvedeny níţe pod grafy.
TreatA
Lycoeur6
Lamiamp6
Soncole6
Chenalb6
Erodcic6
Polyavi6
Raphrap6
Thlaarv6
Fallcon6
Sinaarv6
Anagarv6
Mentarv6
Equiarv6
Stelmed6
Echivul6
TreatC
Violarv6
Veroper6
Artevul6
Rumecri6
Gleched6
Oxalfon6
Rumeobt6
Planlan6
Elytrep6
Cirsvul6
Antharv6
Dauccar6 Linavul6
Conycan6
Tragori6 Avenpub6
Geumurb6
Planmed6 Violhir6
Gerapra6
Rhinmin6
Trifpra6
Vicitet6
Festovi6
Viciang6
Knauarv6
Ranuacr6
Lotucor6
Dactglo6
Agrieup6 Calaepi6
Rosacan6
Tarasec6
Trifcam6
Poa pra6
Anthodo6 Ceraglu6
Hypeper6
Convarv6
Camppat6
Urtidio6
Rumeace6
Valeloc6
Stelgra6
-1.0
Arenser6
Myosram6
TreatB
-1.0
1.2
Axes
1
2
Eigenvalues
:
0.566 0.146
Species-environment correlations :
0.980 0.843
Cumulative % variance of species data:
6.8
of species-environment relation:
79.5 100.0
Sum of all
eigenvalues
Sum of all canonical
eigenvalues
74
3
0.507
0.000
8.5
0.0
4
0.462
0.000
14.6
0.0
Total inertia
8.632
20.2
8.339
0.712
„Úroda 12/2011, vědecká příloha―
1.2
Obrázek 2: CCA analýza letních fytocenologických snímků (P= 0.0020, F=9.55).
TreatB
Robipse6
Lamialb6
Stelgra6
Rumeobt6
Conycan6
Agrogig6
Potearg6
Urtidio6
Linavul6
Gleched6
Elytrep6
Silelat6
Dauccar6
Rumecri6
Oxalfon6
Myosarv6
Planlan6
Setapum6
Lactser6
Antharv6
Soncasp6
Fallcon6
-1.0
Chenalb6
Setavir6
Polyavi6
Echivul6
Tarasec6
Poa pra6
Calaepi6
Dactglo6 Festrub6
Verocha6 Pastsat6
Planmed6 Carepal6
Achimil6
Trifrep6
Agrieup6 Rosacan6 Galialb6
Centjac6
Hiersab6
Crepbie6
Anagarv6
Mentarv6
Equiarv6
Trisfla6
Ranuacr6
Rhinmin6
TreatC
Artevul6
Tripino6 Violarv6
Gerapus6
Thlaarv6
Erodcic6
Perslap6
Sinaarv6
Salvpra6
TreatA Raphrap6 Echicru6
-1.0
Axes
1
Eigenvalues
:
0.561
Species-environment correlations :
0.975
Cumulative % variance of species data: 6.8
of species-environment relation:
85.9
Sum of all
eigenvalues
Sum of all canonical
eigenvalues
1.3
2
0.092
0.709
7.9
100.0
3
0.497
0.000
14.0
0.0
4
0.440
0.000
19.3
0.0
Total inertia
8.526
8.216
0.652
Vysvětlivky druhových zkratek:
Agrieup6-Agrimonia eupatoria
Agrogig6-Agrostis gigantea
Achimil6-Achillea millefolium agg.
Anagarv6-Anagallis arvensis
Antharv6-Anthemis arvensis
Anthodo6-Anthoxanthum odoratum
Arenser6-Arenaria serpyllifolia
Artevul6-Artemisia vulgaris
75
„Úroda 12/2011, vědecká příloha―
Avenpub6-Avenula pubescens
Calaepi6-Calamagrostis epigejos
Campat6-Campanula patula
Carepal6-Carex pallescens
Centjac6-Centaurea jacea
Ceraglu6-Cerastium glutinosum
Cirsvul6-Cirsium vulgare
Convarv6-Convolvulus arvensis
Conycan6-Conyza canadensis
Crepbie6-Crepis biennis
Dactglo6-Dactylis glomerata
Dauccar6-Daucus carota
Echicru6-Echinochloa crus-gallii
Echivul6-Echium vulgare
Elytrep6-Elytrigia repens
Equiarv6-Equisetum arvense
Erodcic6-Erodium cicutarium
Fallcon6-Fallopia convulvulus
Festovi6-Festuca ovina
Festrub6-Festuca rubra agg.
Galialb6-Galium album
Gerapra6-Geranium pratense
Gerapus6-Geranium pusillum
Geumurb6-Geum urbanum
Gleched6-Glechoma hederacea
Hiersab6-Hieracium sabaudum
Hypeper6-Hypericum perforatum
Chenalb6-Chenopodium album agg.
Knauarv6-Knautia arvensis
Lactser6-Lactuca serriola
Lamialb6-Lamium album
Lamiamp6 – Lamium amplexicaule
Linavul6-Linaria vulgaris
Lotucor6-Lotus corniculatus
Lycoeur6 – Lycopus europaeus
Mentarv6-Mentha arvensis
Myosarv6-Myosotis arvensis
Myosram6-Myosotis ramosissima
Oxalfon6-Oxalis fontana
Pastsat6-Pastinaca sativa
Perslap6-Persicaria lapathifolia
Planlan6-Plantago lanceolata
Planmed6-Plantago media
Poapra6-Poa pratensis
Polyavi6-Polygonum aviculare agg.
Potearg6-Potentilla argentea
Ranuacr6-Ranunculus acris
Raphrap6-Raphanus raphanistrum
Rhinmin6-Rhinanthus minor
Robipse6-Robinia pseudacacia
Rosacan6-Rosa canina agg.
Rumeace6-Rumex acetosella
Rumecri6-Rumex crispus
Rumeobt6-Rumex obtusifolius
Salvpra6-Salvia pratensis
Setapum6-Setaria pumila
Setavir6-Setaria viridis
Silelat6-Silene latifolia
Sinaarv6-Sinapis arvensis
Soncasp6-Sonchus asper
Soncole6-Sonchus oleraceus
Stelgra6-Stellaria graminea
Stelmed6-Stellaria media
Tarasec6-Taraxacum sect. ruderalia
Thlaarv6-Thlaspi arvense
Tragori6-Tragopogon orientalis
Trifcam6-Trifolium campestre
Trifpra6-Trifolium pratense
Trifrep6-Trifolium repens
Tripino6-Tripleurospermum inodorum
Trisfla6-Trisetum flavescens
Urtidio6-Urtica dioica
Valeloc6-Valeriana locusta
Verocha6-Veronica chamaedrys
Veroper6-Veronica persica
Viciang6-Vicia angustifolia
Vicitet6-Vicia tetrasperma
Violarv6-Viola arvensis
Violhir6-Viola hirta
76
„Úroda 12/2011, vědecká příloha―
ROZDÍL V SUKCESI DRUHOVÉ SKLADBY POROSTU PŘI ŘÍZENÉM
A SAMOVOLNÉM UVEDENÍ ORNÉ PŦDY DO KLIDU
Differences in the succession of stand species composition in the supervised
and spontaneous conversion of arable land into fallow
Krausová A., Hrabě F., Rosická L., Hejduk S.
Mendelova univerzita v Brně, Agronomická fakulta
Abstrakt
Z výsledků hodnotících systém řízeného a samovolného zatravnění orné půdy a obhospodařování
porostů mulčováním (3x a 1x za rok) vyplývá průkazný vliv intenzivního mulčování (3x) na sníţení %
dominance travní a zvýšení % D vikvovité sloţky a i ostatních bylin. Třísečné mulčování a dále i
systém řízeného zatravnění s vyuţitím jetelotravní směsi průkazně sníţilo zastoupení dominance
Elytrigia repens L. v porovnání se samovolným zatravňováním. Mulčování 1x za rok sníţilo průkazně
druhovou pestrost porostů.
Klíčová slova: orná půda – travní porost – mulč – systém zaloţení – počet sečí
Abstrakt
Experimental results evaluating the systems of supervised and spontaneous conversion of arable land
into fallow and the variants of stand management by mulching (3x and 1x a year) showed a significant
influence of intensive mulching (3x) on the suppression of the percentage share of grasses in the sward
and on the increase of % D of legumes and other herbs. As compared with the spontaneous greening,
the three-cut mulching as well as the system of supervised greening with the use of clover-grass
mixture significantly decreased the dominance of Elytrigia repens L. in the sward. Mulching 1x a year
significantly reduced the species diversity of the experimental stands.
Keywords: arable land, grass stand, mulch, stand establishment system, number of cuts
Úvod
V současné době je diskutováno systémové začlenění travních porostů na orné půdě („půda
v klidu―) do systému obhospodařování zlepšujícího kulturnost krajiny a podporujícího
produkci polních plodin (např. rozšíření nabídky pro opylovače) či návrat řady druhů
ţivočichů, zvl. ptáků (BRABAND, D. et.al., 2003). Diskutovaná je i tématika řízeného
zatravňování s vyuţitím „regionálních― směsí, či spontánního ozelenění, u něhoţ dle
SCHAFFNER et.al. (1998a, 1998b) je nebezpečí zvl. na chudších stanovištích s ochuzenou
zásobou („bankou―) semen v půdě, převahy úzkého okruhu méně ţádoucích druhů a i
nejistoty dosaţení ţádoucí a rychlé pokryvnosti s návazným nebezpečím vyplavení NO3N.
Problematiku sukcese rozvádí u trvalých travních porostů FIALA, GAISLER (1999).
Omezení rozšíření Trifolium repens L. v mulčovaných trávnících a podporu růstu trav
prokazují výsledky výzkumu prezentované CAGAŠ et.al. (2011).
Materiál a metoda
Výzkum byl realizován v letech 2006-2010 ve Výzkumné pícninářské stanici Vatín
(pracoviště Mendelovy univerzity v Brně) v CHKO Ţďárské vrchy. Jedná se o BVO
s nadmořskou výškou 650 m n.m. Průměrná roční teplota 6,9 oC, roční úhrn sráţek (průměr
30 let) 617,5 mm. Půdní podmínky - orná půda, půdní typ - kambidzem, půdní druh písčitohlinitá.
Pokusné varianty
Experiment byl zahájen v roce 2005 systémem blokového parcelového pokusu ve 4.
opakováních dle náhodného uspořádání následovně.
77
„Úroda 12/2011, vědecká příloha―
Intenzita vyuţívání (mulčování):
blok I - mulč 3x za rok (31.5.; 31.8.; 31.10.)
blok II - mulč 1 x za rok (31.8.)
Varianty porostŧ
A. řízené zatravnění s výsevem jetelotravní směsky (90 % trávy + 10 % Trifolium repens L.);
B. samovolné zatravnění plochy s aplikací Roundupu na jaře před zahájením řešení;
C. samovolné zatravnění bez aplikace Roundupu před zahájením řešení.
Stanovení dominance (% váhové) jednotlivých druhů provedeno ručním rozborem z 1. seče a
z plochy 1,0 m2 jednotlivých parcel. Po usušení druhů a zváţení vypočten % podíl (% D) na
hmotnosti suché fytomasy celého vzorku (bez podílu odumřelé fytomasy). V příspěvku jsou
prezentovány údaje o struktuře (% D) jednotlivých porostových sloţek, údaje o dominantním
druhu Elytrigia repens L. a o druhové pestrosti porostů. Statistické vyhodnocení výsledků
bylo provedeno prostřednictvím ANOVA a následným Tukey HSD testem s pomocí
programu STATISTIKA (verze 8).
Výsledky
Vliv intenzity mulčování na strukturu travního porostu
Z porovnání průměrných hodnot % dominance (tab. 1) hodnotících vliv intenzity (počtu)
mulčování v roce byl zjištěn průkazný vliv mulčování 3x ročně na sníţení % D (průměr 61,0
%) travní sloţky, dále na zvýšení dominance vikvovité sloţky (průměr 15,1 %) a rovněţ vyšší
% ostatních bylin (průměr 23,9 %) v porovnání s mulčováním jen 1x za rok. U této varianty
4/5 porostu tvoří travní sloţka s převahou (aţ 2/3) plevelného Elytrigia repens L., zvl. u
variant samozatravnění plochy. Uvedený trend udává VELICH (1986) a u sniţování podílu
vikvovité sloţky CAGAŠ et.al (2011) při mulčování trávníkových porostů.
Vliv systému zakládání na strukturu travních porostŧ
Systém zaloţení porostů se neprojevil průkazně do podílu travní sloţky a to ani v interakci
s intenzitou mulčování. Z hlediska zastoupení vikvovité sloţky (% D) v porostu jsou rozdíly
mezi jednotlivými systému zakládání nevýznamné ( A–10,5 %, B–18,3 %, C–16,5 % při 3x
mulčování, resp. u 1x mulčované jen 1,5 %-3,2 %-3,1 %). U variant se samozatravněním při
interakci s 3x mulčované dochází k rychlejšímu trendu vzrůstu zastoupení vikvovité sloţky.
S odkazem na zjištění LÖTSCHER (1994) se zde projevuje v porovnání s variantou řízeného
zatravnění vyšší světelný efekt. Dokladem je nízké % D uvedené jeteloviny v porostech
mulčovaných jen 1x za rok. Ostatní byliny tvoří v porostech 3x ročně mulčovaných 1/5 aţ 1/4
podílu (% D); rozdíl mezi systémy zakládání v tomto směru není průkazný. Významně je však
niţší % D ostatních bylin v interakci samozatravnění (u obou variant) x mulč 1x za rok (8,3 %
a 9,2 %) v porovnání s var. řízeného zatravňování (17,1 %). V tomto případě se projevuje
nejen konkurenční síla převládající travní sloţky, ale dle KLIMEŠE (2000) i moţný
alelopatický vztah, tj. vliv Elytrigia repens L. na sníţení vitality jiných druhů. Výrazný rozdíl
v dominanci Elytrigia repens L. u samozatravněných porostů (56,2 %) a variantou řízeného
zatravnění (jen 24,8 %; tab. 2). K rozšíření Elytrigia repens L. přispívají ţiviny z rozkladu
fytomasy a minimálního utuţování půdy.
Druhová pestrost mulčovaných porostŧ
Druhová pestrost mulčovaných travních porostů na orné půdě je nízká (tab. 3). Rozdíly
v počtech druhů ve vztahu k systému zaloţení porostů jsou neprůkazné (průměr A – 14 druhů,
B – 15 druhů, C – 13 druhů). Maximální počet druhů, tj. 21, byl zjištěn jen u var. B, tj.
samovolné zatravnění plochy s aplikací Roundupu. Ve vztahu k počtu mulčování došlo ke
sníţení počtu druhů u 1x ročně mulčovaných porostů na 12,7 v porovnání s 15,3 druhy u 3x
mulčovaných. Z hlediska počtu převaţují bylinné druhy (průměr 7,6) před travními druhy
(průměr 5,5).
78
„Úroda 12/2011, vědecká příloha―
Nízká druhová pestrost mulčovaných travních porostů vyplývá v souladu se zjištěním
SCHAFFNER et.al. (1998b) s redukcí plevelných druhů kaţdoročně kultivované orné půdě.
Pozdní mulčování – u 3x mulčovaných porostů koncem května a u 1x mulčovaných porostů
koncem srpna – umoţňuje vysoký nárůst fytomasy, omezující etablování jiných druhů
z blízkých zdrojů. Obdobný trend, t.j vyšší počet druhů v obnoveném lučním porostu (78
druhů) po mechanickém zpracování kypřeného drnu a bez pouţití herbicidů v porovnání
s původním počtem v trvalém porostu (67 druhů) zjistila i ZELENÁ (in. Rychnovská, M. ed.,
1993). Ochuzení druhové pestrosti travních porostů se vzrůstajícím počtem sečí
(BUCHGRABER, GINDL, 2004) je platné pro intenzivně pícninářsky vyuţívané travní
porosty. Ústup některých travních a bylinných druhů vlivem mulčování prokázal FIALA,
GAISLER (1999).
Závěr
Vliv systému řízeného zatravnění orné půdy v porovnání se systémy samozatravnění (s
vyuţitím Roundupu a bez) se projevil nevýznamně v podílu trav a vikvovitých. Významný
vliv na strukturu porostu byl u počtu mulčování. Podíl (% D) trav při mulčování 3x v roce byl
61 % a při 1x mulč 81-88 %. Vyšší bylo při intenzivním mulčování % D vikvovitých (průměr
15,1 %) v porovnání s 2,6 % D u 1x mulč. Podíl dominantního Elytrigia repens L. byl
systémem řízeného zatravnění sníţen na 12,6–36,9 % v porovnání s jeho % u porostů se
samovolnou sukcesí, tj. 49,7-44,8 % při mulčování 3x ročně a 62,8-68,5 % při mulčování 1x
v roce. Druhová pestrost vlivem mulčování byla sníţena jen při samovolné sukcesi – rel. -23,0
% a -26,7 %.
Dedikace
Příspěvek byl zpracován s podporou Výzkumného záměru č. MSM6215648905 uděleného
Ministerstvem školství, mládeţe a tělovýchovy České republiky.
Pouţitá literatura:
Braband, D., Haack, S., Oppermann, R., Schiller, E., T. van Elsen (2003) Artenreiches
Ackerland- Kennarten und Metodik zur Feststellung förderwürdiger artenreicher
Ackerflächen. In: Artenreiches Grünland. Eugen Ulmer GmbH & Co, Stuttgart, 146-150,
ISBN 3-8001-4261-9
Buchrgaber,K.,Gindl (2004): Zeitgemässe Grünland-Bewirtschaftung 2. Völlig neubearbeitete
Auflage, Leopold Stocker Verlag, Graz-Stuttgart, 192 pp. ISBN 3-7020-1073-4
Cagaš, B., Ševčíková, M., Hrabě, F., Straková, M., Hejduk, S., Janků, L., Knot, P., Lošák, M.,
Straka, J. (2011): Zakládání a ošetřování krajinných trávníků a travnatých ploch veřejné
zeleně, certifikovaná metodika, Svaz zakládání a údrţby zeleně, Brno, 65 s
Fiala, J., Gaisler, J. (1999): Obhospodařování travních porostů pícninářský nevyuţívaných.
Metodiky pro zemědělskou praxi. Praha: Ústav zemědělských a potravinářských
informací.
Klimeš, F (2000): Dynamics of species richners of floodplain meadows. Rostl. Výr., 46, (5):
199-208
Lötscher,M. (1994): Austrieb und Entwicklung der Seitentriebe von Weissklee (Trifolium
repens L.), Einfluss der Bewurzelung Sowie der Lichtintensität und Qualität. Diss ETH Nr.
10454, Zürich, 81 s.
Schaffner, D., S. Keller & P.M. Fried (1998a): Spontanbegrünung von Brachen – im
Mittelland sinnvoll? Agrarforschung 5 (5), 257-259
Schaffner, D., A. Schwab, T. Zwimpfer & P. Kappeler (1998b): Saatmischungen beeinflussen
die Vielfalt in Buntbrachen. Agrarforschung 5 (4), 169-174
Velich, J. Studium vývoje produkční schopnosti trvalých lučních porostů a drnového procesu
při dlouhodobém hnojení a jeho optimalizace. VŠZ Praha, 1986, 162 s.
79
„Úroda 12/2011, vědecká příloha―
Zelená, V.: Structure of the populations of plant communities. Inf: Rychnovská, M. (ed.):
Structure and functioning of Seminatural meadows. Academia, Praha, 1993, s. 83-98
Tab. 1: Vliv způsobu zaloţení a intenzity mulčování na strukturu travního porostu. Vatín,
2006-2010
Systém zaloţení
Dominance
Intenzita
mulč/rok
ost.
byliny
3x
62,7aA
10,5aA
26,8aA
1x
81,4bA
1,5aA
17,1aA
A. řízené
průměr
72,1
6,0
21,9
3x
61,7aA
18,3bA
20,0aA
B. samozatravnění +
1x
88,5bA
3,2aA
8,3aA
Roundup
průměr
75,1
10,7
14,2
3x
58,6aA
16,5bA
24,9aA
C. samozatravnění
1x
87,7bA
3,1aA
9,2aA
bez Roundupu
průměr
73,1
9,8
17,1
3x
61,0
15,1
23,9
průměr (ABC)
1x
85,9
2,6
11,5
Stejná malá písmena znamenají statisticky neprůkazný rozdíl mezi intenzitou ošetřování a stejná velká písmena
neprůkazný rozdíl mezi systémem zaloţení (P ≤ 0,05)
Tab. 2:
trávy
vikvovité
Dominance Elytrigia repens v mulčovaných travních porostech
% D Elytrigia repens / systém mulčování
A.
B. samozatravnění C. samozatravnění
průměr
řízené
+ Roundup
bez Roundupu
3x
12,6aA
49,7aB
44,8aB
35,7
1x
36,9bA
62,8aB
68,5bB
55,9
průměr
24,5
56,2
56,6
Stejná malá písmena ve sloupcích znamenají statisticky neprůkazný rozdíl mezi intenzitou ošetřování a stejná
velká písmena neprůkazný rozdíl mezi systémem zaloţení (P ≤ 0,05)
Intenzita
mulč/rok
Tab. 3:
Počty druhů v mulčovaných travních porostech. Vatín, 2006-2010
Systém zaloţení
A. řízené
B.
samozatravnění
+ Roundup
C.
samozatravnění
bez Roundupu
průměr (ABC)
Intenzita
mulč/rok
3x
1x
průměr
3x
1x
průměr
3x
1x
průměr
3x
1x
Počet druhů v travním porostu
14 (18)
14 (21)
6
6
1
1
ost.
byliny
7
7
17 (21)
13 (17)
6
5
1
1
10
7
15 (17)
11 (15)
5
5
1
0
9
6
15,3
12,7
5,7
5,3
1,0
0,7
8,6
6,7
celkem
trávy
vikvovité
Kontaktní adresa:
Prof. Ing. František Hrabě, CSc. Mendelova univerzita v Brně, Agronomická fakulta,
Zemědělská 1, 613 00 Brno, [email protected]
80
„Úroda 12/2011, vědecká příloha―
VLIV VYBRANÝCH PLODIN NA TVORBU POVRCHOVÝCH
ODTOKŦ V PODMÍNKÁCH ČESKOMORAVSKÉ VRCHOVINY
Effect of selected crops on surface runoff occurrence under BohemiaMoravian upland condition
Hejduk S., Sochorec M.
Mendelova univerzita v Brně
Abstrakt
Povrchový odtok ze zemědělské půdy je neţádoucí jev, který sniţuje dotaci vody ze sráţek do půdy a
do podzemních vod, zvýrazňuje projevy sucha a můţe způsobovat povodně. V tomto příspěvku jsou
hodnoceny povrchové odtoky ze dvou typů travních porostů (extenzivně a intenzivně
obhospodařovaných), siláţní kukuřice, brambor, ozimé pšenice a z holé vegetací nekryté půdy. Během
vegetačního období vykazují oba typy travních porostů výrazný ochranný účinek proti vzniku
povrchového odtoku. V zimním a předjarním období však intenzivně obhospodařované travní porosty
tento ochranný účinek ztrácí. Během vegetačního období 2008-2010 bylo zjištěno nejniţší mnoţství
3
-1
-1
povrchově odteklé vody na obou typech travních porostů (52,4 a 53,4 m ha rok ), zatímco nejvyšší
3
-1
1
odtoky byly zaznamenány u holé půdy a na stanovišti siláţní kukuřice (614.3 a 487.0 m ha ro ).
Naopak v zimním období (X-IV) nebyly zjištěny mezi jednotlivými variantami
Klíčová slova: povrchový odtok, přívalové deště, tání sněhu
Abstract
Surface runoff from agriculture land is undesirable phenomenon as it reduces dotation of water from
precipitation into soil and underground water, emphasizes drought symptoms and it can cause floods.
This contribution deals with an evaluation of surface runoffs from two types of grassland (extensively
and intensively managed), silage maize, potatoes, winter wheat and bare soil. During vegetation period
grassland express distinct protective effect and prevent effectively surface runoffs. In winter and early
spring period however, intensively managed grasslands lose the positive effect.Within the growing
3
1
seasons 2008 - 2010, the least average runoff was found on both grasslands (52.4 and 53.4m ha
-1
3
year ), while the highest runoffs were measured on bare soil and maize stands (614.3 and 487.0 m
ha-1year-1 respectively). Reversely in winter period (X-IV) there were found no significant differences
among the variants.
Key words: surface runoff, heavy rains, snow melting
Úvod
Travní porosty plní řadu mimoprodukčních funkcí a jednou z nejdůleţitějších je regulace toku
vody v krajině. Velmi důleţitá je jejich schopnost bránit vzniku, popř. omezovat objem
povrchového odtoku. Povrchový odtok je povaţován za neţádoucí jev, neboť sniţuje dotaci
vody ze sráţek do půdy a do podzemních vod, zvýrazňuje projevy sucha a můţe způsobovat
lokální povodně a erozi půdy.
Ochranný účinek travních porostů je dán celoroční přítomností vegetačního pokryvu na
povrchu půdy, který chrání půdní agregáty před destrukčním účinkem dešťových kapek. Pod
travními porosty se vytváří stabilní, droptovitá struktura a po zatravnění orné půdy výrazně
narůstá obsah půdní organické hmoty. Je to dáno jednak absencí kultivace a tím omezením
mineralizace a také vysokou produkcí podzemní biomasy (Nösbergeret al., 2000).Přívalové
deště vytváří na povrchu holé půdy málo propustnou membránu, která výrazně sníţí její
infiltrační schopnost. Tím vznikají příznivé podmínky pro povrchový odtok sráţkových vod.
Přívalové deště jsou zvláště nebezpečné, pokud se vyskytnou v jarním období, kdy půda ještě
není dostatečně pokryta vegetací. Půdní membrána (krusta) je produktem mechanického
81
„Úroda 12/2011, vědecká příloha―
působení úderů vodních kapek na holou půdu. Po vzniku této krusty dojde ke 200 aţ 400
násobnému sníţení infiltrační schopnosti půdy (Fohreret al., 1999).Tlapák et al. (1992) uvádí
příklady povodní, které byly způsobeny přívalovými dešti na velmi malém území 3 – 10 km2
z obcí Luka nad Jihlavou v roce 1988 a z Brtnice u Jihlavy v roce 1970.
Na druhé straně, intenzivně obhospodařované travní porosty v níţinných oblastech ztrácí
během zimního období tuto ochranou funkci v důsledku zhutnění půdy, rychlejšího tání sněhu
na travním strništi v porovnání s ornou půdou a díky pomalejšímu zániku zledovatělého
půdního horizontu v předjaří (Hejduk a Kasprzak, 2010).
Cílem tohoto příspěvku je demonstrovat hydrologický význam travních porostů v krajině a
poukázat na jejich schopnost eliminovat vznik povrchových odtoků ve vegetačním období.
Materiál a metody
Níţe uvedené výsledky byly získány při měření povrchových odtoků v letech 2008–2010 na
Výzkumné pícninářské stanici Mendelovy univerzity ve Vatíně (49o15´5″N, 15o 58´15″E).
Odtokoměrná soustava leţí v nadmořské výšce 540 m a skládá se z 12 ploch o velikosti 10,0
m2 (délka svahu 4,0 m a šířka parcel 2,5 m) se svaţitostí 5o. Půdním představitelem je
písčitohlinitá kambizem (obsah jílnatých částic 27,0%) vytvořená na deluviuorthorul.
Polovina ploch je orientována na jih, další polovina na sever, takţe kaţdá z šesti variant
s odlišným vegetačním pokryvem je přítomna na obou expozicích. Plochy jsou přizpůsobeny
pro měření povrchových odtoků tak, ţe spodní části parcel navazují na ţlábek, který
zachycuje povrchový odtok. Záchytný ţlábek je krytý proti dopadu sráţek a odvádí
zachycenou vodu, případně splaveniny do záchytné nádrţe o objemu 160 litrů.
Během vegetačního období byly jednotlivé dvojice parcel obdělávány následovně:
1. Trvalý travní porost se standardním způsobem obhospodařování (3 seče, 100 kg
N+PK).
2. Trvalý travní porost s extenzivním způsobem obhospodařování (2 seče, bez hnojení,
porost nebyl posečen před nástupem zimního období). Oba trvalé travní porosty byly
zaloţeny v roce 2001.
3. Holá půda (kontrolní varianta) – půda byla udrţována v bezplevelném stavu pomocí
herbicidů, popř. byly jednotlivé plevele vytrhávány.
4. Ozimá pšenice (výsev bez orby po sklizni brambor koncem září nebo na počátku října)
5. Siláţní kukuřice (výsev do řádků o rozteči 75 cm na počátku května po orbě, po
výsevu byl povrch půdy ošetřen preemergentním herbicidem)
6. Brambory (typická plodina v dané oblasti, rozteč řádků 70 cm, po výsadbě ošetření
preemergentním herbicidem)
Varianty 3 aţ 6 byly střídány v rámci rotace. Hnojení bylo k jednotlivým plodinám
aplikováno podle metodických postupů a před plánovanou výsadbou brambor byl
zaoránchlévský hnůj v dávce 40 t.ha-1.
Během zimního období byly jednotlivé odtokoměrné plochy udrţovány v následujícím stavu:
1. Trvalý travní porost před začátkem zimního období posečený
2. Trvalý travní porost s ponechaným porostem o výšce 100 – 200 mm
3. Kyprá půda s urovnaným povrchem po orbě (rytí) do hloubky 200 mm
4. Strniště pšenice
5. Strniště kukuřice
6. Ozimá pšenice vysetá do půdy bez orby po sklizni brambor
82
„Úroda 12/2011, vědecká příloha―
Jednotlivá měření byla brána jako průměrné hodnoty objemu povrchových odtoků z obou
orientací svahu. Pro statistické analýzy byla pouţita ANOVA (Statistica 7.1, StatSoft)
s následným testováním podle Tukey (p = 0.05).
Výsledky a diskuze
Celkové objemy povrchových odtoků v období květen aţ září v letech 2008 aţ 2010
z jednotlivých plodin a jejich srovnání s holou půdou jsou uvedeny v tab. 1. Z tabulky
vyplývá, ţe povrchové odtoky z holé půdy a ze stanoviště siláţní kukuřice jsou neprůkazně
odlišné, odtoky z travních porostů a z ozimé pšenice jsou průkazně niţší. Mnoţství vody,
které povrchově odtéká z porostů siláţní kukuřice, způsobuje nejen viditelné erozní a
povodňové škody, ale přispívá také k deficitu vody v půdě. Tento deficit můţe v suchých
letech limitovat produkci rostlin (v průměru 48,7 mm za období vegetace).
Tab. 1: Srovnání povrchových odtoků (m3 ha-1) ve vegetačním období (V-IX) z jednotlivých
variant pokryvu půdy v období 2004 – 2010
Měřené období (VIX)
Půdní pokryv
pšenice
holá
ozimá
půda
99,9
808,3
2008
travní porost
intenzivní
56,8
travní porost
extenzivní
44,8
siláţní
kukuřice
483,6
2009
54,8
44,4
73,9
436,5
384,5
278,6
2010
Ø 2008 – 2010*
45,7
52,4a
70,9
53,4 a
61,5
78,4 a
598,0
614,3b
593,0
487,0b
225,2
410,9 ab
Srovnání (%)
8,5
8,7
12,8
100
79,3
66,9
brambory
728,8
* označení rozdílnými písmeny znamená statistiky průkazné rozdíly (p < 0,05)
Relativně malé rozdíly mezi odtoky z porostů siláţní kukuřice a z holé půdy lze vysvětlit
pomalejším počátečním růstem kukuřice při niţších teplotách a tím delším obdobím, kdy
nebyla půda chráněna před účinky dešťových kapek. Dalším faktorem, který sniţoval rozdíly
mezi holou půdou a kukuřicí, byla kaţdoroční tvorba krusty na povrchu půdy v porostech
kukuřice na počátku jejich vegetace, jejíţ přítomnost zvyšovala součinitele povrchového
odtoku i v pozdějších obdobích. Vzhledem k tomu, ţe půda nebyla zhutňována pojezdy těţké
zemědělské techniky, je pravděpodobné, ţe v praxi by byly hodnoty součinitelů povrchového
odtoku větší.
V mimovegetačním období nebyly zjištěny mezi jednotlivými variantami zpracování půdy
statisticky významné rozdíly (tabulka 2). Celkový objem povrchových odtoků byl také
podstatně niţší, neţ v průběhu vegetace. Nepotvrdilo se zde průkazné sníţení povrchových
odtoků z extenzivně obhospodařovaných travních porostů, které bylo zaznamenáno v níţinné
oblasti Brna (Hejduk a Kasprzak, 2004). Souvisí to zřejmě s niţší hloubkou promrzání půdy
v důsledku pravidelné sněhové pokrývky a s absencí častých oblev a zimních dešťů
v podmínkách Českomoravské vrchoviny. V důsledku těchto skutečností většina sráţkové
vody spadlé v podzimním a zimním období zasakuje do půdy a obohacuje podzemní a
povrchové vody v období tání.
83
„Úroda 12/2011, vědecká příloha―
Tab. 2: Srovnání povrchových odtoků v mimovegetačním období (X-IV) z jednotlivých
variant zpracování půdy v období 2008 – 2011 (m3 ha-1)
Měřené období
(X - IV)
2008/09
travní porost
intenzivní
71,0
2009/10
43,3
Půdní pokryv
travní porost strniště kyprá
extenzivní
pšenice půda
50,3
113,6
56,7
21,6
58,4
13,6
31,8
4,5
21,7
13,1
9,9
13,7
a
a
a
a
2008 – 2011*
39,6
31,2
61,7
30,4
39,4a
Srovnání
130,3
102,6
203,0
100
129,6
* označení rozdílnými písmeny znamená statistiky průkazné rozdíly (p < 0,05)
14,4
52,6a
172,9
2010/11
24,6
strniště ozimá
kukuřice pšenice
90,9
111,5
Závěr
Z uvedených výsledků vyplývá, ţe porostysiláţní kukuřice vyvolávají ve vegetačním období
průkazně vyšší povrchové odtoky neţ travní porosty a ozimá pšenice. Rozdíly se zvyšují
v případě přívalových dešťů. Povrchově odtékající voda způsobuje erozi půdy, lokální
povodně a ochuzuje rostliny o vláhu během následujícího bezesráţkového období.
V mimovegetačním období nebyly zjištěny průkazné rozdíly mezi povrchovými odtoky z
travních porostů, strniště pšenice a kukuřice a ozimé pšenice.
Dedikace
Příspěvek byl zpracován s podporou Výzkumného záměru č. MSM6215648905 „Biologické a
technologické aspekty udrţitelnosti řízených ekosystémů a jejich adaptace na změnu klimatu―
uděleného Ministerstvem školství, mládeţe a tělovýchovy České republiky a s podporou
Interní grantové agentury Agronomické fakulty MENDELU č. TP 2/2011.
Pouţitá literatura
Fohrer, N., Berkenhagen, J., Hecker, J.M., Rudolph, A., 1999: Changing soil and surface
conditions during rainfall single rainstorm/subsequent rainstorms. Catena 37:355-375
Hejduk, S., Kasprzak, K., 2004: Advantages and Risks of Grassland Stands from the
Viewpoint of Flood Occurrence. In: Proceedings of EGF General meeting, 'Grassland
Science in Europe, Vol 9', Luzern, p. 228 - 230
Hejduk, S., Kasprzak, K., 2010: Specific features of water infiltration into soil with different
management in winter and early spring period. J. Hydrol. Hydromech.,58, (3): 175-180
Nösberger, J., Blum, H., Fuhrer, J., 2000: Crop Ecosystem Responses to Climatic Change:
Productive Grasslands. Climate Change and Global Crop Productivity. CAB international,
p. 271 - 291
Tlapák, V. Šálek, J., Legát, V., 1992: Voda v zemědělské krajině. Zemědělské nakladatelství
Brázda, Praha, 320 s.
Kontaktní adresa:
Ing. Stanislav Hejduk Ph.D.,
Ústav výţivy zvířat a pícninářství AF,
Mendelova univerzita v Brně, Zemědělská 1, 613 00 Brno
e-mail: [email protected]
84
„Úroda 12/2011, vědecká příloha―
VYUŢITÍ LUSKOVINO-OBILNÍCH SMĚSEK V EKOLOGICKÉM
ZEMĚDĚLSTVÍ
Utilization of cereals and grain legumes intercropping in organic
farming systems
Huňady I., Hochman M., Poníţil A.
AGRITEC výzkum, šlechtění a sluţby s.r.o., Šumperk
Abstrakt
O luskovino-obilní směsky (LOS) narůstá v ekologickém zemědělství (EZ) zájem nejen pro jejich
pozitivní vliv na půdu, schopnost zvyšovat a stabilizovat výnosy, omezovat růst plevelů, zlepšovat
zdravotní stav plodin a sniţovat výskyt některých škodlivých organismů. Pěstování LOS jako hlavní
plodiny se jeví jako jedno z perspektivních řešení směřujících ke zvýšení soběstačnosti ekologických
farem s ohledem na zásobení kvalitním domácím jadrným krmivem s vysokým obsahem proteinů. Tak
mohou ekofarmy sníţit svou závislost na importu biokrmiv ze zahraničí, coţ můţe přispět ke zlepšení
jejich ekonomické situace. V rámci výzkumného projektu byly proto v letech 2008 - 2010 zakládány
maloparcelkové pokusy s hrachem a obilovinami (pšenice, ječmen) za účelem vyzkoušení nových
potenciálně vhodných odrůd a jejich kombinací pro pěstování v LOS a stanovení optimálního poměru
komponent směsky. Tyto informace jsou nezbytné pro reintrodukci LOS do osevních sledů EZ.
Klíčová slova: ekologické zemědělství, luskovino-obilní směsky, hrách, pšenice, ječmen
Abstract
The legume-cereal intercropping (LOS) in organic farms (OF) is of special interest not only for its
positive influence on the soil, the ability to increase and stabilize yields, reduce weed infestation,
improve the health of crops and reduce the incidence of certain harmful organisms. The introduction
of LCI growing as major crop appears to be one of the promising solutions to increase self-sufficiency
of OF with regard to the supply of quality home-made concentrates with high protein content. In this
way, OF can reduce its dependence on imported organic fodder from abroad, which can help to
improve their economic situation. In years 2008-2010, plot trials with intercropped peas and spring
cereals (wheat, barley) were conducted. Varieties and pea-cereal combinations (seed ratios) were
screened to evaluate the suitability of the varieties for intercropping, and the best pea to cereal ratio in
the seed mixture. These know-how is necessary for reintroduction LCI in the growing systems of OF.
Key words: organic farming, pea-cereal intercropping, pea, wheat, barley
Úvod
Ekologické zemědělství (EZ) je celosvětově podporovanou zemědělskou strategií významně
přispívající k udrţitelnému rozvoji a ochraně ţivotního prostředí na Zemi. V současné době je
EZ nejrychleji rostoucím zemědělským odvětvím. V České republice (ČR) absolvovalo EZ od
svého počátku dynamický rozvoj. Z alternativního zemědělského systému vznikla státem
uznávaná a zákonem definovaná produkce, která má přísná pravidla respektující ţivotní
prostředí, welfare zvířat a která si získala širokou podporu a důvěru spotřebitelů. ČR je v
rozloze ekologicky obdělávaných ploch na předních místech v Evropě. K 31. 12. 2010 v ČR
ekologicky hospodařilo celkem 3 517 farem a podíl ekologicky obhospodařované plochy na
celkové výměře zemědělské půdy činil celkem 10,55 % (Ministerstvo zemědělství, 2011).
Jeden z aktuálních problémů EZ v ČR je soběstačnost farem v produkci bílkovin pro výţivu
hospodářských zvířat. Jednou z důleţitých zásad Nařízení Rady a Evropského parlamentu
(834/2007) o EZ mimo jiné stanovuje, ţe krmivo pro hospodářská zvířata se získává v prvé
řadě ze zemědělského podniku, kde jsou zvířata drţena, nebo z jiných ekologických
zemědělských podniků ve stejném regionu (čl. 14 odst. 1 písm. d) bod i) nařízení 834/07).
Tato podmínka podporuje vlastní produkci kvalitních krmiv na ekofarmách.
85
„Úroda 12/2011, vědecká příloha―
Principy ekologické produkce tedy kladou důraz na uzavřenost podniku a omezení nákupu
vstupů, které by mohly znamenat riziko, zejména v současné době aktuální riziko
kontaminace geneticky modifikovanou sójou či kukuřicí. Ekologicky hospodařícím
zemědělcům je proto třeba nabídnout cenově dostupnou alternativu dovozové sóji, která není
pro EZ přípustná s ohledem na moţné riziko kontaminace GMO. Právě zavedení pěstování
LOS jako hlavní plodiny se jeví jako jedno z perspektivních řešení směřující ke zvýšení
soběstačnosti ekologických farem s ohledem na zásobení vysoce kvalitním domácím jadrným
krmivem s vysokým obsahem bílkovin. LOS nabízejí moţnost zvýšení produkce vlastních
proteinových krmiv vyuţitelných pro chov masného a mléčného skotu, prasat a drůbeţe.
Tímto způsobem mohou ekofarmy sníţit svou závislost na importu biokrmiv ze zahraničí, coţ
můţe přispět ke zlepšení jejich ekonomické situace.
LOS byly ještě před rozvojem intenzivního velkoplošného zemědělství běţnou součástí
osevních postupů na orné půdě. Zlepšující efekt pro půdu je všeobecně známý. Schopnost
LOS obohacovat půdu o dusík, omezovat zaplevelení, potlačovat a přerušovat rozmnoţování
chorob a škůdců (E. S. Jensen et al. 2006) nabývá mimořádně na významu právě v oblasti EZ,
kde je zakázáno pouţívání pesticidů, minerálních hnojiv a kde jsou minimalizovány vstupy.
Důleţitým prvkem je i trend směřující ke zvyšování biodiverzity v oblasti EZ. Rozvoj
diverzity rostlin ve směsce vytváří také prostředí pro rozvoj uţitečných predátorů, kteří
omezují šíření škůdců (Hauggaard-Nielsen a Andersen 2000, Seidenglanz 2011).
V mnoha studiích bylo také prokázáno, ţe z hlediska ochrany proti chorobám můţe být
pěstování plodin ve směskách pro jejich komponenty výhodné (Boudreau a Mundt, 1992;
Fininsa, 1996). Například v polních experimentech s hrachem, bobem, lupinou, ječmenem a
jejich směskami v Dánsku bylo zjištěno, ţe výskyt chorob byl celkově niţší ve směsce
luskovina-ječmen ve srovnání s monokulturami. V jiných výzkumech bylo zjištěno, ţe u
hrachu byla úroveň napadení hobami Ascochyta pisi, Mycosphaerella pinodes a Erysiphe pisi
niţší ve směsce neţ v monokultuře (Ondráčková 2010). Výskyt hnědé skvrnitosti ječmene
(Pyrenophora teres) na ječmenu byl signifikantně niţší ve směsce s hrachem. Rovněţ výskyt
rzi (Puccinia recondita) a padlí (Blumeria graminis f. sp. hordei) byl v kaţdé ze směsek niţší
neţ v monokultuře ječmene (Kinane a Lyngkjaer, 2002).
Jak vyplývá např. z výzkumu provedeného ve Francii (Bedoussac et al., 2010) i několika
dalších studií, ve směskách dochází ke sníţení výskytu mšic (Acyrthosiphon pisum, obilné
mšice). Bylo také zjištěno, ţe ve směskách hrachu s jarními obilovinami dochází k zastavení
populačního růstu kolonií kyjatky hrachové dříve neţ v hrachu pěstovaném v monokultuře.
Samičky pestřenek preferují kolonie kyjatky hrachové na hrachu ve směskách a kladou zde
více vajíček (Seidenglanz, 2011).
Hlavním cílem tohoto výzkumu je podpořit rozšíření pěstování LOS a jejich zařazování do
osevních postupů v EZ. Po zavedení vysoce výkonných odrůd hrachu, včetně typů s
redukovanou listovou plochou (afila typů), a nových odrůd obilovin jiného růstového typu,
není totiţ v současné době dostatek prakticky vyuţitelných a experimentálně ověřených
informací a zkušeností s jejich vyuţíváním pro pěstování ve směskách, zejména
v podmínkách EZ.
Materiál a metody
Na pokusných plochách společnosti Agritec, s.r.o. v Rapotíně (RA) v letech 2008 - 2010 a na
ekologické farmě v Postřelmově (PO) v letech 2009 – 2010 byly zakládány maloparcelkové
pokusy s hrachem a obilovinami (pšenice, ječmen). V pokusech byly vysety dvě odrůdy
hrachu - Bohatýr (listový typ) a Terno (semi-leafless typ) – a dále odrůda pšenice jarní Sirael
a odrůda ječmene jarního Pribina. Hrách a obiloviny byly vysety ve 24 pokusných variantách
– v monokulturách a šesti různých vzájemných poměrech.
86
„Úroda 12/2011, vědecká příloha―
Zkoušené výsevní poměry - hrách:obilovina (%): 100:0, 80:20, 60:40, 40:60, 20:80, 0:100.
Plocha jednoho pokusu činila 0,13 ha, sklizňová plocha jedné varianty 10 m2.
Po sklizni zrna byl vyhodnocen hrubý a čistý výnos zrna ve směsce a výnos jednotlivých
komponent. Byl stanoven parametr LER (Land Equivalent Ratio) jako hodnotící parametr
výhodnosti/nevýhodnosti pěstování testovaných plodin ve směskách ve srovnání s
monokulturami. LER je poměrné číslo udávající plochu monokultury potřebnou k dosaţení
stejného výnosu jako je výnos směsky z jednotky plochy.
LER = (Vab /Vaa) + (Vba / Vbb)
V… výnos t/ha
a, b… monokultury plodin A a B
ab, ba… směsky plodin A a B
LER monokultury = 1. Pokud je hodnota LER větší neţ jedna, povaţuje se pěstování plodin
ve směsce za výhodnější z hlediska výnosu neţ jejich pěstování v monokultuře (Vandermeer,
1989).
Statistické zpracování dat bylo provedeno pomocí software Statistica Cz 9.1. Byla provedena
analýza variance (one-way ANOVA) a následně Fisherův LSD test pro zjištění případných
staticky významných rozdílů mezi zkoumanými variantami (P < 0,05).
Výsledky a diskuze
Získané výsledky ukazují, ţe v podmínkách omezené kontroly plevelů, chorob a škůdců, se
výsledky velmi liší podle lokality a ročníku.
V roce 2008 došlo na lokalitě RA k silnému napadení rostlin hrachu virovými chorobami - to
mělo za následek sníţení výnosů, coţ do určité míry zkreslilo parametr LER. Nejvyšších
výnosů dosahovala směska BOHATÝR/SIRAEL. U kombinace hrachu s ječmenem dosáhla
nejvyššího výnosu směska TERNO/PRIBINA v poměru 20:80 (1,85 t/ha).
V roce 2009 dosáhly v průměru nejvyššího výnosu směsky BOHATÝR/SIRAEL v poměru
40:60. (4,48 t/ha), BOHATÝR/SIRAEL v poměru 20:80. (4,47 t/ha) a TERNO/ SIRAEL
20:80 (4,19 t/ha). U kombinace hrachu s ječmenem dosáhla nejvyššího výnosu směska
BOHATÝR/PRIBINA v poměru 40:60. (3,98 t/ha), TERNO/PRIBINA 20:80 (3,92 t/ha) a
BOHATÝR/PRIBINA 20:80 (3,89 t/ha).
Celkové orientační průměrné výnosy pokusů v RA a v PO (bez ohledu na procentuální
zastoupení plodin ve směsce) byly vyšší na lokalitě RA (3,60 t/ha) neţ na pokusné lokalitě PO
(3,24 t/ha). Průměrný výnos hrachu (bez ohledu na procentuální zastoupení plodin ve směsce)
byl vyšší v PO (2,28 t/ha) neţ v RA (1,51 t/ha). U obilovin tomu bylo naopak: RA – 2,81 t/ha,
PO – 1,60 t/ha. Průměrný LER (Land Equivalent Ratio) dosahoval v RA s vyloučením
monokultur hodnoty 1,05, v PO pouze 0,96.
Rok 2010 měl mimořádný průběh z hlediska sráţkové činnosti. Například na pokusné lokalitě
RA spadlo během května mimořádné mnoţství sráţek – 166,9 mm – coţ je 243 %
dlouhodobého normálu (68,7 mm). Spolu s vyšší hladinou spodní vody na lokalitě RA měla
tato okolnost negativní vliv zejména na výnosy hrachu a ječmene. Vyšších výnosů dosahovaly
proto směsky hrachu s pšenicí. Rozdíl ve výnosech mezi směskami hrachu s pšenicí (4,85
t/ha) a směskami hrachu s ječmenem (2,90 t/ha) byl velký a statisticky průkazný.
Nejvyšších výnosů v pokusech na ekofarmě PO bylo dosahováno ve směskách s poměrem
zastoupení hrachu a obiloviny 80:20, 60:40 a 40:60. Parametr LER dosahoval nejvyšších
hodnot u poměrů 60:40, 40:60 a 20:80.
Celkové orientační průměrné výnosy pokusů v RA a v PO (bez ohledu na procentuální
zastoupení plodin ve směsce) byly vyšší na lokalitě PO (3,64 t/ha) neţ na pokusné lokalitě RA
(3,55 t/ha). Průměrný výnos hrachu (bez ohledu na procentuální zastoupení plodin ve směsce)
byl vyšší v PO (2,63 t/ha) neţ v RA (0,84 t/ha). U obilovin tomu bylo opět naopak: RA – 3,53
87
„Úroda 12/2011, vědecká příloha―
t/ha, PO – 1,68 t/ha. Průměrný LER (Land Equivalent Ratio) dosahoval v RA s vyloučením
monokultur hodnoty 1,04, v PO 1,21.
Při srovnání průměrných výnosů na lokalitě RA za roky 2008 – 2010 z hlediska výsevních
poměrů nejvyšších výnosů dosahovaly směsky hrách:obilovina v poměru 80:20 (3,54 t/ha) a
40:60 (3,38 t/ha). Nejvyšší hodnoty LER dosáhly směsky 60:40 (1,15) a 40:60 (1,13) - obr. 1.
Na lokalitě PO (ekologická farma) za roky 2009 - 2010 nejvyšších výnosů dosáhly směsky
s poměrem hrách:obilovina 40:60 (3,73 t/ha) a 60:40 (3,64 t/ha). Nejvyšší hodnoty LER
dosáhly směsky 40:60 (1,24) a 20:80 (1,20) - obr. 2.
88
„Úroda 12/2011, vědecká příloha―
Při srovnání výnosů za celé období 2008 – 2010 a všechny pokusné lokality (RA, PO-1 a PO2) z hlediska výsevních poměrů nejvyšších průměrných výnosů dosahovaly směsky
hrách:obilovina v poměru 40:60 (3,56 t/ha), 20:80 (3,46 t/ha) a 60:40 (3,41 t/ha). Nejvyšší
hodnoty LER dosáhly směsky v pořadí 40:60 (1,18), 60:40 (1,15) a 20:80 (1,14) - obr. 3.
Závěr
Z průměru výnosů a LER za období tří let lze vyvodit, ţe pěstování hrachu, pšenice a
ječmene ve směsce má stabilizující efekt na jejich výnosy ve srovnání s monokulturou.
Z výsledků je také patrné, ţe hrách pěstovaný ve směskách má i v podmínkách ekologického
zemědělství za příznivých podmínek vysoký výnosový potenciál. V pokusech se z hlediska
výnosů a výhodnosti pro pěstování ve směsce jako optimální jevilo zastoupení hrachu a
obiloviny ve směsce v poměru hrách:obilovina 40:60 a 60:40, i kdyţ získané výsledky nebyly
statisticky průkazné.
Při volbě plodin, jejich odrůd a jejich výsevního poměru ve směsce je kromě pěstitelských
podmínek nezbytné přihlédnout také k účelu jejich pěstování – jestli jeho cílem je sklizeň
směsky v zeleném stavu nebo jde o pěstování směsky pro získání zrna. Lze přitom vycházet z
dalších hledisek – je třeba zváţit otázky agrotechniky, ochrany proti zaplevelení, chorobám a
škůdcům a ujasnit si poţadavky na sloţení krmiva (například poměr mezi N-látkami a
energií).
Pokud cílem pěstování je získat zelené krmení pro přímé zkrmování či na siláţ, pak lze
doporučit spíše listovou odrůdu hrachu a vyšší zastoupení hrachu ve směsce (aţ 60 %). Pokud
je směska pěstována na zrno, pak se jako vhodnější jeví pouţít bezlistovou odrůdu hrachu a
sníţit tak riziko polehnutí porostu. Lze také doporučit sníţení podílu hrachu ve směsce na 40
%. Při vyšší vlhkosti a silném růstu hrachu můţe totiţ dojít k zalehnutí obilovin rostlinami
hrachu a tím i k zastavení dalšího vývoje obiloviny. Toto riziko nastává zejména při pěstování
listových odrůd hrachu.
89
„Úroda 12/2011, vědecká příloha―
Dedikace
Projekt č. QH82027 „Inovace technologie pěstování luskovino-obilních směsek v
ekologickém zemědělství a jejich vliv na vybrané charakteristiky půdy se zaměřením na
koloběh dusíku― je podporován Ministerstvem zemědělství ČR (MZe) prostřednictvím
Národní agentury pro zemědělský výzkum (NAZV).
Pouţitá literatura
Bedoussac, L., Hemptinne, J., Justes, E., (2010): Winter Pea – Durum Wheat Intercrops: A
Solution to Reduce Pesticide Use by Decreasing Grain Legume Pests and Diseases. Book
of Abstracts from 5th International Food Legumes Research Conference (IFLRC V) and
7th European Conference on Grain Legumes (AEP VII), April 26-30, 2010 – Antalya, pp
97.
Boudreau M. A., Mundt C. C. (1992): Mechanisms of alterations in bean rust epidemiology
due to intercropping with maize. Phytopathology, 82, 1051-1060.
Fininsa C. (1996): Effect of intercropping bean with maize on bean common bacterial blight
and rust diseases. Int. J. Pest Man., 42, 51-54.
Hauggaard-Nielsen H. a Andersen M. K. (2000): Intercropping grain legumes and cereals in
organic cropping systems. Grain Legumes, 30, 18-19.
Jensen E. S., P. Ambus, N. Bellostas, S. Boisen, N. Brisson, G. Corre-Hellou, Y. Crozat, C.
Dahlmann, A. Dibet, P. von Fragstein, M. Gooding, H. Hauggaard-Nielsen, E. Kasyanova,
M. Launay, M. Monti and A. Pristeri (2006): Intercropping of cereals and grain legumes
for increased production, weed control, improved product quality and prevention of N –
losses in European organic farming systems (INTERCROP). Project QLK5-CT-200202352, Final report 257-258.
Kinane J., Lyngkjaer M. F. (2002): Effect of barley-legume intercrop on disease frequency in
an organic farming system. 6. Conference of European Foundation for Plant Pathology
(EFFP 2002), Prague (CZ), 8-14 Sep. 2002. Plant Prot. Sci. 38, 227-231.
Ministerstvo zemědělství (2011): Základní statistické údaje ekologického zemědělství k 31.
12. 2010, http://eagri.cz/public/web/file/105980/statistika_zakladni_31_12_2010.doc
Ondráčková E., Huňady I., Hochman M. 2010: Vliv luskovino-obilních směsek na redukci
výskytu chorob hrachu. Rostlinolékař, 4: 12-14; ISSN 1211-3565
Seidenglanz, M., Huňady, I., Poslušná, J., Løes., A. K. (2011): Influence of intercropping
with spring cereals on the occurrence of pea aphids (Ayrthosiphon pisum Harris, 1776) and
their natural enemies in field pea (Pisum sativum L.). Plant Protect. Sci., Vol. 47, No. 1,
25-36.
Vandermeer, J. (1989): The Ecology of Intercropping. Cambridge University Press,
Cambridge.
Kontaktní adresa:
Ing. Igor Huňady
AGRITEC výzkum, šlechtění a sluţby s.r.o.
Zemědělská 2520/16
787 01 Šumperk
[email protected]
90
„Úroda 12/2011, vědecká příloha―
OBSAH VITAMÍNU E V OBILKÁCH GENETICKY ODLIŠNÝCH
ODRŦD JEČMENE JARNÍHO ZE STRESOVÝCH PODMÍNEK
The content of vitamin E in caryopses of genetically different spring barley
varieties from stress conditions
Ehrenbergerová J. 1, Pluháčková H. 1, Bradáčová M. 1, Březinová Belcredi N. 1,
Benešová K. 2, Vaculová K.3
1
Ústav pěstování, šlechtění rostlin a rostlinolékařství, Mendelu v Brně
Výzkumný ústav pivovarský a sladařský, a.s. Sladařský ústav v Brně
3
Zemědělský výzkumný ústav Kroměříţ, s.r.o.
2
Abstrakt
Cílem práce bylo hodnocení obranné reakce na navozený stres (sucho, mokro) rostlin odrůd ječmene
jarního. Stres byl hodnocen jako změny v obsahu isomerů vitamínu E a jeho aktivitě. Rostliny pěti
odrůd byly pěstovány ve třech odlišných vláhových reţimech - sucho, pozdní sucho a mokro v letech
2009 a 2010. Zjistili jsme, ţe podmínky pěstování v reţimu pozdní sucho vedly v průměru souboru
odrůd a roků k nejniţší aktivitě (8,38 mg.kg-1 oproti 9,19 a 9,66 mg.kg-1) i nejniţším obsahům většiny
isomerů vitamínu E. Byly pozorovány odrůdové rozdíly v reakci na oxidativní stres ze sucha, odrůda
Wabet a linie KM 1057, měly nejvyšší aktivitu vitamínu E (9,42 aţ 18,07 mg.kg -1) v reţimu sucha i
pozdního sucha, coţ je moţné povaţovat za projev jejich silnějšího obranného mechanismu.
Vzhledem k rozdílům vzušné teploty a vlhkosti ve vegetačních obdobích roků je pro zobecnění
výsledků ţádoucí v experimentu pokračovat.
Klíčová slova: vláhový reţim, isomery α-, β-, γ-, δ-, tokoferol, tokotrienol
Abstract
In 2009 and 2010 the effects of three different soil moisture regimes (drought, late drought and
wetness) on the defense response of barley genotypes assessed using vitamin E isomers were studied.
Vitamin E isomers were determined with the HPLC method with fluorescent detection. Genotypes
with contrasting malting quality (hulled Kompakt, Krona, Wabet and hulless Wanubet, KM 1057)
were included in the study. The lowest content of vitamin E isomers (8.38 mg.kg-1 ) on average of
varieties and years was found in the late drought regime. The highest vitamin E activity in the drought
and late drought regimes was found in the genotypes Wabet and KM 1057 (9.43 to 18.08 mg.kg-1),
which may be due to their stronger defense mechanism to drought-induced stress.
Key words: moisture regime, α-, β-, γ-, δ- isomers, tocopherol, tocotrienol
Úvod
Stresové faktory působící na rostliny, mohou zpomalovat ţivotní funkce, nebo vést aţ k
uhynutí rostlin. Intenzita stresu závisí nejen na mnoţství dostupné vody v prostředí, vitalitě,
ale i na genotypu rostliny, t.j. na vlastnostech odrůdy.
Většina procesů, probíhajících v rostlinách při stresu ze sucha, směřuje k zamezení ztrát vody
z buněk, ale aktivují se i enzymatické systémy [1], které směřují k ochraně před oxidativním
stresem. V důsledku stresu dochází ke katalýze reakcí vedoucích k prudké, přechodné tvorbě
velkého mnoţství aktivních forem kyslíku (AFK), např. peroxidu vodíku, superoxidového
nebo hydroxylového radikálu, coţ vede k poruše rovnováhy mezi produkcí a odbouráváním
aktivních forem kyslíku.
Ochranu před oxidativním poškozením organismu AFK zajišťuje řada antioxidativních
obranných systémů enzymové povahy – např. peroxidasa, superoxid dismutasa aj. a
neenzymové povahy - askorbát, beta-karoten, rostlinné hormony [2], některé aminokyseliny
[3] redukovaný glutation a vitamin E. Za biologicky nejaktivnější isomer vitaminu E je
povaţován alfa-tokoferol. Tento isomer inhibuje oxidační poškození buněčných membrán a
má i další funkce.
91
„Úroda 12/2011, vědecká příloha―
Aktivní obrana rostlin, která omezuje negativní dopad stresorů, vede ke spuštění řetězce
změn, označovaných jako stresové reakce. Tyto změny jsou v poslední době intenzivně
studovány. Poznání těchto reakcí je důleţité pro hodnocení [4] a výběr odrůd zemědělských
plodin pěstovaných ve stresových podmínkách současného průběhu povětrnosti, velmi
odlišného od průměrných dlouhodobých podmínek.
V rámci ochranného mechanismu před oxidativním poškozením jsou v rostlinách
syntetizovány i jednotlivé izomery vitamínu E, tokochromanoly, souhrnně nazývané tokoly.
Rozlišují se dvě kategorie tokochromanolů [5], které jsou tvořeny osmi homology, α-, β-, γ-,
δ-tokoferoly (T) a tokotrienoly (T3), [6].
Materiál a Metody
a) Rostlinný materiál a metodika pokusu
Vybrali jsme dvě odrůdy sladovnické kvality: Kompakt a Krona, dvě odrůdy nesladovnické
kvality: Wabet a Wanubet (provenience USA s waxy genem) a linii KM1057 – poslední dva
genotypy jsou bezpluché. Odrůdy/linie byly vybrány jednak podle jejich odlišného původu,
sladovnické kvality a jednak podle různého obsahu tokolů (tokoferolů a tokotrienolů), který
jsme zjistili v předchozím výzkumu. Osivo odrůd bylo vyseto po sedmi semenech do devíti
nádob - tři nádoby tvořily vţdy jedno opakování, o objemu cca 8 l zeminy. Nádoby byly
umístěny na pozemek v areálu MENDELU pod vybudovaný přístřešek. Zpočátku byla
v celém experimentu udrţována zálivka na 75 % plného nasycení půdy, coţ přibliţně
odpovídá optimální zálivce, tzv. ―mokro”, (pro porovnání účinku sucha). Po čtyřech týdnech,
na konci fáze odnoţování (DC 32- 35) byl u třetiny nádob zaveden reţim omezené zálivky
(30 % plného nasycení půdy) – varianta „sucho”. Další, třetí variantou bylo „pozdní sucho“,
u níţ byla zálivka sníţena na 30 % plného nasycení půdy od počáteku fáze metání (DC 47 49). Reţim u obou variant u sucha byl udrţován aţ do konce vegetace. Ostatní podmínky
zůstaly závislé na průběhu povětrnostních podmínek a aktuálním počasí (délka dne, teplota,
vlhkost vzduchu, tab.1).
Na analýzy obsahu jednotlivých izomerů vitamínu E byly odebrány obilky v plné zralosti,
vzorky byly přečištěny, homogenizovány a výsledné hodnoty byly přepočteny na 100%
sušinu obilky. Výsledky uvedené v textu jsou průměrné hodnoty získané ze dvou stanovení.
b) Metodika stanovení obsahu isomerŧ vitamínu E (tokolŧ)
Princip metody stanovení tokoferolů (T) a tokotrienolů (T3) je zaloţen na alkalickém
zmýdelnění a extrakci nezmýdelněného podílu vzorku diethyletherem, s následným
stanovením metodou HPLC s fluorescenční detekcí [8]. Aktivita vitamínu E byla vyjádřena
v mg -tokoferol-ekvivalentu (součet jednotlivých tokoferolů a tokotrienolů se zohledněním
jejich biologické aktivity, [9]).
Statistické hodnocení výsledků aktivity a obsahu isomerů vitamínu E bylo provedeno
v programu StatSoft, Inc. (2009), STATISTICA analýzou variance (ANOVA) a
mnohonásobným porovnáním průměrných hodnot pomocí Fischerova testu (LSD-test) při P =
0,05.
Výsledky a diskuse
V roce 2009 (tab. 2) nebyly vzorky v průměru mokré varianty bohatší na isomer α-T (7,34
mg.kg-1) neţ ve variantě sucho a pozdní sucho. Minoritní isomery β, γ a δ-T však v průměru
vzorků všech odrůd vyústily ve statisticky významně vyšší mnoţství z mokré varianty.
Hladina isomeru α-T3 byla rovněţ statisticky významně vyšší ve vzorcích z mokré varianty
(15,10 mg.kg-1) oproti vzorkům z reţimu sucho a pozdní sucho (12 mg.kg-1 ). Podobně tomu
bylo u minoritních isomerů β+γ-T3 s významně vyšším obsahem v mokré variantě (6,42
mg.kg-1), rovněţ i isomerů δ-T3 bylo vyšší mnoţství v průměru mokré varianty. V roce 2010
92
„Úroda 12/2011, vědecká příloha―
nebyly zaznamenány v průměru všech odrůd významné rozdíly v hodnotách aktivity vitamínu
E a isomerů α, β, γ –T a δ-T3 mezi reţimy pěstování, vyšší hodnoty však patřily vzorkům ze
suché varianty. Hodnoty α –T3 isomeru byl významně vyšší (7,47 mg.kg-1) v průměru suché
varianty oproti dalším dvěma vláhovým reţimům.
V obou letech pěstování odrůd v reţimu pozdního sucha, navozeného v době počátku metání,
byla v jejich průměru aktivita vitamínu E niţší (8,38 mg.kg-1), oproti variantě sucho (9,19
mg.kg-1), které bylo nastoleno jiţ na konci odnoţování rostlin a niţší i oproti variantě mokro
(9,66 mg.kg-1) (tab. 3). Stejná tendence byla pozorována v hladině α –T, která byla statisticky
významně vyšší rovněţ v mokré variantě (5,86 mg.kg-1) ve srovnání se suchou (5,20 mg.kg-1)
variantou. Průměrná hodnota α –T3 byla ve vzorcích z mokrých variant (10,76 mg.kg-1)
statisticky významně vyšší nejen oproti variantám z pozdního sucha (8,87 mg.kg-1), ale i z ze
sucha (9,94 mg.kg-1). Na základě zjištěných hodnot vitamínu E můţeme tedy usuzovat, ţe
rostliny pociťovaly větší míru stresu z podmínek mokra a podmínek déle trvajícího sucha.
V jednotlivých letech pokusu však lze pozorovat poněkud specifické trendy. V roce 2010, s
chladnějším počasím a vyšší relativní vlhkostí vzduchu (v důsledku vyšších sráţek - tab.1),
byl průměrný obsah α –T celého souboru odrůd mírně vyšší v mokré variantě oproti suché, v
obsahu druhého majoritního isomeru α –T3 tomu bylo naopak (graf 2). Průměrná hodnota ze
suché varianty byla významně vyšší oproti variantě pozdní sucho. V rámci hodnocení souboru
odrůd jako celku, byly nejniţší hodnoty většiny sledovaných parametrů vitamínu E stanoveny
v obilkách z reţimu pěstování pozdní sucho (tab. 3), jak jiţ bylo výše zmíněno. Proto byly
sumy hodnot z této varianty pěstování vzaty jako 100 % a k nim pak vyjádřeny hodnoty
sledovaných parametrů z ostatních reţimů. Aktivita vitamínu E v obilkách, v souhrnu všech
odrůd, převyšovala v letech 2009 a 2010 v reţimu mokra o 32 % a v reţimu sucha 22 - 32 %
variantu pozdní sucho(graf 1 a 2). Obdobně tomu bylo i u isomeru α-T, v roce 2010 měl o 36
% vyšší hodnoty v suché a o 46 % v mokré variantě pěstování, isomer α-T3 měl ke
srovnávané variantě v témţe roce o 46 % vyšší hodnoty v suché a v roce 2009 o 24 % v
mokré variantě pokusu. Výsledky statistického hodnocení však mezi vzorky v průměru odrůd
(tab. 2) nepotvrdily významné rozdíly v aktivitě vitamínu E, ani v obsahu isomeru α-T mezi
reţimy pěstování v jednotlivých letech pokusu (tab. 2). Avšak v průměru obou roků byly
rozdíly jak v obsahu α-T, α-T3 i aktivitě vitamínu E významné (tab. 3). Podobně jako [6,7]
můţeme potvrdit přítomnost všech osmi isomerů vitamínu E v obilkách ječmene.
Vyšší teploty s niţší realtivní vlhkostí vzduchu (niţšími sráţkami) v roce 2009 oproti roku
2010 (tab. 1), mohly být jednou z příčin vyšších aktivity vitamínu E a biosyntézy jeho
majoritních isomerů α –T a α –T3 u souboru odrůd (tab. 3). Významně zvýšená biosyntéza
isomerů α –T3 v suché i mokré variantě pokusu je patrná v průměru vzorků z celého pokusu
(tab. 3), coţ můţe svědčit o významu tohoto isomeru v obranné reakci rostlin na stres ze
sucha i z vlhčích podmínek (mokrá varianta). Byly potvrzeny naše dřívější výsledky o
nejvyšší schopnosti biosyntézy isomerů vitamínu E, zejména majoritních, odrůdami s waxy
endospermem - Wabet a Wanubet (tab. 3). Nejniţší hodnoty obsahu i aktivity vitamínu E v
průměru roků i vláhových reţimů naopak byly stanoveny u bezpluché linie KM1057. V práci
[10] byly zjištěny genotypové rozdíly na oxidativní stres a obranné reakce v důsledku mokra.
Podobně jsme zjistili i v této práci genotypové obranné reakce, hodnocené jako obsah isomerů
a aktivita vitamínu E, na odlišné podmínky vláhových reţimů pěstování rostlin ječmene.
93
„Úroda 12/2011, vědecká příloha―
Tab. 1: Povětrnostní podmínky vegetačního období v letech 2009 a 2010
2009
měsíc
březen
duben
květen
červen
červenec
Suma
Průměr
2010
2009
2010
Sráţkový Sráţkový
T prům. T max. T min. T prům. T max. T min. úhrn [mm] úhrn [mm]
4,3
13,8
14,8
16,5
19,6
8,0
20,6
21,1
22,2
26,7
1,1
7,0
8,3
11,2
13,4
4,1
9,3
13,0
17,8
21,0
9,3
15,4
17,3
23,1
27,2
-0,8
3,2
9,5
12,2
15,1
13,8
19,7
8,2
13,1
18,4
7,8
71,9
12,2
44,7
94,8
69,1
292,6
15,3
39,0
106,6
121,7
90,7
373,3
Tab. 2: Obsahy isomerů a aktivity vitamínu E v průměru souboru odrůd
Reţim
Rok
Obsah (mg.kg-1 sušiny)
β-T
γ-T
δ-T
α-T3
α-T
E vit
b
b
b
sucho
11,68
7,31
0,50
pozdní sucho 2009 11,70 b 7,42 b 0,50 b
mokro
12,64 b 7,34 b 0,57 c
sucho
6,72 a 4,09 a 0,26 a
pozdní sucho 2010 5,07 a 2,10 a 0,24 a
mokro
6,69 a 4,39 a 0,25 a
Pozn.: Průměrné hodnoty označené odlišnými písmeny
P=0,05; T = tokoferoly, T3 = tokotrienoly
b
b
2,81
0,88
2,81 b 1,12 c
3,24 c 1,33 d
1,46 a 0,67 a
1,37 a 0,90 b
1,39 a 0,60 a
ve sloupcích se
β+γ-T3
c
δ-T3
c
12,42
5,00
0,69 ab
c
abc
12,16
4,54
0,67 a
15,10 d 6,43 d 0,79 b
7,47 b 4,15 ab 0,97 c
5,59 a 4,72 bc 1,04 c
6,44 ab 4,04 a 0,99 c
od sebe statisticky významně liší při
Tab. 3: Průměrné hodnoty aktivity a obsahu majoritních izomerů vitamínu E (mg . kg-1)
Odrŧda
KM1057
Kompakt
Krona
Wabet
Wanubet
E (mg . kg-1)
a
7,74
ab
8,24
bc
9,26
c
9,38
d
10,76
α-T
4,45
4,72
4,88
6,06
7,81
a
a
a
b
c
α -T3
8,03
9,05
9,38
9,43
13,40
a
b
b
b
c
Reţim
pozdní sucho 8,38
sucho
9,19
mokro
9,66
Rok
a
ab
b
5,20
5,69
5,86
a
ab
b
8,87
9,94
10,76
a
b
c
a
2010
6,15
3,82 a 6,49 a
b
2009
12,01
7,35 b 13,22 b
Pozn.: Průměrné hodnoty označené odlišnými písmeny ve sloupcích se od sebe statisticky významně liší při
P=0,05; T = tokoferoly, T3 = tokotrienoly
94
„Úroda 12/2011, vědecká příloha―
Graf 1: Obsahy isomerů a aktivita vitmínu E v procentickém vyjádření k variantě pozdní
sucho (100 %) v roce 2009
2009
150
140
130
(%)
120
Sucho/Drought
110
Pozdní sucho/Late drought
100
Mokro/Wetness
90
80
70
60
E vit
α-T
β-T
γ-T
δ-T
α-T3
β+γ-T3
δ-T3
Graf 2: Obsahy isomerů a aktivita vitmínu E v procentickém vyjádření k variantě pozdní
sucho (100 %) v roce 2010
2010
160
150
140
130
(%)
120
Sucho/Drought
Pozdní sucho/Late drought
110
Mokro/Wetness
100
90
80
70
60
E vit
α-T
β-T
γ-T
δ-T
α-T3
β+γ-T3
δ-T3
Závěr
Můţeme konstatovat, ţe podmínky pěstování ve variantě pozdní sucho, které bylo navozené
aţ na začátku fáze metání, vedly k nejniţším obsahům většiny isomerů a aktivitě vitamínu E.
Můţeme usuzovat, ţe tento vláhový reţim byl pro vývoj rostlin nejpřijatelnější, rostliny
nepociťovaly stres. Na zvýšení obsahu většiny isomerů a aktivity vitamínu E měly vliv
reţimy suché a mokré varianty pokusu, a to v obou letech, coţ je moţné povaţovat za
obrannou reakci na stres pěstovaných odrůd, navozený vláhovými podmínkami v těchto
reţimech pěstování. Výjimkou byl obsah α –T v roce 2009, jehoţ hodnoty byly shodné ve
všech variantách pěstování. Byly také zjištěny odrůdové reakce na odlišné reţimy pěstování
odrůd, které se projevily obsahy isomerů vitamínu E, zejména minoritních, a aktivitou
vitamínu E. Byl pozorován i vliv ročníků pěstování, především teploty a vzdušné vlhkosti (v
důsledku vyšších sráţek), vhlkost půdy byla dodrţována podle reţimů pěstování. Vzhledem k
rozdílům výše aktivity i obsahu majoritních isomerů (α –T a α –T3) v řízených odlišných
vláhových reţimech mezi roky pěstování odrůd, je pro zobecnění výsledků ţádoucí
pokračovat ve výzkumu v dalším roce (coţ je jiţ realizováno).
95
„Úroda 12/2011, vědecká příloha―
Poděkování
Práce vznikla za podpory projektu 1M0570 „Výzkumné centrum pro studium obsahových
látek ječmene a chmele― Ministerstva školství, mládeţe a tělovýchovy České republiky.
Pouţitá literatura
Ryšlavá, H., Doubnerová, V.: Enzymy Hatchova-Slackova cyklu v C3 rostlinách. Chem.
Listy, 104, 2010, 1175-2010.
Havlová, M., Dobrev, P. I., Motyka, V., Štorchová, H., Libus, J., Dobrá, J., Malbeck, J.,
Gaudinová, A. and Vanková, R.: The role of cytokinins in responses to water deficit in
tobacco plants over-expressing trans-zeatin O-glucosyltransferase gene under 35S or
SAG12 promoters. Plant, Cell & Environment, 31, 2008, 341–353.
Dobrá, J., Motyka, V., Dobrev, P., Malbeck, J., Prasil, I. T., Haisel, D., Gaudinova, A.,
Havlova, M., Gubis, J., Vankova, R.: Comparison of hormonal responses to heat, drought
and combined stress in tobacco plants with elevated proline content Original Research
Article. Journal of Plant Physiology, Volume 167, Issue 16, 1 November 2010, 1360-1370.
Středa, T., Dostál, V., Chloupek, O., Bodner, G.: Šlechtění a výběr odrůd obilnin s větší
tolerancí k suchu. Úroda. 2009. sv. LVII, č. 5, 10-12.
Brinch-Pedersen, H.,Borg, S., Tauris, B., Holm, P. B.: Molecular genetic approaches to
increasing mineral availability and vitamin content of cereals. Journal of Cereal Science.
2007, n. 46, 308-326.
Panfili, G., Frantianni, A., Di Criscio, T., Marconi, E.: Tocol and β-glucan levels in barley
varieties and in pearling by-products. Food Chemistry, n. 107, 2008, 84-91.
Velíšek, J.; Cejpek, K.: Biosynthesis of Food Components. 1st edition. Tábor: OSSIS,
Vitamins, 2008, 181-185.
Prýma, J., Ehrenbergerová, J., Belcrediová, N., Vaculová, K.: Acta Chim. Slov. 54, 2007,
102.
McLaughlin, P. J., Weibrauch, J. L.: Vitamin E content of foods. J. Am Diet Assoc. 75, 1979,
647.
Zhang, G.; Tanakamaru, K.; Abe, J., Morita, S.: Influence of waterlogging on some antioxidative enzymatic activities of two barley genotypes differing in anoxia tolerance. Acta
Physiol Plant, vol. 29, n. 2, 2007, 171-176.
Kontaktní adresa:
Prof. Inf. Jaroslava Ehrenbergerová, CSc.
Mendelu v Brně, Zemědělská 1, Brno 613 00
[email protected]
96
„Úroda 12/2011, vědecká příloha―
KVALITA ROSTLINNÝCH PRODUKTŦ – SOUČASNOST A
BUDOUCNOST
Quality of plant products – nowadays and future
Bárta J., Bártová V., Čurn V.
Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta
Abstrakt
Příspěvek se zabývá současným pohledem na kvalitu rostlinných produktů, potravinových surovin a
potravin v České republice s návazností na předpokládaný budoucí vývoj. V příspěvku jsou
diskutovány vybrané oblasti, které mají a dá se předpokládat, ţe i nadále budou mít zásadní význam
v rámci vertikály šlechtitel – pěstitel – zpracovatel – obchodník – spotřebitel. Klíčová diskutovaná
témata jsou: současné priority kvality potravin, funkční potraviny, biopotraviny, šlechtění rostlin a
nové produkční technologie, hodnocení a analýza produktů, legislativa a kontrola, obchod a
informovanost spotřebitele.
Klíčová slova: kvalita, rostlinné produkty, potraviny, hodnocení, legislativa
Abstract
The contribution deals with the present opinion on quality of plant products and food in the Czech
Republic with subsequence on the probable future development of this branch. The contribution
discussed selected themes that have and probably will have fundamental importance in the
relationships among breeders, growers, processors, dealers and consumers. The key discussed themes
are: the present priorities of food quality, functional foods, organic foods, breeding and new
production technologies, evaluation and analysis of individual products, legislation and control
systems, trade and evaluation, legislation and providing of the information for the consumers.
Keywords: quality, plant products, foods, evaluation, legislation
Úvod
Kvalita rostlinných produktů je dnes nejen významným odvětvím zemědělského výzkumu, ale
také disciplínou, která významně ovlivňuje praxi od šlechtitelů, přes pěstitele, zpracovatele a
obchodníky a pak samozřejmě finálního spotřebitele. Přestoţe celosvětově existují obecné
standardy kvality jednotlivých produktů a potravin, jinak intenzivně bude pojem a obsahová
náplň kvality vnímána v různých regionech. Jistě si dokáţeme představit rozdílný pohled
sytého vs. hladovějícího spotřebitele nejen na kvantitu a kvalitu potravin, na systém hodnot,
ale i na ţivot jako takový. Úlohou zemědělství bylo vţdy ţivit člověka. Na Zemi dnes ţije 7
miliard lidí a do roku 2050 má tento počet překročit 9 miliard obyvatel. Toto navýšení bude
velmi nevyrovnané zejména z pohledu hustoty obyvatel ţijících na jednotlivých světadílech.
Vţdyť v roce 2000 ţilo v Asii a Africe 74 % lidské populace a v roce 2050 by to mělo být aţ
79 %. Naopak v Evropě dojde za stejné období ke sníţení z 11,9 % na 7,2 % (Anonym,
2011a). Potřeba zvýšené produkce potravin a zajištění výţivy pro rostoucí lidskou populaci za
podmínek, kdy základní zdroje (půda, voda, hnojiva, fosilní paliva) jsou značně limitovány,
bude vyţadovat zvýšené nároky nejen na pěstitelské technologie, ale také na šlechtění nových
odrůd, včetně praktického vyuţívání GM odrůd rostlin. Avšak to nebude vše - uţ dnes není
úkolem jen vypěstovat rostliny či vyrobit potraviny, ale také zajistit jejich distribuci do
mnohdy politicky a společensky velmi nestabilních oblastí. To je a dále bude z pohledu
zajištění výţivy lidí na Zemi patrně větším problémem, neţ vlastní problematika produkce
potravin.
Evropa a především Evropská unie, jejíţ jsme součástí, patří mezi části světa, kde se problém
nedostatku potravin neřeší. Kapacita evropského zemědělství převyšuje lokální poptávku a
dbá se na vysokou kvalitu potravin. Na vysoké úrovni je i samotné hodnocení kvality
rostlinných produktů určené pro potravinářský i krmivářský sektor. V kontrastu s
97
„Úroda 12/2011, vědecká příloha―
rozvojovými zeměmi se v EU řeší spíše nadprodukce potravin, vyuţití zemědělské produkce
na nepotravinářské účely, či přímo uloţení půdy do klidového reţimu. Pohled na uplatnění a
kvalitu produktů rostlinné výroby tak dostává nový rozměr. Kromě kvality hodnocení
rostlinných produktů jako přímých potravin či potravinářských surovin, nastupuje i rozvoj
hodnocení rostlinných produktů pro nepotravinářské účely – biosloţka paliv, spalování
fytomasy, fytomasa jako náplň pro bioplynové stanice nebo v oblasti nového vyuţití rostlin či
rostlinné hmoty pro bezodpadovou transformaci na nejrůznější látky (tzv. biorafinérie).
V těchto novějších odvětvích se teprve jakostní poţadavky na vstupní suroviny utvářejí
(Kolář, 2006). Významově prvotním odvětvím ale bude kvalita rostlinných produktů jako
potravin či potravinářských surovin. V tomto krátkém referátu se nyní podívejme na současný
stav vybraných témat v oblasti kvality rostlinných produktů souvisejících s potravinami i na
jejich moţný budoucí vývoj.
Současné priority kvality rostlinných produktŧ
Kvalita obecně, stejně tak jako kvalita rostlinných produktů, je stále chápána jako komplexní
souborné hodnocení znaků a vlastností výrobku a jinak to ani být nemůţe. Jsou hodnoceny
znaky „vnější― a „vnitřní― kvality. Rostlinné produkty jsou dále hodnoceny z pohledů kvality
technologické, nutriční, senzorické, hygienické atd. Pochopitelně záleţí na naší pozici, na
našem úhlu pohledu, který chceme nebo musíme preferovat. Na klasický rohlík bude mít
poněkud odlišný pohled technolog v pekárně, jiný zase konzument. Na příkladu nutriční
kvality je vidět, jak se posouvá vnímání látek v produktu obsaţených. Do popředí se dostávají
látky, které jsou v produktech obsaţené v menších mnoţstvích či objemech, zato ale mají
přímý vliv na zdraví konzumenta či jsou s ním dávány do spojitosti. Zajímají nás tedy jiţ
nejen obsah a skladba bílkovin, sacharidů a tuků, ale také obsah ostatních nutričně a
zdravotně prospěšných látek jako jsou antioxidanty, vitaminy, minerální látky, esenciální
mastné kyseliny, vláknina apod.
Podstatně více se sledují (a dá se předpokládat, ţe v budoucnu tento trend vzhledem ke
vzrůstajícím nárokům na bezpečnost potravin bude pokračovat) také látky, které mohou mít
negativní dopady na zdraví konzumentů. Jde o přirozeně se vyskytující látky antinutriční aţ
toxické povahy (např. inhibitory proteas, glukosinoláty, glykoalkaloidy, lektiny), a dále
přírodní či přirozené (např. mykotoxiny a bakteriální toxiny, vyšší koncentrace dusičnanů) a
umělé (např. rezidua pesticidů, těţké kovy, polychlorované uhlovodíky) kontaminanty.
„Nové“ skupiny potravin
V souvislosti s výše uvedeným důrazem na zdraví prospěšné látky se mluví o tzv. funkčních
potravinách, jejichţ pravidelná konzumace můţe ovlivňovat zdraví konzumentů. Spojitost se
zdravotním stavem je zaloţena na obsahu účinných látek či sloţek v potravinách, jejichţ
příjem souvisí s vývojem určité choroby (či celé skupiny onemocnění) resp. se sníţením
pravděpodobnosti jejího vzniku - jde tedy o preventivní působení zaloţené na pravidelném a
dlouhodobém příjmu. Pro samotné účinné sloţky funkčních potravin (probiotika, prebiotika,
synbiotika, antioxidanty, vláknina, esenciální mastné kyseliny, fytosteroly a fosfolipidy,
biologicky aktivní peptidy, fytoestrogeny a další přírodní látky) se dnes převáţně pouţívá
termín nutriceutika (z angl. nutraceuticals), ale někdy se pouţívá i trochu odtaţitě znějící
termín „fytochemikálie― (z angl. phytochemicals). S propagací významu funkčních potravin
souvisí pravdivá informovanost spotřebitelů o reálném vlivu faktorů na vzniku populačních
onemocnění. Většina lidí se prvotně bojí potravinářských aditiv, kontaminace potravin rezidui
pesticidů, dusičnany a těţkými kovy, mykotoxiny apod. Výzkumy však ukazují, ţe hlavním
problémem vzniku srdečně-cévních, nádorových a metabolických onemocnění je nesprávný
ţivotní styl v čele s nadbytečným příjmem potravy v kombinaci s její nevhodnou strukturou a
příjmem mimo doporučovaný časový reţim. Šířící se informovanost můţe napomoci
98
„Úroda 12/2011, vědecká příloha―
rostoucímu zájmu o skupinu funkčních potravin. Na druhé straně hlavním problémem zůstává
nedořešená legislativní definice funkčních potravin a jejich obchodní označování s ohledem
na jejich prokázané zdravotní přínosy. Jinak můţe hrozit ze strany výrobců a obchodníků
s potravinami zneuţívání pojmu „funkční potraviny― k propagaci i potravin s pochybným
zdravotním přínosem (Kalač, 2003; Coppens et al., 2010; Anonym, 2011b).
Druhou skupinou potravin, která je v současné době na vzestupu jsou biopotraviny. Podle
platného zákona č. 242/2000Sb. o ekologickém zemědělství jsou biopotravinou rozuměny
potraviny, které jsou vyrobeny za podmínek uvedených v tomto zákoně a navíc splňující
podmínky zákona č. 110/1997 Sb. o potravinách a na něj navazujících platných prováděcích
vyhlášek MZe a MZ ČR. Podle zjištění výzkumu o povědomí a nákupním chování v oblasti
biopotravin společnosti STEM/MARK z října loňského roku bylo zjištěno, ţe 74 %
dotázaných si pod pojmem „biopotravina― představuje produkt vypěstovaný ekologicky bez
chemie, postřiků a hnojiv. Z výzkumu vyplývá rostoucí zájem o biopotraviny, zejména u
skupiny vzdělanějších ţen z finančně lépe situovaných rodin (STEM/MARK, 2010). Názory
na kvalitu biopotravin často spotřebitele rozdělují nesprávně pokládanými otázkami, které za
kaţdou cenu hledají jednoznačné srovnání s konvenčními potravinami ve stylu „co je lepší či
horší―. Původní smysl biopotravin – tedy potravin s garancí produkce „bez chemie― (jako
alternativní ţivotní filosofie ve vertikále biopěstitel – spotřebitel) obohacující jak pestrost
nabízeného zboţí, tak i svobodu spotřebitele – se pak často vytrácí. Bohuţel k tomu mnohdy
přispívají média a „různí― odborníci, takţe se nakonec řada informací dostane ke čtenářispotřebiteli ve značně zkreslené podobě či na hranici poplašné správy.
Šlechtění, nové technologie a vliv prostředí
Šlechtění rostlin jako cílevědomá lidská činnost, jejíţ produktem jsou nové odrůdy má
moţnost výrazně měnit stávající kvalitu a vytvářet novou. Mezi hlavní priority současného
šlechtění patří šlechtění na kvalitu a rezistentní šlechtění. Oba tyto šlechtitelské cíle
významnou měrou formují kvalitu výsledných produktů a potravin – ve šlechtění je pozornost
věnována zvyšování obsahu a výnosu nutričních resp. zpracovatelsky či energeticky
zajímavých látek, eliminaci nepříznivých, antinutričních látek, šlechtění plodin se změněnou
skladbou aminokyselin, mastných kyselin a dalších nutričně i zdravotně významných látek,
sniţování rizik kontaminace zdraví škodlivých látek (např. nepřímo mykotoxinů
prostřednictvím zvyšování odolnosti plodin vůči houbovým patogenům), sniţování
antinutričních látek, zvyšování stálosti kvality v různých prostředích, zvyšování pestrosti
druhovou a odrůdovou diverzitou, včetně tvorby odrůd vhodných pro pěstování v systému
ekologického zemědělství (Chloupek, 2008).
Při tvorbě moderních odrůd s novou kvalitou bude více uplatňováno i progresivních
šlechtitelských technologií a genotypového výběru, tj. vyuţívání selekčních markerů na
molekulární úrovni, tzv. „Marker Assisted Selection―. Tyto postupy jsou pouţívány i v našich
podmínkách a příkladem můţe být vyuţití molekulárních selekčních markerů ve šlechtění
obilovin (Sedláček, Stemberková, 2010; Havlíčková et al., 2010), řepky (Čurn et al., 2008).
Celosvětově do tvorby nových odrůd silně promlouvají metody transgenóze a tvorba
geneticky modifikovaných odrůd (GMO/GMP). V ČR je zatím přímo ke kvalitě vztaţena jen
jedna genetická modifikace u polní plodiny (konkrétně brambor), která je v podobě odrůdy
Amflora povolená od roku 2010 k pěstování. Hlízy této odrůdy obsahují prostřednictvím
vneseného rostlinného genu škrob, který obsahuje z 98 % amylopektin (normální odrůdy
obsahují škrob s přibliţným poměrem amylózy a amylopektinu 1:4), coţ je výhodnější pro
vyuţití v papírenském a textilním průmyslu či pro produkci lepidel. Nepřímý vztah ke kvalitě
pak mají pěstované Bt hybridy kukuřice (odolnost vůči hmyzím škůdcům a sníţení
sekundárního napadení toxiny produkujícími houbami). Ve světě se jiţ pěstují či připravují
odrůdy dalších plodin, které mají transgenózí pozměněnou kvalitu sklizňového produktu – jde
99
„Úroda 12/2011, vědecká příloha―
např. o tzv. „zlatou rýţi― produkující β-karoten v obilkách, řepku a sóju, u nichţ je docíleno
změn ve skladbě mastných kyselin s ohledem na finální vyuţívání oleje (např. „high laurate
canola―, dále modifikace prostřednictvím kterých se mění skladba zásobních bílkovin u
obilovin a luskovin (zvýšení obsahu lysinu a methionu v zásobním proteinu), u rajčete je
vyuţívána modifikace zajišťující prodlouţenou skladovatelnost plodů. Otázka je, jak bude
dosud poměrně konzervativní Evropa k těmto odrůdám s novou kvalitou v budoucnu vstřícná.
Zatím je Evropa v oblasti povolování odrůd geneticky modifikovaných plodin za okolním
světem pozadu (Clive, 2010).
Pěstování rostlinných produktů je spojeno ve velké míře s péčí o jakost výrobního prostředí.
Kvalitní produkt musí nejen odpovídat jakostní normě, ale má být také pěstován kvalitní
agrotechnikou z kvalitních osiv, a vyrovnaných porostů, na optimálním stanovišti (rajonizace)
a zpracován při dodrţení správné technologické praxe a zachování kvality prostředí, k čemuţ
je producent zavazován předpisy. Jakost rostlinné produkce se tak často tvoří jiţ
v předvýrobní sféře (kromě zmíněného šlechtění jde i o semenářství), během pěstování,
v posklizňové úpravě a skladování. Připomenout je také potřeba i pokroky ve vlastním
potravinářském zpracování produktů, kdy je kladen důraz na „šetrnost― technologie ke
zpracovávanému produktu např. pouţívání nových konzervačních technologií a nových
způsobů balení potravin (Prugar et al., 2008; Kopec, 2010).
Hodnocení rostlinných produktŧ a moderní analytika
V posledních dvaceti letech došlo ke zlepšení moţností analytiky rostlinných produktů,
zejména zásluhou dostupnosti a rozvoje moderních analytických přístrojů a výpočetní
techniky zapojené do vyhodnocovacích procesů získaných dat. V analytické praxi jsou hojně
uplatňovány metody plynové a kapalinové chromatografie. Plynová chromatografie je dnes
uplatňována pro stanovení např. účinných látek pesticidů, mastných kyselin, nitrosaminů,
sterolů, celé řady uhlovodíků, alkaloidů, terpenů, dioxinů a dalších skupin látek. Kapalinová
chromatografie je vyuţívána hlavně v uspořádání vysoko účinné kapalinové chromatografie
(HPLC) a v poslední době zejména ve spojení s detektory pracujícími na principu hmotnostní
spektrometrie. Pomocí HPLC je moţné stanovit obsahy řady mykotoxinů, biogenních aminů,
reziduí pesticidů, ale také obsahy aminokyselin, cukrů, vitamínů, přírodních a umělých
barviv, organických kyselin a dalších sloučenin. Ze spektrálních metod je významná
především atomová absorpční spektrometrie (AAS) pro stanovení prvků a stále většího
praktického uplatnění nabízí i metody hmotnostní spektrometrie. Pro rutinní testování velkých
sérií vzorků na obsah mnoha důleţitých sloţek (hodnocení obsahu sušiny, bílkovin, škrobu a
tuku, ale i obsahu vlákniny, popela apod.) v rostlinných produktech je dnes hojně vyuţívána
technika NIRS. Jde o metodu nedestruktivní, poměrně levnou a rychlou, nevýhodou je
náročná kalibrace (Prugar et al., 2008).
Pro potravinářské analýzy mají význam také biochemické metody – enzymové a
imunochemické (nejčastěji vyuţívána technika ELISA v podobě analytických souprav pro
detekci mykotoxinů, bakteriálních enterotoxinů, ale také např. celé řady alergenů). Prudký
rozvoj zaznamenaly a v budoucnu i nadále budou zaznamenávat metody molekulárněbiologické zaloţené na bílkovinném a DNA polymorfismu. Ty se dnes pouţívají jiţ zcela
rutinně např. pro predikci pekařské jakosti zrna obilnin, při diagnostice některých infekčních
nemocí a patogenních mikroorganismů a při verifikaci pravosti a původu potravin či
potravinářských surovin v rámci problematiky falšování potravin. Na tomto úseku je třeba
zmínit i techniky SNIF-NMR a IRMS, jimiţ je vybavena SZPI, které pracují na principu
izotopových analýz umoţňující odhalit např. falšování vína, dţusů, medu a dalších potravin
(Lees et al., 1998; Anonym, 2006; Prugar et al., 2008).
Kromě výše zmíněných metod spojených s hodnocením produktů z hlediska „obsahové―
kvality má stále značný význam sledování senzorické kvality, zahrnující hodnocení vzhledu,
100
„Úroda 12/2011, vědecká příloha―
chuti, vůně a textury pomocí lidských smyslů v podobě panelu hodnotitelů. Zde je v poslední
době snaha o větší objektivizaci pomocí přístrojové techniky umoţňující hodnocení některých
texturních vlastností a aromatických látek. V budoucnu se dá předpokládat větší rozvoj těchto
metod; v komplexním hodnocení stavu potraviny (produktu) by se měla více uplatňovat i
digitální analýza obrazu. Přesto ale mnoho rysů klasické senzorické analýzy nebude moţné
nahradit ani v budoucnu.
Legislativa, kontrola, bezpečnost potravin
Na mezinárodní úrovni je všeobecně uznávaným standardem jako „světový potravinářský
zákoník― tzv. Codex Alimentarius, který vznikl v 60. letech 20. století spoluprací organizací
FAO a WHO. Na této úrovni jsou řešeny obecné i specifické normy týkající se hygieny,
značení výrobků, reziduí pesticidů a veterinárních léčiv, inspekce dovozu a vývozu,
certifikačních systémů, metod pro odběr vzorků a provádění analýz potravinářských aditiv,
kontaminantů, dále výţivy a potravin pro speciální dietologiecké účely (Prugar et al., 2008;
Anonym, 2011b).
Z hlediska právní závaznosti se u nás kvalita rostlinné produkce, ale i dalších potravin odvíjí
od platné legislativy EU a ČR. Na úrovni EU je nařízením Evropského parlamentu a Rady
(ES) č. 178/2002 vymezeno právní prostředí v oblasti potravinářství. V ČR je dle stávající
legislativy v oblasti potravin závazný zákon č. 110/1997 Sb. o potravinách a tabákových
výrobcích. Tento zákon definující základní principy kvality potravin je dále doplněn celou
řadou souvisejících zákonů a prováděcích vyhlášek. Zvláštní kapitolou hodnocení kvality
produktů rostlinné produkce jsou tzv. normy jakosti (ČSN, české státní normy), které definují
jakostní ukazatele jednotlivých komodit a určují postup pro stanovení konkrétního jakostního
ukazatele (Prugar et al., 2008). Legislativní systémy EU i ČR stanovují pro výrobce a
zpracovatele pravidla hodnocení kvality rostlinné produkce (dodavatelsko-odběratelské
vztahy, technologické úpravy, skladování a uchovávání obchodovatelné kvality komodity,
oceňování aj.). Z pohledu konečného spotřebitele pak jde o zajištění maximální bezpečnosti
potravin. V rámci zajištění tohoto cíle byla přijata řada legislativních norem a zajištěno
zřízení několika organizací a institucí, a to jak na úrovni národní, tak i na úrovni EU. Právě
v EU hraje klíčovou úlohu Evropský úřad pro bezpečnost potravin (EFSA) v rámci něhoţ
funguje „Systém rychlého varování pro potraviny a krmiva― (RASFF). V ČR je důleţitou
kontrolní autoritou zejména Státní zemědělská a potravinářská inspekce (SZPI), ale také
ÚKZÚZ, SRS a SVS. MZe ČR zřídilo od roku 2005 Úřad pro potraviny, který je zodpovědný
za tvorbu právních předpisů v oblasti potravin (Prugar, Sýkorová, 2006; Anonym, 2011b).
Označování potravin, obchod
Označování potravin patří mezi nejsloţitější oblasti v rámci potravinového práva v Evropské
unii – poţadavky na označování potravin obsahuje více neţ čtyřicet právních předpisů.
Existují obecné poţadavky na označování potravin (horizontální úroveň) a specifické
poţadavky označování pro určité druhy potravin (vertikální úroveň). Na úrovni České
republiky jsou základní poţadavky na označování všech potravin stanoveny zákonem č.
110/1997 Sb., prováděcí vyhláškou 113/2005 Sb. o označování potravin a vyhláškami pro
jednotlivé skupiny potravin (Anonym, 2011b; Suková, 2008).
Označení potravin se obvykle zahrnuje datum pouţitelnosti/minimální trvanlivosti, název,
sloţení, varovná oznámení, informace o skladování, způsobu pouţití, nutriční hodnotě, údaje
o firmě, označení šarţe, země původu a u mnohých rostlinných produktů se také vyţaduje
označení jakosti a odrůdy. Zásadně platí, ţe způsob označení nesmí uvádět spotřebitele
v omyl a musí být uváděn v českém jazyce (bohuţel není stanovena velikost písma). U
potravin pocházejících z geneticky upravených surovin musí být uvedeno, ţe byly vyrobeny z
„geneticky modifikovaného organismu― nebo konkrétně např. z „geneticky modifikované
101
„Úroda 12/2011, vědecká příloha―
kukuřice―. V EU jsou pro potravinářské účely schváleny jen GM-kukuřice,
-sója, -řepka,
-bavlník (Anonym, 2011b). Vedle těchto stěţejných údajů se na výrobcích objevují i další
nepovinná označení. Jedná se např. o pouţívání značek kvality „KLASA―, „CzechMade― a
„Česká kvalita―, které informující spotřebitele o kvalitních českých výrobcích. Pro
biopotraviny je pouţíváno označení „eko―, „bio―, za předpokladu, ţe jsou splněny podmínky
nařízení 834/2007/ES a zákona č. 242/2000 Sb. (Suková, 2008). Novinkou je značka
„Regionální potravina―. Ta je součástí marketingového programu, který má seznámit
spotřebitele s regionálními potravinami z jednotlivých krajů České republiky a pomoci
prosadit na náš trh kvalitní, chutné a tradiční potraviny (Anonym, 2011b).
K vnímání kvality potravin také zcela nepochybně přispívá obchod. Během posledních dvou
desetiletí výrazně ubylo malých obchodů a nahradily je nové supermarkety a hypermarkety.
Mnoho se v kultuře prodeje potravin zlepšilo, i kdyţ jsou mezi jednotlivými subjekty rozdíly.
Bohuţel často je hlavním lákadlem pro spotřebitele výhodná „akční― cena neţ kvalita
produktu. Své sehrává i globalizace obchodu. Na jedné straně pozitivní, kdy cizokrajné
produkty u nás nevyráběné obohacují nabídku potravinářské produkce. Na druhé straně je
však trh často zaplavován levnými zahraničními produkty, které nejen ţe poškozují domácí
výrobce a pěstitele, ale také často omezují spotřebitele v moţnosti koupit si domácí zboţí,
protoţe dotyčný obchodní řetězec v nabídce tuzemské výrobky jednoduše nemá. Jako příklad
lze uvést mediálně velmi proslavenou kauzu český česnek versus čínský česnek. Dobrou
zprávou je, ţe ve vybraných obchodech se jiţ tato tradiční komodita začíná opět ukazovat
v tuzemské podobě.
Závěr
Je moţné konstatovat, ţe budoucí vývoj odvětví kvality rostlinných produktů je ze současné
pozice nasměrován dobrým směrem. Pochopitelně je stále co zlepšovat. Na tom by se měl
velmi výrazným dílem podílet i zemědělsko-potravinářský výzkum a to nejen výzkum
dotýkající se přímo kvality, ale i zemědělský výzkum v celé své šíři – na úseku rostlinné
výroby zahrnující šlechtění a semenářství, pěstitelskou technologii včetně hnojení, výţivy a
agrotechniky, ochranu rostlin, prostředí a další oblasti. Získané poznatky by měly být rychlou
cestou poskytnuty široké veřejnosti, protoţe jen tak mají šanci být uplatněny v praxi. Je proto
potěšující skutečností, ţe k tomuto transferu jiţ několik let přispívá i tato vědecko-odborná
konference.
Dedikace
Příspěvek byl zpracován v rámci řešení výzkumného záměru MSM 6007665806 a
výzkumného projektu GAJU 064/2010/Z.
Pouţitá literatura
Anonym (2006): Státní zemědělská a potravinářská inspekce – informační portál.
http://www.szpi.gov.cz/ (On –line: 18.08.2011)
Anonym (2011a): World Population Growth, 1950-2050. Population Reference Bureau.
http://www.prb.org/Educators/TeachersGuides/HumanPopulation/PopulationGrowth.aspx
(On-line: 18.08.2011)
Anonym
(2011b):
Potraviny
–
informační
portál
MZe.
http://eagri.cz/public/web/mze/potraviny/ (On-line: 18.08.2011)
Clive J. (2010): Global Status of Commercialized Biotech/GM Crops: 2010. ISAAA Brief No.
42. ISAAA: Ithaca, NY.
Coppens P., Fernandes da Silva M., Pettman S. (2006): European regulations on
nutraceuticals, dietary supplements and functional foods: A framework based on safety.
Toxicology 221: 59-74.
102
„Úroda 12/2011, vědecká příloha―
Čurn V., Nováková A., Šimáčková K., Ondřichová B., Bárta J. (2008): Molecular markers as
a tool for plant breeding and variety identification. In: ModernVariety Breeding for Present
and Future Needs, Prohens J., Badenes M.L. (eds.). UP Valencia, Spain, p. 699-703.
Havlíčková L., Marè C., Rizza F., Aprile A., Borrelli G., Panna R., Perrotta C., De Bellis L.,
Mazzucotelli E., Cattivelli L., Čurn V., (2010): Validation of microarray analysis and
identification of differentially expressed genes in two durum wheat cultivars with
contrasting response to drought stress. Úroda 12: 163 – 166.
Chloupek O. (2008): Genetická diverzita, šlechtění a semenářství. Vyd. 3. Academia ČMT,
Praha, 308 p. (ISBN 978-80-200-1566-2)
Kalač P. (2003): Funkční potraviny – kroky ke zdraví. DONA, České Budějovice, 130 p.
(ISBN 80-7322-029-6)
Kolář L. (2006): Problematika kontroly jakosti biomasy pro energetické účely v závislosti na
energetických technologiích. Sborník z referátů ze semináře „Současné představy a
poţadavky na kvalitu rostlinných produktů―. Jihočeská univerzita v Českých Budějovicích,
Zemědělská fakulta, České Budějovice, 124 p. (ISBN 80-7040-874-X)
Kopec K. (2010): Aktuální poţadavky na kvalitu zemědělských produktů. Vědecká příloha
časopisu Úroda12: 845-849.
Lees M. et al. (1998): Food Authenticity – Issues and Methodologies. Eurofins Scientific,
Nantes, 311 p. (ISBN: 2-9512051-0-4)
Ondřej M., Drobník J. (2002): Transgenoze rostlin. Academia, Praha, 317 p. (ISBN 80-2000958-2)
Prugar J. (2008): Kvalita rostlinných produktů na prahu 3. tisíciletí. VÚPS a.s., Kvasný
průmysl, Praha, 327 p. (ISBN 978-80-86576-28-2)
Prugar J., Sýkorová S. (2006): Kvalita rostlinných produktů dříve a nyní. Sborník z referátů
ze semináře „Současné představy a poţadavky na kvalitu rostlinných produktů―. Jihočeská
univerzita v Českých Budějovicích, Zemědělská fakulta, České Budějovice, 124 p. (ISBN
80-7040-874-X)
Sedláček T., Stemberková L. (2010): Development of a Molecular Marker for Simultaneous
Selection of Rph7 Gene and Effective Mla Alleles in Barley. Cereal Research
Communications 38: 175-183.
STEM/MARK (2010): Ekologické zemědělství a biopotraviny. Závěrečná zpráva z
Kvantitativního výzkumu společnosti STEM-MARK – povědomí a nákupní chování
v oblasti
biopotravin.
http://eagri.cz/public/web/mze/vyhledavani/index$41111.html?query=Biopotraviny+pr%C
5%AFzkum&segments=eagri. (On-line: 18.08.2011)
Suková I. (2008): Průvodce označování potravin. ÚZEI, Praha, 52 p. (ISBN 80-7271-174-1)
Kontaktní adresa:
doc. Ing. Jan Bárta, Ph.D.
oddělení pěstování rostlin, Katedra rostlinné výroby a agroekologie
Zemědělská fakulta, Jihočeská univerzita v Českých Budějovicích
Studentská 13, 370 05 České Budějovice , e-mail: [email protected]
103
„Úroda 12/2011, vědecká příloha―
104
„Úroda 12/2011, vědecká příloha―
ZMĚNY OBSAHU REZISTENTNÍHO ŠKROBU U HRACHU
Changes of content resistant starch on pea
Dostálová R.1, Horáček J.1,Trojan R.2, Hasalová I.2
1
Agritec Plant Research s.r.o., Šumperk
2
SEMO, a.s.
Abstrakt
V letech 2006 - 2011 byl proveden screening odrůd polního a dřeňového hrachu na obsah celkového a
rezistentního škrobu (RŠ). Byly sledovány vztahy mezi obsahem RŠ, sušiny, hodnotami TD – stupeň
zralosti, vliv odběrů z jednotlivých pater hrachu. Byla zjištěna optimální doba technologické sklizně
pro konzervárenské a mrazírenské vyuţití dřeňového hrachu. Byly porovnány různé způsoby
posklizňové úpravy (sušení, mraţení, lyofilizace) na obsah RŠ.
Klíčová slova: Hrách, rezistentní škrob, zralost
Abstract
Screening of varieties of field and garden peas was carried out on content of total and resistant starch
in the years 2006 - 2011. Relationships were observed between the content of RS, dry matter, TD
values - the degree of maturity, the impact of donations from 3 floors peas. Was found optimum time
for harvesting technology canning and freezing peas use. For determination of resistant starch were
compared different methods (drying, freezing, lyophilization).
Key words: Peas, resistant starch, ripeness
Úvod
U hrachu zaujímá největší podíl semene škrob. Hrách je moţno rozdělit na skupiny: 1. Hrách
polní – Pisum sativum L. ssp. sativum var. sativum, který se sklízí v plné zralosti, vyznačuje
se kulatými hladkými semeny a oválnými škrobovými zrny 2. Hrách dřeňový – Pisum
sativum L. ssp. sativum var. medullare se svrasklými semeny, má škrobová zrna paprsčitě
rozštěpena, sklízí se v technologické zelené zralosti. K sloţkám, které pozitivně ovlivňují
trávící procesy, patří rezistentní škrob (RS). ENGLYST et al. (1992) ho definuje jako škrob a
jeho degradační produkty, které zdravý člověk není schopný strávit a vstřebat v tenkém
střevě. Pro jeho příznivý vliv na trávení se zařazuje mezi novou generaci dietní vlákniny jako
prebiotikum. Existují 4 typy rezistentního škrobu. Typ RS1 je přirozeně fyzicky nedostupný
degradací amylolytickými enzymami trávicího traktu. Typ RS2 má primární strukturu a
sloţení, které způsobuje jeho odolnost proti degradaci (mutanti s vysokým obsahem amylózy
nebo zelené banány a syrové brambory). Typ RS3 vzniká při běţné úpravě potravin vařením,
pečením nebo zmrazováním. Typ RS4 je chemicky modifikováný škrob esterifikací nebo
příčnými vazbami. Z literárních zdrojů je zřejmé, ţe obsah RS závisí na mnoţství amylózy a
právě dřeňový hrách má vyšší obsah amylózy, neţ obilniny nebo pseudoobilniny
(MIKULÍKOVÁ et al., 2005). V AGRITECu je k dispozici kolekce genových zdrojů hrachu
(kulatosemenného, hrachu se svraštělým povrchem semen a intermediárního hrachu), u
kterých byly zjišťovány korelace mezi obsahem škrobu a amylózy, amylopektinu a hrubého
proteinu. (HÝBL et al., 2001, DOSTÁLOVÁ et al., 2010).
Cílem práce bylo zjistit obsah celkového škrobu, amylózy a rezistentního škrobu v semenech
polního a dřeňového hrachu a zjistit postihnout změny obsahu RS u dřeňového hrachu
v různých termínech technologické sklizně.
Materiál a metody
Byly hodnoceny registrované odrůdy ze seznamu SDO polního hrachu a odrůdy a linie
dřeňového hrachu ze společnosti SEMO a.s. Dřeňový hrách byl odebírán ve 2-4 termínech
105
„Úroda 12/2011, vědecká příloha―
technologické sklizně. Stanovení rezistentního škrobu (tj. škrobu, který nepodléhá
enzymatické hydrolýze) bylo prováděno pomocí komerčního kitu Megazyme (AOAC metoda
2002.02). Stanovení celkového škrobu bylo prováděno metodou NIRS, později byl vyuţíván
komerční kit Megazyme (Megazyme Total Starch Kit, AOAC metoda 996.11).
Obsah amylózy byl stanovován metodou NIRS, dle interní metodiky Agritecu.
Výsledky a diskuze
V 2006-2010 byl proveden screening souboru polních a dřeňových hrachů, celkem bylo
analyzováno 426 vzorků odrůd polního a dřeňového hrachu. Z výsledků je zřejmé, ţe obsah
rezistentního škrobu je vyšší u dřeňového hrachu a amylózního hrachu (DOSTÁLOVÁ et al.,
2009). Stanovením obsahu celkového škrobu polního hrachu byly zjištěny hodnoty v rozmezí
53,61 - 57,23 %, průměrný obsah amylózy byl 27,87 %. Obsah RS se pohyboval od 2,68 % 6,25 %. U dřeňového hrachu byl zjištěn obsah škrobu v rozmezí 26,57 - 32,55%. Průměrný
obsah amylózy byl 76,82 % z celkového obsahu škrobu. Obsah rezistentního škrobu se
pohyboval od 6,8 % - 7,5 % v technologické zralosti.
Změny v obsahu rezistentního škrobu během přezrávání zahradního hrachu
Změny, ke kterým v obsahu RŠ dochází, jsou důsledkem přirozených procesů a změn, které
probíhají během dozrávání semen. Situace v obsahu RŠ je ovšem výrazně odlišná od ostatních
parametrů, které popisují postupné přezrávání hrášku.(Tenderometrické hodnoty (TD), obsahy látek
nerozpustných v alkoholu (% PANu) i obsahy celkového škrobu (CŠ) během zrání neklesají, ale rostou).
Rozloţení bodů, které znázorňuje po aproximaci hodnot graf č.1, naznačuje, ţe průměrné
hodnoty RŠ stanovené ve vzorcích nevytvářejí na sušině vzorku jednoznačně závislý lineární
trend.
Graf 1: Aproximace znázorňující postupný vzestup a pokles obsahu rezistentního škrobu ve
sklizených vzorcích přezrávajícího zahradního hrachu.
obsah RŠ (%)
9
Rychlý vzestup obsahu RŠ
y=0,2564x+1,0841 R2=0,3784
r=0,62**
8,5
Pomalý pokles obsahu RŠ během zrání semen
8
7,5
7
6,5
6
5,5
5
Technologické
optimum
Zralé semeno
(osivo)
4,5
4
15
20
25
30
35
40
45
50
55
60
65
70
75
80
průměrný obsah sušiny ve sklizeném vzorku (%)
85
Celý soubor dat byl rozdělen na jednotlivé odběry. V prvním odběru jsou pro všechny odrůdy
průkazně niţší obsahy RŠ (6,63 %) neţ byly v 2. a 3. odběru (7,39 % a 7,56 %).
Obsah RŠ nejdříve stoupá a dosahuje u některých kultivarů max. hodnot (graf č. 2). Dále jeho
obsah zřejmě nejdříve stagnuje a později výrazně poklesne. Ve zralém semenu pak aţ na
106
„Úroda 12/2011, vědecká příloha―
průměrnou hodnotu 4,84 %. Přesněji jeho obsah klesne do rozmezí daného intervalem 4,72 4,95 % RŠ v sušině.
Graf 2: Obsah RŠ a CŠ stanovený v postupně přezrávajících vzorcích hrášku
Průměrné hodnoty RŠ se mění v závislosti na termínu odběru (se stoupající sušinou vzorku
SV %). V suchém semenu obsah RŠ dosáhl konečné průměrné hodnoty 4,84 % (při 84%
sušině v osivu).
Poměr RŠ/CŠ, tedy vyjadřuje zastoupení malé a nestálé frakce RŠ ve vztahu k neustále se
rychle hromadícímu obsahu celkového škrobu. Pokles poměru rezistentního škrobu RŠ na
celkovém škrobu CŠ pak znázorňuje pro všechny sklizené vzorky aproximace znázorněná na
grafu č. 3.
Rychlý pokles zastoupení RŠ v CŠ závislý na obsahu sušiny stanovené ve sklizeném vzorku
(SV od 20 do 35 %) je vyjádřen: y=-1,1234 x+58,411, R2 = 0,84 a statisticky vysoce
významným regresním koeficientem r= - 0,92**. Ve zcela přezrálých vzorcích (s obsahem
sušiny vyšším neţ 35 %) je pokles poměru RŠ/ CŠ jiţ pomalý a v suchém semenu pak
dosahuje nízké hodnoty. (RŠ/CŠ =16,2 při 84% sušině)
Graf 3: Aproximace znázorňující pokles obsahu RŠ jako frakce CŠ ve vzorcích hrachu.
Vliv teploty sušení na obsah sušiny RŠ a CŠ ve vzorcích hrachu
Šest vzorků odrůdy Radovan bylo získáno po sklizni čerstvého hrášku z technologických
zkoušek. Po vysítování byla tenderometrem typu TG-4E stanovena hodnota TD = 130. Sušení
bylo prováděno ve dvou opakovaných odběrech vzorků a při třech reţimech: 100°C 48 hodin,
105°C 24 hodin a 120°C po dobu 8 hodin, aţ vzorky dosáhly konstantní (konečné hmotnosti).
Mezi stanovenými obsahy sušiny v jednotlivých vzorcích nebyly zjištěny analýzou rozptylu
107
„Úroda 12/2011, vědecká příloha―
průkazné rozdíly. Z šesti vzorků byl vypočten průměrný obsah sušiny 21,7 %, který lze
povaţovat za technologické optimum. Výsledky měření jsou uvedeny v grafu č. 4
Graf 4: Vliv teplot a délky sušení na obsah rezistentního a celkového škrobu %
Stanované hodnoty obsahu RŠ a CŠ byly hodnoceny analýzou rozptylu dvojného třídění
s opakováním. Cílem analýzy bylo statisticky odhadnout, zda se faktory reţim sušení (teplota
a čas) a opakovaný odběr vzorků, průkazně podílí na velikosti pokusné chyby, 2) v jakých
relacích úkony (faktory) potřebné pro přípravu vzorků přispívají k pokusné chybě (tabulka č.
1 a 2).
Tab. 1: Anova dvojné třídění s opakováním ( 3x2x2) pro RŠ v "konstantní a homogenní―
sušině 21,7 %
Zdroj variability
s. v.
MS
F
F krit.
Reţim sušení ( teplota,čas)
2
0,620*
7,459
5,143
Opakování vzorku v určitém reţimu
1
0,310
3,737
5,987
Interakce (Reţim sušení x opakování vzorku)
2
0,413
4,977
5,143
Chyba stanovení RŠ
6
0,083
Celkem
11
Tab. 2: Anova dvojné třídění s opakováním (3x2x2) pro CŠ v "konstantní a
sušině 21,7 %
Zdroj variability
s. v.
MS
F
Reţim sušení ( teplota,čas)
2
0,190
1,935
Opakování vzorku v určitém reţimu
1
4,967*
50,533
Interakce (Reţim sušení x opakování vzorku)
2
0,423
4,301
Chyba stanovení CŠ
6
0,098
Celkem
11
homogenní―
F krit.
5,143
5,987
5,143
Bylo zjištěno, ţe po sušení při 100°C po dobu 48 hodin a po sušení při 120°C po dobu 8 hodin
nevznikly statisticky významné rozdíly v průměrných hodnotách 6,71 a 6,77 % obsahu RŠ v
sušině. Vzorky vystavené 8 hodinovému sušení při 120°C průkazně nezměnily vlastní
stanovení RŠ. V analýze rozptylu, která hodnotí vliv faktorů na stanovení hodnot obsahu CŠ v
sušině, nebyl prokázán průkazný vliv reţimu sušení ani průkazný vliv na jeho interakci. Pro
stanovení CŠ lze povaţovat všechny reţimy (teploty i doby) sušení za vyhovující.
Vliv lyofilizace vzorkŧ na obsah RŠ a CŠ u pěti kultivarŧ dřeňového hrachu
108
„Úroda 12/2011, vědecká příloha―
Pro testování vlivu lyofilizace a sušení na hodnoty obsahu RŠ a CŠ byly vybrány vzorky
následujích pěti kultivarů odr. Vladan, Radovan, Morris, SM441/02 a SM 470/02.
Vzorky byly před vlastním stanovením škrobů připraveny dvěma způsoby.
1) Zmraţením (a dlouhodobým uchováváním při - 42°C) a následnou lyofilizací.
2) Obvyklým sušením při 100°C po dobu 48 hodin.
Čerstvě sklízené vzorky nezralého hrášku byly vţdy rozdělovány na dvě části. Ještě před
vlastním zmraţením byla na malé části hrášku stanovena sušina.
V tomto párovém pokusu byl testován vliv dvou způsobů přípravy vzorku před vlastním
stanovením obsahu RŠ a CŠ . Obě hodnoty uvádí souhrnně graf. č. 5. Proměnlivost pokusu ve
stanovených hodnotách RŠ hodnotí analýza rozptylu dvojného třídění s opakováním a analýza
dvojného třídění bez opakování hodnotí proměnlivost zjištěnou v obsahu celkového škrobu.
Graf 5 : Obsah rezistentního a celkového škrobu po lyofilizaci a sušení vzorků
Průměrné hodnoty RŠ, které byly stanoveny po sušení vzorku, byly o 61 % vyšší neţ ty, které
byly stanovené z mraţených a následně lyofilizovaných vzorků. Je pravděpodobné, ţe
nezbytné zahřívání vzorků během sušení zvýší nejméně o polovinu obsah rezistentního škrobu
ve srovnání s hodnotami stanovenými v lyofilizovaných vzorcích.
Příprava vzorku lyofilizací nebo sušením (při 100°C po dobu 48 hodin) průkazně neovlivnilo
stanovené obsahy celkového škrobu a bylo moţno od sebe pouţité odrůdy vzájemně odlišit.
Sušené vzorky mají nadhodnocený obsah RŠ, se kterým lze počítat v klasických
technologických postupech, které při sušení zeleného hrášku vyuţívají vysoké teploty.
Obsah škrobu, rezistentního škrobu a sušiny v jednotlivých patrech dřeňového hrachu
Pro hodnocení bylo záměrně vybráno šest různě raných a typově odlišných odrůd
Vzorky byly odebírány 3 x týdně z 1., 2. a 3. patra porostu. Postupné přezrávání hrášku bylo
moţno sledovat nejen v určitých termínech, ale i podle stoupajícího obsahu sušiny.
Po hodnocení všech odrůd analýzami rozptylu bylo moţno vyjádřit, jakou částí se na celkové
proměnlivosti podílejí patra, termíny sklizně, interakce (patra x termíny) a chyba stanovení.
Proporce proměnlivosti v obsahu celkového a rezistentního škrobu pro jednotlivé odrůdy
znázorňuje tabulka č. 3.
Tab. 3: Charakteristika šesti odrůd vyjádřená proporcemi z proměnlivosti v CŠ % a RŠ %
Proporce proměnlivosti CŠ a RŠ vyjádřené v %.
Zdroj proměnlivosti
OSKAR
HAVEL
RADOVAN
CTIRAD
KUDRNÁČ
DALILA
Patra
48,1
53,7
3,6
16,1
23,4
15,7
5,6
23,8
9,6
11,3
7,2
5,7
Termíny sklizně
46,7
25,7
55,2
80,8
70,1
52,4
93,1
40,6
85,1
42,0
84,4
92,7
Patra x Termíny
5,1
18,9
26,9
3,0
6,3
28,2
1,2
25,6
5,0
39,8
3,3
1,6
Chyba stanovení
0,1
1,7
14,3
0,1
0,3
3,7
0,1
10,0
0,2
6,9
5,1
0,1
Odrůdy lze seřadit podle velikosti heterogenity v obsahu celkového škrobu, která je vyjádřená
proměnlivostí způsobenou patry, do následujícícho sestupného pořadí: odr. Oskar (48,1 %),
Radovan (23,4 %), Havel (16,1 %), Kudrnáč (9,6 %) Dalila (5,7 %) a odr. Ctirad (5,6 %).
109
„Úroda 12/2011, vědecká příloha―
Podobné sestupné pořadí lze vytvořit i pro heterogenitu v obsahu rezistentního škrobu: Oskar
(53,7 %), Ctirad (23,8 %), Radovan (15,7 %), Kudrnáč (11,3 %) Dalila (7,2 %) a odr. Havel
(3,6 %).
Odrůdy měly odlišné rozdělování a ukládání škrobu do přezrávajích semen v těch luscích,
které byly nasazeny v různě starých patrech. Rozdíly v ukládání asimilátů do jednotlivých
pater se projevily i různou heterogenitou v přezrávajícím hrášku v porostech sledovaných
odrůd.
Odrůda Oskar, v prvním patře nasazuje na 8. nodu jeden nebo dva, dlouhé ostře ukončené
lusky s 10-12 velkými semeny, do kterých přednostně ukládá sušinu. Oskar nejdříve ukládá
škrob do prvního patra a do ostatních pater ukládá mnohem méně a později. Důsledkem toho
vznikne po jednorázové sklizni surovina, která je v obsahu škrobu značně heterogenní a
„konzervárensky riziková―.
Pozdní odrůdy Ctirad a Dalila, které nasazují lusky na 13. a 14. nodu, tvoří jiţ před počátkem
kvetení mnohem větší lodyhy s velkou listovou plochou a jsou schopné vytvořit vyšší výnos.
Vývoj lusků v různých patrech porostu i ukládání asimilátů do menších semen je
rovnoměrnější. Po jednorázové sklizni vznikne homogenní surovina vytvořená menším
hráškem, který má poměrně vyrovnaný obsah celkového škrobu.
Závěr
Z výsledků je patrné, ţe obsah rezistentního škrobu je průkazně vyšší u odrůd dřeňového
hrachu. Jeho obsah je závislý na optimálním termínu sklizně i jeho posklizňovém zpracování.
Informace o obsahu celkového a rezistentního škrobu se uplatní při cíleném šlechtění hrachu
určeného pro potravinářský průmysl. Předpoklad vyuţití výsledků tohoto výzkumu, je
podpořen aktivní účastí šlechtitelské firmy SEMO a.s, která zaujímá významnou úlohu při
tvorbě nových odrůd určených pro potravinářské vyuţití u nás i v zahraničí.
Dedikace
Tato práce byla podpořena grantem Ministerstva školství mládeţe a tělovýchovy ČR MSM
2B06085 a MSM 2678424601.
Pouţitá literatura:
Dostálová R., Horáček J., Trojan R. And Hasalová I.: Study of resistant starch content in peas
after harvesting treatment. Proceedings of the 6th international conference on
polysaccharides - Glycoscience. 2010. sv. 6, s. 82-85. ISBN 978-80-86238-78-4.
Dostálová R., Horáček J., Hasalová I., Trojan R.: Study of resistant starch(RS) content in peas
during maturation. Czech J. Food Sci, Vol. 27, 2009 Special Issue, p. S120-S124
Englyst, H., N., Kingman, J., H., Cummings, J., H., (1992). Classification and measurement
of nutritionally important starch fraction. In: Eur. J. Clin. Nutr., 46, 1992, 33-50
Hýbl, M., Urban, J., Václavíková, J., Griga, M.: Evaluation of Pea Genetic Resources
Collection for Seed Starch, Amylose/Amylopectin and Protein Content. Czech J. Genet.
Plant Breed., 2001. 37, (4) 114 – 123.
Mikulíková, D., Čičová, I., Antalíková, G., Kraic, J.: Content of resistant starch in grains of
six undervalued plant species. In: Czech J. Genet. Plant Breed., 41, 2005, 96-104
Kontaktní adresa:
Ing. Radmila Dostálová
Agritec Plant Research, s.r.o., Zemědělská 16, 787 01 Šumperk
[email protected]
110
„Úroda 12/2011, vědecká příloha―
OBSAH SILIC A JEJICH JEDNOTLIVÝCH SLOŢEK VE VYBRANÝCH
ODRŦDÁCH CHMELE
Essential oil content and it's individual compounds in selected
varieties of hop
Pluháčková H.1, Ehrenbergerová J.1, Kocourková B.1, Fojtová J.2
1
Mendelova univerzita v Brně, Ústav pěstování, šlechtění rostlin a rostlinolékařství
2
Mendelova univerzita v Brně, Ústav chemie a biochemie
Abstrakt
Cílem práce bylo zhodnotit vlastnosti chmelových hlávek z různě starých chmelnic u odrůd
pěstovaných v Tršické chmelařské oblasti. Předmětem hodnocení byly odrůdy Ţatecký
poloraný červeňák - ozdravená forma (ŢPČ), dále odrůdy Premiant a Sládek. Hlávky chmele
byly odebrány při sklizni v roce 2009 a 2010. Jednotlivé odrůdy byly hodnoceny kaţdá
zvlášť, vzhledem k rozdílnému stáří chmelnic. Z výsledků vyplývá, ţe u odrůdy ŢPČ byl
v obou letech nejvyšší obsah silice u vzorků z chmelnice zaloţené v roce 1997, u této odrůdy
byl potvrzen vyšší obsah farensenu, který tuto odrůdu odlišuje od ostatních. U odrůdy Sládek
byl obsah silic nejvyšší u vzorků z chmelnice zaloţení v roce 2007 v obou letech, tyto vzorky
měly také nejvyšší obsah myrcenu. Obsah caryophylenu a humulenu u této odrůdy byl však
odlišný. U odrůdy Premiant byl ve sledovaných letech rozdílný obsah silice i jejich sloţek.
Z dvouletých výsledků vyplývá, ţe na průběh ročníku v obsahu silic a jejího sloţení nejvíce
reaguje odrůda Premiant.
Klíčová slova: myrcen, karyofylen, humulen, farnesen, stáří chmelnic
Abstract
The aim of the work was to evaluate the properties of hop cones of varieties from Tirschitz
growing region from the hop gardens of different age. Varieties Saaz hops – strengthen form
(ŢPČ), Premiant and Sládek were took into the assessment. Hop cones were sampled in the
harvest in 2009 and 2010. Regarding the different age of hop gardens, the individual varieties
were tested separately. The results showed that variety Saaz hops had the highest content of
essential oil in the samples from the gardens found in 2007 in both tested years. Also, higher
content of farnesene in essential oil was confirmed at this variety, as it is the feature which
distinguishes Saaz hops from the other varieties. Variety Sládek had also the highest content
of essential oil in the samples from hop gardens found in 2007 in both years. These samples
had also the highest content of myrcene. Caryophyllene and humulene content was
completely different at this variety. The content of the essential oil and its compounds at
variety Premiant was different in the observed years. Two years data showed that the most
sensitive variety to the course of the year in the essential oil content and its composition is
Premiant.
Key words: myrcen, karyofylen, humulen, farnesen, hop fields age
Úvod
Tršicko je moravskou chmelařskou oblastí, která má celkovou výměru 742 ha a rozkládá se v
okresech Olomouc, Přerov a Prostějov. Dlouhodobý průměr dešťových sráţek za vegetační
období je v Tršicích 344,4 mm.
Většina chmelnic je vysázena v nadmořské výšce 260 – 300 m n.m.. Jednou z nejdůleţitějších
klimatických podmínek pro pěstování chmele je teplota a dále pak atmosférické sráţky.
Dlouhodobý teplotní průměr za vegetační měsíce duben - srpen je v Tršicích 15,15°C.
111
„Úroda 12/2011, vědecká příloha―
Porovnáme-li dlouhodobý teplotní denní průměr např. s Ţatcem, pak zjišťujeme, ţe v Ţatci je
průměrná denní teplota vyšší o cca 0,30°C. (ROSA, 2007)
Moravská Zemědělská a.s. Prosenice se rozkládá v údolí Moravské brány. Klimatické
podmínky odpovídají teplejší oblasti s průměrem teplot 8,4°C a středně vlhké s průměrem
sráţek 672 mm. Tento podnik se specializuje na výrobu chmele, patří do oblastí nejstarších
v historii pěstování chmele na Moravě. V současné době obhospodařuje 167 ha chmelnic,
čímţ je největším pěstitelem chmele na Moravě. Odrůdová skladba v tomto podniku je
zaměřena více na pěstování hybridních typů odrůd chmele jako je Premiant, Sládek, ale ve
velké míře se stále pěstují i typické odrůdy Ţateckého poloraného červeňáku jak ozdravené
tak i neozdravené formy.
Silice jsou v chmelových hlávkách přítomny v lupulinových zrnech chmelové hlávky a chmel
jich obsahuje od 0,5 do 3,0 %. Jsou sloţitou směsí několika set přírodních látek terpenického
charakteru a různého chemického sloţení. Některé jsou zastoupeny ve větším mnoţství,
některé jen ve stopách (ČEPIČKA, 2008).
Sloţky chmelových silic je moţno rozdělit do tří skupin. Největší podíl připadá na
uhlovodíkovou frakci, která u čerstvého chmele tvoří 70 -80 % celkové hmotnosti silic.
Zbývající podíl připadá na látky obsahující kyslík. Jedno procento tvoří sirná frakce, která je
senzoricky velmi aktivní a není v silici chmele zanedbatelná. Nedůleţitější však jsou sloţky
uhlovodíkové frakce a to myrcen, karyofylen, humulen a farnesen. Otázkami obsahu a sloţení
chmelových silic se zabývala řada autorů, v poslední době, především KROUPA (2007).
Tento autor uvádí, ţe chemické sloţení chmele je závislé na odrůdě, podmínkách počasí
daného pěstitelského roku, ale i klimatické podmínky dané pěstitelské oblasti. Velmi
charakteristické je sloţení silic u odrůdy Ţatecký poloraný červeňák, kterou lze podle obsahu
a sloţení silic identifikovat. Sloţení silic ostatních odrůd je velmi podobné, ale existují sloţky
silic, podle kterých je moţné jednotlivé odrůdy odlišit. KROUPA (2007) prokázal závislost
biosyntézy silic na klimatických podmínkách daného roku. Dále prokázal i rozdíly ve sloţení
silic českých odrůd podle způsobu skladování. Z jeho práce dále vyplynulo, ţe sesviterpen
farnesen – tento charakteristický znak silic Ţateckéko poloraného červeňáku - je velmi
nestabilní a během stárnutí chmele, případně vlivem nesprávného skladování dochází k jeho
rychlému úbytku.
Materiál a Metody
Pro tuto práci byly v zemědělské organizaci Moravská zemědělská a. s. se sídlem
v Prosenicích v Tršické chmelařské oblasti odebrány vzorky ze sklizně roku 2009 a 2010.
Pro tuto práci byly vybrány vzorky odrůd Ţatecký poloraný červeňák (dále jen ŢPČ)
z meristemového mnoţení tzv. ozdravená forma, dále hybridní typy odrůd Premiant a Sládek.
Vzorky byly odebrány z různě starých chmelnic s ohledem na odrůdu, do papírových obalů
při sklizni po očesání, vysušení a následné klimatizaci na vlhkost 11 – 12 %, kdy byly tyto
vzorky podrobně popsány, označeny a uloţeny ve tmě ve skladu při konstantní teplotě aţ do
samotných rozborů.
Obsah silice v odebraných vzorcích hlávek chmele ze sklizně roku 2009 a 2010 byl stanoven
destilací vodní parou dle metodiky, kterou uvádí KROFTA (2008). Vzhledem k moţnostem
stanovení byla tato metoda pro naše potřeby modifikována a vyuţívá se destilační aparatura
podle Českého lékopisu 2009 na stanovení silic v rostlinných drogách. Obsah silice byl
stanoven po půlročním skladování vzorků. Sloţení silice bylo stanoveno na Ústavu chemie a
biochemie MENDELU v Brně plynovou chromatografií s následnou detekcí (GC/FID). Pro
identifikaci a stanovení poměrů zkoumaných látek byl pouţit plynový chromatograf HP4890D s plamenově ionizačním detektorem. Separace probíhala na koloně HP-INNOW ax
(30 m x 250 µm x 0,5 µm filmu polyetylenglykolu). Na kolonu byl dávkován 1 µl silice
naředěné hexanem se splitem 50:1. Průtok helia byl 1 ml/min, teplot a nástřiku 240 oC a
112
„Úroda 12/2011, vědecká příloha―
teplota detektoru 250 oC. Teplotní program pro chmelovou silici byl T1 = 60 oC, t1= 0,01 s, 1,5
o
C za min., T2 = 80oC, t2 =0,01 s, 40 oC za min. T3 =240oC, t3 = 8 min. Celkový čas 25,33 min..
Ze sloţek silice jsme hodnotili: humulen, farnesen, karyofylen, myrcen, vţdy ve dvou
opakováních. Pro hodnocení výsledků byl vyuţit statistický program STATISTICA (StatSoft,
Inc. 2009). (data analysis software system), version 9.0. Výsledky byly vyhodnoceny
jednofaktorovou analýzou variance s následným testováním LSD testem.
Výsledky a diskuse
Z celkového obsahu silic v hlávkách chmele ŢPČ z chmelnic různého roku výsadby je vidět,
ţe jsou mezi výsledky průkazné rozdíly. Ze sklizně roku 2009 byl nejniţší obsah silic zjištěn
u vzorků z roku výsadby 1998 (674 mg.100g-1), který se však lišil od druhé nejniţší hodnoty z
roku sklizně 1996 (879 mg.100g-1). Nejvyšší hodnota celkového obsahu silic byla zjištěna v
roce sklizně 2009 u vzorků z roku výsadby 1995 a 1997 (1164 a 1083 mg.100g-1), které se
však statisticky významně nelišily od vzorků z roku sklizně 2010 z roku výsadby 1997 (1030
mg.100g-1). Další hodnoty z roku sklizně 2010 se od sebe statisticky významně nelišily a byly
celkově v obou letech sklizně nejniţší. Vzorky byly z let výsadby 1995, 1996 a 1998 v
rozmezí od 183 do 277 mg.100g-1 (tab. 1 a 2). Obsah myrcenu ve vzorcích ze sklizně roku
2010 (od 58,95 do 42,48 %), byl v průměru vyšší neţ u vzorků z roku sklizně 2009 (od 41,45
do 30,56 %) (tab. 1 a 2). V obsahu caryofylenu u odrůdy ŢPČ byl trend opačný jako u obsahu
myrcenu. Obsahu caryofylenu byl v průměru vyšší v roce sklizně 2009 (od 9,08 do 8,20 %),
oproti vzorkům z roku sklizně 2010 (od 8,09 do 5,58 %). Také obsah humulenu byl v roce
sklizně 2009 (od 39,41 do 32,37 %) průměrně vyšší neţ v roce sklizně 2010 (od 22,87 do
23,73). (tab. 1 a 2)
Tab. 1: Analýza variance pro obsah chmelových silic odrůdy ŢPČ a jednotlivých sloţek silice
PČ
Zdroj
proměnlivosti
n-1
rok sklizně
rok výsadby
rok sklizně * rok výsadby
chyba
1
3
3
8
celkový
obsah silic
1083785***
272913***
147726***
4274
myrcene
t-caryophyllene
t-b-farnesene
a-humulene
678,78***
113,40***
25,44*
6,49
12,90***
2,24***
0,58*
0,10
151,36***
12,13***
1,01
0,77
155,39***
38,65***
16,24**
2,13
Pozn.: * - p ≤ 0,05; ** - p ≤ 0,01; *** - p ≤ 0,001; PČ = průměrný čtverec; Obsah silic v mg .100g-1
Tab. 2: Obsah a sloţení chmelových silic odrůdy ŢPČ v jednotlivých letech zaloţení
chmelnic
rok sklizně rok výsadby
2009
2009
2009
2009
2010
2010
2010
2010
1995
1996
1997
1998
1995
1996
1997
1998
celkový
obsah silic
d
1164
c
879
d
1083
b
674
a
183
a
277
d
1030
a
227
myrcene t-caryophyllene t-b-farnesene a-humulene
41,45
30,56
35,50
39,34
48,84
42,48
48,67
58,95
c
a
ab
bc
d
c
d
e
8,20
9,37
9,08
8,49
6,88
8,09
7,39
5,58
d
f
ef
de
b
cd
bc
a
16,55
19,32
17,75
16,15
10,20
13,26
12,88
8,84
c
d
cd
c
a
b
b
a
32,37
39,41
36,61
34,57
31,21
33,87
29,22
23,73
bc
e
de
cd
bc
cd
b
a
Pozn.: Průměrné hodnoty označené odlišnými písmeny ve sloupcích se od sebe statisticky významně liší při P=0,05; Obsah silic v mg.100g-1,
jednotlivé sloţky silice jsou v procentickém zastoupení
Vzorky odrůdy Sládek byly odebrány z chmelnic pěti rozdílných stáří, z tab. 3 vyplývá, ţe
mezi vzorky byly vysoce průkazné rozdíly. U odrůdy Sládek byl celkový obsah silic nejvyšší
u vzorků z roků výsadby 2007. V roce sklizně 2009 (2433 mg.100g-1) a v roce sklizně 2010
(1512 mg.100g-1). Nejniţší hodnoty byly zjištěny u vzorků z roku výsadby 2003 u obou let
113
„Úroda 12/2011, vědecká příloha―
sklizně (v roce sklizně 2009 675 mg.100g-1 a v roce sklizně 2010 1197 mg.100g-1). Obsah
myrcenu byl podobně jako u celkového obsahu silic nejvyšší u vzorků z roku sklizně 2007
(53,62 a 61,72 %). Nejniţší hodnoty však byly zjištěny v roce sklizně 2009 u vzorků z roku
výsadby 2005 (19,48 %). V roce sklizně 2010 byly nejniţší hodnoty naměřené u vzorků z
roku výsadby 2003, coţ byla celkově nejniţší naměřená hodnota u odrůdy Sládek v obsahu
myrcenu v obou letech sklizně. Nejvyšší obsah caryofylenu byl zjištěn u vzorků ze sklizně
2009 roku výsadby 2001 (17,07 %), 2005 (17,07 %), 2003 (16,51 %) a u vzorků ze sklizně
2010 roku výsadby 2003 (16,55 %). Oproti tomu byly nejniţší hodnoty caryofylenu zjištěny u
vzorků ze sklizně 2010 roku výsadby 2007 (9,19 %). Odrůda Sládek oproti odrůdě ŢPČ se
vyznačuje velmi nízkým případně nedetekovatelným mnoţstvím farnesenu. Obsah farnesenu
je pro odrůdu ŢPČ typickým ukazatelem. U odrůdy Sládek byly zjištěny nízké hodnoty pouze
v roce sklizně 2010 oproti vzorkům sklizených v roce 2009, kde obsah farnesenu nebyl
zjištěn. Nejvyšší hodnota byla zjištěna u vzorků ze sklizně 2010 z roku výsadby 2004 (0,11
%). Nejvíce zastoupenou sloţkou silice byl obsah humulenu, kde nejvyšší hodnoty byly
zjištěny u vzorku ze sklizně 2010 roku výsadby 2003 (67,37 %). Nejniţší obsah humulenu byl
zjištěn u vzorků ze sklizně 2010 roku výsadby 2007 (27,56 %). (tab. 3 a 4)
Tab. 3: Analýza variance pro obsah chmelových silic odrůdy Sládek a jednotlivých sloţek
silice
PČ
Zdroj
proměnlivosti
n-1
rok sklizně
rok výsadby
rok sklizně * rok výsadby
chyba
1
4
4
10
celkový
obsah silic
100809***
645792***
360620***
3236
myrcene
t-caryophyllene
t-b-farnesene
a-humulene
654,11***
753,48***
254,02***
6,02
38,34***
17,09***
6,66***
0,14
0,01***
0,00***
0,00***
0,00
169,65***
490,91***
200,38***
5,38
Pozn.: * - p ≤ 0,05; ** - p ≤ 0,01; *** - p ≤ 0,001; PČ = průměrný čtverec, obsah silic v mg.100g-1
Tab. 4: Obsah a sloţení chmelových silic odrůdy Sládek v jednotlivých letech zaloţení
chmelnic
rok sklizně rok výsadby
2009
2009
2009
2009
2009
2010
2010
2010
2010
2010
2001
2003
2004
2005
2007
2001
2003
2004
2005
2007
celkový
obsah silic
b
870
a
675
b
981
1113 c
2433 g
1319 de
1197 cd
1357 e
1396 ef
1512 f
myrcene t-caryophyllene t-b-farnesene a-humulene
34,86
24,48
27,10
19,48
53,62
46,35
14,86
39,18
54,62
61,72
d
bc
c
ab
f
e
a
d
f
g
17,07
16,51
14,73
17,07
12,67
13,14
16,55
14,36
10,96
9,19
e
e
d
e
c
c
e
d
b
a
0,00
0,00
0,00
0,00
0,00
0,01
0,05
0,11
0,03
0,01
a
a
a
a
a
b
d
e
c
b
46,34
53,10
51,64
58,11
31,33
38,89
67,37
45,05
32,53
27,56
c
de
d
e
a
b
f
c
a
a
Pozn.: Průměrné hodnoty označené odlišnými písmeny ve sloupcích se od sebe statisticky významně liší při P=0,05; Obsah silic v mg.100g-1,
jednotlivé sloţky silice jsou v procentickém zastoupení
Vzorky odrůdy Premiant nevykazovaly statisticky průkazné rozdíly v letech sklizně, v letech
výsadby však byly hodnoty statisticky vysoce průkazné. (tab. 5) Celkový obsah silic byl
nejvyšší ve vzorcích odrůdy Premiant roku sklizně 2010 z roku výsadby 1998 (1290 mg.100g1
), které se však statisticky významně neliší od vzorků ze sklizně 2010 roku výsadby 1997
(1229 mg.100g-1). Nejniţší hodnoty byly zjištěny také ze sklizně 2010 ve vzorcích roku
výsadby 2001 (321 mg.100g-1). Obsah myrcenu odrůdy Premiant byl podobně jako u
celkového obsahu silic nejvyšší u vzorků ze sklizně 2010 roku výsadby 1998 (78,82 %).
Obsah caryofylenu byl v průměru vyšší ze sklizně roku 2009 (od 17,56 do 10,51 %) oproti
114
„Úroda 12/2011, vědecká příloha―
sklizni 2010 (13,87 do 5,01 %). Sloţka silice farnesen byla v nejvyšším mnoţství zjištěna ve
vzorcích sklizených v roce 2010 roku výsadby 1997 (1,06 %), nejniţší mnoţství bylo zjištěno
ve vzorcích z roku sklizně 2009 roku výsadby 1998 (0,33 %). Ve vzorcích odrůdy Premiant
byly zjištěny statisticky významné rozdíly mezi jednotlivými vzorky. Nejvyšší procentické
zastoupení humulenu bylo zjištěno u vzorků ze sklizně 2009 roku výsadby 2001 (81,31 %),
nejniţší obsah byl ze sklizně 2010 roku výsadby 1998 (14,38 %).(tab. 5 a 6)
Tab. 5: Analýza variance pro celkový obsah chmelových silic odrůdy Premiant a jednotlivých
sloţek silice
PČ
Zdroj
proměnlivosti
n-1
rok sklizně
rok výsadby
rok sklizně * rok výsadby
chyba
1
2
2
6
celkový
obsah silic
23678
146507***
586704***
3400
myrcene
t-caryophyllene
t-b-farnesene
a-humulene
3182,90***
2311,03***
52,74*
6,29
66,80***
64,04***
0,87*
0,23
0,08***
0,21***
0,14***
0,00
1981,70***
1832,37***
11,78*
5,65
Pozn.: * - p ≤ 0,05; ** - p ≤ 0,01; *** - p ≤ 0,001; PČ = průměrný čtverec
Obsah silic v mg.100g-1, jednotlivé sloţky silice jsou v procentickém zastoupení
Tab. 6: Obsah a sloţení chmelových silic odrůdy Premiant v jednotlivých letech zaloţení
chmelnic
rok sklizně rok výsadby
2009
2009
2009
2010
2010
2010
1997
1998
2001
1997
1998
2001
celkový
obsah silic
b
572
c
899
1103 d
1229 de
1290 e
a
321
myrcene t-caryophyllene t-b-farnesene a-humulene
23,98
41,24
0,29
59,87
78,82
24,53
b
c
a
d
e
b
13,45
10,51
17,56
8,47
5,01
13,87
d
c
e
b
a
d
0,49
0,33
0,81
1,06
0,39
0,66
b
a
d
e
ab
c
57,18
42,02
81,31
29,46
14,38
59,57
d
c
e
b
a
d
Pozn.: Průměrné hodnoty označené odlišnými písmeny ve sloupcích se od sebe statisticky významně liší při P=0,05; Obsah silic v mg.100g-1,
jednotlivé sloţky silice jsou v procentickém zastoupení
Závěr
Obsah silic a zastoupení jednotlivých jejich sloţek ve vybraných odrůdách chmele byl
sledován u vzorků odebraných při sklizni v roce 2009 a 2010 z různě starých chmelnic u
odrůd Ţatecký poloraný červeňák – ozdravená forma, Premiant a Sládek. Statistické
vyhodnocení bylo provedeno pro kaţdou odrůdu zvlášť vzhledem k rozdílnému stáří
chmelnic. Silice byly získány destilací vodní parou a sloţení silic bylo stanoveno plynovou
chromatografií s následnou detekcí (GC/FID). Pro identifikaci a stanovení poměrů
zkoumaných látek byl pouţit plynový chromatograf HP-4890D s plamenově ionizačním
detektorem. Z výsledků můţeme učinit tyto závěry:
1. U odrůdy ŢPČ byl v obou letech shodný obsah silice u vzorků z chmelnice zaloţené v roce
1997 (1083 a 1030 mg.100g-1). Nejvyšší obsah silice však u této odrůdy byl u vzorků
z chmelnice zaloţené v roce 1995 (1164 mg.100g-1). U této odrůdy byl potvrzen vyšší obsah
farnesenu, který tuto odrůdu odlišuje od ostatních. Nejvyšší byl v obou letech u vzorků
z chmelnice zaloţené v roce 1996 (19,32 a 13,26 %). Ze statistického hodnocení vyplývá, ţe u
všech sloţek silice jsou rozdíly průkazné v obou sledovaných letech
2. U odrůdy Sládek byl obsah silic nejvyšší v obou letech u vzorků z chmelnice zaloţené
v roce 2007 (2433 a 1512 mg.100g-1), tyto vzorky měly také nejvyšší obsah myrcenu (53,62 a
61,72 %). Byly prokázány statisticky průkazné rozdíly v obsahu caryofylenu a humulenu u
odrůdy Sládek.
3. U odrůdy Premiant byl v obou sledovaných letech statisticky významný rozdíl v obsahu
silic i jejím sloţením. V roce sklizně 2009 byl nejvyšší obsah silice u vzorků z roku zaloţení
115
„Úroda 12/2011, vědecká příloha―
2001 (1103 mg.100g-1). V roce 2010 byl nejvyšší obsah silice u vzorků z roku zaloţení 1998
(1290 mg.100g-1). Podobné tendence byly u odrůdy Premiant také ve sloţení silic.
Z dvouletých výsledků vyplývá, ţe obsah silic a sloţení silic je závislé na průběhu ročníku.
Nejvíce na průběh ročníku jak vyplývá z výsledků reagovala odrůda Premiant.
Z dosaţených výsledků vyplývá, ţe obsah a sloţení silic je závislé nejen na průběhu ročníku,
ale i na odrůdě a stáří chmelnice. Vliv stáří chmelnice bude třeba ověřit v další letech.
Poděkování
Práce vznikla za podpory projektu 1M0570 „Výzkumné centrum pro studium obsahových
látek ječmene a chmele― Ministerstva školství, mládeţe a tělovýchovy České republiky.
Pouţitá literatura
Čepička J. In Prugar J: Kvalita rostlinných produktů na prahu 3.tisíciletí. Výzkumný ústav
pivovarský a sladařský a.s. ve spolupráci s Komisí jakosti rostlinných produktů ČAZV,
2008, s.327, ISBN 978-80-86576-28-2
Kroupa F.: Objektivní charakteristika chmelového aroma českých chmelů a chmelových
výrobků. Dizertační práce. VŠCHT v Praze, Fakulta potravinářské a biotechnologické
technologie, 172 s. Praha 2007
Krofta K.: Hodnocení kvality chmele. Metodika pro praxi 4/08, Chmelařský institut Ţatec, 50
s., ISBN 978-80-86836-84-3, 2008
ROSA Z., 2009: Český chmel 2009. Ministerstvo zemědělství, Praha, 31s., ISBN 978-80-7084853-1.
Kontaktní adresa:
Ing. Helena Pluháčková
Mendelova univerzita v Brně
Agronomická fakulta, Ústav pěstování, šlechtění rostlin a rostlinolékařství
Zemědělská 1, Brno 613 00
[email protected]
116
„Úroda 12/2011, vědecká příloha―
PŠENICE S ODLIŠNÝM ZABARVENÍM ZRNA A MOŢNOST JEJICH
VYUŢITÍ V POTRAVINÁŘSTVÍ
Wheats with Different Grain Colour and Their Use in Food Processing
Martinek P.1, Vyhnánek T.2, Podhorná J.2, Novotná P.3, Vaculová K.1, Kadlíková M.1,
Jirsa O.1, Kurečka R.4
Agrotest fyto s.r.o.Kroměříţ
Mendelova univerzita v Brně
3
Výzkumný ústav potravinářský Praha, v.v.i.
4
IREKS - ENZYMA, s.r.o. Brno
1
2
Abstrakt
Běţné odrůdy pšenice (T. aestivum L.) mají červené zabarvení zrna, které je řízeno jednou aţ třemi
dominantními alelami R-A1a (na chromosomu 3AL), R-B1b (na 3BL) a R-D1b (na 3DL); bílé zrno je
podmíněno sestavou recesivních alel. Ţlutá barva zrna je podmíněna širokým spektrem alel
odpovědných za biosyntetické dráhy enzymu fytoen syntázy (na 7A, 7B, 5A), modrý aleuron je řízen
alelami Ba1 (na 4BS) a Ba2 (na 4A), purpurový perikarp je řízen alelami Pp1 (na 7B), Pp2 (na 7A),
Pp3a, Pp3b (na 2A). Rozdíly v zabarvení zrna jsou způsobeny přítomností polyfenolů, taninů,
antokyanů a karotenoidů. Je uveden přehled donorů pšenice s neobvyklou barvou zrna a některé
typické charakteristiky zrna. V rozdílných pletivech zrna je rozdílné zastoupení barevných látek, které
ovlivňuje jejich obsah v mouce a šrotu a tím i v jednotlivých druzích pekárenských a pečivárenských
výrobků. Geny pro biosyntézu barviv, lokalizované na různých chromosomech, lze vzájemně
kombinovat a vytvářet tak linie s vyšším obsahem látek s antioxidačním účinkem v zrnu.
Klíčová slova: barva zrna, pšenice setá, antioxidanty, potravinářství
Abstract
Common cultivars of wheat (T. aestivum L.) have red colour of grain which is controlled by one to
three dominant alleles R-A1a (on chromosome 3AL), R-B1b (on 3BL) and R-D1b (on 3DL); white
grain is determined by recessive constitution of the alleles. Yellow colour is determined by a large
spectrum of alleles responsible for biosynthetic pathways of enzyme phytoene synthase (on 7A, 7B,
5A), blue aleurone is determined by alleles Ba1 (on 4BS) and Ba2 (on 4A), purple pericarp by Pp1 (on
7B), Pp2 (on 7A), Pp3a, Pp3b (on 2A). The differences in grain colour are caused by the presence of
polyphenols, tannins, anthocyanins and carotenoids. The overview of collected wheat donors with
unusual grain colour and some of its typical characters are presented. In different kernel tissues there
are different amounts of coloured substances that affect their content in the flour and meal and thus
their content in bakery and biscuit products. The genes on different chromosomes can be combined
and used for development of wheats with higher content of antioxidants.
Key words: grain colour, wheat, antioxidants, food processing
Úvod
V současnosti stoupá zájem o pšenice s purpurovým perikarpem, modrým aleuronem a
ţlutým endospermem zrna (Zeven, 1991) pro rozšíření sortimentu potravinových výrobků.
Jedná se o formy pšenice, jejichţ specifické zabarvení zrna je podmíněno látkami
s antioxidačním účinkem. Předpokládá se, ţe jejich vyuţití v jídelníčku by za předpokladu
dlouhodobé a pravidelné konzumace mohlo mít příznivý vliv na lidské zdraví (Pokorný et al.,
2001; Knievel et al., 2009) a některé vhodné odrůdy by mohly slouţit jako surovina pro
výrobu funkčních potravin. Testování vlivu pšenic obsahujících přírodní barviva v zrnu na
zdraví člověka dosud nebylo prozkoumáno klinickými testy. Jsou ale známy pozitivní vlivy
antioxidantů na člověka z jiných zdrojů potravy. Zatím jsou známy dílčí výsledky, uvádějící
pozitivní vliv zkrmování zrna pšenice s purpurovým perikarpem na hmotnostní přírůstek
slepic o 6,22 % a počet snesených vajec o 3,43 % (Rückschloss et al., 2010). U odrůd se
117
„Úroda 12/2011, vědecká příloha―
ţlutým endospermem zrna je uváděn příznivý vliv na zabarvení ţloutku. Krmné testy pšenic
s modrým aleuronem zřejmě nebyly dosud prováděny.
Červené zrno se vyskytuje u většiny běţných evropských odrůd pšenice. Je podmíněna
alespoň jednou ze tří dominantních alel lokusu R: R-A1 (na 3AL), R-B1 (3BL), R-D1 (3DL).
Pigment je tvořen deriváty katechinu a taninu, za účasti enzymů chalkon syntáza, chalkon
isomeráza, flavono 3-hydroxyláza, dihydroflavonol 4-reduktáza, vznikajícími v procesu
biosyntézy flavonoidů (Himi et al., 2005; Himi a Noda, 2005). Červená barva zrna je
spojována s vyšším obsahem fenolických látek, niţší aktivitou hydrolytických enzymů a s tím
spojenou lepší odolností k porůstání. Fenolické látky omezují výskyt volných radikálů,
inhibují lipoxygenázu a fungují jako nespecifické inhibitory (Lachman et al., 2003).
Bílé zrno je podmíněno sestavou recesivních alel r-A1, r-B1 a r-D1. Pšenice s bílým zrnem
má výrazně niţší obsah hořkých fenolických látek. Neobsahuje polyfenol oxidázu, která je u
červenozrnné pšenice uloţena v povrchových vrstvách zrna. To umoţňuje nastavení vyšší
výmelnosti mouky a produkt tak můţe obsahovat více vlákniny, minerálů a proteinů.
Nepřítomnost hořkých látek způsobuje, ţe zrno bývá náchylnější na porůstání, a ţe produkt je
přirozeně sladší, coţ můţe mít význam v cukrářství.
Ţluté zrno je podmíněno dvěma lokusy Psy1 a Psy2, které se nacházejí na 7. a 5. skupině
homeologických chromosomů (Pozniak et al., 2007). Ty ovlivňují biosyntetickou dráhu
karotenoidů, konkrétně enzym phytoen syntázu. Nejvíce jsou prozkoumány geny Psy1-A1 (na
7AL) a Psy1-B1 (na 7B) (Howitt et al., 2009). Obsah ţlutého pigmentu má v současnosti
význam především v těstárenství u T. durum (Zhang a Dubcovsky, 2008; He et al., 2008).
Jsou však známy rovněţ odrůdy pšenice seté (T. aestivum) ozimé Caroti, Citrus, Yellow,
Bona Dea a jarní Luteus, Safrania poskytující ţlutou mouku, která obsahuje lutein, zeaxantin
a β-karoten.
Purpurový perikarp je řízen geny pro purpurový perikarp Pp (purple pericarp), které byly do
pšenice seté přeneseny z tetraploidních pšenic pocházejících z oblasti Etiopie, Somálska a
Jemenu. Vyznačuje se výskytem antokyanů v povrchové vrstvě (perikarpu) obilek, kde jsou
nejvíce zastoupeny kyanidin 3-glukosid, kyanidin 3-rutinosid a kyanidin sukcinyl-glukosid
(Abdel-Aal a Hucl, 2003; Knievel et al., 2009). U purpurového zrna je uváděn průměrný
obsah antokyanů ve šrotu 104 mg.kg-1 a v otrubách 251 mg.kg-1 (Abdel-Aal a Hucl, 1999).
Antokyany jsou významné ze zdravotního hlediska, jsou tradičně vyuţívány v lidové
medicíně a přispívají ke zdraví populace. Dosud bylo nalezeno několik genů pro purpurový
perikarp. Pomocí monosomické analýzy byly u odrůdy Purple Feed nalezeny dva geny: Pp1
na chromosomu 7B a Pp2 na 6A. Odrůda Purple obsahovala gen Pp1 (na 7B) a Pp3 na 2A
(Arbuzova a Maystrenko, 2000). Později bylo zjištěno, ţe Pp3 je tvořen dvěma alelami, které
byly označeny Pp3a a Pp3b. Obě se nacházejí v centromerické oblasti na chromosomu 2A.
U genů Pp1 a Pp3 byl popsán jejich komplementární účinek. Při kříţení purpurové pšenice
s červenozrnnou pšenicí dochází k segregaci v poměru 11 purpurové : 5 červenozrnné, a
naznačuje, ţe se jedná o dihybridní kříţení a míra pigmentace závisí na dávce genu (Zeven,
1991; Knievel et al., 2009). Kromě genů pro purpurový perikarp jsou u pšenice známy i jiné
geny, podmiňující purpurové prašníky, červená ouška, červené a purpurové koleoptile,
purpurové stéblo a podobně (Dobrovolskaya et al., 2006).
Modrý aleuron Ba (blue aleurone). Qualset et al. (2005) informuje o existenci jarní pšenice
'UC66049B' s modrým zrnem. Uvádí, ţe modrý aleuron je řízen kodominantně působícím
genem Ba1. Do pšenice se tento gen dostal přenesením celého ramena chromosomu
z Thinopyrum ponticum Podp., které bylo zabudováno do chromosomu 4BS. Pozdější
literatura uvádí u vzorku TRI 2401 (Triticum aestivum var. tschermakianum Mansf.), který
pochází z genové banky v IPK Gatersleben v Německu, odlišný gen Ba2, který do této
pšenice byl přenesen disomickou substitucí chromosomu 4A jiným chromosomem
neznámého původu, pravděpodobně však z Aegilops elongatum (Zeven, 1991). Na základě
118
„Úroda 12/2011, vědecká příloha―
odchylek ve způsobu dědičnosti se usuzuje, ţe Ba1 a Ba2 jsou odlišné geny (Mettin et al.,
1991). Katalog genetických symbolů pšenice uvádí kromě výše uvedených dvou genů ještě
gen se slabší expresí modré barvy (half-blue), který se vyskytl ve vzorku T. monococcum spp.
aegilopoides.
Šrot ze zrna pšenice s modrým zrnem obsahoval 157 mg.kg-1 antokyanů a otruby 458 mg.kg-1
antokyanů (Abdel-Aal a Hucl, 1999). Nejvíce jsou zastoupeny delfinidin 3-glukosid a
delfinidin 3-rutinosid. Kyanidin 3-glukosid a kyanidin 3-rutinosid zde byly, na rozdíl od
purpurového zrna, v menším mnoţství (Knievel et al., 2009). Zastoupení jednotlivých
antokyanů v povrchové vrstvě zrna s modrým aleuronem a zrna s purpurovým perikarpem je
odlišné, coţ lze pozorovat i na příčných lomech obilkou (Abdel-Aal a Hucl, 2003).
V České republice se modrou barvou zrna pšenice dlouhou dobu zabýval Miroslav Škorpík et
al. (1983) z VÚRV Praha, přičemţ pravděpodobně pouţíval výchozí materiál, který posbíral
jiţ Erich von Tschermak-Seysenegg (jeden ze znovuobjevitelů Mendelových zákonů v roce
1900). V současnosti je zařazena do Státních registračních zkoušek v Rakousku Škorpíkova
linie RU 440-6, která má naději na registraci jako první odrůda s modrým aleuronem v zrnu
po ukončení zkoušení v roce 2011. Dr. Emil Šebesta v USDA-ARS v Oklahoma State
University získal v období 1958-1988 linie BS-1, BS-2 a BS-3 (Blue Sebesta) s modrým
zrnem s chromosomálními segmenty přenesenými z Th. ponticum (Morrison et al., 2004),
které mají zřejmě podobný původ jako UC66049.
Materiál a metody
Ve firmě Agrotest fyto, s.r.o. je shromaţďována kolekce hexaploidní pšenice (T. aestivum L.)
s geneticky podmíněnou nestandardní barvou zrna. Přehled vzorků je uveden v tabulce. 1.
V tabulce jsou uvedeny alely odpovědné za barevný projev znaku (pokud jsou známy), dárci
od kterých byly vzorky získány, případně informace o registraci materiálu.
Tabulka 1. Přehled genotypů pšenice s rozdílným zabarvení zrna
Barva
a typ Název
červené zrno (red grain)
jarní: *)ANK-1A
*)ANK-1B
*)ANK-1C
*)ANK-1D
bílé zrno (white grain)
ozimé: Heroldo
ţluté zrno (yellow grain)
ozimé: Citrus
Alely
Stát
pŧvodu
Poskytovatel
r-A1, r-B1, R-D1
r-A1, R-B1, r-D1
r-A1, r-B1, R-D1
R-A1, r-B1, r-D1
RUS
RUS
RUS
RUS
S. Koval, Rusko
S. Koval, Rusko
S. Koval, Rusko
S. Koval, Rusko
r-A1, r-B1, r-D1
DEU
regist. v VZE roce 2005
DEU
SVK
DEU
USA
regist. v CZE v roce 2011
Istropol
Solary
a.s.
Slovensko
regist. v CZE v roce 2011
A.J. Lukaszewski, USA
RUS
RUS
USA
USA
NZL
CZE
ENG
S. Koval, Rusko
S. Koval, Rusko
O.B. Dobrovolskaya, Rusko
O.B. Dobrovolskaya, Rusko
A.Böerner, Německo
GB. Praha, 01C0200501
J. Schweiger, Rakousko
USA
N. Watanabe, Japonsko
Bona Dea
Luteus
TA 4024
purpurový perikarp (purple pericarp Pp)
jarní: *)ANK-28A
Pp1, Pp2=Pp3b
*)ANK-28B
Pp1, Pp3=Pp3a
Purple
Pp1, Pp3a
Purple Feed
Pp1, Pp3b
Konini
Abissinskaja arrasajta
ozimé: Indigo
modrý aleuron (blue aleuron Ba)
jarní: UC66049
Ba1
jarní:
119
„Úroda 12/2011, vědecká příloha―
Tschermaks Blaukörniger
Sommerweizen
Ba2
GER
A. Böerner, Německo
H 83-952-1
USA
R.J. Metzger, USA
H 90-15-2
USA
R.J. Metzger, USA
H 90-35-1
USA
R.J. Metzger, USA
M 90-41
USA
R.J. Metzger, USA
Blue Baart
USA
A.J. Lukaszewski, USA
Blue Norco
USA
A.J. Lukaszewski, USA
BS-1 (EF02-5426-3)
USA
E. Šebesta, USA
BS-2 (EF02-5430-2)
USA
E. Šebesta, USA
BS-3 (EF02-54/9)
USA
E. Šebesta, USA
Xiao Yian
JPN
N. Watanabe, Japonsko
ozimé: RU 440-6
CZE
M. Škorpík, Česko
Barevná 9
CZE
M. Škorpík, Česko
Barevná 25
CZE
M. Škorpík, Česko
48M
USA
H. Woś, Polsko
*)Genotypy označené symbolem ANK (jarní pšenice s červeným a purpurovým zrnem) jsou téměř
izogenní linie odvozené od Novosibirskaya 67.
U vybraných vzorků z výše uvedeného seznamu prováděno hodnocení technologických
charakteristik zrna, zastoupení vysokomolekulárních gluteninových alel, obsahu nutričních a
antinutričních látek. Rovněţ jsou hodnoceny obsahy látek s antioxidačním účinkem
v celozrnném šrotu a mouce. Barviva byla extrahována metanolem dle Abdel-Aal a Hucl
(1999) a stanovovány spektrofotometricky porovnáním s kalibrační křivkou pro barvivo
kuromanin. Koncentrace antokyanů byla stanovena metodou HPLC dle Schwarz a Láber
(1965). Detekce přítomnosti vybraných alel pro vysokomolekulární podjednotky gluteninů
byla prováděna pomocí DNA markerů dle Vyhnánek et al. (2010) a detekce přítomnosti nebo
absence lokusu Sec-1 metodikou dle Chai et al. (2005).
Byl prováděn šlechtitelský pre-breeding orientovaný na získání materiálu s uspokojivými
hospodářskými vlastnostmi a s kombinací genů odpovědných za biosyntézu různých druhů
barviv. Pro přenos genů, odpovědných za změněné zabarvení zrna do genetického základu
současných odrůd, je pouţíváno běţné a zpětné kříţení a následně standardní rodokmenová
metoda slelekce.
Alternativně je vyuţíván princip spontánní hybridizace, zaloţený na vyuţití linie pšenice
nesoucí dominantní mutantní gen pro tvorbu tří pestíků v kvítků (TP - three pistils) (Peng et
al., 2008). Výskyt tohoto znaku je doprovázen vysokou mírou otevřeného kvetení a to
umoţňuje spontánní opylení okolními rostlinami. K opylování dochází ve speciálně
vytvořených směsných parcelách, zahrnujících asi poloviční podíl mateřské formy s TP a
vhodně zvolenou otcovskou formu nebo směs otcovských forem (composite cross). Po
spontánním opylení jsou sklizeny pouze klasy se třemi pestíky v kvítku, které zahrnují rovněţ
určitý podíl hybridních zrn. Tyto klasy jsou vymláceny dohromady a vysety do další generace
(mohou být vysety opět do směsi s vybranými otcovskými formami pro opakované kříţení).
Následující populace zahrnuje určitý podíl F1 heterozygotních třípestíkových rostlin,
vzniklých po předchozím spontánním kříţení. Opět se vyberou pouze klasy se třemi pestíky,
vymlátí se dohromady a vysejí do následující generace, ve které se bude vyskytovat určitý
podíl F2 vysegregovaných homozygotně recesivních rostlin jen s jedním pestíkem v kvítku.
Rostliny s jedním pestíkem v kvítku jsou samosprašné a mohou se u nich nalézat různé
kombinace barevných obilek, (v závislosti na sloţení rodičů ve výchozí uměle vytvořené
směsné populaci, míře synchronizace jejich kvetení a na příznivosti klimatických podmínek
během cizosprášení). Různě zabarvené obilky těchto vybraných rostlin jsou snadno vizuálně
rozlišitelné a mohou postupovat do dalších stádií selekce.
120
„Úroda 12/2011, vědecká příloha―
Výsledky a diskuse
Pomocí DNA markerů bylo analyzováno sloţení vysokomolekulárních gluteninů.
Perspektivnější z hlediska technologické kvality zrna se jeví Indigo (s alelami Glu-A1b, GluD1d), UC66049 (s alelami Glu-A1a, Glu-D1d) a RU 440-6 (s alelami Glu-A1b, Glu-D1d) v
důsledku výskytu alely Glu-D1d, která je charakteristická výskytem bílkovinných
podjednotek 5+10). Současně u těchto materiálů nebyl nalezen sekalinový lokus Sec-1, který
je spojován se zhoršenou technologickou kvalitou zrna, s přítomností translokace 1BL.1RS a
genem rezistence ke rzi pšeničné Lr26. U genotypů ANK-28A, ANK-28B, Abissinskaja
arrasajta, Konini, Purple, Purple Feed, Tschermaks Blaukörniger Sommerweizen, 48M,
Barevná 9 a Barevná 25 nebyla zjištěna přítomnost Glu-D1d a Sec-1. Proto jsou tyto genotypy
pokládány za méně výhodné donory z hlediska pekařské jakosti neţ Indigo, UC66049 a RU
440-6.
Pšenice s vyšším obsahem barviv v zrnu mají zpravidla niţší výnosy neţ běţné standardní
kontrolní odrůdy. Jejich obsah bílkovin je ale obvykle vyšší. Analýzy obsahu jednotlivých
aminokyselin u odrůd Bona Dea, RU 440-6 a kontrolních odrůd Cubus (kvalita A), Samanta
(kvalita B) a Dromos (kvalita C) potvrdily u odrůd Bona Dea a RU 440-6 poněkud vyšší
obsah některých esenciálních aminokyselin (threonin, methionin, isoleucin, leucin
phenylalanin a histidin) v sušině vzorku oproti kontrolním odrůdám. Obsah lysinu nebyl
výrazně odlišný. Domníváme se, ţe obsah barviv nebude v genetické vazbě s obsahem
jednotlivých aminokyselin v zrnu.
Nejvyšší obsahy barviv typu antokyanů v zrnu byly nalezeny ve vzorcích s modrým
aleuronem Tschermaks Blaukörniger Sommerweizen (78,6 μg.g-1), UC66049 (73,7 μg.g-1) a
RU 440-6 (31,6 μg.g-1). Za těmito vzorky následovaly pšenice s purpurovým perikarpem
ANK-28B (18,0 μg.g-1), Abissinskaja arrasajta (17,6 μg.g-1) a ANK-28A (11,2 μg.g-1).
Nejméně barviv se podle očekávání nacházelo v běţných červenozrnných odrůdách
Novosibirskaya 67 a Complet (8,2 μg.g-1) a prakticky nulové mnoţství u odrůdy Heroldo
s bílým zrnem. U vzorků s červeným a bílým zrnem byly detekovány barevné látky fenolické
povahy, nikoli antokyany. Nejvíce ţlutých barviv typu karotenoidů bylo nalezeno v odrůdě
Citrus (44,27 mg.100g-1 suš.), méně u odrůdy Bona Dea (26,74 mg.100g-1 suš.), u donorů
s purpurovým perikarpem Konini, Abissinskaja arrasajta, ANK-28B (22,81 mg.100g-1 suš.), u
kontrolních s červeným zrnem Cubus, Samanta, Dromos (21,35 mg.100g-1 suš.) a u donorů
s modrým aleuronem UC66049, RU 440-6 (11,93 mg.100g-1 suš.).
Výsledky analýz ukázaly, ţe do mouky pšenic s purpurovým perikarpem se dostává malé
mnoţství barviv, protoţe obsahuje především vnitřní část endospermu, kde převaţují bílá
škrobová zrna. Zajímavé ale bylo, ţe nejvyšší změna odstínu barvy mouky byla zaznamenána
u ANK-28B s purpurovým perikarpem, která měla nejniţší jas. Více barviv se do mouky
dostávalo u pšenic se ţlutým endospermem (ţlutomouké pšenice) a modrým aleuronem, kde
mouka má šedomodrý odstín.
Přestoţe barviva antokyanové povahy jsou přítomna především ve svrchních vrstvách obilky,
u ANK-28B byla zaznamenána poměrně velká změna odstínu barvy mouky oproti běţné
mouce coţ naznačuje, ţe část barviv se dostala mletím do mouky. V odstínech ţluté barvy,
podmíněné přítomností luteinu, zeaxantinu a zejména vyšším obsahem beta-karotenů, byla
nejvyšší hodnota ţlutého odstínu nalezena v odrůdě Citrus a byla téměř dvojnásobkem
hodnoty u kontrolní hladké mouky.
Ve zralém zrnu chráněném oplodím (pericarp) srostlým s osemením (sead coat) se purpurová
barviva nachází v perikarpu - tedy v původem v mateřském diploidním pletivu, modrý
aleuron a ţlutý endosperm se nacházejí v triploidním pletivu, kde dvě dávky genetické
informace pocházejí od matky a jedna od otce. Z tohoto důvodu exprese těchto barviv je
závislá na dávce genů.
121
„Úroda 12/2011, vědecká příloha―
V současnosti se pšenice s rozdílným zabarvením zrna vyuţívají pro výrobu celozrnné směsi
pro pekárenské výrobky ve firmě IREKS Enzyma, s.r.o., Brno, odrůda Indigo se mnoţí v
SAATBAU LINZ reg. Gen.m.b.H. v Rakousku, která se zde vyuţívá pro pečení chleba
nazývaný PurPur.
Závěr
Donory pšenice s purpurovým perikarpem, modrým aleuronem a ţlutým zrnem mohou být
vyuţity pro vyšlechtění odrůd se zvýšeným obsahem zdraví prospěšných látek. Hybridizační
experimenty naznačují, ţe lze kombinovat různé barvy do jednoho genotypu.
Jsou získány první poznatky týkající se stanovení obsahu antokyanů a flavonoidů v zrnu a
v jednotlivých frakcích zrna. Antokyany se nacházely ve svrchních vrstvách zrna u donorů
pšenice s purpurovým perikarpem a rovněţ i s modrým aleuronem. U donorů pšenice s
modrým aleuronem a ţlutým byla zjištěna tato barviva v mouce.
Je vytvářena kolekce genových zdrojů hexaploidní pšenice s geneticky rozdílnou barvou
obilek tak, aby zahrnovala existující genetické varianty barev obilky (core kolekce).
Byly vytvořeny předpoklady pro studium biosyntetických drah enzymů odpovědných za
tvorbu jednotlivých typů antokyanů v zrnu a předpoklady pro sledování změn obsahu a
zastoupení barviv od sklizené obilky aţ po finální potravinářský výrobek.
Poděkování
Práce byla podpořena projektem NAZV QI91B095 Ministerstva zemědělství České republiky.
Literatura
Abdel-Aal E.S.M., Hucl P.: A rapid method for quantifying total anthocyanins in blue
aleurone and purple pericarp wheats. Cereal Chem., 76(3), 1999: 350-354.
Abdel-Aal E.S.M., Hucl P.: Composition and stability of anthocyanins in blue-grained wheat.
J. Agric. Food Chem., roč. 51(8), 2003: 2174-2180.
Arbuzova V.S., Maystrenko O.I.: Chromosomal location of genes for purple grain colour
introgressed in common wheat. Cereal Res. Comm. 28(2), 2000: 235-237.
Dobrovolskaya O., Arbuzova V.S., Lohwasser U., Röder M.S., Börner A.: Microsatellite
mapping of complementary genes for purple grain colour in bread wheat (Triticum
aestivum L.). Euphytica, 150(3), 2006: 355-363.
He X.Y., Zhang Y.L., He Z.H., Wu Y.P., Xiao Y.G., Ma C.X., Xial X.C.: Characterization of
phytoene synthase 1 gene (Psy1) located on common wheat chromosome 7A and
development of a functional marker. Theor. Appl. Genet., 116(2), 2008: 213-221.
Himi E., Nisar A., Noda K.: Colour genes (R and Rc) for grain and coleoptile upregulate
flavonoid biosynthesis genes in wheat. Genome, 48(4), 2005: 747-754.
Himi E., Noda K.: Red grain colour gene (R) of wheat is a Myb-type transcription factor.
Euphytica, 143(3), 2005: 239-24.
Howitt C.A., Cavanagh C.R., Bowerman A.F., Cazzonelli C., Rampling L., Mimica J.L.,
Pogson B.J.: Alternative splicing, activation of cryptic exons and amino acid substitutions
in carotenoid biosynthetic genes are associated with lutein accumulation in wheat
endosperm. Funct. Integr. Genomics, 9(3), 2009: 363-376.
Chai J.F., Liu X., Jia J.Z.: Homoelogous cloning of omega-secalin gene family in a wheat
1BL/1RS translocation. Cell Research, 5(8), 2005: 658-664.
Knievel D.C., Abdel-Aal E.S.M., Rabalski, I., Nakamura, T., Hucl P.: Grain color
development and the inheritance of high anthocyanin blue aleurone and purple pericarp in
spring wheat (Triticum aestivum L.) J. Cereal Sci., 50(1), 2009: 113-120.
122
„Úroda 12/2011, vědecká příloha―
Lachman J., Dudjak J., Orsák M., Pivec V.: Effect of accelerated ageing on the content and
composition of polyphenolic complex of wheat (Triticum aestivum L.) grains. Plant, Soil
Environ., 49(1), 2003: 1-7.
Mettin D., Schlegel G., Lehmann C.: Instability of the blue grain colour in a strain of Triticum
aestivum L. Genome, 34(5), 1991: 745-750.
Morrison L.A., Metzger R.J. Lukaszewski A.J.: Origin of the blue-aleurone gene in Sebesta
blue wheat genetic stocks and a protocol for its use in apomixis screening. Crop Sci. 44(6),
2004: 2063-2067.
Peng Z-S, Martinek P., Kosuge K., Kuboyama T., Watanabe N.: Genetic mapping of a mutant
gene producing three pistils per floret in common wheat. J. Appl. Genet., 49(2), 2008: 135139.
Pokorný J., Yanishlieva N., Gordon M. (editors): Antioxidants in food - Practical
applications. Woodhead 2001, 400p.
Pozniak C.J., Knox R.E., Clarke F.R., Clarke J.M.: Identification of QTL and association of a
phytoene synthase gene with endosperm colour in durum wheat. Theor. Appl. Genet.,
114(3), 2007: 525-37.
Qualset C.O., Soliman K.M., Jan C.C., Dvořák J., Mcguire P.E., Vogt H.E.: Registration of
UC66049 Triticum aestivum blue aleurone genetic stock. Crop Sci., 45(1), 2005: 432.
Rückschloss Ľ., Matúšková K., Hanková A., Jančík D.: Vplyv pšenice s purpurovou farbou
zrna na parametre uţitkovosti nosníc a kvalitu vajec. Potravinárstvo - Food Sci.,
4(mimoriadne číslo), 2010: 231-235.
Schwarz V., Lábler L.: Chromatografie na tenké vrstvě. 1. vydání, Praha: Nakladatelství
Československé akademie věd, 1965: 465s.
Škorpík M., Rod J., Šíp V., Sehnalová J., Košner J.: Coloured wheat from the effects of E.
Tschermak. Acta Agron. Acad. Scient. Hungar., 2(2), 1983: 147-157. ISSN 0238-0161.
Vyhnánek T., Halouzková E., Trojan V., Martinek P.: Detekce alel pro vysokomolekulární
podjednotky gluteninů u tritikale pomocí DNA markerů. Potravinárstvo - Food Science
[CD-ROM], roč. 4, 2010, č. Supplement, s. 545-551. ISSN 1337-0960.
Zeven A.C.: Wheats with purple and blue grains: a review. Euphytica, 56(3), 1991: 243-258.
Zhang W., Dubcovsky J.: Association between allelic variation at the Phytoene synthase 1
gene and yellow pigment content in the wheat grain. Theor. Appl. Genet., 116(5), 2008:
635-645.
Kontaktní adresa:
Ing. Petr Martinek, CSc.
Agrotest fyto s.r.o., Havlíčkova 2787/121, 767 01 Kroměříţ
[email protected]
123
„Úroda 12/2011, vědecká příloha―
124
„Úroda 12/2011, vědecká příloha―
REZIDUA AKARICIDŦ VE VČELÍM VOSKU
Residues of acaricide in beeswax
Hofbauer J. , Vejraţka K.
Zemědělský výzkum, s.r.o. Troubsko
Abstrakt
Rezidua akaricidů (fluvalinát a acrinathrin) byly stanoveny plynovou chromatografií ve včelím vosku.
Vzorky mezistěn a vosků byly získány ze 7 států Evropy (Holandsko, Belgie, Německo, Polsko,
Slovensko, Chorvatsko a Slovinsko). Z ČR byly vzorky z roku 2006-2009 (výrobci Včelpo
s.r.o.,Obora, Kewa Boskovice, Výrobna mezistěn s.r.o. Stráţisko). Pouze jeden zahraniční vzorek
obsahoval detekovatelné mnoţství fluvalinátu. V českých vzorcích byl stanoven podlimitní obsah
acrinathrinu ale jen aţ ve vzorcích z roku 2009.
Klíčová slova: Residua, acaricidy, fluvalinat, acrinathrin, včelí vosk
Abstract
Residues of acaricides (fluvalinate and acrinathrin) have been determined in beeswax and foundation
from 7 Europe countries (The Netherland, Belgium, Deutschland, Poland, Slovak Republic, Croatia,
Slovenia) and Czech Republic. Czech samples covered main wax manufacturers over the course of 4
years (2006-2009). Only one foreign sample contained detectable contain of fluvalinate. We detected
content of acrinathrine under limit of quantification in one sample from 2009.
Key words: residues, acaricide, fluvalinate, acrinathrin, beeswax
Úvod
Včelí vosk je důleţitou surovinou pro průmysl a pro včely. Pro výrobu mezistěn musí být
nezávadný, t.z. nesmí obsahovat rezidua různých léčiv. Vosk se vrací po pouţití u včelařů
přes výrobny mezistěn opět zpět do úlů a je zde reálné nebezpečí kumulace reziduí ve vosku.
Při několikaletém pouţívání léčiv při likvidaci roztoče Varroa destructor jako MP-10 FUM
obsahující při jednom ošetření 1mg fluvalinátu a Gabon PF 90 obsahující 160 mg na ošetření,
léčiva Gabon PA 92 obsahujícího 1,5 mg acrinathrin na pásek se dostává do prostředí úlu
určitá mnoţství těchto látek. Tyto látky jsou lipofilní povahy a nelze je z vosku odstranit a
proto se mohou dostat z vosku i do medu.
Materiál a Metody
V posledních letech jsme se opakovaně zabývali analytikou a stanovením tau-fluvalinátu a
acrinathrinu ve vosku a mezistěnách pomocí plynové chromatografie.
Ve vzorcích z let 2006- 2009 jsme při stanovení acrinatrinu a fluvalinátu pouţili detektor
ECD. Pouţitá metoda stanovení byla podle Bogdanov a kol.(1998) a byla modifikována.
Stanovení acrinathrinu a fluvalinátu bylo prováděno na plynovém chromatografu GC 6820
firmy Agilent Technology. Tento přístroj umoţňuje přesně reprodukovatelné podmínky
stanovení. Nastavení: kapilární kolona DB 1, 30 m, teplota 130‗C 1min., nárust 20´C na
230´C, nárust 0,5´C/1 min. na 250´C. Doba trvání jedné analýzy 60 minut. Jako standard byl
pouţit tau-fluvalinát od firmy Chem Service, acrinahtrin od firmy Dr.Ehrenstorfer GmbH.
Dále byly získány vzorky vosku s fluvalinátem 1 a 5 ppm od prof. Wallnera z univerzity
v Hohenheimu, které byly pouţity jako standardy. Vzorky vosků (0,5 g) byly rozpuštěny ve 2
ml směsi toluen, isooktan 1:1. Nástřik standardů byl odstupňován v intervalu 0,1-1 mikrolitru,
nástřik testovaných vzorků byl 1 mikrolitr.
Vzorky mezistěn a vosků byly získány ze zahraničí koncem roku 2009 ze 7 států Evropy
(Holandsko, Belgie, Německo, Polsko, Slovensko, Chorvatsko a Slovinsko). Z ČR byly
vzorky z roku 2006-2009 (výrobci Včelpo s.r.o., Obora, Kewa Boskovice).
125
„Úroda 12/2011, vědecká příloha―
Výsledky a diskuze
V roce 2006, 2007 a 2009 byly sledovány rezidua akaricidů (acrinathrin, fluvalinate)
v mezistěnách různých výroben v České republice. Zahraniční vzorky byly analyzovány
v roce 2009. Limit kvantifikace u fluvalinátu a acrinathrinu byl 0,1 mg / 1 kg vosku. Persano,
Pucini a kol. (2003) dosáhli limitu detekce pro fluvalinát 0,01 mg/kg vosku.
Výsledky ze stanovení 26 vzorků mezistěn a vosků ukázaly pouze v 1 vzorku detekované
mnoţství fluvalinátu (2,9 ppm). Jednalo se o vzorek dovezený z Holandska, ale původ vosku
byl Španělsko (tabulka 1). Bonvehí a Bermejo (2010) zjistili v souboru španělských vosků 7,6
% vzorků s obsahem fluvalinátu v intervalu 1-5 ppm. Více neţ 70 % španělských vzorků však
obsahovalo mnoţství pod 0,5 ppm. Hodnoty 0,3-3 ppm v mezistěnách zjistil také Tsigouri a
kol. (2003). Tato skutečnost můţe naznačovat na snahu prodávat takto zatíţený vosk do
zahraničí za nízkou cenu. Získané výsledky nám ukázaly velmi dobrou situaci v České
republice. V sledovaných vzorcích nebyla zjištěna detekovatelná mnoţství reziduí fluvalinátu.
Pouţitím fumigace MP-10 FUM se dostane při ošetření do včelstva ročně cca 3 mg
fluvalinátu. Při aplikaci Apistanu 1 aţ 12,5 měsíce stanovil Bogdanov a kol. (1998) 1,8 aţ 48
mg/kg rezidua fluvalinátu ve vosku. Obsah byl aţ 10x niţší u medných plástů ve srovnání
s plodovými plásty. Obsah fluvalinátu má vzestupnou tendenci v komerčním vosku. Dosáhl
za 6 let pouţívání aţ 2,9 mg/kg fluvalinátu. V propolisu byly rovněţ zjištěny rezidua, ale aţ
při permanentní přítomnosti Apistanu ve včelstvu. Lodesani (2003) uvádí v ekologickém
včelařství sníţení reziduí fluvalinátu ve vosku z 1,5 ppm v letech 1990-1997 na 0,1 ppm
v roku 2001 při zastavení pouţívání Apistanu z důvodů rezistence roztočů.
Z výsledků lze usoudit, ţe pouţívání léčiva s obsahem fluvalinátu v ČR prozatím nijak
zásadně nezvyšuje obsah této účinné látky ve vosku.
Acrinathrin jsme detekovali v českých vzorcích mezistěn z roku 2009. Mnoţství acrinathrinu
bylo 0,2 ppm. Bonvehí a Bermejo (2010) zachytili ve svém souboru španělských vosků pouze
jeden pozitivní vzorek (6,7 %) na acrinathrin s hodnotou 0,139 ppm. Pouţívání Apistanu
v zahraničí, který je extrémně efektivní (dávka 1600 mg) v likvidaci roztočů, způsobuje
problémy ve světovém včelařství hlavně díky obchodu s voskem. Při pouţití Gabonu PF 90
s obsahem 80 mg na pásek (2 pásky na nástavek odpovídající 160 ppm) dostaneme do vosku
v ČR 10x niţší dávky neţ při pouţití Apistanu o obsahu 1600 mg. Při pouţití přípravku
Gabon PA 92 se tak, v ČR, dostává do včelstva cca ročně 3 mg acrinathrinu. V současné době
bylo však pouţívání acrinathrinu u včelařů omezeno z důvodu sníţené účinnosti na roztoče.
Problematika reziduí akaricidů ve vosku je provázána i s hlavním komerčním produktem,
medem. Účinné látky akaricidů jsou totiţ schopny do medu přecházet.
Bernal a kol (2000) při stanovení acrinathrinu a jeho hlavního metabolitu 3phenoxybenzaldehyd (PBA) v medu získal detekční limit 0,01 mg pro PBA. Acrinathrin byl
pod detekčním limitem. PBA byl nalezen v medu od 0,5 do 2,4 mg/kg medu. Sabatini a kol.
(2003) měli detekční limit 0,01 ppm. Z 71 vzorků medu bylo 70 vzorků podlimitních –
menších jak 0,01 ppm. Turi a Mátray (2003) přidali acrinathrin do medu v mnoţství 0,05-0,2
ppm/kg a 1-5 mg/kg do vosku. Obsah reziduí byl v medu niţší neţ 0,01 ppm a ve vosku niţší
neţ 0,1 ppm. Při pouţití Gabon PA 92 bylo zjištěno, ţe acrinathrin nebyl detekovatelný
v ţádném vzorku ani v medu ani ve vosku. Walner (1999b) uvádí v německém medu rezidua
fluvalinátu 0,002-0,005 ppm. V medu z východní Evropy uvádí aţ 0,04 ppm. Acrinathrin ve
vosku byl pod detekční hladinou.
Výsledky monitoringu cizorodých látek v medu v roce 2004 v ČR ukazují 0 vzorků
s pozitivním nálezem tau-fluvalinátu (Včelařství 6/2005).
Důvod zvýšené úrovně těchto látek v zahraničí ve vosku a medu je dán jiţ dlouhodobým
pouţíváním léčiv, které obsahují akaricidy, např. u Apistanu 10 násobně vyšší mnoţství neţ
český přípravek Gabon PF 90. Rovněţ nekontrolovatelná distribuce léčiv a nedisciplinovanost
včelařů v zahraničí způsobuje zvýšený obsah. Nebezpečím pro český med zůstává v současné
126
„Úroda 12/2011, vědecká příloha―
době dovoz vosku ze zahraničí nebo výměna zahraničního vosku za mezistěny, který by mohl
být kontaminován těmito látkami. Výrobou mezistěn z tohoto vosku by se mohly tyto látky
dostat ve značné míře do mezistěn, a následně i do medu.
Závěr
Z výsledků je patrné ţe, při správném pouţití léčiv, které jsou registrované v České republice
a to jak fluvalinátu (fumigace, pásek) tak i acrinathrinu (pásek) a při pravidelné obměně díla
v úlech nemůţe dojít k nepřípustné kumulaci rezidui fluvalinátu a acrinathrinu ve vosku a tím
i v medu.
Výhledově je zapotřebí stále provádět monitoring těchto reziduí v nových mezistěnách u
výrobců. Zde je největší nebezpečí výskytu reziduí při výrobě mezistěn z dovezeného
kontaminovaného vosku. Vyrobené mezistěny mohou být hlavním zdrojem těchto reziduí ve
včelařské praxi. Díky chemismu akaricidů (jsou lipofilní povahy) není moţné vosk těchto
látek zbavit.
Nebezpečím pro český med zůstává v současné době dovoz levného vosku ze zahraničí nebo
výměna zahraničního vosku za mezistěny, který by mohl být kontaminován těmito látkami.
Výrobou mezistěn z tohoto vosku by se mohly tyto látky dostat ve značné míře do mezistěn, a
následně i do medu.
Velké poděkování patří panu Ivanu Černému za nezištné dodání vzorků vosků ze zahraničí.
Dedikace
Práce byla podporována finančně z Výzkumného záměru financovaného MŠMT pod číslem
MSM 2629608001.
Pouţitá literatura
Bernal J.L., Jiménez J.J., Nozal M.J., Higes M., Llorente J.: Gas chromatographic
determination of acrinathrine and 3-phenoxybenzaldehyde rezidues in honey. J.
Chromatography A, 882, 239-243, 2000.
Bogdanov S., Kilchenmann V., Imdorf A.: Acaricide residue in some bee products. J.Apicul.
Res. 37,2, 57-67, 1998
Bonvehí Serra J., Bermejo Orantes J.: Acaricides and their residues in Spanish commercial
beeswax. Pest Manag Sci 66:1230-1235, 2010
Lodesani M., Costa C., Bigliardi M., Colombo R.: Acaricide residues in bee wax and organic
beekeeping. Apiacta 38, 31-33, 2003
Persano O.L., Pulcini P., Morgia C., Marinelli E.: Organic beekeeping and acaricide residues
in beewax. Apiacta 38, 40-45, 2003.
Sabatini A.G., Carpana E., Serra G., Colombo R.:Presence of acaricides and antibiotics in
samples of italian honey. Apiacta 38, 46-49, 2003
Tsigouri A., Menkissoglu-Spiroudi U., Thrasyvoulou A., Diamantidis G.: Fluvalinate residues
in Greek honey an beewax. Apiacta 38, 50-53, 2003.
Turi M.S., Matray E.S.: Honey and wax analysis for acrinathrin residues.: Apiacta 38, 34-39,
2003
Walner K.: Residues of varroacides in honey, bee wax and propolis, 37-42, In: Fair CT973686 Coordination in Europe of integrated control of Varoa mites in honey bee colonies.
Appendix VI. From 98-01-01 to 99-12-31, 1999b
127
„Úroda 12/2011, vědecká příloha―
Tabulka1
Mezistěny a vosky
Fluvalinát Acrinathrin
původ z:
ppm
ppm
1
Německo mezistěna
0
0
2
Slovinsko mezistěna
0
0
3
Slovensko mezistěna
0
0
4
Slovensko mezistěna
0
0
5
Polsko mezistěna
0
0
6
Polsko mezistěna
0
0
7
Belgie původ směs italských vosků
0
0
8
Holandsko původ italský vosk
0
0
9
Holandsko původ směs vosků španělský, německý, italský
0
0
10
Holandsko původ španělský vosk
2,9
0
11
Holandsko vosk
0
0
12
Chorvatsko vosk
0
0
13
Chorvatsko vosk
0
0
14
Chorvatsko vosk
0
0
15
Polsko mezistěna
0
0
16
1991 ČR mezistěna
0
0
17
2006 ČR mezistěna
0
0
18
2006 ČR mezistěna
0
0
19
2007 ČR mezistěna
0
0
20
2007 ČR mezistěna
0
0
21
2007 ČR mezistěna
0
0
22
2009 ČR mezistěna
0
0,2
23
2009 ČR mezistěna
0
0
24
2009 ČR mezistěna
0
0
25
2009 ČR mezistěna
0
0,2
26
2009 ČR mezistěna
0
0,2
Kontaktní adresa:
RNDr. Jan Hofbauer, CSc.
Zemědělský výzkum, s.r.o.
66441 Troubsko
[email protected]
128
„Úroda 12/2011, vědecká příloha―
KVALITA CHLEBA OVLIVNĚNÁ PODÍLEM ŢITNÉ MOUKY
Quality bread influenced proportion of rye flour
Kučerová J., Šottníková V.
Mendelova univerzita v Brně
Abstrakt
Byl sledován vliv podílu ţitné mouky chlebové na měrný objem, vlhkost střídy a kyselost pšeničnoţitného chleba. Podíl ţitné mouky v pečených chlebech se pohyboval od 20 do 50 %. Se zvyšujícím se
přídavkem ţitné mouky se sniţoval měrný objem výrobků, zvyšovala se vlhkost střídy a kyselost
chleba. Výrobky byly senzoricky zhodnoceny bodovou stupnicí. Nejlepšího senzorického hodnocení
dosáhly pšenično-ţitné chleby s přídavkem 40 % a 45 % ţitné mouky.
Klíčová slova: ţitná mouka, chléb, pekařský pokus
Abstract
He investigated the effect of the proportion of rye flour in bread specific volume, crumb moisture and
acidity of wheat-rye bread. The proportion of rye flour in baked breads ranged from 20 to 50%. With
the increasing addition of rye flour with reduced specific volume of products, increasing the moisture
and acidity of the bread crumb. The products were evaluated by sensory-point scale. The best sensory
evaluation of wheat-rye reached breads with added 40% and 45% rye flour.
Key words: rye flour, bread, baking test
Úvod
Ţito (Secale cereale L.) na našem území patří k nejstarším obilovinám vyuţívaných k lidské
výţivě. Ještě začátkem 90. let minulého století tvořila zhruba polovinu sloţení chleba ţitná
mouka. S rostoucí nabídkou pestré škály cereálních výrobků na bázi pšeničné mouky klesla
spotřeba chleba, avšak výrobky s větším podílem ţitné mouky vyhovují novému výţivovému
trendu, racionální a zdravé výţivy. Jejich hlavní předností je vyšší biologická hodnota ţitných
bílkovin, vyšší obsah vlákniny (i rozpustné), minerálních látek a pentozanů (PELIKÁN et al.,
2008). Rozpustné pentozany váţou velké mnoţství vody a vytváří spolu s bílkovinami
slizovité látky, čímţ mění reologické vlastnosti těsta (PŘÍHODA, HRUŠKOVÁ, 2007).
Významná je i jejich funkce při pečení, kdy se při zahřátí uvolňuje značné mnoţství vázané
vody, která je pouţita pro mazovatění škrobu a bobtnání nerozpustných pentozanů. Pentozany
na rozdíl od škrobu během zahřívání nekoagulují a ani u nich nedochází k retrogradaci během
chlazení a skladování, čímţ prodluţují trvanlivost ţitného pečiva (PŘÍHODA et al., 2003,
KUČEROVÁ, 2004).
Ţitná mouka má uplatnění v pekárnách při výrobě pšeničnoţitného, ţitnopšeničného a ţitného
chleba a pečiva. Ovlivňuje charakter nejen těsta, ale i upečených výrobků. Různý přídavek
ţitné mouky ovlivňuje vlhkost střídy i kyselost chleba, coţ je velmi významné pro
technologický a pečící proces. Rovněţ má vliv na měrný objem i senzorické vlastnosti pečiva.
Výrobky s podílem ţitné mouky jsou chuťově výraznější, mají kompaktnější střídu s delší
trvanlivostí. Na základě výsledků studie OSTASIEWICZ et al. (2009) bylo potvrzeno,
ţe droţdí spolu s kvasem v pouţité receptuře mají příznivý vliv na objem pečiva a jeho
výtěţnost a také na zlepšení střídy chleba.
Materiál a Metody
K hodnocení byly pouţity ţitná mouka tmavá (chlebová) a pšeničná mouka hladká ze mlýna
„Mlýny J. Voţenílek, spol. s.r.o.― z Předměřic nad Labem. Pekařský pokus byl proveden
v pekárenské dílně SPŠP v Pardubicích. Vaznost směsi mouky s různým podílem ţitné mouky
129
„Úroda 12/2011, vědecká příloha―
chlebové byla zjištěna na farinografu. Bylo připraveno šest druhů těst s různým podílem ţitné
mouky 20 %, 30 %, 35 %, 40 %, 45 % a 50 %. Těsta byla vedena na záraz podle receptury
uvedené v Tab. 1. Po vymísení v mísícím stroji Diosna těsto zrálo v díţi při teplotě 30 0C po
dobu 15 min, pak bylo rozděleno na kusy o hmotnosti 250 g, tvarováno do bochníků, které
byly osazeny na plechy a umístěny do kynárny. Teplota kynutí byla 30 ± 2 oC a relativní
vlhkost 70–75 %, doba kynutí 20 minut. Po osazení chlebů do pece se pec krátce zapařila
a chleby se pekly při teplotě 260 oC po dobu 15 min.
Tab. 1: Pouţitá receptura
Mnoţství
Surovina
Ţitná mouka chlebová
Pšeničná mouka hladká
Pitná voda
Kuchyňská sůl
Kvas „Bas―
Pekařské droţdí
Tuk
od 20 % do 50 %
od 50 % do 80 %
dle vaznosti
17 g
200 g
40 g
10 g
Po 24 hodinách po upečení byl vyhodnocen měrný objem pečiva a výrobky byly senzoricky
zhodnoceny třístupňovou bodovou stupnicí. Byly hodnoceny deskriptory: vzhled, tvar
a objem chleba, barva, lesk, parcelace a tvrdost kůrky, pórovitost, vláčnost a pruţnost střídy,
vůně a chuť. U upečených chlebů bylo provedeno stanovení vlhkosti střídy chleba podle ČSN
56 051-6 a kyselosti střídy chleba podle ČSN 56 0512-7 v MENDELU, Ústavu technologie
potravin.
Výsledky a diskuze
V Tab. 2 jsou uvedeny průměrné hodnoty ze tří měření měrného objemu chleba, vlhkosti
a kyselosti střídy chleba. Z výsledků je patrné, ţe s vyšším podílem ţitné mouky chlebové se
sniţuje měrný objem výrobku. Při přídavku 20 % ţitné mouky byl měrný objem nejvyšší 461
ml/100 g výrobku.
Tab. 2: Měrný objem chleba, vlhkost a kyselost střídy
Měrný objem
Podíl ţitné mouky
[%]
[ml/100 g]
20
461
30
443
35
437
40
433
45
423
50
420
Vlhkost
[%]
41,26
42,29
42,58
42,81
43,24
43,72
Kyselost
[mmol/kg]
41,47
44,65
50,66
54,36
59,18
66,82
Zvyšující se přídavek ţitné mouky v receptuře měl za následek zvýšení vlhkosti střídy chleba.
S vyšším podílem ţitné mouky chlebové v receptuře se zvyšovala kyselost střídy chleba
z 41,47 mmol/kg u 20% podílu ţitné mouky na 66,82 mmol/kg u 50% podílu ţitné mouky.
KIM, CHUN (2008) uvádějí zvyšující se kyselost a vlhkost s přídavkem ţitné mouky a kvasu.
MEJZLÍK (2005) uvádí kyselost chleba vyrobeného pomocí německé technologie IsernHäger
v rozmezí 61–80 mmol/kg u pšenično-ţitného chleba, 63–91 mmol/kg u ţitno-pšeničného
chleba (nad 50 % ţitné mouky) a do 99 mmol/kg u ţitného chleba.
130
„Úroda 12/2011, vědecká příloha―
V grafu 1 a grafu 2 jsou vyjádřeny regresní vztahy mezi podílem ţitné mouky v receptuře
a vlhkosti střídy a kyselostí chleba. Směrnice regresních přímek vyjadřují pozitivní závislosti.
Graf 1: Regresní závislost mezi přídavkem ţitné mouky a vlhkostí střídy chleba
Graf 2: Regresní závislost mezi přídavkem ţitné mouky a kyselosti chleba
Senzorické vyhodnocení upečených chlebů je uvedeno v grafu 3. Nejvyšším počtem bodů
byly ohodnoceny chleby s podílem ţitné mouky 40 a 45 %. U těchto chlebů byla lépe
hodnocena pruţnost střídy a parcelace kůrky.
Graf 3: Senzorické hodnocení upečených chlebů
131
„Úroda 12/2011, vědecká příloha―
Závěr
Podíl ţitné mouky chlebové měl vliv na všechny sledované parametry. Zvyšující se podíl
ţitné mouky v receptuře měl za následek zvýšení vlhkosti střídy chleba, coţ znamená, ţe
během pečení dochází k menším ztrátám. Na druhou stranu však musíme vzít v úvahu
i ten fakt, ţe výrobky s vyšším podílem ţitné mouky vyţadují dokonalejší propečení a tedy
správnou volbu parametrů pečení, hlavně teplotu a dobu.
Mezi přídavkem ţitné mouky chlebové a kyselostí byla zaznamenána pozitivní závislost,
vyšší podíl ţitné mouky vedl ke zvýšení kyselosti chleba. Průkazný negativní vliv měla ţitná
mouka na měrný objem upečených chlebů. Senzorickým hodnocením nejvyšším počtem bodů
byly ohodnoceny výrobky chleba s podílem ţitné mouky 40 % a 45 %.
Pouţitá literatura
Kim, M.-Y., Chun, S.-S., 2008: Effects of sourdough on the quality characteristics of ryewheat mixed bread, J. Korean Soc. Food Sci. Nutr., 37, 5, 625-632. ISSN: 1226-3311.
Kučerová, J. Technologie cereálií. MZLU v Brně, 2004, 141 s. ISBN 80-7157-811-8
Mejzlík P., 2005: Přírodní kvasy pro chléb a pečivo. Pekař a cukrář, 7, 19– 21. ISSN 12132403.
Ostasiewicz, A., Ceglinska, A., Skowronek, S., 2009: Quality of rye bread with leavens
added. Zywnosc. Nauka. Technol. Jakosc/Food. Sci. Technol. Qual., 16, 2: 67–74. ISSN
14256959.
Pelikán, M., Burešová, I., Kučerová, J., Petr, J., 2008: Ţito a tritikale, 104–115. In: PRUGAR,
J. (ed.), Kvalita rostlinných produktů na prahu 3. tisíciletí. VÚPS a. s. ve spolupráci s
komisí jakosti RP ČAZV, Praha, 2008, 327 s. ISBN 978-80-86576-28-2.
Příhoda J., Humpolíková, P., Novotná, D. Základy pekárenské technologie. Pekař a cukrář s
r.o. Praha, 2003, 363 s. ISBN 80-902922-1-6
Příhoda, J., Hrušková, M. Hodnocení kvality. Mlynářská technologie sv. 1. Svaz
průmyslových mlýnů ČR, Praha, 2007, 187 s. ISBN 978-80-239-9475-9.
Kontaktní adresa:
doc. Ing. Jindřiška Kučerová, Ph.D.
Mendelova univerzita v Brně
Ústav technologie potravin
Zemědělská 1, 613 00 Brno, Česká republika
[email protected]
132
„Úroda 12/2011, vědecká příloha―
NUTRIČNÍ HODNOCENÍ SLADŦ Z OBILOVIN A PSEUDOOBILOVIN
Nutritional evaluation of malts, made from cereals and pseudocereals
Vavreinová S. 1, Ouhrabková J.1, Rysová J.1, Fiedlerová V. 1, Holasová M. 1,
Laknerová I.1, Winterová R. 1, Prokeš J. 2, Hartman I. 2
1
2
Výzkumný ústav potravinářský Praha, v.v.i.
Výzkumný ústav pivovarský a sladařský, a.s., Praha, Sladařský ústav Brno
Abstrakt
Byly provedeny nutriční analýzy 6 druhů ječných sladů (diastatického,mnichovského, plzeňského,
karamelového, tmavého karamelového, barvícího), ţitného, 3 druhů pšeničného (pšeničný, diastatický,
karamelový) a 3 druhů pohankového (hvozděny při 55 °C, hvozděný při 105°, karamelový) sladu.
Byla stanovena i antioxidační aktivita sladů metodou DPPH a FRAP a obsah celkových polyfenolů.
Analyzované slady budou vyuţity ve spolupráci s pekárenským závodem pro zlepšení nutričních,
senzorických a texturních vlastností chleba a pečiva.
Klíčová slova: slady, nutriční hodnocení, antioxidační aktivita, celkové polyfenoly
Abstract
Nutritional evaluation of seven types of barley malt /diastatic, munich, pilsner, caramel, dark caramel,
ingrained), rye malt, three types of wheat malt (wheat, diastatic, caramel) and three types of
buckwheat malt (kilning at 55 °C, kilning at 105 °C and caramel) was realized. Antioxidant activity of
malts by methods DPPH and FRAP and content of total polyphenols were determined. Analysed malts
will be used to improve nutritional, sensory and texture quality of breads and pastry in cooperation
with bakery factory.
Key words: malts, nutritional evaluation, antioxidant activity, total polyphenols
Úvod
Sladování je jedna z nejstarších biotechnologií, v níţ dochází k výrazným změnám biologické
a senzorické kvality zrna (Zarnkow a kol. 2007; Anurag a Sarojini 1996). Proces spočívá
v máčení zrna, jeho postupném naklíčení a hvozdění (sušení). Tímto postupem se aktivují
enzymy, obsaţené v zrnu. Volbou podmínek během technologického procesu (obsah vody
v zrně, doba a teplota klíčení, osvětlení, teplota hvozdění) lze dosáhnout různých změn
kvality produktu, ovlivnit aktivitu enzymů a v důsledku toho poměr zkvasitelných a
nezkvasitelných cukrů, rozpustné a nerozpustné vlákniny a stupeň odbourání bílkovinné
sloţky zrna (Sborn 2001; Krahl a kol. 2009; Dvorakova a kol. 2008). Výsledné produkty
neobsahují ţádné konzervanty, barviva ani jiné aditivní látky. Z nutričně významných sloţek
jsou v ječných sladech přítomny zejména beta-glukany, mající funkci prebiotika a polyfenoly,
které působí jako antioxidanty (Holasová a kol. 2002). Během sladování dochází k tvorbě
senzoricky významných látek.
Materiál a metody
Materiál: Ječné (plzeňský, mnichovský, karamelový, tmavý karamelový, barvící) a pšeničný byly
připraveny ve Sladovně Litovel (Sladovny Soufflet ČR, a.s.), Slad ječný diastatický, pšeničný
karamelový a diastatický,ţitný a pohankové slady byly vyrobeny v laboratorní mikrosladovně
ve Výzkumném ústavu pivovarském a sladařském v Brně.
Analytické metody: obsah sušiny byl stanoven gravimetricky sušením při 105 °C; obsah
bílkovin podle Kjeldahla (faktor pro přepočet 6,25) na přístroji Kjeltec 2000; nebílkovinný
dusík stanovením obsahu bílkovin ve filtrátu po vysráţení 12 % kyselinou trichloroctovou;
popel ţíháním při 545 °C; tuky po kyselé hydrolýze a extrakci chloroformem; vláknina
potravy enzymově – gravimetrickou metodou s pouţitím filtračního zařízení Fibertec;
sacharidy a energie byly získány dopočtem. Celkový obsah polyfenolických látek byl
133
„Úroda 12/2011, vědecká příloha―
stanoven spektrofotometrickou metodou s vyuţitím Folin-Ciocalteuova činidla, měření při
vlnové délce 765nm; rutin metodou RP-HPLC; antioxidační aktivita spektrofotometrickými
metodami DPPH (měření při 515 nm) a FRAP (měření při 593 nm). Sladovnické ukazatele
byly stanoveny podle metodiky EBC.
Výsledky a diskuze
Výsledky nutričních analýz jsou uvedeny v tabulkách 1-3. V tabulce 4 jsou uvedeny základní
sladařské ukazatele analyzovaných sladů.
Tabulka 1: Nutriční hodnoty ječných sladů
druh sladu / nutrient
mnichovský plzeňský karamel tm.karamel barvicí
sušina
(g/100g) 95,8
95,1
95,2
95,2
97,9
bílkoviny
(g/100g) 9,1
9,0
9,3
10,6
11,1
nebílk.dusík
(g/100g) 2,8
2,9
2,9
2,5
2,5
nebílk.dusík (% bílkovin) 30,8
32,2
31,1
23,6
22,5
tuky
(g/100g) 2,2
2,4
2,4
2,1
2,2
sacharidy
(g/100g) 68,6
68,3
66,5
66,1
42,7
vláknina celk.
(g/100g) 13,8
13,4
14,9
14,3
39,6
vláknina neroz. (g/100g) 12,2
11,5
13,1
13,2
19,1
vláknina rozp. (g/100g) 1,6
1,9
1,8
1,1
12,5
popel
(g/100g) 2,1
2,0
2,1
2,1
2,3
energie
(kJ/100g) 1513
1510
1497
1496
1313
antiox.aktivita DPPH* 1,90
1,40
3,66
3,13
1,63
antiox.aktivita FRAP* 1,73
1,19
4,50
4,87
2,99
celkové polyfenoly **
828
635
1862
2512
2136
*......mg kys.askorbové/1g, která vykazuje stejnou antioxidační aktivitu jako vzorek
**....ekvivalent kys. gallové (mg GAE/100g)
Tabulka 2: Nutriční hodnoty ţitného a pšeničných sladů
druh sladu / nutrient
ţitný
pšeničný pš.karamel. pš.diastat.
sušina
(g/100g) 95,5
89,2
93,8
93,8
bílkoviny
(g/100g) 8,6
10,9
10,3
10,4
nebílk.dusík
(g/100g) 4,2
3,7
4,0
3,1
nebílk.dusík (% bílkovin) 48,8
33,9
38,8
29,8
tuky
(g/100g) 1,8
1,6
1,6
2,2
sacharidy
(g/100g) 70,4
65,0
66,3
66,7
vláknina celk. (g/100g) 13,2
10,2
13,3
12,9
vláknina neroz. (g/100g) 8,6
6,5
9,3
7,5
vláknina rozp. (g/100g) 4,6
3,7
4,0
5,4
popel
(g/100g) 1,5
1,5
2,3
1,6
energie
(kJ/100g) 1515
1431
1468
1495
antiox.aktivita DPPH* 0,70
0,22
2,05
0,54
antiox.aktivita FRAP* 1,00
0,33
2,62
0,62
celkové polyfenoly **
347
213
850
222
*......mg kys.askorbové/1g, která vykazuje stejnou antioxidační aktivitu jako vzorek
**....ekvivalent kys. gallové (mg GAE/100g)
134
diastatický
94,0
8,0
3,0
37,5
2,2
67,7
13,8
11,0
2,8
2,3
1479
1,61
1,57
750
„Úroda 12/2011, vědecká příloha―
Tabulka 3: Nutriční hodnoty pohankových sladů
slad pohanka
vzorek / nutrient
pohanka
55°C
105°C karamel
sušina
(g/100g) 92,7
96,6
92,3
87,2
bílkoviny
(g/100g) 11,9
12,8
13,4
10,6
nebílk.dusík
(g/100g) 3,6
3,8
4,2
2,7
nebílk.dusík (% bílkovin) 30,3
29,7
31,3
25,5
tuky
(g/100g) 2,2
2,3
2,2
1,8
sacharidy
(g/100g) 69,2
72,4
66,2
66,6
vláknina celk. (g/100g) 7,20
6,7
8,1
6,2
vláknina neroz. (g/100g) 2,9
3,8
6,4
3,1
vláknina rozp. (g/100g) 4,3
2,9
1,8
3,1
popel
(g/100g) 2,21
2,3
2,5
2,1
energie
(kJ/100g) 1518
1589
1498
1426
rutin
(mg/100g) 27,1
36,5
68,8
6,41
antiox.aktivita DPPH*
4,58
4,73
2,87
3,94
antiox.aktivita FRAP*
3,79
3,45
2,66
2,26
celkové polyfenoly**
633
706
1172
449
*......mg kys.askorbové/1g, která vykazuje stejnou antioxidační aktivitu jako vzorek
**....ekvivalent kys. gallové (mg GAE/100g)
Tabulka 4: Základní sladařské ukazatele vyrobených sladů
ukazatel / druh sladu
Ječné slady
- plzeňský
- mnichovský
- karamelový
- tmavý karamelový
- barvící
- diastatický
Ţitný slad
Pšeničný slad
Pšeničný karamelový
Pšeničný diastatický
Pohankový slad
- hvozděný do 55 °C
- hvozděný do 105 °C
- karamelový
Extrakt (%)
Diastat.
Barva sladiny
Mohutnost (j.
(j. EBC)
WK)
81,2
81,8
77,9
76,9
83,1
89,7
84,9
83,5
83,5
3,2
14,0
147,0
202,0
1400,0
3,1
13,0
3,7
110
4,5
311
181
-
83,4
74,8
83,0
6,5
neměř.
43,0
-
394
352
399
396
Z výsledků v tabulkách 1–3 je patrný vyšší obsah vlákniny ve sladech ječných, ţitném i
pšeničných a to zejména nerozpustné vlákniny. Poměr nerozpustné vlákniny k rozpustné je
vysoký zejména u ječných sladů (mnichovský, plzeňský, karamelový, karamelový tmavý a
diastatický). Slad ţitný, pšeničný, pšeničný karamelový a diastatický vykazuje tento poměr
135
„Úroda 12/2011, vědecká příloha―
niţší, obsahuje více rozpustné vlákniny. Pohankové slady (diastatický, hvozděný při 105°C a
karamelový) lze charakterizovat niţším obsahem vlákniny v porovnání se slady z jiných
obilovin, zastoupení rozpustné vlákniny je však vyšší. Je to dáno tím, ţe pohankové slady jsou
vyrobeny z loupaných naţek a neobsahují tedy obalové vrstvy semene jako slady ostatní.
Antioxidační aktivita ve sladech z různých obilovin stoupá v pořadí pšeničný < ţitný < ječný
< pohankový. Vysoká antioxidační aktivita pohankového sladu souvisí s obsahem polyfenolů,
zejména rutinu. Při přípravě sladů za vyšších teplot dochází k Maillardově reakci a tak ke
vzniku produktů, které zvyšují antioxidační aktivitu (pšeničný a ječný slad karamelový),
zvýšení se však neprokázalo u karamelového sladu pohankového. Antioxidační aktivita
zjištěná oběma metodami je v těsné korelaci s obsahem polyfenolů u pšeničných a ţitných
sladů, u ječných sladů je těsná korelace pouze s výsledky zjištěnými metodou FRAP a u
pohankových sladů je těsná korelace s oběma metodami s vyloučením vzorku karamelového
sladu.
Hodnoty nebílkovinného dusíku a procentický obsah nebílkovinného dusíku z obsahu
celkových bílkovin u ječných sladů je nejvyšší u diastatického sladu a nejniţší u barvicího a
tmavého karamelového, koreluje se stoupající teplotou při jeho výrobě.
Závěr
Bylo provedeno nutriční hodnocení 13 druhů sladů. Získané analytické výsledky budou
vyuţity v další práci v rámci projektu pro tvorbu funkčních cereálních potravin ve spolupráci
s pekařským závodem a případně funkčních nápojů.
Dedikace
Práce byla provedena v rámci Programu Výzkum v agrárním komplexu, VAK, QI101B090.
Pouţitá literatura
Sborn, H. (2001): Carbohydrates in medicine. Educ. Chem. 38:96-98
Zarnkow, M., Kessler, M., Burberg, F., Back, W., Arendt, E.K., Kreisz, S. (2007): The use of
response surface methodology to optimise malt conditions of pros Miller as raw materials
for gluten-free food. Journal of the Institute of Brewing, 133(3): 280-292
Dvorakova, M., Douanier, M., Jurkova, M., Kellner, V., Dostalek, P. (2008): Comparison of
antioxidant activity of barley (Hordeum vulgare L.) and malt extracts with the content of
free phenolic compounds measured by high performance liquid chromatography coupled
with CoulArray detector. Journal of the Institute of Brewing 114, (2): 150-159
Krahl, M., Mueller, S., Zarnkow, M., Back, W., Becker, T. (2009): Arabinoxylan and fructan
in the malting and brewing process. Quality Assurance and Safety of Crops & Foods. 1,
(4): 246-255
Anurag Chaturvedi, Sarojini, G. (1996):Malting of pearl millet (Pennisetum typhoideum) - its
effect on starch and protein digestibilities. Journal of Food Science and Technology, India.
33, (4): 342-344
Holasová, M., Fiedlerová, V., Smrčinová, H., Orsák, M., Lachman, J., Vavreinová ,S. (2002):
Buckwheat - the source of antioxidant activity in functional foods. Food Research
International 35 (2-3): 207-211
Kontaktní adresa:
Ing. Slavomíra Vavreinová, CSc.
Výzkumný ústav potravinářský
[email protected]
Praha
v.v.i.,
136
Radiová
7,
102
31
Praha
10
„Úroda 12/2011, vědecká příloha―
POROVNÁNÍ VLIVU EKOLOGICKY CERTIFIKOVANÝCH,
KONVENČNÍCH A FARMÁŘSKÝCH OSIV OBILNIN
NA NÁSLEDNOU GENERACI
Comparison of influence of farmer, conventional and certified organic seeds
of cereals on subsequent generation
Bláha L.1, Stehno Z.1, Konvalina P.2
1
Výzkumný ústav rostlinné výroby v.v.i., Praha 6 Ruzyně
2
Jihočeská Univerzita v Českých Budějovicích
Abstrakt
V předkládané práci se srovnává vliv ekologicky certifikovaných, konvenčních certifikovaných
nemořených a farmářských osiv devíti odrůd jarních obilnin (pšenice seté, ječmene jarního a ovsa
nahého a pluchatého), na fyziologické vlastnosti a výnosové prvky v následné generaci. Výsledky
potvrzuji význam provenience osiva a zdůrazňují potřebu preferovat certifikované osivo.
Klíčová slova: obilniny, osivo, provenience, růst a vývoj, následná generace
Abstract
In this study analysis of influence of organic, conventional untreated and farmer seeds of various
spring cereal cultivars (wheat, barley, naked and hulled oat) on physiological traits in the filial
generation was performed. Our results confirmed importance of the seed provenance for the
production of the plants.
Key words: cereals, seeds, provenance, growth and development, subsequent generation
Úvod
Vzhledem k náročnosti mnoţení osiv v podmínkách s omezením pesticidní ochrany
semenářských porostů, dochází k logickému nedostatku ekologicky certifikovaného osiva,
které je velmi často nahrazováno opakovanými přesevy (Konvalina, Moudrý, 2007). Cílem
této práce je posouzení semenářské kvality vlastních (farmářských) osiv, k jejichţ produkci
jsou farmáři vzhledem k nedostatku ekologicky certifikovaných osiv legislativou nuceni. Naše
dosavadní výsledky podtrhují význam certifikovaného osiva (Bláha a kol.2011).
Materiál a Metody
V našem pokusu byly porovnány různé kategorie osiv (ekologicky certifikované, konveční
nemořené a farmářské) odrůd následujících plodin: pšenice setá, oves setý pluchatý, oves setý
nahý a ječmen setý. Voleny byly odrůdy, které jsou nejvíce pěstovány v ekologickém systému
hospodaření a u nichţ bylo získáno nejvíce hodnocených kategorií osiv. Z důvodu co nejvyšší
objektivity výsledků (podobnosti běţné praxi) nebylo zohledňováno místo původu osiv,
protoţe v zemědělské praxi se v ČR nikdo komplexně nevěnuje mnoţení široké škály druhů a
odrůd pro ekologické zemědělství. Vyuţita byla reálná nabídka odrůd, ke které jsme se snaţili
získat přeseté (farmářské) osivo, které je běţně vyuţíváno k zakládání porostů. V případě
farmářského osiva jsou v některých případech zařazena dvě osiva jedné odrůdy od různých
farmářů s cílem zjistit eventuelní odlišnosti v jejich kvalitě. V tomto případě bylo voleno
osivo z porostu, který byl 1. mnoţen v téměř ideálních podmínkách pro pěstování dané
plodiny – farmářské osivo první kategorie (FL), 2. mnoţen v podmínkách méně příznivých
pro pěstování dané plodiny – farmářské osivo druhé kategorie (FH). V pokusech byla pouţita
osiva pšenice seté (SW Kadrilj), ječmene setého (Pribina), ovsa pluchatého (Vok) a ovsa
nahého (Izák, Saul). U všech byly vţdy následující původy: certifikované ekologické,
konvenční nemořené, 2 x farmářské osivo.
137
„Úroda 12/2011, vědecká příloha―
Výsledky pokusů byly získány na základě metodiky předcházející práce (Bláha a kol., 2011).
Dále byly u sklizeného osiva (následné generace) ve víceúčelovém pokusu hodnoceny
standardními metodami základní parametry osiva a klíčních rostlin. Zvoleny byly znaky
s dobrou predikční schopností pro další růst (hmotnost semen, morfologie semen, klíčivost a
vitalita, délka, objem a hmotnost sušiny zárodečných kořínků). Pro stanovení dynamiky
klíčení byl zaloţen samostatný pokus. Od kaţdé kategorie byly hodnoceny 4 vzorky po 100
semenech dle standardní metodiky stanovení klíčivosti. Ta byla vyhodnocována po 1, 2, 3, 4 a
7 dnech. Počty byly zaznamenány jako denní přírůstky vyklíčených semen. Pokusy byly
čtyřikrát opakovány. V této práci se pouţívá počet vyklíčených semen druhý den po zaloţení
pokusu - vitalita, která velmi statisticky významně souvisí s celou řadou dalších parametrů a
s následným růstem a vývojem, jak vyplývá z dosavadních nádobových a polních pokusů.
Hodnocení délky zárodečných kořínků probíhalo tak, ţe na Petriho miskách bylo osivo
sledovaných odrůd a kategorií vţdy naklíčeno standardním způsobem na filtračním papíru, při
zavlaţování deionizovanou vodou, teplota během klíčení byla řízena termostatem v reţimu 20
°C den, 10 °C noc. Sedmý den po zaloţení pokusu bylo provedeno změření délky kořínků.
Objem kořenů se hodnotil z naskenovaných snímků standardním programem a pro kontrolu v
odměrných válcích. V dalším kontrolním pokusu byly délky kořenů měřeny i
v minirhizotronu v průtočné pískové kultuře. U všech variant byl měřen nejdelší kořínek, tedy
hloubka pronikání kořene do půdy, sušina kořenů a jejich objem. V laboratorních podmínkách
s váţenkami o objemu 40 cm3 u jednotlivých odrůd bylo kromě standardního klíčení
s optimálním mnoţstvím vody, prováděno hodnocení vlivu sucha na klíčení u jednotlivých
proveniencí (Bláha 2009). U osiva uvedených proveniencí a u sklizeného osiva následné
generace (lokalita Ruzyně) byla téţ testována vzcházivost v regulovaných podmínkách
skleníku. Na povrch homogenizované půdy s konstantním obsahem ţivin a vody při teplotě
25ºC (den) a 20ºC (noc) byly vysety do řádků obilky první a následné generace vţdy vedle
sebe a v několika opakováních. Pro výsev byly pouţity kontejnery o rozměrech 40x60x15 cm.
Výsev byl překryt 2 cm homogenizované půdy a kontejnery byly zakryty plexisklem a
zastíněny za účelem udrţení konstantní vlhkosti. Třetí den po počátku vzcházení po
odstranění plexiskel bylo zvlhčování půdy prováděno sprejováním deionizovanou vodou.
Odečet se dělal čtvrtý den a pak po dnech aţ do konečného počtu vzešlých rostlin.
Výsledky a diskuze
Z výsledků uvedených v grafech 1 a 2 vyplývá vliv provenience na velikost kořenové
soustavy s moţným negativním projevem v polních podmínkách. Obdobné závěry lze učinit i
pro počátek klíčení (tabulka 1), kdy jiţ po týdnu je delší hlavní kořínek klíčních rostlin u
ekologicky certifikovaného a konvenčního nemořeného osiva.
Graf 1 Vliv provenience osiva na objem kořenů rostliny v době metání
Objem kořenů(cm3)
Objem kořenů jedné rotliny
35
30
25
20
15
10
5
0
K
K
ad
r
ad ilj c
ril e r
j k t.
K on
ad v
ri .
K lj F
ad L
ril
jF
H
Pr
ib
Pr ina
ib c
in e
a rt.
k
Pr on
ib v.
i
Pr na
ib FL
in
a
FH
Vo
k
Vo ce
k rt.
ko
n
Vo v.
k
Vo FL
k
FH
Iz
ák
Iz ce
ák rt
ko .
Iz nv.
ák
Iz FL
ák
FH
Sa
ul
Sa c e
ul rt.
ko
n
Sa v.
ul
Sa FL
ul
FH
Objem
(cm3)
138
„Úroda 12/2011, vědecká příloha―
Graf 2 Vliv provenience osiva na sušinu kořenů rostliny
Sušina sušina kořenů
S
S
K
au
l
c
au er
l k t.
o
S nv.
au
l
S FL
au
lF
H
Sušina
(g)
ad
K ri lj
ad c
ri ert
lj
.
K ko
ad nv
ri .
K lj
ad FL
ri
lj
FH
P
ri
bi
P na
ri
bi ce
na rt
.
P ko
ri nv
bi .
P na
ri
bi FL
na
FH
V
ok
V ce
ok rt
.
ko
n
V v.
ok
V FL
ok
FH
Iz
ák
Iz ce
ák rt
ko .
Iz nv.
ák
Iz F L
ák
FH
Sušina kořenů (g)
4
3,5
3
2,5
2
1,5
1
0,5
0
Tabulka 1 Obecný trend délky zárodečných kořínků - průměr přes hodnocené plodiny
% klíčivosti /dva dny
69
82
61
65
Kategorie osiva
Ekologicky certifikované osivo
Konvenční nemořené osivo
Farmářské osivo první kategorie
Farmářské osivo druhé kategorie
Prŧm. dél. koř. po týdnu klíč. (cm)
8,31
8,12
7,06
7,50
Z grafu 3 vyplývá vliv provenience osiva na vitalitu semen. V další generaci byl vliv
provenience osiv jiţ značně sníţený, u některých znaků byl však dále výrazný. Především se
jednalo o klíčivost po týdnu v podmínkách sucha. Ve standardních podmínkách byl rozdíl
minimální. Zjištěn byl téţ vliv provenience na hmotnost semen v klasu (latě), kde ekologicky
certifikovaná osiva a konvenční nemořená osiva byla vţdy lepší při srovnání s farmářskými
původy. Stejný trend byl u zárodečných kořínků v následné generaci
Graf 3 Vliv provenience osiva na vitalitu semen
Klíčivost-vitalita v % (dva dny)
120
% vyklíčených semen
100
80
60
40
20
S
au
S l ce
au r
l k t.
o
n
S v.
au
lF
S L
au
lF
H
Iz
ák
Iz ce
á r
Iz k k t.
ák o
n
Iz lep v.
ák š
í
h FL
o
rš
íF
H
ok
c
ok ert
ko .
n
V v.
ok
V FL
ok
F
H
V
V
K
ad
K rilj
ad c
ri ert
lj .
k
K K on
ad ad v
ri ri .
lj lj
h F
o L
rš
íF
H
P
ri
b
P ina
ri
b ce
in r
a t.
k
P on
ri v
b .
i
P na
ri F
b L
in
a
F
H
0
Jak vyplývá z grafu 4, vliv provenience byl i na vzcházivost (výsledky u odrůdy ovsa Saul
mohou být zkreslené houbovou chorobou).Vliv provenience vyplývá také z průměrného
hodnocení přes varianty (tabulka 2). Překvapivé a mírně odlišné byly výsledky u další
generace (graf 5, tabulka 3). Moţné vysvětlení: výsev všech odrůd v identických podmínkách.
Graf 4 Vliv provenience osiva na vzcházivost–počet vzešlých rostlin z 50 semen v řádku
Počet vzešlých rostlin
ad
ril
j
ad ce
ril rt
jk
K on
ad v
r
K ilj F
ad L
ril
jF
H
P
rib
i
P na
rib c
in ert
a
P ko
rib nv
in
P a
rib F
in L
a
FH
Vliv provenience na vzcházivost
60
50
První
odečet
40
30
Konečný
počet
20
10
139
au
l
S ce
au rt
lk
o
S nv
au
lF
S L
au
lF
H
S
Iz
ák
Iz ce
ák rt
ko
Iz n v
ák
Iz FL
ák
FH
V
ok
V cer
ok t
ko
V nv
ok
F
V L
ok
FH
K
K
0
„Úroda 12/2011, vědecká příloha―
Tabulka 2 Vliv provenience osiva na vzcházivost –počet vzešlých rostlin z 50 vysetých v řádku
Kategorie osiva
Ekologicky certifikované osivo
Konvenční nemořené osivo
Farmářské osivo první kategorie
Farmářské osivo druhé kategorie
Konečný počet
40
32
31
29
4 den
37
27
27
27
Graf 5 Vliv provenience na vzcházivost v následné generaci –počet vzešlých rostlin z
50 semen vysetých v řádku
60
50
První
odečet
40
30
20
Konečný
počet
10
S
au
S l ce
au r t
lk
o
S nv
au
lF
S
au L
lF
H
Iz
ák
Iz ce
ák r t
ko
n
IZ v
ák
Iz FL
ák
FH
V
V
ok
ce
ok rt
ko
V nv
ok
V FL
ok
FH
0
K
ad
K r ilj
ad ce
r il rt
j
K ko n
ad v
r
K ilj F
ad L
r il
jF
H
P
rib
P ina
rib c
in ert
a
P ko
rib n
i v
P na
rib F
in L
a
FH
Počet vzešlýchrostlin
Vliv provenience na vzcházivost ve druhé generaci
Tabulka 3.Vliv provenience na vzcházivost v následné generaci –počet rostlin z 50 semen
Kategorie osiva
Ekologicky certifikované osivo
Konvenční nemořené osivo
Farmářské osivo první kategorie
Farmářské osivo druhé kategorie
4 den
34
29
27
28
Konečný počet
38
42
30
31
Závěry
Výsledky potvrzuji význam provenience osiva a zdůrazňují potřebu preferovat kvalitní osivo,
buď ekologicky certifikované nebo konveční nemořené, které však lze vysévat na
ekologickém pozemku jen ve výjimečných případech. Polní testy potvrdily negativní vliv
farmářských osiv na celkovou výkonnost porostů. V další práci bude nutné zhodnotit vliv
provenience osiva na kořenový systém, vliv osmotického stresu a chemické sloţení semen.
Dedikace
Práce vznikla za podpory projektu NAZV Q191C123 a za podpory záměru MZE 0002700604,
Pouţitá literatura
Konvalina, P., Moudrý, J. (2007): Volba odrůdy,struktura pěstování a výnosu hlavních
obilnin v ekologickém zemědělství. In: Sborník konference "Ekologické zemědělství
2007", 6.2. – 7.2. 2007, ČZU, Praha, s. 67-69, ISBN: 978-80-213-1611-9
Bláha,L.: Význam vlastností semen trav pro hodnocení suchovzdornosti, Úroda 10,2009,s.4951).
Bláha, L., Laskafeld, D., Stehno, Z., Capouchová , I., Konvalina, P.: Hodnocení vlastností a
praktického pouţití certifikovaných a farmářských osiv u obilnin. In: Osivo a sadba,
sborník referátů ,10.2011 ,X Odborný a vědecký seminář.,ISBN 978-80-213-2153-3,s.5056.
Kontaktní adresa:
Ing.Ladislav Bláha CSc, Výzkumný ústav rostlinné výroby,v.v.i., Drnovská 507, 161 06
Praha 6- Ruzyně, [email protected]
140
„Úroda 12/2011, vědecká příloha―
VLIV GENOTYPOVÝCH ROZDÍLŦ V PARAMETRECH
KOŘENOVÉHO SYSTÉMU NA SUCHOVZDORNOST A VÝNOS
ŘEPKY OZIMÉ
The influence of genotype root traits differences on the yield and drought
tolerance in winter oilseed rape
Bláha L.,Vyvadilová M., Klíma M.
Výzkumný ústav rostlinné výroby,v.v.i., Praha - Ruzyně
Abstrakt
Dvouleté výsledky prokázaly, ţe největší vliv na výnos a suchovzdornost řepky ozimé má rychlost
nástupu růstu kořenového systému po ukončení zimního období a zlepšení poměru hmotnosti sušiny
kořenů a nadzemní části ve prospěch kořenové hmoty v podmínkách sucha během vegetace.
Nejrychlejší jarní regeneraci, vyjádřenou poměrem hmotnosti sušiny kořenů na jaře a na podzim, měly
odrůdy Californium, Labrador, Grizzly a Cadeli, to odpovídá i jejich pořadí z hlediska průměrného
výnosu na dvou lokalitách ve dvou ročnících. Jako optimální se jeví laboratorní test s takovým
obsahem vody půdě, kdy sušina nadzemní hmoty klesne o 10% oproti standardu.
Klíčová slova: Řepka ozimá, kořenový systém, výnos, suchovzdornost
Abstract
Two-year results showed that the greatest impact on drought tolerance and yield of rapeseed had the
speed of the root growth initialization after the winter period, and the change of the proportion
between dry weight of roots and aboveground parts in favour of the root mass in dry conditions during
the vegetation period. The fastest spring regeneration, expressed by the ratio of the dry weight of roots
in spring and autumn, had varieties Californium, Labrador, Grizzly and Cadeli. It corresponds to their
ranking in terms of average yield on two locations in two years. For testing the drought resistance in
laboratory conditions, the best effect was achieved under such soil humidity, which led to the decrease
of aboveground dry mass by 10% compared to standard.
Key words: Winter oilseed rape, root system, yield, drought tolerance
Úvod
K významnému sníţení výnosu u řepky ozimé dochází především v těch případech, kdy se
nedostatek vody v půdním profilu kryje s určitými vývojovými stádii této plodiny
(Bouchereau et al 1996). Jde o období vzcházení po setí, přezimování, jarní regeneraci,
období maximálního nárůstu nadzemní hmoty, období po ukončení kvetení, respektive dobu,
kdy začíná syntéza zásobních látek v semeni. Předchozí experimenty (Bláha et al. 2009)
potvrdily, ţe na vývoj a růst kořenové soustavy má velký vliv kromě kvality půdy, její
přípravy a průběhu počasí téţ odolnost vůči abiotickým stresorům v raných vývojových
stádiích, tj. jiţ na počátku klíčení. Genotypy, které jsou odolnější vůči těmto stresorům jiţ
během této fáze, mají i kvalitnější kořenový systém. Uvedený jev je patrný ještě na začátku
jarní regenerace. Cílem této práce bylo posouzení vlivu odrůdy na morfologii a hmotnost
kořenového systému ozimé řepky a následně na její odolnost vůči suchu a výnos.
Materiál a Metody
Do pokusů byly zařazeny následující kontrastní odrůdy ozimé řepky: Californium (Francie,
Monsanto SAS), Viking (Německo, Norddeutsche Pflanzenzucht), Navajo (Velká Británie,
CPB Twyford Ltd), OP4947/07(ČR,Oseva PRO, s.r.o., novošlechtění), Cadeli (Francie,
Monsanto SAS), Grizzly (Francie, Société RAGT 2n), ČŢL 20 (Čína, šlechtitelský materiál),
Labrador (Francie, SCA Adrien Momont et Fils). Blokově uspořádané pokusy byly s výše
uvedenými odrůdami zaloţeny na Šlechtitelské stanici Chlumec nad Cidlinou a Slapy u
141
„Úroda 12/2011, vědecká příloha―
Tábora. Kořeny byly odebírány do hloubky 30 cm ve třech termínech - na podzim (září,
listopad) a na jaře na počátku vegetace (konec března). Hustota porostu byla na odběrových
částech všech parcel upravena protrháváním na stejný spon (cca 45 rostlin na m2).
V neodběrové části parcel (sklizňová část) byly v jarním období zjišťovány počty rostlin ve
stejných termínech za účelem vyhodnocení hustoty rostlin po přezimování na uvedených
lokalitách.
Odebrané kořeny byly hodnoceny standardními metodami na plavicím zařízení (uţitný vzor
VÚRV). Kořeny byly zbaveny půdních částic a digitalizovány pomocí scanneru (Medion).
V počítačovém programu (autor dr. J. Janáček, fyziologický ústav ČAV) byl u skenů uměle
zvýšen jasový kontrast mezi kořeny a pozadím. Obrysy kořenů byly u kontrastních obrázků
dále zvýrazněny prahováním a obvod kořenové soustavy byl změřen automatickou
Croftonovou metodou (http://nucleus.img.cas.cz/kurz/napln.htm).
Délka kořenů byla počítána jako polovina obvodu. U obrázků s nedostatečným kontrastem
byla délka odvozena z počtu průsečíků kořenového systému s přiloţenou čárovou mříţkou. Po
stanovení morfologických charakteristik kořenové soustavy byla následně vypočtena
hmotnost sušiny kořenů.
Další experiment byl zaměřen na hodnocení vývoje kořenů ve standardizovaných
podmínkách. Rostliny vybraných materiálů byly pěstovány v plastových kbelících o objemu
12 litrů (deset rostlin/nádobu ve třech opakováních), v homogenizované hlinité hnědozemi na
spraši s vyhovující zásobou ţivin (stupnice dle Melicha) ve skleníku s teplotou den/noc 20 –
25 °C/15°C. Osvětlení bylo nastaveno tak, aby se v případě niţší intenzity světla přisvětlovalo
sodíkovými výbojkami na optimální intenzitu světla (výbojky značky Philips).Byla provedena
startovní konstantní jednorázová zálivka úplným ţivným roztokem (Knopp) u všech nádob.
Obsah vody byl udrţován na optimální úrovni pro rostlinu, která byla odhadnuta pomocí
hodnot vodního sytostního deficitu a testovací stupnice s rozdílnými obsahy vody v půdě, kdy
se měřil maximální růst. Obsah vody v půdě byl udrţován postupným doplňováním vody na
stanovenou úroveň dvakrát během dne na základě kaţdodenního měření hloubkovými
sondami v různých vrstvách nádob (Senzor půdní vlhkosti byl řízen pomocí přístroje Delta-T
HH2 od firmy Ekotechnika s.r.o.). Pro pouţitou půdu při dané struktuře se jednalo o 15
objemových procent vody. Pro kontrolu byla vytvořena kalibrační tabulka, kde byly
porovnány naměřené hodnoty uvedeným přístrojem a laboratorně zjištěn obsah vody v půdě.
Pokusy probíhaly po dobu dvou měsíců od výsadby juvenilních rostlin ve stadiu pěti pravých
listů v regulované kóji ve skleníku. Paralelně s hodnocením polních pokusů probíhaly pokusy
v minirhizotronu s nastavitelnou teplotou v kořenové a nadzemní části rostlin a v nádobách.
Tyto pokusy slouţí jako kontrola získaných odrůdových rozdílů a k detailnější analýze.
Výsledky a diskuze
Sledované materiály dosahovaly velmi rozdílných výnosů na obou lokalitách, zřetelný byl i
vliv ročníku. Ve všech variantách byly nejlepší odrůdy Labrador a Californium, pak následují
OP 4947, Grizzly, Cadeli a Viking. Nejniţší výnosy měla odrůda Navajo a čínský
šlechtitelský materiál ČŢL 20 (graf.č.1). Kromě vlastností kořenové soustavy má u řepky
ozimé velký význam rychlost jarní regenerace, jak vyplývá z tabulky č.1, kde je zobrazen
průměrný výnos a poměr sušiny kořenů jaro/podzim. Nejrychlejší regeneraci, vyjádřenou
poměrem hmotnosti sušiny kořenů na jaře a na podzim, měly odrůdy Californium, Labrador,
Grizzly a Cadeli, coţ odpovídá i jejich pořadí z hlediska průměrného výnosu na dvou
lokalitách ve dvou ročnících. Na rozdíl od podzimu, kdy vlastnosti kořenů (sušina, objem,
délka) korelují kladně s nadzemní biomasou, v jarním období je situace odlišná. Nejvyšší
hodnotu korelace dosáhla rychlost jarní regenerace (r=0,89‫)٭‬. Údaje pro jednotlivé lokality a
ročníky jsou u sedmi odrůd velmi podobné, s výjimkou materiálu ČŢL 20, který vykazuje
horší zimovzdornost (prořídlý porost).
142
„Úroda 12/2011, vědecká příloha―
Graf 1: Výnosy odrůd a šlechtitelských materiálů-průměry za dva ročníky
Tabulka 1. Průměrný výnos z lokalit a rychlost jarní regenerace na uvedených lokalitách
Genotyp
Výnos
Poměr sušin kořenŧ jaro/podzim
Californium
Labrador
OP4947
Grizzly
Cadeli
Viking
Navajo
ČŢL 20
Průměr
4,13
4,21
3,79
3,71
3,42
3,40
3,18
2,71
3,57
1,13
1,09
0,89
1,04
0,97
0,81
0,77
0,85
0,94
Graf 2: Průměrná hmotnost sušiny kořenů jedné rostliny v nádobových pokusech
Graf 3: Průměrná hmotnost sušiny nadzemní části jedné rostliny v nádobových pokusech
Průměrná hmotnost sušiny nadzemní části (g)
6
5
4
Standard
3
Sucho
2
1
ad
e
La li
br
ad
or
O
P
49
47
Č
Ţ
L
20
C
V
ik
in
g
G
riz
zl
y
av
aj
o
N
C
al
ifo
rn
iu
m
0
143
„Úroda 12/2011, vědecká příloha―
Graf 4: Poměr sušin kořenů a nadzemní části v nádobových pokusech
Pomě r sušin koře nů a na dze mní čá sti (g)
1,2
1
0,8
0,6
0,4
0,2
0
standard
ad
e
La li
br
ad
or
O
P
49
47
Č
Ţ
L
20
C
V
ik
in
g
G
riz
zl
y
av
aj
o
N
C
al
ifo
rn
iu
m
sucho
Nejmenší sníţení hmotnosti kořenů v podmínkách sucha měly odrůdy Cadeli, Grizzly, Viking
a šlechtitelský materiál OP 4947, nejmenší sníţení hmotnosti sušiny nadzemní části bylo
zjištěno u materiálů Cadeli, Labrador a OP 4947 (Graf . 2, 3, 4). Odrůda Cadeli a šlechtitelský
materiál OP 4947 projevily v laboratorních testech nejvyšší suchovzdornost, v polních
pokusech však byl jejich výnos jen mírně nadprůměrný (Tab.1). Odolnost k suchu nemusí
souviset přímo s nejvyšším výnosem, nicméně má-li odrůda dostatečnou hmotnost nadzemní
a kořenové části, pak i v podmínkách sucha můţe dát uspokojivý výnos. N. Sabaghnia et al.
(2011) doporučují pro podmínky sucha vyuţití heterozního efektu. Genotypy odolnější vůči
stresorům, mají jiţ od počátku klíčení kvalitnější kořenový systém. Dále jsme zjistili, ţe je
moţné provést výběr na suchovzdornost i v laboratorních podmínkách (Bláha et al. 2009).
Nelze však přesně doporučit optimální procentuální podíl vody v půdě, protoţe kaţdá půda
má jiné chemické sloţení a jiné osmotické poměry. Je však třeba mít takový substrát, ve
kterém se podmínky pěstování rostlin blíţí přirozenému prostředí.
Závěr
Byl prokázán vliv hmotnosti kořenového systému na suchovzdornost a výši výnosu.
Významný je rychlý nástup růstu kořenového systému po ukončení zimního období a zvýšení
poměru hmotnosti kořenů a nadzemní části ve prospěch kořenové hmoty. Pro výběr materiálů
se zvýšenou suchovzdorností se jako optimální jeví test s takovým obsahem vody půdě, kdy
sušina nadzemní hmoty klesne cca o 10% oproti optimální zásobenosti vodou.
Dedikace
Práce vznikla za podpory projektů MZe ČR 00027090604 a QH82285.
Pouţitá literatura
Sabaghnia N. H., Dehghani H., Alizadeh B., Moghaddam M. (2011): Yield analysis of
rapeseed (Brassica napus L.) under water-stress conditions using GGE biplot metodology.
Journal of Crop Improvement. Vol 25, Issue 1: 26 – 45.
Bouchereau A., Clossais-Besnard N., Bensaoud A., L. Leport.L, Renard, M (1996): Water
stress effects on rapeseed duality. Europ. Journ. of Agronomy. Vol 5, Issue 1-2: 19-30.
Bláha, L., Vyvadilová, M., Klíma, M. (2009): Výběr genetických zdrojů řepky ozimé se
zvýšenou suchovzdorností pomocí laboratorních testů. Sborník referátů z konfer. Vliv
abiotických a biotických stresorů na vlastnosti rostlin, Praha 4. – 5.3. 2009, s. 383-386.
ISBN: 978-80-87011-91-1.
Kontaktní adresa:
Ing. Ladislav Bláha CSc Výzkumný ústav rostlinné výroby v.v.i. Drnovská 507, 16106 Praha
6.-Ruzyně,e-mail: [email protected]
144
„Úroda 12/2011, vědecká příloha―
STUDIUM PROTEINOVÝCH PROFILŦ HLÍZ VYBRANÝCH
GENOTYPŦ KULTURNÍCH DRUHŦ BRAMBOR POMOCÍ ČIPOVÉ
ELEKTROFORESY
Protein profiles study of selected genotypes of cultivated potato species by
chip electrophoresis
1
Brabcová A., 1Bárta J., 1Bártová V., 2Horáčková V.
1
Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta
2
Výzkumný ústav bramborářský Havlíčkův Brod, s.r.o.
Abstrakt
V příspěvku byly hodnoceny bílkovinné profily získané pomocí čipové elektroforesy Experion (BioRad) u vybraných genotypů pěti kulturních druhů resp. poddruhů brambor – diploidní S. stenotomum,
S. goniocalyx, S. phureja a tetraploidní S. tuberosum subsp. andigena, S. tuberosum subsp. tuberosum
(cv. Desireé). Byla získána variabilní spektra ve dvou hlavních oblastech hlízových bílkovin. V oblasti
bílkovin patatinového komplexu byly detekovány 2 (S. stenotomum, S. goniocalyx) aţ 3 (S. phureja,
oba poddruhy S. tuberosum) bílkovinné pruhy v intervalu 43,4 – 57,6 kDa, coţ je pravděpodobně
způsobeno rozdílným stupněm glykosylace polypeptidu patatinu. V oblasti inhibitorů proteas bylo
detekováno 3-6 bílkovinných pruhů v intervalu 9,1-35,0 kDa. Relativní abundance bílkovin v oblasti
výskytu patatinu se pohybovala v rozpětí 20 % (S. tuberosum) – 40 % (S. tuberosum subsp. andigena,
S. stenotomum) a abundance majoritních bílkovinných pruhů představovala v oblasti inhibitorů proteas
rozpětí 43 % (S. stenotomum) – 66 % (S. tuberosum subsp. tuberosum).
Klíčová slova: automatická čipová elektroforesa, analýza proteinů, brambor
Abstract
The presented contribution is focused on possibility of using automatic chip electrophoresis Experion
(Bio-Rad) for studying protein profiles of five selected cultivated potato species – diploid
S. stenotomum, S. goniocalyx, S. phureja and tetraploid S. tuberosum subsp. andigena, S. tuberosum
subsp. tuberosum (cv. Desireé). The spectrum variability in two main areas of potato tubers was
obtained. There were detected from two (S. stenotomum, S. goniocalyx) to three (S. phureja and both
subsp. S. tuberosum) protein bands in range of 43.4 – 57.6 kDa in patatin complex area. This fact is
probably caused by different level of patatin polypeptide glycosylation. In protease inhibitors area
were detected from 3 to 6 protein bands in range of 9.1 – 35.0 kDa. Relative protein abundance in
patatin area was detected in range from 20 % (S. tuberosum) to 40 % (S. tuberosum subsp. andigena,
S. stenotomum) and abundance of the major protein bands covered the range from 43 %
(S. stenotomum) to 66 % (S. tuberosum subsp. tuberosum) in protease inhibitors area.
Key words: automatic chip electrophoresis, analysis of protein, potato
Úvod
U odrůd evropského bramboru (Solanum tuberosum subsp. tuberosum) se na základě SDSPAGE analýzy rozlišují tři významné skupiny hlízových bílkovin: bílkoviny patatinového
komplexu, inhibitory proteas a ostatní bílkoviny (Pots 1999). Bílkoviny patatinového
komplexu jsou skupinou imunologicky identických glykoproteinových isoforem o velikosti
40-43 kDa, mající především funkci zásobní bílkoviny. Předpokládá se však i jejich účast na
obranných reakcích hlíz prostřednictvím enzymových aktivit, kterými disponují – např.
nespecifická lipidacylhydrolasová aktivita, aktivita β-1,3-glukanasy aj. (Bárta and Bártová
2007). Inhibitory proteas jsou dle Pouvreau et al. (2001) děleny do sedmi tříd a zahrnují
bílkoviny od 4-25 kDa. V hlízách brambor mají zásobní funkci, ale obecně se podílejí na
obranných mechanismech v hlízách (Lawrence et al. 2002). Automatická čipová elektroforesa
je novou alternativou ke klasické SDS-PAGE. U této techniky probíhá analýza bílkovin ve
145
„Úroda 12/2011, vědecká příloha―
speciálních čipech a jejím principem je mikrofluidní separace a fluorescenční detekce vzorku
(Brubacher 2008). Čip dostupného analytického kitu Experion Pro260 je schopen analyzovat
bílkoviny v rozpětí molekulových hmotností 10-260 kDa; nevýhodou můţe být posun
molekulových hmotností ve srovnání s SDS-PAGE analýzou (Zhu et al. 2005; Bárta et al.
2010). Bílkoviny hlíz byly pomocí čipové elektroforesy analyzovány u komerčně dostupných
odrůd S. tuberosum, kde byl zjištěn posun molekulových hmotností pro obě majoritní skupiny
bílkovin – oblast bílkovin patatinového komplexu byla lokalizována v intervalu 42-58 kDa a
oblast inhibitorů proteas v rozpětí 9-35 kDa (Bárta et al. 2009). Cílem tohoto příspěvku bylo
studium profilů hlízových bílkovin u vybraných kulturních druhů rodu Solanum pomocí
čipové elektroforesy Experion.
Materiál a Metody
Rostlinný materiál byl získán z Genové banky bramboru (Výzkumný ústav bramborářský
Havlíčkův Brod, s.r.o.). Vstupním materiálem pro analýzu bílkovin byla lyofilizovaná
sušina hlíz vybraných kulturních druhů brambor Solanum stenotomum (EVIGEZ
07S0300001), Solanum phureja (EVIGEZ 07S0300136), Solanum goniocalyx (EVIGEZ
07S0300109), Solanum tuberosum subsp. andigena (EVIGEZ 07S0300235) a Solanum
tuberosum subsp. tuberosum odrůda Desireé (EVIGEZ 07S0100243). Extrakce bílkovin byla
provedena pomocí extrakčního pufru (0,0625 M Tris-HCl pH=6,8 + 0,2 % SDS + 5 % βmerkaptoethanol), kdy k 50 mg sušiny bylo přidáno 500 µl extrakčního pufru. K analýze
bílkovin byl pouţit systém automatické čipové elektroforesy Experion (Bio-Rad
Laboratories, USA) s příslušným analytickým kitem Experion Pro260. Analýza probíhala dle
pokynů výrobce a byla vyhodnocena softwarem Experion, verze 3.0 (Bio-Rad, USA).
Statistické vyhodnocení dat relativní abundance patatinu (Tukey HSD test) bylo provedeno
pomocí software STATISTICA 9 (StatSoft USA, 2009). Uvedené analýzy byly provedeny
v letech 2009 – 2010.
Výsledky a diskuze
Analýzou bílkovin pomocí automatické čipové elektroforesy byla získána variabilní spektra u
všech vybraných druhů (viz obr. 1). V oblasti výskytu bílkovin patatinového komplexu byly
nalezeny dva (S. stenotomum, S. goniocalyx) nebo tři (S. phureja, S. tuberosum subsp.
andigena, S. tuberosum subsp. tuberosum) pruhy o různé intenzitě v rozpětí molekulové
hmotnosti 43,4-57,6 kDa (viz tab. 1). Pruhy nejspíše představují jednotlivé hmotnostní
isoformy patatinu, které vznikají rozdílným stupněm glykosylace polypeptidového řetězce,
jak uvádí Pots (1999). U diploidních druhů byla suma relativní abundance isoforem patatinu
od 27 % (S. phureja) do 38 % (S. stenotomum). U tetraploidních poddruhů S. tuberosum
(subsp. tuberosum a subsp. andigena) byly zjištěny hodnoty, které v podstatě vystihují
literárně uváděné rozpětí 20-40 % patatinových bílkovin z celkového spektra bílkovin hlíz
(Mignery et al. 1988; Pots 1999; Bárta and Bártová 2007). Uvedená zjištění potvrzují
předchozí výsledky (Bárta, Bártová, 2008), ţe relativní abundance patatinových bílkovin je
velmi variabilní a u jednotlivých druhů i odrůd můţe být značně odlišná. V oblasti inhibitorů
proteas bylo detekováno od tří (S. goniocalyx) do šesti (S. tuberosum subsp. andigena a subsp.
tuberosum, S. stenotomum) pruhů odlišné intenzity v intervalu molekulové hmotnosti od 9,135 kDa. Suma relativní abundance bílkovin v oblasti inhibitorů proteas byla také velmi
variabilní a pohybovala se v rozpětí 43 % (S. stenotomum) – 66 % (S. tuberosum subsp.
tuberosum) (viz tab. 1). Zjištěné hodnoty jsou tak vyšší, neţ je literárně často uváděný (Pots
1999; Bárta and Bártová 2007) rozsah zastoupení inhibitorů proteas 20-30 % v bílkovinách
hlíz bramboru.
146
„Úroda 12/2011, vědecká příloha―
Obr. 1: Profily hlízových bílkovin v podobě imaginárního gelu.
Oblast
výskytu
patatinového komplexu
bílkovin
Oblast výskytu inhibitorů proteas
M – marker 260Pro (Bio-Rad); 1,2 – Solanum stenotomum; 3,4 – Solanum goniocalyx; 5,6 –
Solanum phureja; 7,8 - Solanum tuberosum subsp. andigena; 9,10 - Solanum tuberosum
subsp. tuberosum
Tab. 1: Počet bílkovinných pruhů, jejich molekulové hmotnosti a souhrnná relativní
abundance v oblastech výskytu bílkovin patatinového komplexu a inhibitorů proteas u
vybraných druhů rodu Solanum
Druh
poddruh
resp.
S. stenotomum
S. goniocalyx
Oblast výskytu bílkovin
patatinového komplexu (42-58 kDa)
počet pruhŧ
souhrnná
(mol. hm. v kDa)
rel. abund.
bílkovin (%)
2
38,5 c
(43,4; 47,5)
2
(43,9; 48,9)
3
(48,2; 51,4; 54,3)
30,4 b
S. tuberosum
subsp. andigena
3
(43,4; 48,9; 55,8
37,9 c
S. tuberosum
subsp. tuberosum
3
(50,3; 53,9; 57,6)
20,1 a
S. phureja
27,6 b
Oblast výskytu inhibitorů proteas
(9-35 kDa)
počet pruhŧ
souhrnná
(mol. hm. v kDa)
rel. abund.
bílkovin (%)
6
42,7 a
(9,2; 16,8; 21,6;
23,6; 25,6; 29,8)
3
44,1 a
(16,8; 23,7; 29,7)
5
56,2 c
(9,1; 11,5; 16,3;
22,1; 29,3)
6
49,4 b
(9,1; 17,3; 20,6;
23,4; 24,8; 30,3)
6
66,0 d
(9,2; 16,8; 19,8;
23,0; 30,2; 35,0)
Neshodná písmena indikují průkazný rozdíl na hladině významnosti P<0,05 (Tukey HSD test)
147
„Úroda 12/2011, vědecká příloha―
Závěr
Výsledky potvrdily předpokládaný posun molekulových hmotností bílkovin v porovnání
s technikou SDS-PAGE. V uvedených oblastech obou majoritních skupin hlízových bílkovin
byla mezi studovanými poloţkami zjištěna variabilita, a to jak v počtu a intenzitě pruhů, tak i
v souhrnném relativním zastoupení bílkovin těchto oblastí z celkového bílkovinného spektra.
Vzhledem k prokázané vysoké nutriční hodnotě patatinových bílkovin druhu S. tuberosum a
specifickým biochemickým vlastnostem těchto bílkovin s vysokým potenciálem vyuţití
v nejrůznějších biotechnologických aplikacích jsou zjištěné moţnosti detekce a charakterizace
patatinu příbuzných kulturních druhů rodu Solanum s vyuţitím moderních postupů významné
především s ohledem na jiţ ve světě probíhající šlechtitelské programy zaměřené na
zvyšování obsahu bílkovin v hlízách druhu S. tuberosum.
Dedikace
Výsledky byly získány v rámci řešení výzkumných projektů NAZV QI91A069 a GAJU
064/2010/Z a výzkumného záměru MSM 6007665806.
Pouţitá literatura
Bárta, J., Bártová, V. (2007): Bílkoviny hlíz bramboru (Solanum tuberosum L.), vědecká monografie,
Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta, s. 116.
Bárta, J., Bártová, V. (2008): Patatin, the major protein of potato (Solanum tuberosum L.) tubers, and
its occurrence as genotype effect: processing versus table potatoes. Czech Journal of Food Sciences
26: 347-359.
Bárta, J., Bártová, V., Diviš, J. (2009): Vyuţití analýzy bílkovin hlíz na automatické čipové
elektroforese Experion pro charakterizaci genotypů brambor: metodika pro praxi, České
Budějovice: ZF JU, s. 37.
Bárta, J., Bártová, V., Čurn, V. (2010): Analýza proteinů pomocí automatické čipové elektroforézy
Experion a porovnání s metodou SDS-PAGE, Chemické Listy 104: 33-40.
Brubacher, M.G. (2008): The New Face of Electroproresis: Modernization of a Workhorse
Technology, BioTechniques 44/4: 568-570.
Lawrence, P.K., Koundal, K.R. (2002): Plant protease inhibitors in control of phytophagous insects,
Electronic Journal of Biotechnology, 5: 93-109.
Mignery, G.A., Pikaard, C.S., Park, W.D. (1988): Molecular characterization of the patatin multigene
family of potato, Gene 62: 27–44.
Pots, A.M. (1999): Physico-chemical properties and thermal aggregation of patatin, the major potato
tuber protein, PhD. thesis, Wageningen Agricultural University, Wageningen, the Netherlands, s.
123.
Povreau, L., Gruppen, H., Piersma, S.R., Broek Van Den, L.A.M., Koningsveld Van, G.A.,
Voragen, A.G.J. (2001): Relative Abundance and Inhibitory Distribution of Protease Inhibitors in
Potato Juice from cv. Elkana, Journal of Agricultural and Food Chemistry 49: 2864-2874.
Zhu, K., Nguyen, M., Strong, W., Whitman-Guliaev, C. (2005): Protein Sizing, Quantitation, and
Analysis Using the Experion Automated Electrophoresis System: A Comparison with SDS-PAGE,
BioRadiations 117: 22-25.
Kontaktní adresa:
Ing. Adéla Brabcová
Oddělení pěstování rostlin, Katedra rostlinné výroby a agroekologie
Zemědělská fakulta
Jihočeská univerzita v Českých Budějovicích
Studentská 13, 370 05 České Budějovice
e-mail: [email protected]
148
„Úroda 12/2011, vědecká příloha―
VARIABILITA GLUTENINŦ V SORTIMENTU ODRŦD PŠENICE
PĚSTOVANÝCH V ČR
Glutenin variability in wheat varieties grown in the Czech Republic
Bradová J., Štočková L.
Výzkumný ústav rostlinné výroby,v.v.i., Praha
Abstrakt
Metodou SDS-PAGE byla hodnocena genetická diverzita podjednotek gluteninů s nízkou (LMW-GS)
a vysokou (HMW-GS) molekulovou hmotností u souboru 134 odrůd pšenice. V analyzovaném
souboru bylo detekováno celkem 13 HMW-GS alel a 15 LMW-GS alel, které tvořily celkem 88
elektroforetických profilů. Nejčetnější alelickou sestavou, detekovanou u 9 genotypů, byla kombinace
alel Glu-A1c, Glu-B1b, Glu-D1d a Glu-A3d, Glu-B3g, Glu-D3c. Pro 12 % odrůd byl charakteristický
vnitroodrůdový polymorfismus LMW- a HMW-GS. Odrůdy jarní pšenice vykazovaly vyšší
vnitroodrůdový polymorfismus (20,8 %) neţ odrůdy ozimé pšenice (10,0 %). U lokusů Glu-1 a Glu-3,
teoreticky nezávislých, lokalizovaných na rozdílných ramenech chromozomu jedna, byly zjištěny
některé vztahy díky nízké alelické diverzitě.
Klíčová slova: pšenice, gluteniny, diverzita
Abstrakt
Genetic diversity of glutenin subunits with low (LMW-GS) and high (HMW-GS) molecular weight in
a set of 134 wheat varieties was evaluated by SDS-PAGE. A total of 13 HMW-GS alleles and 15
LMW-GS alleles, which accounted for 88 electrophoretic profiles, were detected. The most common
allelic profile detected in 9 genotypes was the combination of alleles Glu-A1c, Glu-B1b, Glu-D1d and
Glu-A3d, Glu-B3g, Glu-D3c. Intra-varietal polymorphism of LMW- and HMW-GS was found in
12% of the varieties. Spring wheat varieties showed higher intra-varietal polymorphism (20,8%) than
winter wheat varieties (10,0%). Some associations were found for the theoreticaly independent loci
Glu-1 and Glu-3 located on a different chromosome arms due to the low allelic diversity.
Key words: wheat, glutenins, diversity
Úvod
Uplatnění nových technologií a genetické diverzity ke zlepšování biologického potenciálu
zemědělských plodin je hlavním přínosem pro rozvoj rostlinné produkce. Inovace odrůd je
jedním z rozhodujících faktorů pro zvyšování produktivity plodin. Vyuţití pšenice je velmi
rozsáhlé a kaţdé odvětví má rozdílné poţadavky na její kvalitu. Vhodnost pšenice pro
specifické koncové pouţití (potravinářské i nepotravinářské) je určována zejména vlastnostmi
hlavních chemických komponent pšeničného zrna, tedy škrobu a bílkovin. Škrob tvoří asi
70% a bílkoviny asi 10-15% pšeničného endospermu. Bílkovinný komplex pšenice je velmi
heterogenní, obsahuje protoplazmatické bílkoviny - albuminy, globuliny (cca 20%) a komplex
zásobních bílkovin - gliadiny, gluteniny (cca 80%), (Branlard et al., 2003). U gluteninů
rozeznáváme na základě jejich molekulové hmotnosti tzv. podjednotky s vysokou
molekulovou hmotností (HMW-GS) - a podjednotky s nízkou molekulovou hmotností
(LMW-GS). Syntéza HMW-GS je kódována lokusy Glu-1 na dlouhém rameni a syntéza
LMW-GS lokusy Glu-3 na krátkém rameni první homeologické skupiny chromosomů. LMWGS se vyskytují jako multigenní skupina v úzkém spojení s omega gliadiny (Metakovsky et
al., 1997). HMW-GS a LMW-GS vytváří alelické kombinace, na jejichţ základě mohou být
charakterizovány a jejichţ výskyt je v přímé vazbě k technologické jakosti zrna pšenice
(Černý, Šašek, 1996). Zásobní bílkoviny endospermu mají zásadní výzkumný a šlechtitelský
význam, který spočívá v moţnosti predikce kvality zrna u hodnoceného šlechtitelského
materiálu na základě znalosti polymorfismu jednotlivých bílkovinných sloţek.
149
„Úroda 12/2011, vědecká příloha―
Cílem práce bylo charakterizovat LMW- a HMW- gluteniny vybraného souboru odrůd
pšenice a vyhodnotit jejich alelickou diverzitu tak, aby bylo moţno vyuţít těchto poznatků ve
šlechtění nových odrůd.
Materiál metody
K elektroforetickým analýzám byl pouţit soubor 134 odrůd jarní a ozimé pšenice, které byly
průběţně registrovány od počátku 80 let aţ po současnost pro pěstování v České republice
resp. na území bývalého Československa (do r. 1993). Semenné vzorky standardních
(etalonových) odrůd poskytl ÚKZÚZ Brno. Ke stanovení alelického sloţení gluteninů byla
pouţita metoda SDS-PAGE (Bradová et al., 2011). Na uvedeném souboru odrůd (vyjma
odrůd reg. v roce 2010) byla testována vzájemná závislost gluteninových a gliadinových
(Bradová, Šašek, 2007) lokusů v párech alel Pearsonovým χ-square testem.
Výsledky a diskuze
Metoda SDS-PAGE byla pouţita ke studiu genetické diverzity LMW- a HMW-GS u souboru
134 odrůd pšenice. V hodnocené souboru, který obsahoval 110 odrůd ozimého a 24 odrůd
jarního typu, bylo detekováno celkem 13 HMW-GS alel a 15 LMW-GS alel (Tabulka 1).
Lokusy Glu-B1 a Glu-B3 se vyznačovaly nejvyšší alelickou variabilitou jak u jarní tak u
ozimé pšenice, coţ uvádí i řada dalších autorů (Branlard et al., 2003, Tsenov et al., 2010).
V nejvyšším zastoupení u jarní i ozimé pšenice byly zjištěny gluteninové alely Glu-B1c (71
%; 41 %), Glu-D1d (68 %; 62 %), Glu-A3a (74 %; 46 %) a Glu-D3c (58 %; 93 %). Rozdíly
mezi jarní a ozimou pšenicí byly zjištěny pouze na gluteninových lokusech Glu-A1 a Glu-B3.
Na LMW-gluteninovém lokusu Glu-A1 u jarních pšenic byla zaznamenána nejvyšší četnost
alely Glu-A1a (61 %) na rozdíl od souboru odrůd ozimé pšenice s nejčastěji se vyskytující
alelou Glu-A1c (70 %), kterou Payne a Lawrence (1983) popsali jako nulovou alelu. Pokud
se týká LMW-gluteninového lokusu Glu-B3, nejvyšší frekvencí se vyznačovala alela Glu-B3b
(61 %) u jarních a Glu-B3g (63 %) pak u ozimých pšenic. Detekované LMW- a HMWgluteninové alely v různých kombinacích tvořily celkem 88 elektroforetických profilů v celém
souboru hodnocených odrůd, přičemţ nejčetnější alelickou sestavou byla kombinace alel
Glu-A1c (null), Glu-B1b (7+8), Glu-D1d (5+10) a Glu-A3d, Glu- B3g, Glu-D3c, která byla
detekována u 9 genotypů (6,7 %).
Tabulka 1: Frekvence LMW- a HMW-GS alel v souboru odrůd jarní a ozimé pšenice.
Počet alel (n)
Výskyt alel s nejvyšší frekvencí
Lokus
jarní
pšenice
ozimá pšenice
jarní
ozimá
jarní + ozimá
pšenice pšenice
pšenice.
alela
%
alela
%
Glu-A1
3
3
3
a (1)
61
c (null)
70
Glu-B1
4
6
7
c (7+9)
71
c (7+9)
41
Glu-D1
3
3
3
d (5+10)
68
d (5+10)
62
Glu-A3
3
4
4
a
74
a
46
Glu-B3
5
6
8
b
61
g
63
Glu-D3
3
3
3
c
58
c
93
Počet odrůd
24
110
Počet Glu - linií (biotypů)
31
123
Průměrný počet Glu - linií (biotypů) na odrůdu
1,3
1,1
Pro charakterizaci jednotlivých odrůd pšenice elektroforetickou analýzou gluteninů je důleţitá
znalost případného vnitroodrůdového polymorfismu v elektroforetické skladbě zmíněných
bílkovinných genetických markerů (McLendon, 1993; Sontag-Strohm et al., 1996). V případě
150
„Úroda 12/2011, vědecká příloha―
polymorfních odrůd je pak jejich genetická struktura charakterizována počtem gluteninových
biotypů (linií) (Černý, Šašek,1996). Na základě detekovaných HMW- a LMW-GS alel bylo v
testovaném souboru celkem charakterizováno 16 (12 %) heterogenních resp. víceliniových
odrůd, z toho 5 jarních a 11 ozimých odrůd pšenice (Tabulka 2). Polymorfismus ve skladbě
HMW-GS byl zjištěn u šesti odrůd. Deset odrůd bylo polymorfních v LMW-GS. Ani u jedné
odrůdy nebyl zjištěn současně HMW- i LMW- gluteninový polymorfismus. Většina
heterogenních odrůd se skládala ze dvou HMW- či LMW - gluteninových biotypů (linií),
pouze odrůdy Sandra, Septima, Eurofit byly charakterizované třemi HMW-gluteninovými
biotypy a odrůda Windsdor třemi LMW-gluteninových biotypy. Z tabulek 1 a 2 je zřejmé, ţe
odrůdy jarní pšenice vykazovaly vyšší vnitroodrůdový polymorfismus. V analyzovaném
souboru odrůd ozimé pšenice bylo zjištěno 10,0 % polymorfních odrůd (průměrný počet
gluteninových biotypů na odrůdu byl 1,1) na rozdíl od jarní pšenice, kdy bylo zjištěno 20,8 %
polymorfních odrůd (biotyp : odrůda = 1,3).
Tabulka 2: Vnitroodrůdový polymorfismus LMW- a HMW-GS hodnocených odrůd pšenice.
Bílkovinný
systém
Jarní pšenice (24 odrůd)
n
% Název odrůdy
n
LMW-GS
2
8,3
Munk, Tercie
8
HMW-GS
3
12,5
Granny,
Septima
3
2,7
∑
5
20,8
11
10,0
Sandra,
Ozimá pšenice (110 odrůd)
% Název odrůdy
Barryton, Fortis, Graindor,
7,2 Karolinum, Mladka, Niagara,
Solara, Windsor
Asta, Bodyček, Eurofit
Vzhledem k tomu, ţe lokusy Glu-3 a Gli-1 jsou těsně propojeny na krátkém rameni
chromozomů lA, 1B a 1D, byly očekávány silné vztahy mezi těmito lokusy (Branlard et al.,
2003). Vzájemná závislost gluteninových a gliadinových lokusů (charakteristiky ω-gliadinů
byly pouţity z práce Bradová, Šašek ,2007) byla testována v párech alel Pearsonovým χsquare testem. V tabulce 3 jsou uvedeny hodnoty „p― vyplývající z tohoto testu, které určují
pravděpodobnost závislosti kaţdých dvou alel. Závislost lokusů Glu-3 a Gli-l se projevila
vysokým podílem nízkých hodnot „p― ve vzájemných vztazích. Avšak i u lokusu Glu-1
(HMW-GS) resp. Glu-3 (Gli-1), které jsou lokalizovány na dlouhém resp. krátkém rameni
chromozomu 1 a jsou povaţovány za geneticky nezávislé, byly zjištěny některé alelické
vztahy jako velmi významné pro tento analyzovaný soubor odrůd pšenice. To bylo především
v případě vztahů mezi alelami na Glu-A1 a alelami u většiny ostatních studovaných lokusů,
coţ si lze vysvětlit velmi nízkou alelickou diverzitou tohoto lokusu.
Tabulka 3: Hodnocení vztahů mezi gliadinovými, HMW- a LMW- gluteninovými alelami χsquare testem nezávislosti
Lokus
Gli-A1 Gli-B1 Gli-D1 Glu-A1 Glu-B1 Glu-D1 Glu-A3 Glu-B3
Gli-B1 0,000
Gli-D1 0,000
0,576
Glu-A1 0,002
0,572
0,000
Glu-B1 0,994
0,492
0,966
0,609
Glu-D1 0,509
0,023
0,123
0,001
0,322
Glu-A3 0,000
0,027
0,540
0,004
0,691
0,539
Glu-B3 0,399
0,000
0,402
0,221
0,128
0,219
0,006
Glu-D3 0,035
0,000
0,000
0,000
0,683
0,082
0,180
0,000
151
„Úroda 12/2011, vědecká příloha―
Závěr
Je známo ţe HMW- a LMW- podjednotky gluteninů jsou v přímé vazbě k technologické
jakosti zrna pšenice a proto lze analýzu těchto zásobních bílkovin vyuţít jako účinný nástroj
ve šlechtitelském procesu k výběru vhodných rodičovských genotypů ke tvorbě nových odrůd
a následně k hodnocení raných šlechtitelských generací pšenice.
Dedikace
Výsledky byly získány při řešení projektu MZe ČR č. QH 92155 a 0002700604.
Pouţitá literatura:
Branlard G., Dardevet M., Amiour N., Igrejas G. (2003): Allelic diversity of HMW and LMW
glutenin subunits and omega gliadins in French bread wheat (Triticum aestivum
L.).
Genet Resour Crop Event. 50: 669-679.
Metakovský E.V., Branlard G., Chernakov V.M., Upelniek V.P., Redaelli R., Pogna N.E.
(1997): Recombination Mapping of Some Chromosome 1A-, 1B-, 1D- and 6B-controlled
Gliadins and Lowmolekular –Weight Glutenin Subunits in Common Wheat. Theor Appl
Genet 94: 788-795.
Černý, J., Šašek, A.(1996): Bílkovinné signální geny pšenice obecné. ÚZPI, Praha.
Bradová J., Dvořáček V., Štočková L. (2011): Vyuţití gelové a čipové elektroforézy pro
identifikaci podjednotek gluteninů s vysokou a nízkou molekulovou hmotností u pšenice.
VÚRV,v.v.i., Praha
Bradová J., Šašek A. (2007): Optimalizace metod elektroforézy proteinů pro identifikaci
odrůd pšenice (Triticum aestivum L.),VÚRV,v.v.i., Praha.
Tsenov N., Atanasova D., Todorov I., Ivanova I., Stoeva I.(2010): Quality of winter common
wheat advanced lines depending on allelic variation of Glu-A3. Cereal Res Commun.
38(2): 250-258.
Payne P.I., Lawrence G.J. (1983): Catalogue of alleles for the complex loci, Glu-A1, Glu-B1
and Glu-D1 which coded for high-molecular-weight subunits of glutenin in hexaploid
wheat. Cereal Res Commun. 11: 29–35.
McLendon M.E., Panniny S.P., McGuire C.F., Martin J.M., Albert L.E. (1993). Variation of
seed storage proteins within hard red spring wheat cultivars and effect on end-use
propertis. Cereal Chem. 70(5):607-610.
Sontag-Strohm T., Payne P.I., Salovaara H. (1996): Effect of allelic variation of glutenin
subunits and gliadins on baking quality in the progeny of two biotypes of bread wheat cv.
Ulla. J Cereal Sci. 24 (2): 115-124.
Kontaktní adresa:
Ing.Jana Bradová,
Výzkumný ústav rostlinné výroby,v.v.i., Praha 6 - Ruzyně
[email protected]
152
„Úroda 12/2011, vědecká příloha―
SROVNÁNÍ VYBRANÝCH UKAZATELŦ EVROPSKÝCH A
ČÍNSKÝCH ODRŦD JARNÍHO JEČMENE
The comparison of selected characteristics of Czech and Chinese spring
barley cultivars
Haberle J., Raimanová I., Svoboda P., Matějková Š.
Výzkumný ústav rostlinné výroby, v.v.i., Praha
Abstrakt: V maloparcelkovém polním pokusu byly porovnány vybrané vývojové, růstové a
fyziologické znaky odrůd jarního ječmene z České republiky a Číny. Pro srovnání byla sledována
jedna zahraniční, dánská odrůda. Odrůdy vykazovaly rozdíly aţ čtrnáct dní v termínu kvetení a
zralosti, výška rostlin byla v rozmezí 0,65 aţ 1,05 m, významné rozdíly vykazovaly odrůdy v
koncentraci makroţivin nebo hmotnosti tisíce zrn (38-54 g). Rozsah hodnot u většiny znaků rostlin
byl větší u čínských odrůd. Podrobně byla sledována dynamika obsahu chlorofylu v listech rostlin
ječmene. Výsledky ukázaly významné rozdíly v obsahu chlorofylu a a b a v rychlosti změn jejich
obsahu v období 30 dní od začátku kvetení mezi evropskými a čínskými odrůdami. Hodnoty získané
nepřímou metodu, chlorofylmetrem, nebyly v průkazné závislosti s výsledky chemické analýzy.
Klíčová slova: chlorofyl, chlorofylmetr, odrůdy, jarní ječmen, Čína
Abstract: Selected growth, developmental and physiological characteristics of Czech and Chinese
spring barely cultivars were compared in two-year field experiment. One foreign, Danish cultivar was
included in the experiment. The terms of flowering and maturity were in the range of fortnight, the
height of plants was between 0,65 and 1,05 m, significant differences were found in the concentration
of nutrient or thousand kernel weight (38-54 g). The dynamics of chlorophyll content in barley leaves
was examined in detail. The results showed significant difference in the content of chlorophyll a and
b and in changes during thirty days after the start of flowering among the both, European and Chinese
cultivars. The values of indirect method, using chlorophyll-meter, were not in significant correlation
with data obtained by chemical analysis.
Key words: chlorophyll, chlorophyll meter, cultivars, spring barley, China
Úvod
Výnos a kvalitativní znaky plodin jsou výsledkem interakce geneticky zaloţených vlastností a
podmínek prostředí. Vliv ročníku, souhrnu aktuálních podmínek prostředí, se často projevuje
silněji neţ variabilita daného znaku mezi variantami a odrůdami. Zvláště výkyvy počasí
zvyšují meziročníkovou variabilitu výnosů a parametrů kvality (Mikulíková a kol. 2009), s
nepříznivými dopady do rentability pěstování. Tyto problémy se můţou s očekávanou
klimatickou změnou ještě prohlubovat. Pro zlepšení produkčních vlastností a zvýšení
tolerance k nepříznivým abiotickým a biotickým faktorům jsou hledány genetické zdroje
pouţitelné pro šlechtění, například mezi starými krajovými odrůdami nebo geograficky
vzdálenými genotypy (Milotová, Vaculová 2010). Důleţitými znaky, které souvisí s tvorbou
výnosu, jsou délka trvání ţivotnosti listů, rychlost stárnutí listů a odbourávání chlorofylu.
Rychlý vývoj je zase strategií úniku před letním suchem a vysokými teplotami. Jednou z cest
pro zlepšení odrůd je hledání donorů specifických vlastností pro šlechtění.
Cílem této práce bylo porovnat v polních podmínkách vybrané fyziologické a produkční
vlastnosti geograficky vzdálených odrůd jarního ječmene.
Materiál a Metody
V maloparcelkovém pokusu bylo v roce 2010 a 2011 sledováno pět českých, jedna dánská a
deset čínských odrůd jarního ječmene (Hordeum vulgare L.) (tab.1). Odrůdy byly získány v
rámci spolupráce s Feed Research Institute v Pekingu. Pokus probíhal na pozemku VÚRV,
153
„Úroda 12/2011, vědecká příloha―
v.v.i., v Praze -Ruzyni (360 m n.m., průměrná teplota a úhrn sráţek (1971-2000): 8,5oC a 477
mm, jílovito-hlinitá půda, hnědozem). Na jaře byl určen obsah Nmin v ornici a podorničí (do
hloubky 0,9 m), obsah P, K, Ca Mg v ornici byl 42 mg, 135 mg, 2600 mg a 116 mg.kg-1 půdy
(Mehlich 3), pHH2O = 7,1.
Pokus byl zaloţen ve třech opakováních, metodou znáhodněných dílců, parcelky měly plochu
12 m2. České odrůdy, spolu s dánskou odrůdou Sebastian, patří mezi dvouřadý ječmen, mezi
čínskými odrůdami jsou dvouřadé i čtyřřadé ječmeny (C1-3, C6). AF Lucius a čínské odrůdy
C1-C3 jsou nahé ječmeny.
Tab. 1 Sledované odrůdy, průměrná HTS a objemová hmotnost zrna (2010).
Evropské
odrůdy
1. Aktiv
2. Bojos
3. Sebastian
4. Advent
5. AF Lucius
6. Heris
Varieta
dvouřadý
dvouřadý
dvouřadý
dvouřadý
dvouřadý
dvouřadý
HTS (g)
43,9
42,2
40,9
43,9
42,0
43,7
Obj.hm.
(g.l-1)
635
646
644
641
699
661
Čínské
odrůdy
C1. Zhu Mai
C2. Su Nong
C3. You Mai
C4. Gan Pi
C5. Meng Pi Mai
C6. Ken Pi Mai
C7.
C8.
C9.
C10.
HTS (g)
46,5
48,3
49,9
49,1
54,2
42,3
43,2
38,5
42,0
40,4
Varieta
víceřadý
víceřadý
víceřadý
dvouřadý
dvouřadý
víceřadý
dvouřadý
dvouřadý
dvouřadý
dvouřadý
Obj.hm.
(g.l-1)
734
729
735
667
667
638
685
675
664
668
V pokusech byla uplatněna běţná agrotechnika, podzimní střední orba s přípravou seťového
lůţka na jaře, předplodinou byl hrách. U všech odrůd jsme pouţili jednotný výsevek 3,7 mil
klíčivých zrna.ha-1, termín setí: 1.4.2010 a 23.3.2011. V roce 2010 bylo aplikováno 40 kg
N.ha-1 v LAV, v roce 2011 nebylo dusíkem hnojeno vzhledem k vysoké zásobě N v půdním
profilu. V průběhu vegetace byly aplikovány chemické přípravky proti chorobám, škůdcům a
plevelům, v roce 2011 byl pouţit přípravek Terpal proti poléhání. Ve fázi kvetení byly z
kaţdé parcelky odebrány rostliny z plochy 2 x 0,25 m2, určena suchá hmota a provedeno
stanovení N, P, K, Ca a Mg. Výška stébel (ke špičce klasu) byla zjišťována ve fází nalévání
zrna. Byla určena HTS, objemová hmotnost zrna a podíl na sítech.
Obr. 1 Výška stébel (ke špičce klasu, bez osin) ve fázi nalévání zrna v roce 2010 a 2011.
1,20
2011
1,00
2010
m
0,80
0,60
0,40
0,20
C
9
C
10
C
8
C
7
on
Yo g
u
M
ai
G
a
M
n
en
Pi
g
Pi
M
Ke
ai
n
Pi
M
ai
M
ai
N
Su
Zh
u
er
is
H
Ak
tiv
Bo
Se jos
ba
st
ia
n
Ad
ve
nt
AF
Lu
ci
us
0,00
Sledování ţivotnosti listů - odrůdové rozdíly v rychlosti stárnutí listů:
Ve třech termínech (začátek kvetení a poté 15. a 30. den) byly odebírány praporcové a
předposlední (druhé nejmladší) listy. Listy byly zváţeny a rozstříhány na malé segmenty.
Naváţené vzorky (0,3 g) byly zamraţeny a uchovávány do zpracování při -20°C. Obsah
chlorofylu ve zmraţených vzorcích (mg.g-1 listu) byl stanoven spektrofotometricky upravenou
154
„Úroda 12/2011, vědecká příloha―
metodou č. 942.04 dle AOAC (1990). Listy rostlin byly také proměřovány přímo v porostu
chlorofylmetrem (Minolta SPAD-502).
Získané údaje byly statisticky hodnoceny analýzou rozptylu, významnost rozdílů mezi
průměrnými hodnotami odrůd byla testována na 5 % hladině průkaznosti metodou LSD.
Výsledky a diskuze
Na základě polního pokusu lze konstatovat, ţe u většiny sledovaných znaků byl rozsah hodnot
širší u souboru čínských odrůd ve srovnání s českými (evropskými) ječmeny, a to i při
porovnání pouze dvouřadých odrůd (tab.1, obr.1). V roce 2010 čínská odrůda C9 dosáhla
zralosti jiţ 14.7., následovaly odrůdy C7 a C10 (19.-22.7.). Odrůdy Aktiv, Sebastian a AF
Lucius a čínské odrůdy C1-C3, C5 a C6 dozrávaly později (28.-30.7.). V roce 2011 rozdíl
mezi nejranější odrůdou, C9 (3.7.) a pozdními odrůdami C1-C3, C6, Sebastian a AF Lucius
činil rovněţ aţ 14 dnů (zralost 14.-18.7). Podobné rozdíly mezi odrůdami se projevily v
termínu metání a kvetení. Výsledky analýzy rostlin ve fázi kvetení ukázaly významně
(p<0,01) vyšší hodnoty koncentrace makroprvků, především Ca (evropské: 0,71% - 0,85%,
čínské: 0,56% - 0,86%), K (evropské: 2,7% - 3,1%, čínské: 2,1 - 3,1%) a P (evropské: 0,38%
- 0,44%, čínské: 0,29 - 0,35%) v sušině nadzemní hmoty evropských odrůd, srovnatelné
hodnoty byly zaznamenány jen u čínských odrůd C6 a C9. Naopak v případě koncentrace N
byly u některých čínských odrůd hodnoty vyšší, rozsah hodnot byl u evropských a čínských
odrůd: 1,79% - 2,00% a 1,65% - 2,15%.
Obsah chlorofylu je základním ukazatelem funkce listů a jeho degradace patří k prvním
viditelným projevům stárnutí listové plochy. U většiny sledovaných odrůd obsah chlorofylu
v praporcovém a druhém nejmladším listu dosahoval v roce 2010 nejvyšší hodnoty 15 dní po
začátku kvetení a poté následoval rychlý rozklad chlorofylu mezi 15. a 30. dnem (obr. 2).
Výjimkou byla čínská odrůda C10, která měla na počátku kvetení výrazně vyšší obsah
chlorofylu neţ ostatní odrůdy a u které byla degradace patrná jiţ 15. den, kdy obsah
chlorofylu klesl o 20 %. Celkový obsah chlorofylu a+b se u souboru evropských odrůd
v době začátku kvetení významněji nelišil a v průměru dosahoval 1,83 mg Chla+b.g-1listu.
V porovnání s tím v kolekci čínských odrůd dosahovaly odrůdy C1, C2, C3 a C5 výrazně
niţších hodnot jen kolem 1,50 mg Chla+b.g-1listu. Naproti tomu odrůdy C7, C8 a zvláště pak
C10 dosahovaly výrazně vyšších hodnot nad 2,00 mg Chla+b.g-1listu. Největší nárůst 15 dní po
začátku kvetení byl pozorován u odrůdy Sebastian (33 %) a čínských odrůd C1 a C5 (31 a 45
%). Rozdíly mezi odrůdami se projevily i v hodnotě poměru chlorofylu a a b.
Obr. 2 Obsah chlorofylu v listech odrůd jarního ječmene (průměr ±SD; P=0,05). Ruzyně
2010.
Kvetení
15.den
30.den
3,0
g
def
defg
h
h
bcd
def
i
cdef
def
gh
fgh
defg
a
def
cd
ab
ab
a
abc
efg
bc
cd
b
cde
ab
a
1,0
de
abcd
abc
abc
ef
f
abcd
bcd
ab
abc
abc
cde
abc
abc
ab
a
České
Evropské
Čínská
155
C10
C9
C8
C7
C6
C5
C4
C3
C2
C1
Heris
AF Lucius
Advent
Sebastian
Bojos
0,0
Aktiv
mg Cha+b.g-1listu
cd
cd
2,0
g
fg
efg
„Úroda 12/2011, vědecká příloha―
Hodnoty obsahu chlorofylu v listech ve fázi kvetení byly významně vyšší v roce 2011 ve
srovnání s hodnotami v roce 2010 (obr.3), zřejmě v důsledku vysoké zásoby N v půdě a
příznivějších povětrnostních podmínek.
Obr.3 Porovnání obsah chlorofylu v listech odrůd jarního ječmene na počátku kvetení v roce
2010 a 2011 (průměr ±SD; P=0,05).
2010
2011
2,5
2,0
1,5
1,0
0,5
Evropské
C10
C9
C8
C7
C6
C5
C4
C3
C2
C1
Heris
AF Lucius
Advent
Sebastian
Bojos
0,0
Aktiv
mg Cha+b.g-1 listu
3,0
Čínské
Hodnoty získané metodou nepřímého určení obsahu chlorofylu přístrojem SPAD-502 nebyly
v průkazné závislosti s údaji zjištěnými chemickou analýzou (r = +0,27 a +0,28), na rozdíl od
našich dřívějších výsledků u pšenice, řepky a ovsa, kde však byly proměřovány listy určené
pro následnou chemickou analýzu, u stejné odrůdy, na jednom pozemku (Haberle a kol.
2007). Důvodem můţe být kromě variability v porostu také odlišná velikost nebo morfologie
praporcového listu u odrůd ječmene nebo odrůdově specifická alokace dusíku v rostlině.
Závěr
Výsledky dvouletého polního pokusu prokázaly významné rozdíly mezi odrůdami evropské,
převáţně české, a čínské provenience v některých znacích, větší rozsah hodnot sledovaných
znaků byl zaznamenán především v rychlosti vývoje a morfologii rostlin, obsahu a dynamice
chlorofylu v listech, koncentraci prvků v nadzemní hmotě a HTS.
Dedikace: Příspěvek byl připraven s podporou projektu MŠMT-KONTAKT ME09078 a VZ
VÚRV MZE0002700604.
Pouţitá literatura
AOAC (1990): Official methods of analysis: Chlorophyll in plants. Spectrophotometric
method for total chlorophyll and a and b components. 62 - 63.
Haberle J., M. Trčková, I. Raimanová and Š. Matějková (2007): The relation among
chlorophyll meter data and chlorophyll, N and Mg concentrations in leaves of cereals and
oilseed rape. In. 6th European Conference on Precision Agriculture. Proceedings, Řecko,
2.-6.6.2007, 6 s. (CD)
Mikulíková D., Masár Š., Horváthová V., Kraic J. (2009): Stability of quality traits in winter
wheat cultivars. Czech J. Food Sci. 27, 403-417
Milotová J., Vaculová K. (2010): Hodnocení nových přírůstků kolekce genetických zdrojů
ječmene jarního. Obilnářské listy 18 (4), 113-117.
Kontaktní adresa:
Ing. Jan Haberle, CSc., Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, 161 06 Praha
6 - Ruzyně, [email protected]
156
„Úroda 12/2011, vědecká příloha―
REZISTENCE OZIMÉHO TRITIKALE KE RZI PŠENIČNÉ
(Puccinia triticina)
Resistance of winter triticale to wheat leaf rust (Puccinia triticina)
Hanzalová A., Bartoš P.
Výzkumný ústav rostlinné výroby, v.v.i., Praha
Abstrakt
Ve skleníkových pokusech byly zjišťovány reakce odrůd tritikale k izolátům rzi pšeničné získaných
z různých lokalit ČR a různých časových období. Do první části pokusu bylo zařazeno 20 odrůd
tritikale a pouţito 8 izolátů rzi pšeničné. Byly vytvořeny čtyři skupiny odrůd s odlišnými reakcemi. Ve
druhém pokusu bylo pouţito šest starších izolátů rzi pšeničné na zjištění reakcí patnácti odrůd tritikale.
Většina z 15ti testovaných kultivarů byla rezistentní ke všem pouţitým izolátům. Z testovaných odrůd
registrovaných v ČR byla zjištěna rezistence k většině pouţitých izolátů u odrůd Hortenso a Cando.
Z dalších zkoušených odrůd byla ke všem pouţitým izolátům rezistentní odrůda Tatra. Byly testovány
náhodně vybrané izoláty z pšenice a z tritikale na odrůdách tritikale a na téměř izogenních liniích
pšenice odr. Thatcher s různými Lr geny. V průměru byly izoláty rzi pšeničné z tritikale virulentní
k většímu počtu odrůd tritikale neţ izoláty získané z pšenice.
Klíčová slova: tritikale; Puccinia triticina; rez pšeničná; odrůdová odolnost
Abstract
Reactions of triticale cultivars to leaf rust isolates from different localities and time periods were tested
in the greenhouse. Four groups of cultivars differing in reactions pattern were formed in the first trial
comprising 20 cultivars and tested with 8 leaf rust isolates. In the second trial with 6 leaf rust isolates
originating from the last century the majority of 15 tested cultivars was resistant to all isolates. Of the
tested cultivars registered in the Czech Republic resistance to the majority of isolates in the first trial
was revealed in cvs Hortenso and Cando. Out of other tested cultivars Tatra was resistant to all applied
isolates. Isolates from wheat and triticale were tested on triticale cultivars and on Thatcher near
isogenic lines with different Lr genes. On the average isolates of leaf rust from triticale were virulent
to a higher number of triticale cultivars than isolates collected from wheat and vice versa.
Key words: triticale; Puccinia triticina; wheat leaf rust; variety resistance
Úvod
Tritikale (x triticosecale Wittmack) je obilnina adaptovaná na nepříznivé vnější podmínky,
vyznačuje se vyšší odolností k biotickým i abiotickým stresům neţ pšenice a zároveň
poskytuje stabilnější výkon neţ ţito. Je důleţitou krmnou plodinou, rovněţ je vhodné pro
produkci lihu, zvýšená aktivita amylolytických a proteolytických enzymů umoţňuje sníţení
spotřeby enzymových preparátů při průmyslovém zpracování tritikale na líh. Je vhodné i pro
získávání energetické biomasy. Tritikale je ekonomicky zajímavé především pro oblasti
s horšími pěstebními podmínkami, pro oblasti trpícími přísuškem a systémy hospodaření
s niţšími vstupy. U tritikale, jako kříţence mezi ţitem a pšenicí, můţe být odolnost k
chorobám odvozena od ţita i od pšenice. Zpravidla však tritikale trpí chorobami pšenice a
rezistence bývá odvozena od pšenice. Tritikale v ČR napadá rez pšeničná, ale nenapadá jej rez
ţitná (Stuchlíková, Bartoš 1979, 1980). Jde však o starší údaj, který je nutno ověřit, poněvadţ
v populaci patogenů probíhají četné změny virulence. Rovněţ údaje o genech rezistence ke
rzím, které byly získány genetickým studiem u nás (Stuchlíková, Bartoš 1980) jsou jiţ
zastaralé, neboť se výrazně změnila odrůdová struktura registrovaných odrůd tritikale.
Materiál a metody
Byly zaloţeny 2 skleníkové pokusy, do prvního bylo zařazeno 20 odrůd ozimého tritikale.
Odrůdy byly zkoušeny osmi izoláty rzi pšeničné, získanými v roce 2008. Ve druhém pokusu
157
„Úroda 12/2011, vědecká příloha―
bylo zkoušeno 15 odrůd tritikale šesti izoláty rzi pšeničné získanými z různých lokalit a let z
ČR, izoláty jsou popsány v práci Hanzalová (2010). Byly pouţity izoláty vhodné pro
diferenciaci genů rezistence v odrůdách pšenice. Vzorky rzi pšeničné byly získány z listů
odrůd tritikale a pšenice, především z odrůdových pokusů ÚKZÚZ z České republiky a
ÚKSÚP ze Slovenska. Vzorky rzi pšeničné z listů pšenice pocházejí z 14 lokalit, vzorky rzi z
tritikale z 12 lokalit (Tab. 1), z 5 uvedených lokalit byly získány vzorky z obou obilnin. Z
kaţdé lokality byly analyzovány v průměru 2-3 vzorky. Izoláty rzi byly rozmnoţeny na
náchylné odrůdě Michigan Amber (pšenice) nebo Kargo (tritikale). Po objevení skvrn na
infikovaných listech, byly odebrány listové segmenty se vznikajícím jednotlivým urediniem,
přeneseny do Petriho misek s vodou a umístěny ve skleníku neţ se objevily urediospory, takto
získané monopustulové izoláty byly dále mnoţeny. Inokulace klíčních rostlin byla provedena
vodní suspenzí urediospor, inokulované klíční rostliny byly umístěny do uzavřených
skleněných válců po dobu 24 hodin pro zajištění vysoké vzdušné vlhkosti. Infekční typy byly
hodnoceny dle stupnice Stakman et al. (1962) 10-14 po inokulaci, rostliny byly umístěny ve
skleníku při teplotách 18-22°C. Avirulence/rezistence byla charakterizována infekčním typem
; 0-2, virulence/náchylnost infekčním typem 2-3 a 3. V pokusu byly pouţity Thatcher téměř
izogenní linie (NILs) s jednotlivými geny rezistence (Lr) dle Mesterházy et al. 2000. Osivo
registrovaných odrůd bylo získáno z ÚKZÚZ a firmy Selgen, a.s., ŠS Úhřetice.
Výsledky a diskuse
Výsledky testů rezistence odrůd tritikale ke rzi pšeničné 8 rasami z ČR (6 vzorků) a ze
Slovenska (2 vzorky) jsou shrnuty v tabulce 1. Výsledky ukazují významné rozdíly v reakcích
odrůd k uţitým izolátům v jedné části pokusů a stejně tak významné rozdíly virulence izolátů
v další části pokusů. Odrůdy tritikale byly rozděleny do 4 skupin s podobnými reakcemi ke rzi
pšeničné. Charakter reakce 9 odrůd byl odlišný, to ukazuje pravděpodobně na sloţitý
genetický základ rezistence ke rzi pšeničné.
Tři z pouţitých izolátů rzi byly virulentní ke všem zkoušeným odrůdám tritikale, další izoláty
byly převáţně avirulentní. Údaje o závaţnosti rzi pšeničné v odrůdových pokusech ÚKZÚZ
ukazují relativně vysoký stupeň rezistence odrůd tritikale v polních podmínkách s výjimkou
odrůd Kitaro, Gutek a Inpetto. Tyto odrůdy byly náchylné v klíční fázi k 4-5 izolátům z 8
pouţitých. Nicméně rovněţ odrůdy, které měly pouze nízké napadení v polních podmínkách,
byly náchylné v klíční fázi, například odr. Triamant. Z odrůd, které nebyly zkoušeny
v odrůdových pokusech ÚKZÚZ, byla odrůda Tatra rezistentní ke všem pouţitým izolátům,
následovaly odrůdy Kinerit, Benetto a Dinaro s rezistencí k 5-6 izolátům.
V dalším pokusu na rezistenci za pouţití starších ras rzi pšeničné bylo zařazeno 11 odrůd
tritikale, které byly zařazeny rovněţ v předchozím pokusu Tab. 1. Starší izoláty rzi pšeničné
měly uţší spektrum virulence neţ nově získané izoláty. Náchylná reakce ke všem nebo
většině izolátů u odrůd Triamant, Lupus a Gutek v druhém testu je ve shodě s výsledky
prvního testu. Všechny 3 odrůdy v těchto pokusech byly náchylné k většině uţitých izolátů.
Do druhého testu byly dodatečně zařazeny náchylné odrůdy Marko a Tornádo. Údaje o
rezistenci v klíční fázi měly jen omezenou hodnotu pro hodnocení polní rezistence, jak
ukazuje srovnání výsledků testů na klíčních rostlinách s napadením v polních podmínkách.
Ukazovaly spíše rozdílnost genetického základu rezistence testovaných odrůd. V pokusu
(Tab. 2, 3), byly zařazeny vzorky rzi pocházející z tritikale i z pšenice ze stejné lokality. Ty
byly testovány na téměř izogenních liniích s různými geny rezistence (Lr) a na 7 odrůdách
tritikale. Vzorky ze stejné lokality z pšenice a z tritikale se lišily v reakcích na téměř
izogenních liniích stejně jako na testovaných odrůdách tritikale. Z výsledků však nelze
vyvodit závěry o moţné korelaci mezi virulencí/avirulencí rzi pšeničné k izogenním liniím a
virulencí/avirulencí testovaných odrůd tritikale. Přesto však izoláty odebrané z pšenice byly
158
„Úroda 12/2011, vědecká příloha―
ve větším počtu virulentní na izogenních liniích pšenice neţ z tritikale. Naopak izoláty
z tritikale byly virulentní k většímu počtu testovaných odrůd tritikale neţ izoláty z pšenice.
V průměru byly vzorky z tritikale méně virulentní k testovaným liniím (NILs) neţ vzorky
získané z pšenice. Průměrně vyšší počet izolátů z tritikale neţ izolátů z pšenice byl virulentní
na tritikale. Vyšší počet izolátů z pšenice neţ z tritikale bylo virulentní jen na odrůdách Gutek
a Lupus. Ţádný z 36 izolátů z pšenice nebyl virulentní na odrůdách Talentro, Agrano a Kitaro,
pouze jeden byl virulentní na odrůdách Modus a Inpetto.
Závěr
Třebaţe počet náhodně vybraných a testovaných vzorků byl příliš nízký k poskytnutí
obecných závěrů, získané výsledky naznačují vyšší afinitu izolátů rzi pšeničné z tritikale
k tritikale neţ k pšenici. Podobně izoláty z pšenice vykazují vyšší afinitu k pšenici (NILs) neţ
k tritikale. Ačkoli nebyla provedena genetická analýza rezistence tritikale, rozdíly
v charakteru reakcí odrůd tritikale zjištěné v testech rezistence ukázaly, ţe testované odrůdy
mají různé geny rezistence ke rzi pšeničné. V odrůdovém pokusu na rezistenci (Tab.1) byly
shrnuty 4 skupiny reakcí, kromě toho byly nalezeny různé kombinace rezistence a náchylnosti
odrůd tritikale k uţitým rasám rzi pšeničné.
Tab 1: Reakce odrůd tritikale k 8 izolátům rzi pšeničné
lokalitat/infekční typ**
Chrlice Chrlice
Vel.
Ruzyně Lípa 1
2
Beluša Oldříškovice Radošiná Ripňany
Polní hodnocení
Odrůda
*
A
B
C
D
E
F
G
H
Kinerit
-, -, -, 3
3
;1
1;
;
;
;1
;2
Benetto
-, -, -, 3
3
;1
1;
;
;
;1
;1
Dinaro
-, -, -, 3
3
3
;2
0
;2
;1
;1
Ticino
8, 8, -, 7
3
3
3
3
;
;1
;
;2
Pawo
-, 7, 7, 3
3
3
3
;2
;1
;
;
Kitaro
4, 5, -, 3
3
3
;
3
;2
;1
;1
Mungis
-, 8, 8, 8
3
3
3
0
3
;1
;2
;
Todan
-, 7, 7, 3
3
3
;1
3
;2
;N
;1
Tricolor
7, -, -, 2-3
3
;2N
;
;2
;2
;2
;2
Hortenso
-, 7, 7, 7
3
3
;2N
;2
;1
;2
;2
Cando
-, 7, 7, 3
3
;
;
;1
;1
;1
SW
Talentro
6, 6.5, 6, 6
0
3
3
3
0
;2
;1
;
Triamant
7, 8, 8, 3
3
3
;2
3
3
3
3
Lupus
6, 7, 7, 3
3
3
;
;2
3
;2
3
Inpetto
6, 6, 6, 5
3
3
3
;1
;2
;2
;2
3
Gutek
5, 5, -, 3
3
3
3
3
;
;1
;2
Modus
-, -, -, 3
3
3
;
3
3
;
;2
Kolor
-, -, -, 3
3
3
;
;2
3
;2
;2
Nazareth
-, -, -, 2-3
3
3
;2N
3
;2
;1
;2
Tatra
-, -, -, ;2
;2N ;2N
;
;1
;1
;
;1
* Napadení rzí pšeničnou v odrůdách testovaných ÚKZÚZ (2007, 2008, 2009, 2010, dle pořadí),
stupnice: 9-rezistentní, 1-náchylná; - nehodnoceno
** Infekční typy ;, ;1, 2 - rezistentní, 2-3, 3 - náchylný, N - nekrózy
159
„Úroda 12/2011, vědecká příloha―
Tab. 2 Reakce izolátů rzi pšeničné z tritikale (tr) a pšenice (w) na téměř izogenních liniích
Lokalita
Odrůda
Téměř izogenní linie Thatcher s Lr genem
1
2a 2b 2c 3a 9 11 15 17 19 21 23 24 26 28
Chrastava
Lupus
tr 0; ;2
3
;2 ;1 0; 3
;2 ;2N ;
3
;2 ;1N 3
0;
Aranka w 3
3
3
3
3 ; 3
3
3
;
3
3
;
3
;2
Lípa
Hortenso tr 0
;2 ;2
2
;1 0 3
;2 ;2
0
3
;2 ;1N 3
0;
LP 53304 w 3
0; ;1
;
3 ; 3
3
3
;
3 ;2-3 ;1
3
3
Pusté
Jakartice
Inpetto
tr 0; ;2N 3
3 ;1-2 0; 3
3
3
0; 2-3 3
;
3
0
Barryton w 3
0 0(3) ;2 0; 3 3
;2
3
;
3
3
;2 2-3 3
Chrlice
Inpetto
tr 0; ;2
3
2
;2 0 3 ;2N 1-2 0;
3
;2 ;1
2
0;
Samanta w
;
3
3
3
3 0; 3
3
3
;
3
3
;2
3 1
Tab. 3 Reakce odrůd tritikale k izolátům rzi pšeničné z tritikale (tr) a pšenice (w)
Lokalita
Odrůda
Gutek Talentro Agrano Lupus Modus Inpetto Kitaro
Chrastava
tr
3
3
3
0;
0;
3
3
w
3
;1N
;1
3
;2
;2
;1
Lípa
tr
3
3
3
3
3
3
3
w
3
0;
;1
3
;1
;1
;1
Pusté Jakartice tr
3
3
3
0;
;1-2
3
3
w
3
3
;1
;2N
3
;1
;2
Chrlice
tr
3
3
3
0
3
3
0;
w
3
3
;2
;3N
3
;2
;1
Dedikace
Publikace vznikla za podpory Výzkumného záměru MZE 000270064.
Pouţitá literatura
Hanzalová A. (2010): Physiologic specialization of wheat leaf rust (Puccinia triticina Eriks.)
in the Czech Republic in 2005–2008. Cereal Research Communications, 38: 366–374.
Mesterházy A., Bartoš P., Goyeau H., Niks R., Csösz M., Andersen O., Casulli F., Ittu M.,
Jones E., Manisterski J., Manninger K., Pasquini M., Rubiales D., Schachermayr G.,
Strzembicka A., Szunics L., Todorova M., Unger O., Vančo B., Vida G., Walther U.
(2000): European virulence survey for leaf rust in wheat. Agronomie, 20: 793–804.
Stakman E.C., Stewart P.M. & Loegering W.O. 1962. Identification of physiologic races of
Puccinia graminis var. tritici. Agricultural Research Service E617. (United States
Department of Agriculture: Washington DC.).
Stuchlíková, E., Bartoš, P. (1980): Genetická analýza rezistence ke rzi pšeničné u tritikale.
Genet. a Šlecht., 16: 171-180.
Stuchlíková, E., Bartoš, P. (1979): Odolnost triticale k Puccinia graminis Pers. f. sp. tritici
Erikss. et Henn. Genet. a Šlecht., 15: 139-144.
Kontaktní adresa:
Mgr. Alena Hanzalová PhD., Výzkumný ústav rostlinné výroby, v.v.i, Drnovská 507, 161 06
Praha-Ruzyně, Česká republika., e-mail: [email protected]
160
„Úroda 12/2011, vědecká příloha―
DIVERSITA ČESKÝCH A SLOVENSKÝCH ODRŦD PŠENICE SETÉ
Diversity of Czech and Slovak common wheat varieties
Hermuth J., Janovská D., Dvořáček V., Prohasková A., Stehno Z.
Výzkumný ústav rostlinné výroby, v.v.i., Praha
Abstrakt – V rámci česko-slovenské spolupráce byl na lokalitě v Ruzyni hodnocen soubor 332 odrůd
pšenic seté a to jak ozimé, tak jarní formy původem z České i Slovenské republiky. Mezi vybranými
materiály byly autochtonní krajové odrůdy, restringované a registrované odrůdy, i významné genetické
kmeny a linie. Výsledky pokusu potvrzují, ţe staré šlechtěné nebo krajové odrůdy mohou být cenným
výchozím materiálem i pro současné šlechtění, především z pohledu obsahu hrubých bílkovin a to jak
u ozimé, tak u jarní formy pšenice (1%, resp. 2,5%). Naopak moderní materiály byly ranější, u ozimů
o 1,3 a u jařin o 4,5 dne. Také byly produktivnější ve výnosu zrna i HTZ. Porosty moderních odrůd
byly u ozimů niţší o 25 cm a u jarních forem o 32 cm.
Klíčová slova: pšenice setá, moderní odrůdy, krajové odrůdy
Abstract – In the frame of Czech-Slovak cooperation project, there were evaluated field trials with
332 common wheat varieties. All materials were originated in the Czech or Slovak Republic. The
samples were modern varieties, landraces or important genetic lines. From the results is clear, that old
varieties and landraces could be a good source of important traits also for modern wheat improvement
mainly due to crude protein content of winter and spring common wheat varieties (1%, resp. 2.5%).
On the other hand modern varieties were earlier in the case of winter varieties about 1.3 days and in
spring varieties 4.5 days; also they were more productive in grain yield and weight of thousand seeds.
Height of plants of modern varieties was in the case of winter form lower about 25 cm and in the case
of spring form about 32 cm.
Key words: common wheat, modern registered variety, landraces
Úvod
Pšenice je jedna z nejdéle pěstovaných a nejrozšířenějších plodin. Několik tisíciletí
přirozených i plánovaných výběrů vedlo k její široké genetické diversitě, která je klíčová pro
současnou i budoucí lidskou populaci (Melnikova et al., 2010). Šlechtění moderních odrůd
vedlo ale k zúţení genetické diversity. To nesouvisí s počty odrůd nabízených pěstitelům (ten
je naopak stále vyšší a zrychluje se i obměna odrůd), ale se zuţováním genetického základu
moderních odrůd - tedy zmenšování genetických rozdílů mezi nimi. Šlechtění přineslo
zásadní pokrok při zvyšování výnosů zemědělských plodin a v současné době je rozhodujícím
faktorem růstu produkce a kvality zemědělských komodit. Např. u pšenice uvádí Mac Key
(1993) zvýšení výnosů inovací odrůd od počátku minulého století do devadesátých let o 49%.
Cílem práce bylo zhodnotit a porovnat vybraný soubor českých a slovenských odrůd pšenice
seté, nových i starých, vybrané morfologické a fenologické vlastnosti a u zrna vyhodnotit
jakostní ukazatele.
Materiál a Metody
V rámci česko – slovenské spolupráce bylo vybráno celkem 332 materiálů pšenice seté a to
jak v jarní formě (62 odrůd), tak v ozimé (270 odrůd) původem z České i Slovenské
republiky. Mezi vybranými materiály byly autochtonní krajové odrůdy, restringované a
registrované odrůdy, i významné genetické kmeny a linie. Polní experiment byl zaloţen na
pozemcích Výzkumného ústavu rostlinné výroby, v.v.i. v Praze – Ruzyni. Ozimé formy byly
vysety 5. října 2009 a jarní 26. března 2010 bezezbytkovým secím strojem. Sklizňová plocha
parcel byla 2m2 a hustota výsevku byla zvolena tak, aby konečný počet byl 400 klíčivých zrn
na m2. Předplodinou byl hrách polní. Během vegetace byly prováděny standardní aplikace
herbicidů a insekticidů. V průběhu vegetace byly také hodnoceny vybrané morfologické a
161
„Úroda 12/2011, vědecká příloha―
fenologické parametry, včetně poléhání a výskytu padlí. U ozimů bylo hodnoceno i
přezimování. Po sklizni byly provedeny rozbory klasů podle klasifikátoru pro rod Triticum L.
(Bareš et al., 1985). Hodnocení technologické kvality vycházelo z ČSN ISO 5529.
Výsledky a diskuze
Pro hodnocení byl soubor 270 odrůd ozimé formy pšenice seté rozdělen na podsoubory (Tab.
1) podle původu na původní československé odrůdy (CSK), na české odrůdy (CZE) a na
slovenské (SVK) a pak na původní materiály a na moderní odrůdy podle data registrace.
Podle členění na původní československé odrůdy a na české a slovenské se ukázalo, ţe je
patrný posun moderních odrůd (CZE, SVK) od původních registrovaných (CSK).
Nejvýraznější byl posun ve výšce porostu. Původní československé odrůdy byly v průměru o
20 cm vyšší neţ české a dokonce o 25 cm vyšší neţ slovenské moderní odrůdy. Také se
zvýšila hmotnost zrna z klasu a také HTZ. Na druhou stranu se sníţil obsah hrubých bílkovin
v sušině. U československých odrůd byl nalezen vyšší obsah bílkovin o více neţ 1%.
U souboru členěného na moderní a původní odrůdy byl rozdíl ještě výraznější. Původní
odrůdy dozrávaly v průměru o 1,3 dne později neţ moderní materiály. Výška porostu
moderních odrůd byla v průměru o 25 cm niţší. Ačkoli byl klas u moderních odrůd kratší,
výnos zrna i HTZ byla v průměru vyšší neţ u původních odrůd. Také byl zjištěn vyšší počet
zrn v klasu a to o 4,7 zrn. Výrazný byl i rozdíl v obsahu hrubých bílkovin v sušině. U
původních odrůd byl zjištěn obsah o 1,54% vyšší neţ u moderních odrůd.
Soubor jarních forem pšenice seté (Tab. 2) byl rozdělen pouze na staré a nové materiály.
Soubor starých materiálů dozrával v porovnání s novými o 4,5 dne později. Porost byl o 32
cm vyšší. U novějších materiálů byl v průměru naměřen kratší klas, ačkoliv měl v průměru
více klásků, vyšší počet zrn na klas i klásek. Počet zrn na klas byl u novějších materiálů o 9
vyšší neţ v případě starších materiálů. HTZ byla ale vyšší u starších materiálů (o 0,7 g).
Velmi výrazný byl rozdíl v obsahu bílkovin. U starších materiálů byla stanovena hodnota
obsahu bílkovin v sušině o 2,5% vyšší neţ u novějších materiálů. Rozdíl v celkovém obsahu
škrobu byl 2% ve prospěch novějších odrůd.
162
„Úroda 12/2011, vědecká příloha―
Tab. 1 Souhrnná tabulka hodnocení u ozimé formy pšenice seté
Počet dní od 1.1. do
metání kvetení
plné
zralosti
CSK
CZE
SVK
staré
materiály
nové
materiály
Prŧměr
159,13
162,26
205,82
Počet
dnů od
kvetení
do plné
zralosti
43,56
Výška
porostu
(cm)
Délka
klasu
(cm)
Počet
klásků
na klas
Hmotnost
zrna z 1
klasu (g)
Počet
zrn na
1 klas
Počet
zrn na
1
klásek
HTZ
(g)
HI
Hrubé
bílkoviny
v suš.
(%)
Zeleny
test
(ml)
Celkový
obsah
škrobu
(%)
Relativní
tvrdost
zrna PSI
(%)
123,81
9,37
18,45
1,51
36,64
1,98
40,96
0,40
15,90
34,03
61,39
SM.ODCH
2,89
2,47
2,07
1,56
12,79
1,28
1,82
0,35
6,59
0,32
4,89
0,05
1,00
9,86
1,17
18,84
2,21
Vk (%)
1,81
1,53
1,01
3,59
10,33
13,70
9,87
23,19
17,98
16,10
11,95
12,16
6,29
28,98
1,91
11,71
Median
159,50
162,00
205,50
44,00
125,00
9,30
18,50
1,47
35,75
1,94
41,30
0,39
15,99
33,00
61,28
18,90
Prŧměr
157,00
160,36
204,12
43,76
104,00
9,76
18,64
1,83
41,03
2,20
44,72
0,48
14,55
40,64
62,91
17,98
SM.ODCH
1,83
1,16
0,65
0,99
6,16
1,30
1,79
0,30
5,94
0,28
4,10
0,03
0,61
10,73
0,61
2,83
Vk (%)
1,17
0,72
0,32
2,26
5,93
13,32
9,58
16,30
14,48
12,66
9,17
5,60
4,20
26,41
0,97
15,72
Median
157,00
161,00
204,00
44,00
105,00
9,80
18,00
1,84
41,50
2,17
43,77
0,48
14,53
41,00
62,92
17,83
19,95
Prŧměr
156,28
159,88
204,68
44,80
99,00
9,04
18,64
1,83
41,61
2,23
43,72
0,49
14,68
36,16
62,83
SM.ODCH
2,31
1,53
0,88
1,33
6,32
0,90
1,47
0,39
6,81
0,35
4,27
0,03
0,55
7,88
0,74
2,16
Vk (%)
1,48
0,96
0,43
2,96
6,39
9,99
7,87
21,52
16,36
15,86
9,77
6,94
3,77
21,79
1,18
10,84
Median
156,00
159,00
205,00
45,00
100,00
9,10
18,00
1,81
41,20
2,26
44,47
0,50
14,72
34,00
62,89
20,05
Prŧměr
158,77
161,96
205,62
43,66
125,62
9,56
18,40
1,54
36,94
2,01
41,43
0,40
16,08
35,70
61,22
18,86
SM.ODCH
2,92
2,47
2,04
1,55
13,12
1,36
1,78
0,36
6,59
0,32
4,84
0,05
1,06
10,97
1,22
2,12
Vk (%)
1,84
1,52
0,99
3,56
10,44
14,25
9,69
23,32
17,84
16,11
11,68
11,76
6,57
30,73
2,00
11,26
Median
159,00
161,00
205,00
44,00
125,00
9,50
18,00
1,51
36,00
1,96
41,69
0,39
16,21
33,00
61,18
18,94
19,05
Prŧměr
155,68
159,65
204,29
44,65
100,29
9,23
18,59
1,83
41,65
2,24
43,89
0,49
14,54
36,18
62,92
SM.ODCH
2,76
1,62
0,96
1,45
7,42
1,14
1,57
0,34
6,53
0,33
4,41
0,03
0,60
9,32
0,76
2,61
Vk (%)
1,77
1,01
0,47
3,25
7,40
12,39
8,47
18,45
15,69
14,83
10,05
6,23
4,10
25,77
1,21
13,72
Median
156,00
159,00
204,00
45,00
100,00
9,10
19,00
1,82
41,28
2,20
43,90
0,50
14,54
34,00
62,93
19,00
Tab. 2 Souhrnné hodnocení u jarní formy pšenice ozimé.
Počet dní od vzcházení do
metání kvetení
plné
zralosti
staré
materiály
nové
materiály
Prŧměr
SM.ODCH
Vk (%)
Median
Prŧměr
SM.ODCH
Vk (%)
Median
88,04
4,31
4,90
88,00
80,15
1,10
1,37
80,00
92,04
4,31
4,69
92,00
84,15
1,10
1,31
84,00
128,47
1,44
1,12
129,00
124,08
0,83
0,67
124,00
Počet
dnů od
kvetení
do
plné
zralosti
36,43
3,65
10,03
37,00
39,92
1,21
3,02
40,00
Výška
porostu
(cm)
Délka
klasu
(cm)
Počet
klásků
na
klas
Hmotnost
zrna z 1
klasu (g)
Počet
zrn na
1 klas
Počet
zrn na
1
klásek
HTZ
(g)
HI
126,63
9,76
7,71
125,00
94,23
8,74
9,27
90,00
8,82
1,09
12,33
8,70
8,52
0,47
5,54
8,70
16,27
1,50
9,19
16,00
17,08
1,07
6,27
17,00
1,02
0,21
20,68
1,01
1,28
0,20
15,73
1,34
30,83
5,06
16,40
31,55
39,55
5,16
13,06
40,15
1,90
0,30
15,71
1,92
2,32
0,30
13,06
2,36
33,19
4,31
12,98
32,50
32,49
3,94
12,12
32,79
0,39
0,04
10,22
0,39
0,45
0,02
5,37
0,45
163
Hrubé
bílkoviny
v suš.
(%)
Zeleny
test
(ml)
Celkový
obsah
škrobu
(%)
Relativní
tvrdost
zrna PSI
(%)
16,20
0,98
6,06
16,23
13,70
0,45
3,29
13,82
42,84
11,83
27,61
43,00
44,31
9,96
22,47
43,00
60,72
1,04
1,71
60,63
62,71
0,55
0,87
62,49
19,13
2,04
10,67
19,35
17,16
2,37
13,80
17,21
„Úroda 12/2011, vědecká příloha―
Závěr
Tato práce přináší výsledky předběţného hodnocení vybraných CZE-SVK odrůd pšenice seté.
Cílem práce je porovnat původní odrůdy, charakterizovat hlavní rozdíly oproti současným
výkonným odrůdám CZE a SVK provenience a předběţně zhodnotit potenciální
šlechtitelskou hodnotu těchto materiálů. Tímto chceme rovněţ přispět k doplnění poznatků o
historických odrůdách a v neposlední řadě i k praktické činnosti České genové banky ve
VÚRV Praha-Ruzyně.
Dedikace
Výsledky byly získány v průběhu řešení projektu MEB0810157 a MZE0002700604.
Pouţitá literatura
Bareš I., Sehnalová J., Vlasák M., Vlach M., Kryštof Z., Amler P., Malý J., Beránek V. 1985.
Klasifikátor genus Triticum L. Výzkumný ústav rostlinné výroby Praha – Ruzyně. Genové
zdroje 21, pp 78
Mac Key, J., 1993: Demonstration of genetic gain from Swedish cereal breeding. Sveriges
Utsadesforenings Tidskrift, 103, 1, p. 33 - 43.
Melnikova N. V., Ganeva G. D., Popova Z. G., Landjeva S. P., Kudryavtsev A. M. 2010.
Gliadins of Bulgarian durum wheat (Triticum durum Desf.) landraces: genetic diversity and
geographical distribution.Genet Resour Crop Evol. 57:587–595
ČSN EN ISO 5529 (461022): Pšenice - Stanovení sedimentačního indexu - Zelenyho test.
Český normalizační institut, 2000. počet stran 16.
Kontaktní adresa:
Ing. Jiří Hermuth
Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507,
161 06 Praha 6- Ruzyně
[email protected]
164
„Úroda 12/2011, vědecká příloha―
MOLEKULÁRNÍ IDENTIFIKACE KRYPTICKÝCH DRUHŦ:
JEDNODUCHÝ ZPŦSOB ODLIŠENÍ PROBLEMATICKÝCH DRUHŦ
ČMELÁKŦ
Molecular identification of cryptic species: a simple diagnostic tool for
discriminating between problematic bumblebee species
Cholastová T.1, 2, Bučánková A.2
1
2
Zemědělský výzkum, spol. s r.o. Troubsko
Výzkumný ústav pícninářský, spol. s r.o. Troubsko
Abstrakt
Rozlišování kryptických druhů je velmi častým problémem entomologů – taxonomů. Bombus
cryptarum a Bombus terrestris se řadí do skupiny kryptických druhů, které jsou morfologicky téměř
neodlišitelné. Přesná identifikace B. cryptarum a B. terrestris je potřebná pro řadu ekologických studií.
V tomto příspěvku je představen rychlý a spolehlivý nástroj pro identifikaci problematických druhů
čmeláků na základě restrikčního štěpení cytochrom oxidázové podjednotky I (COI) mitochondriální
DNA.
Klíčová slova: Bombus cryptarum, Bombus terrestris, mtDNA, restrikční enzym
Abstract
Distinguishing between cryptic species is a perennial problem for entomologists – taxonomists.
Bombus cryptarum and Bombus terrestris are two species of bumblebee, which can be
indistinguishable from their morphology. Acurate identification of B. cryptarum and B. terrestris is
needed for ecological studies. We present a diagnostic tool for quick and reliable identification of
problematic of bumblebee individuals based on a restriction enzyme digest of cytochrome oxidase
subunit I (COI) of mitochondrial DNA region.
Key words: Bombus cryptarum, Bombus terrestris, mtDNA, restriction enzyme
Úvod
Morfologickou identifikaci čmeláků komplikuje problém v podobě tzv. kryptických druhů.
Jedná se o druhy, resp. skupiny druhů, které jsou morfologicky téměř shodné. U čmeláků se
tyto problematické druhy vyskytují v rámci podrodu Bombus s. str. u nichţ je druhová
identifikace často obtíţná kvůli značné interspecifické variabilitě. Na našem území jsou
známy 4 druhy z tohoto podrodu, B. terrestris (Linnaeus, 1758), B. lucorum (Linnaeus, 1761),
B. magnus (Vogt, 1911) a B. cryptarum (Fabricius, 1775). Druhová identifikace dělnic a
samců B. cryptarum a B. terrestris, resp. jejich spolehlivé rozlišení od jiných druhů v rámci
subgenu Bombus na základě morfologických znaků, je zatím prakticky nemoţné. Nové
moţnosti druhové identifikace se otevřely s nástupem stále se rozvíjejících molekulárních
metod. Pro molekulární identifikaci čmeláků sehrává zásadní roli variabilita vyskytující se v
mitochondrálním genomu. Nejčastěji studovanými mitochondriálními geny, vhodnými pro
efektivní rozlišení vnitrodruhové a mezidruhové variability, je oblast genu cytochrom oxidázy
– podjednotka I (COI), podjednotka II (COII) a cytochrom b.
Cílem řešení byla molekulární identifikace 2 kryptických druhů, B. cryptarum a B. terrestris,
vyskytujících se na území ČR s vyuţitím restrikčního štěpení COI genu mitochondriální
DNA, za účelem vzájemného odlišení těchto 2 problematických druhů.
165
„Úroda 12/2011, vědecká příloha―
Materiál a metody
Biologický materiál. Jedinci subgenu Bombus vytipovaní pro molekulární analýzy byly
získáni metodou individuálního sběru z různých, zejména moravských lokalit.
Jako pozitivní kontrola slouţila DNA izolována z poddruhu B. cryptarum, kterého druhová
příslušnost byla potvrzená chemickou analýzou feromonů labiálních ţláz a B. terrestris, který
byl získán z chovu a určen jako B. terrestris na základě morfologických znaků.
Izolace DNA. Genomová DNA byla izolována ze 2 nohou pomocí komerčně dostupného kitu
DNeasy® Blood & Tissue Kit (Qiagen, Německo).
Amplifikace COI genu mtDNA. Amplifikace úseku mitochondriálního CO1 genu s pouţitím
primerového páru CO1_přímý 5´-ATAATTTTTTTTATAGTTATA-3´ a CO1_zpětný 5´GATATTAATCCTAAAAAATGTTGAGG-3´ (Tanaka et al., 2001) probíhala ve 30µl
reakční směsi obsahující 10x pufr (Finnzymes, Finsko), 200µM dNTP mix (Finnzymes,
Finsko), 2µM kaţdého primeru (Metabion, Neměcko), 0,2U DyNAzyme II DNA polymerázy
(Finnzymes, Finsko) a 2µl templátové DNA. V termocycleru (Techne, Anglie) byl pouţit
program: 93°C 1min., 30 cyklů (93°C 45s, 45°C 1min. a 60°C 4min.), po kterých následovala
finální extenze v délce 3min. při teplotě 60°C.
Restrikční štěpení. Amplifikované mtDNA fragmenty byly štěpeny 2 restrikčními enzymy
HinfI (Murray et al., 2008) a Hpy1881, které byly do reakce přidávány jednotlivě. Tyto
restrikční endonuklázy specificky štěpí B. cryptarum a B. terrestris a umoţňují tak jejich
druhové určení. Pro restrikční analýzu bylo pouţito 7,5µl PCR produktu, 10x NEBuffer 2
(New England Biolabs Inc.) 0,1µl enzymu HinfI (10 000U/ml), resp. 0,5µl Hpy1881
(10 000U/ml), v celkovém objemu 10µl, resp. 20µl. Štěpení probíhalo při 37oC 4 hodiny.
Štěpené produkty byly detekovány pomocí transiluminátoru po separaci v 2% agarózovém
gelu a po obarvení ethidium bromidem.
Výsledky a diskuze
Z biologického materiálu byla vyizolována vysokomolekulární DNA s kvalitou vhodnou pro
následnou amplifikaci cytochrom oxidázové podjednotky I (COI) mitochondriální DNA.
Amplifikovaný fragment COI genu mtDNA měl velikost 1064bp pro oba poddruhy Bombus
(obr. 1). Tuto velikost uvádí téţ Murray et al. (2008).
Obrázek 1: Amplifikace CO1 genu mtDNA při pouţití primerů
M
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15
1 064bp
M – 100bp DNA Ladder
(BioLabs Inc.),
1 – pozitivní kontrola B.
cryptarum,
2 – pozitivní kontrola B.
terrestris,
3 – pozitivní kontrola B.
lucorum
4 – negativní kontrola
5 – 15 neznamé vzorky
subgenu Bombus
Restrikčním štěpením CO1 genu mtDNA enzymem HinfI a Hpy1881 byly získány dva
restrikční fragmenty o délce 500bp a 550bp (obr. 2, 3) deklarující přítomnost jedinců subgenu
B. cryptarum. Digesce polymorfního COI genu mtDNA endonukleázou HinfI poskytla 4
fragmenty o rozdílné délce, tj. 110bp, 180bp, 210bp a 560bp (obr. 2), v případě restrikčního
enzymu Hpy1881 byly získány 2 fragmenty s velikostí 290bp a 770bp (obr. 3). Získané
restrikční profily determinují druhovou příslušnost k B. terrestris.
166
„Úroda 12/2011, vědecká příloha―
Obrázek 2: Štěpné profily B. cryptarum a B. terrestris po digesci CO1 genu mtDNA
enzymem HinfI
M
1
2
3
4
5
6
7
L
8
9
10
11
12
13
14
15
M – 100bp DNA Ladder (BioLabs Inc.),
L – 50bp DNA Ladder (BioLabs Inc.),
1 – pozitivní kontrola B. cryptarum
2 – pozitivní kontrola B. terrestris
4, 6, 14 – negativní kontrola
3, 5, 13, 15 – B. cryptarum
7, 8, 9, 10, 11, 12 – B. terrestris
šípky označují velikost fragmentu 500bp
Obrázek 3: Štěpné profily B. cryptarum a B. terrestris po digesci CO1 genu mtDNA
enzymem Hpy1881
M
1
2
3
4
5
6
M
7
8
9
10
11 12
13
M
M – 100bp DNA Ladder (BioLabs Inc.),
1 – pozitivní kontrola B. terrestris
7 – pozitivní kontrola B. cryptarum
13 – negativní kontrola
2 – 6 – B. terrestris
8 – 12 – B. cryptarum
šípky označují velikost fragmentu 500bp
Z celkem 31 jedinců poddruhu Bombus bylo vyuţitím restrikčního štěpení COI genu mtDNA
pomocí enzymu HinfI identifikováno 14 jedinců patřících k B. cryptarum a 17 jedinců u
kterých byla potvrzena druhová příslušnost k B. terrestris. Shodných výsledků bylo dosaţeno
i v případě restrikčního enzymu Hpy1881, s jedním rozdílem, a to, ţe u jednoho vzorku
nedošlo k restrikčnímu štěpení výše uvedeným enzymem.
Digesce polymorfního COI genu mtDNA jak v případě endonukleázy HinfI, tak v případě
Hpy1881, poskytuje dostatečně rozdílné štěpné profily, na základě kterých je moţné určit
druhovou příslušnost ke 2 problematickým druhům, B. cryptarum a B. terrestris,
vyskytujících se na území ČR.
Identifikací problematických druhů čmeláků se zaobíral i Ellis et al. (2006), který k jejich
rozlišení vyuţil poměrně vysokou variabilitu vyskytující se v cytochrom oxidázové –
167
„Úroda 12/2011, vědecká příloha―
podjednotce II (COII) a cytochromu b mitochondriální DNA. Ve své práci také zdůraznil, ţe
jednotlivé morfologické znaky nemůţou být dostačujícím diagnostickým znakem pro
identifikaci kryptických druhů, vzhledem k tomu, ţe jednotliví zástupci téhoţ druhu nebo
poddruhu, mohou vykazovat odlišnosti. Ellis et al. doplnil získaná morfologická data o
mtDNA sekvenční data, které potvrdily existenci 2 samostatných poddruhů, B. ruderatus a B.
hortorum. O rok později Ellis et al. (2006) zvěřejnil spolehlivý a rychlý způsob identifikace
problematických druhů na základě restrikčního štěpení cytochromu b mtDNA. Vyuţil přitom
vlastností pouze jednoho restrikčního enzymu Tsp45I, který v cytochromu b nese restrikční
místo charakteristické pouze pro B. hortorum na základě kterého se podařilo zcela zřetelně
vzájemně odlišit od jiného kryptického druhu B. ruderatus, kterému naopak toto místo
v sekvenci cytochromu b chybí.
Murray et al. (2008) se kromě molekuární identifikace zaměřil i na výskyt kryptických druhů.
Na základě PCR-RFLP metody jednoznačně rozlišil 4 kryptické druhy, B. cryptarum, B.
lucorum, B. magnus a B. terrestris. Dospěl k závěru, ţe výskyt B. cryptarum je poměrně
hojný při vyšší nadmořské výšce, neţ B. lucorum, kterého rozšíření při vyšší nadmořské výšce
není tak časté (> 200m).
Další velmi spolehlivou metodou určení druhové příslušnosti je chemická analýza feromonů
labiálních ţláz, avšak ta vyţaduje odebrání hlavové tkáně ihned po usmrcení a její co
nejrychlejší zpracování.
Závěr
V tomto příspěvku jsou prezentovány výsledky amplifikace a následného restrikčního štěpení
COI genu mitochondriální DNA. Digesce polymorfního COI genu mtDNA s restrikčnými
endonukleázami HinfI a Hpy1881 poskytuje dostatečně rozdílné štěpné profily, na základě
kterých je moţné přiřadit druhovou příslušnost ke 2 problematickým druhům, B. cryptarum a
B. terrestris, vyskytujících se na území ČR.
Molekulární metody hrají v současné době rozhodující význam při identifikaci a typizaci celé
řady problematických druhů. Jejich předností je, ţe se můţe současně vyuţívat více metod, a
tím se slabé místo jedné metody kompenzuje metodou jinou. V běţné praxi a diagnostice však
mají klasické morfologické metody své nezastupitelné místo a jedná se jen o to zvolit správné
kombinace metod morfologických a molekulárních k dosaţení optimálního výsledku.
Dedikace
Výsledky byly podpořeny za částečné institucionální podpory na dlouhodobý koncepční
rozvoj výzkumné organizace a projektem MŠMT reg. č. 2B2B06007.
Pouţitá litereatura
Pouţitá literatura je k dispozici u autora.
Kontaktní adresa:
Cholastová Tereza, Mgr.
Zemědělský výzkum, s.r.o.
Zahradní 1, 664 41 Troubsko
[email protected]
168
„Úroda 12/2011, vědecká příloha―
STANOVENÍ PODOBNOSTÍ V KOLEKCI ODRŦD VOJTĚŠKY SETÉ
Determination of the similarities in the collection of alfalfa varieties
Knotová D.1, Vymyslický T.2
1
2
Zemědělský výzkum, spol. s r.o., Troubsko
Výzkumný ústav pícninářský, spol. s r.o., Troubsko
Abstrakt
V roce 2010 byl hodnocen soubor 32 odrůd vojtěšky seté získaných z 6 států (Česká
republika, Francie, Maďarsko, Slovensko, Švédsko, Dánsko). Hodnocení odrůd probíhalo
v individuálních výsadbách a v porostu. Zhodnoceno bylo 51 znaků. Zjištěné hodnoty
deskriptorů jednotlivých odrůd byly převedeny na body dle devítibodové stupnice a matice
bodů byla statisticky zpracována metodou shlukové analýzy.
Klíčová slova: vojtěška setá, podobnosti, shluková analýza.
Abstract
In the year 2010 the 32 varieties of alfalfa from 6 countries (Czech Republic, France,
Hungary, Slovakia, Sweden and Denmark) were evaluated. The evaluation took place in the
individual outplanting and in the stand. 51 characters were evaluated. Average value of
characters of accessions created the input matrix for evaluation by the method of cluster
analysis.
Key words: alfalfa, similarities, cluster analysis.
Úvod
V České republice je v současné době vojtěška setá pěstována na 65 000 ha zemědělské půdy
(Český statistický úřad, 2011). I přes současný trend jako je sniţování osevních ploch této
pícniny patří vojtěška současně s kukuřicí mezi naše nejvýnosnější pícniny. Její předností jsou
především poměrně stálé a vysoké výnosy, odolnost proti suchu a vytrvalost. Krmiváři
oceňují především vysokou produkci stravitelných bílkovin z 1 ha a nízké náklady na jejich
výrobu. (Hrabě et al., 2004). Nezanedbatelná je také její dobrá předplodinová hodnota. Ve
šlechtitelských programech je velice ceněna znalost podobností mezi kultivary. Genetickou
podobností vojtěšky se zabývali např. Wang et al. (2011), Julier (2010), Tucak (2008) a
morfologickou podobností pak Benabderrahim et al. (2009) aj.
Materiál a metodika
V roce 2010 proběhlo hodnocení 32 odrůd vojtěšky seté. Jednalo se o 14 odrůd z České
republiky, 8 odrůd z Maďarska, 5 z Francie, 5 z USA a po jedné ze Švédska, Slovenska a
Dánska. Morfologické, výnosové a kvalitativní charakteristiky byly zjišťovány jak v porostu
(na parcelách 10 m2), tak v individuálních výsadbách. V individuálních výsadbách bylo
hodnoceno po deseti rostlinách kaţdého původu. Celkově bylo zhodnoceno 51 deskriptorů:
tvar listové růţice na podzim, hustota listové růţice, počet lodyh v trsu, délka lodyh, tloušťka
lodyh, tvar lodyhy na průřezu, dutost lodyhy, barva lodyhy, počet internodií, délka středního
internodia, počet bočních větví, tvar terminálního lístku, okraj terminálního lístku, vrchol
terminálního lístku, délka terminálního lístku, šířka terminálního lístku, plocha terminálního
lístku, barva listu, odění listu, plocha listu, výskyt vícečetných listů, tvar květenství, délka
květenství, počet květenství na lodyze, počet květů v květenství, barva květenství, počet
plodenství na lodyze, počet lusků v plodenství, počet lusků na 100 květů, tvar lusku, barva
lusku, výška spirály lusku, šířka spirály lusku, počet semen v lusku, tvar semene, barva
169
„Úroda 12/2011, vědecká příloha―
semene, hmotnost tisíce semen, odolnost k vyzimování, výška porostu na počátku kvetení,
výška porostu v plném kvetení, výška porostu 20 dnů po 1. seči, obrůstání porostu, počet sečí
v roce, celková produkce zelené biomasy, hmotnost zelené biomasy rostliny, celkový výnos
sena porostu, podíl výnosu 1. seče k celkovému výnosu za rok, výnos semen porostu,
hmotnost semen na rostlině, obsah dusíkatých látek, obsah vlákniny. Odhady středních hodnot
byly na základě klasifikátoru (Vacek et al. 1985) převedeny na body a takto vzniklá matice se
stala podkladem zpracování metodou shlukové analýzy.
Výsledky a diskuze
Z grafu 1 je patrné rozdělení celého souboru do devíti menších skupin. Největší podobnost
byla zjištěna u českých odrůd Denisa a Holyna. Hned po nich následovaly Niva a Litava,
které společně s Terezou utvořili první shluk zaznamenaný v dendrogramu. Tyto odrůdy
pocházejí ze stejné šlechtitelské stanice, proto jakákoliv větší podobnost zde není
překvapující. Druhou skupinu tvoří dvě maďarské odrůdy společně s českou odrůdou Magda
a francouzskou odrůdou Timbale. Další skupina je směsicí české, francouzské, maďarské a
dánské odrůdy, z nichţ si jsou nejpodobnější dánská odrůda Creno a maďarská odrůda KM
Gyongy. Větší podobnost vykázaly maďarské odrůdy Jozsó, Klaudia, Szapko a Alexandra a
spolu s nimi francouzská odrůda Exquise. Skupině českých odrůd Oslava, Morava a Kamila
se blíţí francouzská odrůda Julia, americká Perfekta a česká odrůda Jarka. Za odrůdy
s nejmenší podobností je moţno povaţovat odrůdy francouzské, které byly roztroušeny ve
více různých shlucích. Překvapující byla pozice nejstarší české odrůdy Palava, která
v dendrogramu vykázala největší vzdálenost od všech hodnocených odrůd.
Závěr
Na základě morfologických, výnosových a kvalitativních charakteristik byl soubor rozdělen
do shluků více či méně dle států původu. I kdyţ byly některé shluky sloţeny převáţně z odrůd
pocházejících z jedné šlechtitelské stanice, nebyla mezi těmito poloţkami zjištěna ţádná
duplicita. S výsledky je moţné dále pracovat ve šlechtitelských programech.
Literatura
Benabderrahim, M. A., Mansour, H., Ali, F. (2009): Diversity of lucerne (Medicago sativa L.)
populations in south Tunisia. In: Pakistan journal of botany. Volume: 41. Issue: 6. Pages:
2851-2861. ISSN: 0556-3321.
Struktura ploch osevů v roce 2010, Český statistický úřad, URL: http://www.czso.cz
Hrabě F. et al. (2004): Trávy a jetelovinotrávy v zemědělské praxi. Vydavatelství Ing. Petr
Baštan, Olomouc. ISBN: 80-903275-1-6.
Julier, B., Semiani, Y., Laouar, M. (2010): Genetic Diversity in a Collection of Lucerne
Populations from the Mediterranean Basin Evaluated by SSR Markers. In: Sustainable use
of genetic diversity in forage and turf breeding. Pages: 107-112. ISBN: 978-90-481-87058.
Tucak, M., Popovic, S., Cupic, T., Grljusic, S., Bolaric, S., Kozumplik, V. (2008): Genetic
diversity of alfalfa (Medicago spp.) estimated by molecular markers and morphological
characters. In: Periodicum biologorum. Volume: 110. Issue: 3. Pages: 243-249. ISSN:
0031-5362.
Vacek, V., Mrázková, V., Sestrienka, A., Sehnalová, J., Bareš, I., Hájek, D. (1985):
Klasifikátor genus Medicago L., Praha.
Wang, X., Yang, X., Chen, L., Feng, G., Zhang, J., Jin, L. (2011): Genetic diversity among
alfalfa (Medicago sativa L.) cultivars in Northwest China. In: Acta agriculturae
170
„Úroda 12/2011, vědecká příloha―
scandinavica section b-soil and plant science. Volume: 61. Issue: 1. Pages: 60-66. ISSN:
0906-4710.
Dedikace
Výsledek byl získán za částečné institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace a částečně z prostředků Národního programu konzervace a vyuţití
genetických zdrojů kulturních rostlin a agrobiodiverzity, financovaného MZe ČR.
Graf 1: Dendrogram odrůd vojtěšky seté, hodnocených 51 deskriptory
Medicago sativa
Com plete linkage
Euclidean distances
PalavaCZE
JarkaCZE
PerfektaUSA
JuliaFRA
KamilaCZE
MoravaCZE
OslavaCZE
ExquiseFRA
AlexandraHUN
SzapkoHUN
KlaudiaHUN
JozsóHUN
ZuzanaCZE
SW NexusSWE
LubonaSVK
LegendairyUSA
KM-MaratonHUN
HarpeFRA
JitkaCZE
CrenoDNK
KM-GyongyHUN
GalaxieFRA
VlastaCZE
TimbaleFRA
KM-BossyHUN
Hunor 40HUN
MagdaCZE
LitavaCZE
NivaCZE
TerezaCZE
HolynaCZE
DenisaCZE
5
6
7
8
9
10
11
Distance of connection
Kontaktní adresa:
Ing. Daniela Knotová
Zemědělský výzkum, spol. s r.o.
Zahradní 1
66441 Troubsko
[email protected]
171
12
13
14
15
„Úroda 12/2011, vědecká příloha―
172
„Úroda 12/2011, vědecká příloha―
GENY REZISTENCE HRACHU K VIROVÉ MOZAICE HRACHU
PŘENOSNÉ SEMENEM (PSBMV) A JEJICH VYUŢITÍ VE ŠLECHTĚNÍ
Resistance genes to Pea seed borne mosaic virus (PSbMV) and their use
in pea breeding
Konečná E.1, Smýkal P.2, Hanáček P. 1
1
Mendelova univerzita v Brně, Agronomická fakulta, Ústav biologie rostlin
2
Agritec Plant Research s.r.o, Oddělení biotechnologií, Šumperk
Abstrakt
Virus mozaiky hrachu přenosný semenem způsobuje sníţení výnosu a kvality u celé řady luštěnin,
jako jsou bob, čočka, cizrna, včetně hrachu. Tyto ztráty lze omezit nebo jim zcela zabránit pěstováním
rezistentních odrůd. Genom hrachu obsahuje nejméně dva recesivní geny, které jsou zodpovědné za
rezistenci k některým potyvirům, včetně PSbMV. Rezistence k nejčastěji se vyskytujícímu P1 PSbMV
patotypu je řízena genem eIF4E, lokalizovaném na vazebné skupině VI (sbm-1 lokus). Homologní
eIF4E(iso) gen byl nalezen v těsné blízkosti sbm-2 lokusu (vazebná skupina II), který odpovídá za
rezistenci k L1 (P2) PSbMV patotypu. Byla získána genomová a cDNA sekvence eIF4E(iso)genu a
odvozena proteinová sekvence. Mezi rezistentními a náchylnými genotypy byly identifikovány mutace
v eIF4E(iso), ale tyto prozatím nejsou funkčně přiřazeny. Uţitím metody RACE byly získány
sekvence 5´a 3´UTR oblasti, které byly pouţity k návrhu specifických primerů.
Klíčová slova: hrách, Pea seed-borne mosaic virus, rezistence, translační iniciační faktor 4E (eIF4E)
Abstract
Pea seed-borne mosaic virus (PSbMV) causes yield losses (from 10 to 80%) in a broad spectra of
legumes, such as broad bean, lentil, chickpea, including pea. These losses can be easily prevented by
growing resistant cultivars. The pea genome contains at least two recessive genes that confer
resistance to various potyviruses. Resistance to the common strains of PSbMV is conferred by a single
recessive gene eIF4E, localized on linkage group VI (sbm-1 locus). Homologues eIF4E(iso) gene was
found in close relation to sbm- 2 locus (on linkage group II). Full genomic fragments of pea
eIF4E(iso) were obtained and protein sequences were deduced. Mutations of eIF4E(iso) between
resistant and susceptible genotypes have been identified but are not yet functionally assigned. Using
the RACE method, sequences of 5´ and 3´UTR regions were obtained and used for specific primers
design.
Key words: pea, Pea seed-borne mosaic virus, resistence, translation initiation factor 4E (eIF4E)
Úvod
Virová mozaika hrachu přenosná semenem (Pea seed-borne mosaic virus, PSbMV) patřící do rodu
Potyvirus, čeledi Potyviridae, způsobuje závaţné ztráty kvality a výnosu mnoha luskovin, včetně
ekonomicky významných druhů jako jsou bob, čočka, cizrna a hrách. Choroba je přenášena
prostřednictvím hmyzích vektorů, mšic a také infikovanými semeny. Charakteristickým projevem
napadení hrachu setého (Pisum sativum L.) virem semenem přenosné mozaiky hrachu je nápadné
svinování okrajů, tvorba listové mozaiky, prosvětlování listových ţilek, tvorba zkrácených internodií a
různý stupeň zakrslosti rostliny. U napadených rostlin dochází k pozdějšímu kvetení. Květy jsou často
deformované, mohou ale vykvést za vzniku deformovaných lusků. Následně jsou také postiţena
semena, s typickou mozaikou, je sníţena jejich ţivotaschopnost a kvalita. Účinným nástrojem
k omezení výskytu je pěstování rezistentních odrůd. V případě hrachu bylo popsáno několik lokusů
rezistence k virovým patogenům z rodu Poytvirus, které jsou děděny recesivně a tvoří dva shluky
nacházející se ve dvou odlišných vazebných skupinách (chromozomech). Vazebná skupina VI
obsahuje shluk recesivních genů sbm-1, sbm-3, sbm-4, které zodpovídají za rezistenci k PSbMV P1,
P3, P4 patotypům, dále gen cyv-2 rezistence ke Clover yellow vein virus (ClYVV) a gen wlv Bean
yellow mosaic virus kmene white lupin (BYMV-W). Další shluk je umístěný na vazebné skupině II a
zahrnuje geny bcm, cyv-1, mo, pmv a sbm-2, zprostředkovávající rezistenci k Bean common mosaic
173
„Úroda 12/2011, vědecká příloha―
virus, Clover yellow vein virus (ClYVV), Bean yellow mosaic virus, Pea mosaic virus a PSbMV P2.
Lokusu sbm-1 (LG-VI) odpovídá eukaryotický transalační iniciační faktor 4E (eIF4E) a v těsné vazbě
s lokusem sbm-2 byl nalezen jeho homolog eIF4E(iso). U virů čeledi Potyiridae je na 5´ konci RNA
vlákna místo čepičky připojen protein VPg (viral protein genomelinked), který je při iniciaci translace
rozeznán rostlinným eIF4E jako čepička a tím dochází k translaci virové RNA. Výskyt bodových
mutací v eIF4E způsobuje neschopnost navázat VPg protein a následné syntéze k tvorbě polypeptidu.
Podobně jako VPg a eIF4E spolu interagují virem kódovaný protein virulence P3 s rostlinným
proteinem eIF4E(iso).
Metodou kandidátních genů s pouţitím známých sekvencí z Medicago truncatula, modelové rostliny
čeledi Fabaceae, byl klonován fragment eIF4E z hrachu a navrţen jednoduchý PCR kodominantní
marker pro detekci rezistence sbm-1, zaloţený na délkovém polymorfismu intronu
sensitivní/rezistentní alely (Gao et al., 2004). V roce 2010 byly publikovány úplné genomické
sekvence eIF4E u hrachu, včetně přímých markerů pro MAS (Marker assisted selection), které jsou
zaloţeny na nukleotidových mutacích vedoucích k záměně aminokyselin v primárním řetězci
polypeptidu a umoţňují identifikaci, jak homozygotních náchylných nebo rezistentních jedinců se
100 % spolehlivostí, tak zároveň identifikaci heterozygotů (Smýkal et al., 2010).
Cílem této práce je s pomocí molekulárně biologických metod stanovit celkovou genomovou sekvenci
genu eIF4E(iso) u vybraných poloţek hrachu (Pisum sativum L.), dříve popsaných jako rezistentní či
senzitivní k patotypu P2 PSbMV. Výsledky porovnat s dosud publikovanými sekvencemi cDNA
tohoto genu a provést predikci primární struktury proteinů.V případě zjištění polymorfismů vázaných
na rezistentní genotypy navrhnout jednoduchý markerovací systém pro detekci těchto alel, jeţ by mohl
být vyuţitelný při MAS.
Materiál a metody
Rostlinný materiál: Semena hrachu byla získána z genofondové kolekce USDA-ARS Western
Regional Plant Introduction Unit, Pullman, WA, USA.
Izolace genomové DNA a RNA: Izolace nukleových kyselin byla provedena pomocí komerčně
dodávaných kitů. Genomová DNA byla izolována z jednotlivých suchých semen pomocí DNEasy
Plant Mini Kit (Qiagen). Izolace RNA byla provedena z mladých listů za pouţití RNeasy Plant Mini
Kit (Qiagen) dle protokolu výrobce.
PCR amplifikace fragmentů eIF4E(iso): PCR amplifikace byla provedena v 25µl objemu v 0,2ml
zkumavkách. Sloţení PCR reakční směsi bylo podle standardního protokolu výrobce s pouţitím Green
GoTaq polymerázy (Promega). Seznam pouţitých PCR primerů viz tab. 1. Teplotní profil PCR reakce,
počáteční denaturace 94°C: 3 minuty, 30 cyklů: 94°C/30s, 55°C/30s, 72°C/1min 30s a závěrečná
elongace 72°C po dobu 10 minut. Sekvence 5´UTR oblasti byla získána pomocí SMARTer™ RACE
cDNA Amplification Kitu (Clontech). Rozdělení PCR produktů bylo provedeno horizontální gelovou
elektroforézou na 1% agarosovém gelu (Bioline, Velká Británie) v 1 x TAE pufru. Separace probíhala
30-45 minut při 75-120 V, detekce probíhala pomocí EtBR, vizualizace na UV transluminátoru a Gel
Documentation System (Vilber Lourmat, Francie). Klonování PCR produktu: Při klonování fragmentů
bylo postupováno dle návodu k produktu pGEM-T Vector System (Promega) za pouţití originálních
roztoků. Elektroporace kompetentních buněk byla provedena dle Ausubela et al. (1992). Na výsev
buněk E.coli TOP 10 byly pouţity Petriho misky s pevným LB médiem a selekcí na ampicilin a
komponenty pro blue/white selekci. Pro testování pozitivních kmenů E.coli nesoucích pGEM-T
s inzertem byla pouţita PCR s primery T7 a SP6. Izolace plazmidové DNA byla provedena pomocí
GeneJET Plasmid Miniprep Kit (Fermentas). Sekvenování bylo provedeno pomocí BigDye
Terminator kitu (Applied Biosystems) v Macrogene Korea a Laboratoři sekvenace DNA PřF UK
v Praze.
Tabulka 1: Seznam pouţitých PCR primerů
Název primeru
eIF4E-isoM-F
eIF4E-isoM-R
Ps- eIF4Eiso-F
Ps-eIF4Eiso-R
eIF4E-isoM-R
sbm2-3UTR-Rev3
Sekvence (5´- 3´)
GTGTAGTTGCGAGTGTACGCCAGTG
CACTGGCGTACACTCGCAACTACAC
ATATGGCAACAACAGAACCACTCG
TTACACAGTGTATCGAGCCTTTGC
CACTGGCGTACACTCGCAACTACAC
GATTTATGATTGTACAATCAACACAAC
174
Pozice v eIF4E(iso)
786-710 F
786-710 R
0-22 F
2178-2201 R
786-710 R
R
Orientace
forward
reverse
forward
reverse
reverse
reverse
„Úroda 12/2011, vědecká příloha―
Výsledky a diskuze
Sekvenací byly získány genomové sekvence eIF4E(iso) vybraných poloţek hrachu viz obr.1. Délka
genomického úseku eIF4E(iso) se u analyzovaných poloţek pohybovala v rozmezí 2197 - 2229 bp,
tyto rozdíly jsou způsobeny především polymorfními oblastmi v nejdelším exonu 3. Podobný délkový
polymorfismus, zaloţený na opakované repetici, byl jiţ popsán v intronu 3 u genu eIF4E ve vazbě na
rezistentní alelu a bylo jej vyuţito pro tvorbu markerů (Smýkal et al., 2010). Byl zjištěn bodový
polymorfismus v oblasti intronu 3, ten však po translaci nevedl k záměně aminokyseliny. Pokud došlo
k záměně aminokyseliny, vyskytovala se pouze ojediněle, coţ lze přisuzovat vnitrodruhové variabilitě.
Introny jsou sice během posttranskripčních úprav vystřiţeny a nemají tedy vliv na primární strukturu
proteinů, často však mohou slouţit jako regulátory genové exprese, rovněţ je polymorfismus intronů
vhodným základem pro tvorbu markerů vyuţitelných ve šlechtění na rezistenci. Role eukaryotních
translačních faktorů v rezistenci k virovým patogenům rodu Potyvirus byla jiţ popsána u několika
druhů rostlin včetně salátu (Niciase et al., 2003), papriky (Ruffel et al., 2002), rajčete (Parrela et al.,
2002), fazolu (Naderpour et al., 2010), ječmene (Stein et al., 2005), Arabidopsis thaliana (Lellis et al.,
2002) a hrachu (Gao et al., 2004). Mutace v translačním faktoru mohou přerušit cyklus RNA virů, aniţ
by ovlivnily vývoj rostliny. Výsledky pokusů s Arabidopsis thaliana ukazují, ţe eIF4E i eIF4E(iso)
jsou zapojeny do přirozené rezistence rostlin k potyvirům (Sato et al., 2005). Tyto výsledky by mohly
potvrdit původní domněnku, kdy gen eIF4E(iso) a sbm-2 lokus byly označeny za totoţné. Tyto mutace
lze vyuţít v přirozené rezistenci rostlin k rychlé analýze nebo identifikaci a ulehčit screening
genových kolekcí na poţadovaný znak. Zatím se však nepodařilo najít takové rozdíly mezi senzitivní a
rezistentní alelou, které by se daly jako v případě sbm-1 vyuţít při MAS (Marker assisted selection).
Další moţností při hledání polymorfismu mezi náchylnými a rezistentními genotypy jsou 5´ a 3´UTR
oblasti. Jelikoţ pro amplifikaci eIF4E(iso) byly pouţity primery, které nasedají na počáteční a
koncovou část exonu, nelze proto postihnout variabilitu těchto oblastí. V předchozí práci jsme získali
pomocí 3´ RACE postupu 3´ UTR oblast, která se v rámci jednoho genotypu vyskytovala ve třech
délkově odlišných formách. Metodou 5´ RACE byla získána 100bp dlouhá sekvence 5´UTR oblasti
eIF4E(iso). Na začátek UTR oblasti byly navrţeny specifické primery, které vyuţijeme při hledání
polymorfismu mezi náchylnými a rezistentními genotypy.
Obrázek 1: Schéma genomické sekvence eIF4E(iso) hrachu setého (Pisum sativum L.)
Závěr
Práce se zabývá vyuţitím translačních iniciačních faktorů eIF4E a eIF4E(iso) ve šlechtění
hrachu na rezistenci k PSbMV. Především pak analýzou genu eIF4E(iso), který se nachází ve
vazebné skupině II a předpokládá se, ţe je lokusem sbm-2 zodpovídajícím za rezistenci k
patotypu P2 PSbMV viru. Sekvenováním byly identifikovány mutace v eIF4E(iso) vedoucí
k aminokyselinové záměně mezi rezistentními a náchylnými genotypy, tyto mutace však
nebyly dosud funkčně přiřazeny. Vybrané genotypy jsou testovány L1 (P2) PSbMV
patotypem. Uţitím metody RACE byla získána sekvence 5´a 3´UTR oblastí, které jsou
vyuţity k návrhu specifických primerů a studiu sekvenčního polymorfismu a genové exprese.
Rovněţ se budeme snaţit o charakterizaci dostupných TILLING mutantů, majících nové alely
obou studovaných genů, které by mohly být přímo pouţitelné ve šlechtitelské praxi.
Práce je řešena za podpory IGA AF MENDELU Nr. TP 7/2011 a NAZVa QI91A229
projektu.
175
„Úroda 12/2011, vědecká příloha―
Pouţitá literatura
Ausubel, F. M.; Brent, R.; Kingston, R. E.; Moore, D. D.; Seidman, J. G.; Smith, J. A.; Struhl,
K. (2002) Short protocols in Molecular Biology Fifth edition, John Wiley and Sons, Inc.
Gao. Z., Eyers. S., Thomas. C., Ellis. N., Maule.A. (2004): Identification of markers tightly
linked to sbm recessive genes for resistance to Pea seed- borne mosaic virus. Theor Appl
Genet, 109:488-494
Hjulsager, C. K.; Olsen, B. S.; Jensen, D. M. K.; Cordea, M. I.; Krath, B. N.; Johansen, I. E.;
Lund, O. S. (2006): Multiple determinants in the coding region of Pea seed-borne mosaic
virus P3 are involved in virulence against sbm-2 resistance. Virology, 355 (3), 52–61.
Naderpour, M.; Lund, O. S.; Larsen, R.; Johansen, E. (2010): Potyviral resistance derived
from cultivars of Phaseolus vulgaris carrying bc-3 is associated with the homozygotic
presence of a mutated eIF4E allele. Mol. Plant. Pathol., 11 (2), 255–263.
Niciase, V.; German-Retana, S.; Sanjuán, R.; Dubrana, M. P.; Mazier, M.; Maisonneuve, B.;
Candresse, T.; Caranta, C.; LeGall, O. (2003): The Eukaryotic Translation Initiation Factor
4E Controls Lettuce Susceptibility to the Potyvirus Lettuce mosaic virus1. Plant Physiol.,
132, 1272–1282.
Parrela, G.; Ruffel, S.; Moretti, A.; Morel, C.; Palloix, A.; Caranta, C. (2002): Recessive
resistance genes against potyviruses are localized in colinear genomic regions of the
tomato (Lycopersicon spp.) and pepper (Capsicum spp.) genomes. Theor. Appl. Genet.,
105, 855–861.
Ruffel, S.; Dussault, M. H.; Palloix, A.; Moury, B.; Bendahmane, A.; Robaglia, C.; Caranta,
C.(2002): A natural recessive resistance gene against potato virus Y in pepper corresponds
to the eukaryotic initiation factor 4E (eIF4E). Plant J., 32, 1067–1075.
Sato, M.; Nakahara, K.; Yoshii, M.; Ishikawa, M.; Uyeda, I.(2005): Selective involvement of
members of the eukaryotic initiation factor 4E family in the infection of Arabidopsis
thaliana by potyviruses. FEBS Lett., 579, 1167–1171.
Smýkal P., Šafářová D., Navrátil M., Dostálová R. (2010): Marker assisted pea breeding:
eIF4E allel specific markers to pea seed-borne mosaic virus (PSbMV) resistence. Mol
Breeding. 26:425-438.
Stein, N.; Perovic, D.; Kumlehn, J.; Pellio, B.; Stracke, S.; Streng, S.; Ordon, F.; Graner, A.
(2005): The eukaryotic translation initiation factor 4E confers multiallelic recessive
Bymovirus resistance in Hordeum vulgare (L.). Plant J., 42, 912–922.
Kontaktní adresa:
Ing. Eva Konečná
MENDELU
Zemědělská 1
613 00 Brno
[email protected]
176
„Úroda 12/2011, vědecká příloha―
VYUŢITÍ ELEKTROFORETICKÝCH STANOVENÍ KE STUDIU
WAXY PŠENIC
Use of electrophoresis determinations for study of waxy wheat
Papoušková L., Bradová J., Milec Z.
Výzkumný ústav rostlinné výroby, v.v.i., Praha - Ruzyně
Abstrakt
Pro hodnocení waxy alel u pšeničných materiálů byly pouţity elektroforetické metody SDS-PAGE (ve
dvou modifikacích) a automatická čipová elektroforéza Experion. V obou modifikacích SDS-PAGE
bylo výsledné elektroforetické spektrum téměř totoţné. Výsledný elektroforeogram čipové
elektroforézy se značně lišil jak v počtu, tak ve vzájemné pozici a intenzitě detekovaných
bílkovinných pruhů. Vyhodnocovací software čipové elektroforézy udává obsah detekovaných
proteinů, který lze pouţít jako indikátor přítomnosti waxy alel. Čipová elektroforéza tedy umoţnila
zaznamenat kvantitativní a SDS-PAGE kvalitativní změny proteinů spojených se syntézou škrobu
v pšenici.
Klíčová slova: waxy, pšenice, protein, SDS-PAGE, čipová elektroforéza
Abstract
An assesment of waxy materials was done by SDS-PAGE (two modifications) and automatic chip
electrophoresis Experion. In both SDS-PAGE modifications resulting spectra were nearly identical.
Chip electrophoreogram was markedly different in the number and also in the position of detected
protein bands. Evaluation software of chip electrophoresis indicates protein content which is possible
to use as a detector of presence of waxy alleles. Thus chip electrophoresis enabled quantitative and
SDS-PAGE qualitative changes of proteins connected with starch synthesis in wheat.
Key words: waxy, wheat, protein, SDS-PAGE, chip electrophoresis
Úvod
Waxy pšenice se vyznačují nízkým nebo nulovým obsahem amylosy. Tento obsah je silně
geneticky závislý a klíčovou úlohu při syntéze amylosy hraje enzym GBSS (granule bound
starch synthase) (Gaines, 2000). Obsah amylosy je u hexaploidních pšenic regulován 3 waxy
alelami Wx-A1, Wx-B1 a Wx-D1, které jsou přítomné na chromozomech 7A, 7D a 4A (Van
Hung, 2008). Absence nebo mutace jedné či více alel pak způsobuje sníţení aktivity GBSS a
proto dochází ke sníţení obsahu amylosy. Linie s jednou nebo dvěma nulovými alelami se
nazývají ´částečně waxy´ pšenice, zatímco linie se všemi nulovými alelami se nazývají ´plně
waxy´ pšenice (Monari, 2005). Po vyčištění a elektroforetické separaci GBSS je moţno
identifikovat jednotlivé Wx-alely (Boggini, 2001). Zdokonalená SDS-PAGE elektroforetická
metoda umoţnila identifikovat tyto alely jako tři izoproteiny s deklarovanou molekulovou
hmotností okolo 60 kDa (Nakamura, 1998). Přirozený výskyt mutovaných waxy alel je
poměrně nízký a je podmíněný geograficky (Graybosch, 1998). Ve šlechtitelských
programech se jako donory nulových waxy alel pouţívají přirozené mutanty pšenice:
japonská odrůda Kanto 107 se dvěma nulovými waxy alelami (Wx-A1 a Wx-B1) a čínská
odrůda BaiHou. Nakamura (1995) vyšlechtil první plně waxy pšenici s pouze stopovým
obsahem amylosy pomocí hybridizace mezi liniemi ´BaiHuo´ s nulovou alelou Wx-D1 a
Kanto107 s nulovými alelami Wx-A1 a Wx-B1.
Cílem naší práce bylo zjistit vyuţití jednotlivých elektroforetických technik pro hodnocení
waxy materiálů, které jsou k dispozici ve sbírkách Genové banky v Praze-Ruzyni.
177
„Úroda 12/2011, vědecká příloha―
Materiál a metody
Čtyři pšeničné waxy materiály (T. aestivum L.) s nízkým obsahem amylosy Kanto 107x,
WQL6K107-BHWX2-2a, WQL6K107-BHWX14-7 a Waxy Pen byly pěstovány v letech
2009-2010 v Praze – Ruzyni. Jako srovnávací pro elektroforetická stanovení byla pouţita
standardní odrůda jarní pšenice seté Chinese Spring. Deklarovaný původ waxy materiálů,
přítomnost nulových waxy alel (b) a obsah amylosy je uveden v Tab.1.
Tab.1 Deklarované parametry sledovaných waxy materiálů
Materiál
WQL6K107-BHWX14-7
Charakteristika
Japonský kultivar, jarní tvrdá pšenice
(cca 3% amylosy)
Odrůda
měkké
jarní
pšenice,
(Penawawa*6/´Wx2-2a (‹1% amylosy).
Linie jarní měkké pšenice, kříţenec
´Kanto 107´/´Bai Huo´ (‹1% amylosy)
Linie tvrdé jarní pšenice, kříţenec
´Kanto 107´/´Bai Huo´ (‹1% amylosy)
Chinese Spring
Kontrola (cca 24% amylosy)
Kanto 107x
Waxy Pen
WQL6K107-BHWX2-2a
Přítomnost
waxy
alely
(chromosomy 7A, 4A, 7D)
Wx-A1 Wx-B1 Wx-D1
b
b
a
b
b
b
b
b
b
b
b
b
a
a
a
Purifikace a izolace GBSS proteinů byla provedena dle autorů Zhao a Sharp (1996) a k jejich
detekci byla pouţita SDS-PAGE ve dvou modifikacích i) 10 % PAA gel, velikost gelu 180
×150 × 2 mm, vizualizace proteinů stříbrem (Bassam et al., 1991); ii) 12,5 % PAA gel,
velikost gelu 80 × 55 × 0,75 mm, vizualizace proteinů Coomassie Briliant Blue R250
(Bradová et al., 2011). Jako alternativa ke klasické SDS-PAGE byla testována ke stanovení
GBSS proteinů automatická čipová elektroforéza Experion (Bio-Rad, USA).
Obsah
amylosy
byl
stanoven
pomocí
enzymatické
metody
(Megazyme,
Amylose/Amylopectin assay kit, 2006).
Výsledky a diskuze
Metoda SDS-PAGE umoţňuje separaci proteinů GBSS vázaných na granule škrobu
přítomných v pšenici jako tří elektroforetických pruhů na gelu, které korespondují s výskytem
Wx-A1a, Wx-B1a and Wx-D1a proteinů. Dvě modifikace této metody byly pouţity
k identifikaci přítomnosti či absenci těchto tří Wx proteinů u hodnocených pšeničných
materiálů. Byla testována moţnost vyuţití automatické čipové elektroforézy pro
charakterizaci Wx proteinů jako alternativa ke klasické SDS-PAGE.
Výsledky separace tří GBSS proteinů za pouţití klasické SDS-PAGE a čipové elektroforézy u
sledovaných waxy materiálů jsou znázorněny na obrázku 1.
Z obrázku 1A a B je zřejmé, ţe obě modifikace SDS-PAGE, lišící se velikostí, koncentrací a
barvením gelu, mají téměř totoţný charakter elektroforetického spektra. U kontrolní odrůdy
Chinese Spring byly identifikovány tři elektroforetické pruhy, které odpovídají příslušným
Wx proteinům, jak uvádí Zhao a Sharp (1996). Nejpomalejší pruh odpovídá Wx-A1a proteinu
a dva další pruhy s velmi blízkou pohyblivostí odpovídají Wx-D1a a Wx-B1a proteinům.
Zjištěné výsledky testovaných waxy materiálů se shodují pouze částečně s deklarovanými
charakteristikami (Tab.1). V případě odrůdy Kanto 107x byl detekován kromě deklarovaného
proteinu Wx-D1a i Wx-A1a protein. U ostatních materiálů, které by podle deklarace měly být
zcela bez výskytu příslušných proteinů, byly zjištěny jeden (Wx-D1a u WQL6K107BHWX2-2a) či dva (Wx-D1a, Wx-A1a u WQL6K107-BHWX14-7 a Waxy Pen) Wx
178
„Úroda 12/2011, vědecká příloha―
proteiny. Tyto výsledky korespondují s hodnotami obsahu amylosy zjištěnými u těchto
materiálů (Tab.2), kdy ţádná z deklarovaných plně waxy pšenic nepotvrdila pouhé stopy
obsahu amylosy (pod 1%).
Obrázek 1 Elektroforetické stanovení proteinů vázaných na granule škrobu (GBSS) v pšenici (1Kanto 107x; 2- Waxy Pen; 3- WQL6K107-BHWX2-2a; 4- WQL6K107-BHWX2-14-7; CS-Chinese
Spring; L-hmotnostní marker.). A) SDS-PAGE - 10% gel, barvení stříbrem; B) SDS-PAGE – 12,5%
gel, barvení Coomassie Briliant Blue R250; C) virtuální gel z čipové elektroforézy
Výsledky čipové elektroforézy neumoţnily spolehlivě určit, zda detekované proteiny skutečně
odpovídají Wx proteinům. Z obrázku 1C je zřejmý značný rozdíl ve výsledném
elektroforeogramu oproti klasické SDS-PAGE, a to jak v počtu, tak ve vzájemné pozici a
intenzitě detekovaných bílkovinných pruhů u kontrolní odrůdy Chinese Spring. GBSS
proteiny se nalézají v oblasti výskytu gliadinů (30-60 kDa) a podjednotek gluteninů s nízkou
molekulovou hmotností (LMW-GS), které jsou charakterizovány molekulovou hmotností na
SDS-PAGE gelu 23-68 kDa (Branlard et al. 2001). Čipová kapilární elektroforéza rozděluje
jednotlivé proteiny převáţně podle stoupající hmotnosti. Retenční časy gliadinů, LMW-GS a
GBSS proteinů jsou příliš krátké na to, aby se dosáhlo lepšího rozlišení v této oblasti, tudíţ
GBSS mohou být ostatními proteiny maskovány. Rovněţ separační pořadí jednotlivých
proteinů neodpovídá striktně jejich skutečné molekulové hmotnosti a výsledek tak nesouhlasí
s pořadím elektroforetických pruhů na SDS-PAGE gelu (Uthayakumaran et al., 2006). Proto
nebylo moţno jednoznačně jednotlivé GBSS izoproteiny specifikovat jak u kontrolní odrůdy
Chinese Spring, tak u testovaných materiálů.
Tab.2 Průměrný obsah amylosy a proteinů (oblast 37-75 kDa) u hodnocených materiálů
Odrůda
KW 107x
Waxy Pen
WQL6K107-BHWX 2-2a
WQL6K107-BHWX 14-7
Chinese Spring
n – nehodnoceno
Amylosa (%)
3,4
4,65
6,15
6,65
n
Protein - Experion (ng/µl)
341
127
172
11
4773
Pomocí vyhodnocovacího softwaru čipové elektroforézy byl však stanoven u jednotlivých
materiálů obsah proteinů vyskytujících se ve sledované oblasti dané hmotnostním markerem
v intervalu 37 -75 kDa (Tab 2). Výsledky pak dokumentují velmi nízký obsah proteinů u
waxy materiálů (max. 341 ng/µl), u nichţ je prokázána absence jednoho resp. dvou GBSS
proteinů oproti kontrole (4773 ng/µl), která se vyznačuje přítomností kompletní sestavy
GBSS proteinů.
179
„Úroda 12/2011, vědecká příloha―
Závěr
Klasická metoda SDS-PAGE a automatická čipová elektroforéza byly pouţity u čtyř odrůd
pšenice s deklarovanými parametry k detekci waxy alel. Pomocí čipové elektroforézy bylo
moţno zaznamenat kvantitativní a pomocí SDS-PAGE kvalitativní změny proteinů spojených
se syntézou škrobu v pšenici. Zjištěné výsledky odpovídaly deklarovaným charakteristikám
pouze z části, coţ mohlo být způsobeno buď nedostatečnou purifikací proteinů či
neuspokojivou odrůdovou čistotou testovaných materiálů. Lze však konstatovat, ţe všechny
testované metody je moţno pouţít k detekci proteinových waxy alel s moţností jejich vyuţití
k hodnocení raných šlechtitelských generací či genetických zdrojů pšenic. Metoda čipové
elektroforézy pro přesnou charakterizaci waxy alel však bude potřebovat ještě další studium.
Dedikace
Výsledky byly získány při řešení projektu MZe ČR č. QH 92155 a 0002700604.
Pouţitá literatura:
Gaines C.S., Reaker M.Ö., Tilley M., Finney P.L., Wilson J.D., Bechtel D.B., Martin R.J.,
Seib P.A., Lookhart T., Donelson G.L. (2000): Associations of starch gel hardness, granule
size, waxy allelic expression, thermal pasting, milling quality, and kernel texture of 12 soft
wheat cultivars. Cereal Chemistry 77(2), 163–168
Van Hung P., Yasui T., Maeda T., Morita N. (2008): Physicochemical characteristics of
starches of two sets of near-isogenic wheat lines with different amylose content.
Starch/Stärke 60, 34–40
Monari A.M., Simeone M.C., Urbano M., Margiotta B., Lafiandra D. (2005): Molecular
characterization of new waxy mutants identified in bread and durum wheat, Theor Appl
Genet 110, 1481–1489
Boggini G., Cattaneo M., Paganoni C., Vaccino P. (2001): Genetic variation for waxy
proteins and starch properties in Italian wheat germplasm. Euphytica 119, 111–114
Nakamura T., Vrinten P., Hayakawa K., Ikeda J. (1998): Characterization of a granule-bound
starch synthase isoform found in the pericarp of wheat. Plant Physiol. 118, 451-459
Graybosch, R.A. (1998): Waxy wheats: Origin, properties, and prospects. Trends in Food
Science & Technology, 9, 135-142
Nakamura T., Yamamori M., Hirano H., Hidaka S., Nagamine T. (1995): Production of waxy
(amylose-free) wheats. Molecular & General Genet. 248, 253-259
Zhao X.C., Sharp P.J. (1996): An improved 1-D SDS-PAGE method for the identification of
three bread wheat waxy proteins. Journal of Cereal Science, 23: 191-193
Bassam B.J., Caetano-Anollés G., Gresshov P.M. (1991): Fast and sensitive silver staining of
DNA in polyacrylamide gels. Anal Biochem 196:80–83
Bradová J., Dvořáček V., Štočková L. (2011): Vyuţití gelové a čipové elektroforézy pro
identifikaci podjednotek gluteninů s vysokou a nízkou molekulovou hmotností u pšenice.
VÚRV,v.v.i., Praha
Megazyme (2006): Amylose/ Amylopektin, Assay Procedure, K-Amyl 04/06
Branlard G., Dargevet M., Saccomano R., Lagoutte F., Gourdon J. (2001): Genetic diversity
of wheat storage proteins and bread wheat quality. Euphytica 119, 59–67
Uthayakumaran S., Listiohadi Y., Baratta M., Batey I.L., Wrigley C.W. (2006): Rapid
identification and quantitation of high-molecular-weight glutenin subunits. Journal of
Cereal Science, 44: 34-39
Kontaktní adresa:
Ing.Ludmila Papoušková,
Výzkumný ústav rostlinné výroby,v.v.i., Praha 6 – Ruzyně, [email protected]
180
„Úroda 12/2011, vědecká příloha―
POROVNÁNÍ NĚKTERÝCH MORFOLOGICKÝCH A VÝNOSOVÝCH
CHARAKTERISTIK PLANÝCH DRUHŦ RODU ONOBRYCHIS
S ODRŦDOU VIŠŇOVSKÝ VÍCESEČNÝ
The comparison of some morphological and yield characteristics of wild
species of genus Onobrychis with the variety Višňovský
Pelikán J.1, Knotová D.2
1
2
Zemědělský výzkum, spol. s r.o., Troubsko
Výzkumný ústav pícninářský, spol. s r.o., Troubsko
Abstrakt
V roce 2011 bylo v individuálních výsadbách hodnoceno 10 původů planých forem Onobrychis
viciifolia a 2 původy Onobrychis arenaria, obsaţené v české kolekci rodu a srovnávány s odrůdou
Višňovský vícesečný v některých morfologických a výnosových charakteristikách. Ţádná ze
zkoušených planých forem statisticky průkazně nepřekonala českou odrůdu Višňovský vícesečný.
Naopak tato odrůda statisticky vysoce průkazně překonala některé zkoušené původy ve znacích zelená
hmota trsu, suchá hmota trsu, plocha listu, výška trsu, počet internodií a počet květenství na lodyze.
Odrůda Višňovský vícesečný vykázala ve všech znacích poměrně vysokou vyrovnanost.
Klíčová slova: Onobrychis viciifolia, Onobrychis arenaria, výnosové charakteristiky, morfologické
charakteristiky, variabilita.
Abstract
In 2011 ten origins of wild species of Onobrychis viciifolia and two of Onobrychis arenaria were
evaluated and compared in yield and morphological characteristic with variety Višňovský . The
evaluation took place in individual outplanting. Any tested wild species statistically
conclusively does not exceed the variety Višňovský. On the other hand this variety
statistically highly conclusively exceeds some origins in yield of green matter and dry matter,
leaf area, height plant, number of internodes and number of inflorescences on the stem. The
variety Višňovský proved high stability in all characteristics.
Key words: Onobrychis viciifolia, Onobrychis arenaria, yield characteristics, morphological
characteristics.
Úvod
Vičenec vikolistý (Onobrychis viciifolia Scop.) je víceletá pícnina sušších oblastí původem z jiţní
Evropy. U nás je pěstován jako pícnina jiţ od 18. stol. (Wendys, 2011). V současnosti je v České
Republice od roku 1946 povolena odrůda Višňovský vícesečný, coţ je odrůda vyšlechtěná
výběrem z krajových odrůd a ekotypů (Agrogen, 2011). S ohledem na ekologickou
charakteristiku je moţno pěstovat vičenec převáţně v kukuřičné a řepařské výrobní oblasti na
půdách mělkých a vysychavých. Lze jej pěstovat jak v monokultuře, tak ve směskách
s vojtěškou, štírovníkem a travami. Je ceněn pro kvalitní píci s niţším obsahem vlákniny a
s vysokým obsahem SNL (Regál a Krajčovič, 1963). Vičenec písečný (Onobrychis arenaria
Kit.) je chráněným druhem vzácně se vyskytujícím na území ČR a dalších evropských států.
Materiál a metodika
V individuální výsadbě Onobrychis viciifolia a Onobrychis arenaria bylo v průběhu vegetace
zhodnoceno měřením, váţením a počítáním deset rostlin z kaţdého původu. Získaná data byla
statisticky hodnocena pomocí bodového a intervalového odhadu střední hodnoty a odhadu
variačního koeficientu. Intervalový odhad střední hodnoty umoţňuje posoudit existenci
181
„Úroda 12/2011, vědecká příloha―
statistických rozdílů mezi středními hodnotami původů a variační koeficient udává míru
proměnlivosti daného původu v daném znaku.
Výsledky a diskuze
Hodnoty bodových odhadů střední hodnoty jednotlivých původů v jednotlivých znacích jsou
uvedeny v tabulce 1. Odrůda Višňovský vícesečný nebyla v ţádném ze sledovaných znaků
statisticky překonána ţádným ze sledovaných původů. Nejvyšší průměrnou hmotnost trsu
v zelené hmotě a současně i v seně zaznamenal původ TROU 63/01. Ve výnosu zelené hmoty
dále následovaly původy PIEN 104/05 a SVN 86/01, ve výnosu sena pak odrůda Višňovský
vícesečný a TAJIK 34/06. Odrůda Višňovský vícesečný v obou znacích statisticky vysoce
průkazně překonala původ TROU 4/01. Největší plocha listu byla zjištěna u původu TAJIK
34/06, dále následovaly TROU 32/97 a TROU 63/01. Odrůda Višňovský vícesečný statisticky
vysoce průkazně překonala původy TROU 4/01, TROU 5/01 a TROU 4/06. Ve znaku výška
trsu byla nejvyšší hodnota dosaţena původem TROU 047/95 a dále následovaly původy
TAJIK 34/06 a TROU 63/01. Odrůdy Višňovský vícesečný v tomto znaku statisticky vysoce
průkazně překonala původy TROU 32/97, TROU 178/94, SVN 86/01 a PIEN 104/05.
V počtu lodyh se na prvním místě umístil původ PIEN 104/05 a dále následovaly původy
SVN 86/01 a TROU 63/01. V délce lodyh vynikl původ TROU 63/01, dále následovaly
TAJIK 34/04 a TROU 047/95. V tloušťce lodyh TROU 63/01, TROU 047/95 a Višňovský
vícesečný. Ve znaku počet květů v květenství byly nejvyšší hodnoty zjištěny u původů PIEN
104/05, TROU 5/01 a TROU 167/95. V ţádném z těchto čtyř znaků odrůda Višňovský
vícesečný statisticky nepřekonala ţádný ze zkoušených původů.
Nejvyšší počet internodií byl zjištěn u odrůdy Višňovský vícesečný a dále následovaly
původy TAJIK 34/06 a TROU 63/01. Odrůda Višňovský vícesečný v tomto znaku statisticky
vysoce průkazně překonala původy TROU 4/01, SVN 86/01 a PIEN 104/05. Ve znaku počet
květenství na lodyze vynikl původ TROU 047/95 a dále následovaly TROU 178/94 a odrůda
Višňovský vícesečný, který v tomto znaku statisticky vysoce průkazně překonal původy
TROU 4/01, TROU 4/06 a SVN 86/01.
Zajímavých výsledků bylo dosaţeno u dvou původů vičence písečného (Onobrychis
arenaria). Tento druh, rostoucí v přírodě na výhřevných, výsušných a chudých půdách,
dosáhl v našich podmínkách výsledků srovnatelných s původy kulturního druhu Onobrychis
viciifolia, především ve výšce trsu a délce lodyh. Původ označený TROU 4/01 byl statisticky
vysoce průkazně překonán odrůdou Višňovský vícesečný ve znacích zelená hmota trsu, suchá
hmota trsu, plocha listu, tloušťka lodyhy, počet internodií a počet květenství na lodyze. Druhý
původ, označený TROU 4/06 byl odrůdou statisticky vysoce průkazně překonán pouze ve
znacích plocha listu a počet květenství na lodyze.
Přehled zjištěných hodnot variačních koeficientů pro rozsáhlost neuvádíme a omezíme se
pouze na stručné slovní zhodnocení. Největší variabilita byla zjištěna u znaků zelená hmota
trsu (29,7 – 76,8 %), suchá hmota trsu (26,3 – 67,5 %) a počet květenství na lodyze (15,8 –
51,1 %). Naopak největší vyrovnanost byla zaznamenána u znaků tloušťka lodyhy (8,9 – 25,6
%), výška rostliny (8,3 – 19,0 %), počet internodií na lodyze (8,3 – 25,5 %) a délka lodyh od
7,9 do 18,6 %. U ostatních znaků se hodnoty variačních koeficientů pohybovaly následovně:
u plochy listu od 14,1 do 30,9 %, u počtu lodyh od 20,1 do 58,1 % a u počtu květů
v květenství od 16,1 do 40,0 %. Z pohledu jednotlivých zkoušených původů lze konstatovat,
ţe odrůda Višňovský vícesečný vykázala poměrně vysokou vyrovnanost ve sledovaných
znacích. V rámci zkoušeného sortimentu byly zjištěny původy s vysokou a naopak nízkou
variabilitou v hodnoceném znaku.
182
„Úroda 12/2011, vědecká příloha―
Závěr
Z uvedeného je zřejmé, ţe plané formy vičence jsou cenným zdrojem materiálů pro
šlechtitelské vyuţití. Hodnoty některých hodnocených znaků jsou jednak vyšší oproti
hodnotám odrůdy Višňovský vícesečný ale i variabilita v rámci původů je u některých znaků
vysoká, coţ dává předpoklad úspěšné selekce. Také u druhu Onobrychis arenaria lze
předpokládat jeho vyuţití ve šlechtění, především pro jeho jemnější lodyhy. V příznivých
půdních podmínkách je tento druh schopen se přiblíţit kulturnímu druhu Onobrychis
viciifolia. Data získaná při hodnocení sortimentu rodu Onobrychis poslouţí při vytváření
klasifikátoru pro hodnocení rodu.
Dedikace
Výsledek byl získán za částečné institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace a částečně z prostředků Národního programu konzervace a vyuţití
genetických zdrojů kulturních rostlin a agrobiodiverzity, financovaného MZe ČR.
Literatura
Onobrychis viciifolia, URL: http://botanika.wendys.cz - 20.6. 2011
Regál, V., Krajčovič, V. (1963): Pícninářství. Státní zemědělské nakladatelství, Praha, 1963,
s. 77-81.
Višňovský, URL: http://www.agrogen.cz/ - 26.7.2011
Kontaktní adresa:
Ing. Jan Pelikán, CSc.
Zemědělský výzkum, spol. s r.o.
Zahradní 1, 66441 Troubsko
[email protected]
183
„Úroda 12/2011, vědecká příloha―
Tab. 1: Přehled bodových odhadů střední hodnoty zkoušených původů v jednotlivých znacích
druh
Onobrychis viciifolia
Onobrychis viciifolia
Onobrychis viciifolia
Onobrychis viciifolia
Onobrychis viciifolia
Onobrychis arenaria
Onobrychis viciifolia
Onobrychis viciifolia
Onobrychis viciifolia
Onobrychis arenaria
Onobrychis viciifolia
Onobrychis viciifolia
Onobrychis viciifolia
označení
Višňovský
TROU 047/95
TROU 167/95
TROU 32/97
BK 15/95
TROU 4/01
TROU 5/01
TROU 178/94
TROU 63/01
TROU 4/06
SVN 86/01
TAJIK 34/06
PIEN 104/05
hmotnost hmotnost
stát
trsu
trsu
plocha výška počet délka tloušťka
počet
původu zel. hm. such. hm. listu
trsu lodyh lodyh lodyhy internodií
CZE
CZE
CZE
CZE
CZE
CZE
CZE
CZE
CZE
SVN
TJK
SVK
(kg)
0,39
0,35
0,36
0,38
0,33
0,16
0,39
0,27
0,49
0,12
0,40
0,39
0,46
(kg)
0,10
0,09
0,08
0,08
0,08
0,04
0,10
0,06
0,14
0,03
0,08
0,10
0,09
(cm2)
39,01
30,26
38,07
43,32
31,77
15,61
27,03
38,19
40,19
25,95
29,40
51,12
34,15
184
(cm)
87,1
99,0
65,2
67,3
56,1
81,0
75,6
55,2
89,8
59,5
57,4
91,7
50,1
32,8
23,3
27,3
28,1
42,5
29,4
35,5
29,7
40,1
14,5
43,3
24,5
55,4
(cm)
76,65
81,85
68,10
64,80
59,10
64,06
80,75
61,50
90,05
79,00
65,10
89,35
58,60
(mm)
5,89
5,96
5,84
5,56
4,53
3,66
5,59
5,10
6,09
4,95
5,22
5,20
5,09
9,4
7,2
7,9
7,3
6,6
6,5
8,3
7,5
8,4
7,0
6,1
8,5
5,6
počet
počet
květenství květů v
na
květenství
lodyze
13,5
13,6
10,2
9,6
6,7
6,1
10,9
13,6
9,0
5,3
6,9
9,2
9,6
69,7
73,5
75,1
74,5
72,0
63,8
79,5
57,5
68,4
57,5
68,9
53,9
97,1
„Úroda 12/2011, vědecká příloha―
ZHODNOCENÍ NĚKTERÝCH VÝNOSOVÝCH A
MORFOLOGICKÝCH CHARAKTERISTIK V KOLEKCI DRUHU
ANTHYLLIS VULNERARIA
Evaluation of some yield and morphological characteristics in the collection
of Anthyllis vulneraria
Raab S.1, Pelikán J.2
1
2
Zemědělský výzkum, spol. s r.o., Troubsko
Výzkumný ústav pícninářský, spol. s r.o., Troubsko
Abstrakt
V individuálních výsadbách byla hodnocena kolekce druhu Anthyllis vulneraria z hlediska některých
výnosových a morfologických charakteristik. Byly hodnoceny dvě české odrůdy a 24 planých forem
získaných v minulých letech sběrovými expedicemi v tuzemsku i zahraničí. Celkově bylo hodnoceno
devět znaků na 10 rostlinách kaţdého původu a byly zjištěny bodové a intervalové odhady střední
hodnoty a variační koeficienty.
Klíčová slova: Anthyllis vulneraria; výnosové charakteristiky; morfologické charakteristiky;
variabilita
Abstract
Some yield and morphological characteristics of the Anthyllis vulneraria collection in individual
plants were assessed. Two Czech varieties and 24 wild origins gathered in the past years within both
domestic and foreign collecting expeditions were evaluated. Nine characters on ten plants of each
origin were assessed. Point and interval estimations of mean value and variation coefficients were
calculated.
Key words: Anthyllis vulneraria; yield characteristics; morphological characteristics; variability
Úvod
Rod Anthyllis čítá zhruba 20 druhů, které se vyskytují v Evropě, severní Africe a Přední Asii. Preferují
suchá stanoviště s půdami bohatými na vápno. Většinou se jedná o středně velké byliny, polokeře a
keře, poměrně hustě chlupaté. Zemědělsky vyuţívaný je doposud pouze druh Anthyllis vulneraria.
V české kolekci, uloţené v genové bance je v současné době 19 poloţek, z toho je Anthyllis vulneraria
zastoupen 17 poloţkami. Po jedné poloţce jsou pak zastoupeny druhy Anthyllis tetraphylla a Anthyllis
variegata. Zástupce rodu vyskytující se na území České republiky uvádějí Slavík et al. (1995). Dva
zástupce rodu zkoušel Vacek (1963). Poloţky uloţené v genové bance nejsou doposud
popsány z hlediska morfologického a výnosového, protoţe pro tento druh u nás neexistuje
klasifikátor. Výsledky uvedené v příspěvku poslouţí jako základ připravovaného českého
klasifikátoru.
Materiál a Metody
Hodnocení bylo prováděno na 10 rostlinách kaţdého původu váţením, měřením a počítáním a
získaná data byla statisticky hodnocena pomocí bodového a intervalového odhadu střední
hodnoty a odhadu variačního koeficientu. Intervalový odhad střední hodnoty umoţňuje
posoudit existenci statistických rozdílů mezi středními hodnotami původů a variační
koeficient udává míru proměnlivosti původu v daném znaku.
Výsledky a diskuze
Bodové odhady středních hodnot jednotlivých původů ve sledovaných znacích jsou uvedeny
v tab. 1. Intervalové odhady středních hodnot, které slouţí k posouzení statistických rozdílů
185
„Úroda 12/2011, vědecká příloha―
mezi hodnocenými původy pro rozsáhlost neuvádíme, ale budou pouze slovně komentovány.
Stejně neuvádíme odhady variačních koeficientů.
V hmotnosti trsu v zelené hmotě vynikl původ CZETROU 255/95, avšak statisticky průkazný
rozdíl mezi tímto původem a zkoušenými odrůdami Třebíčský a Pamir zjištěn nebyl. Stejná
situace nastala také u znaků počet květů v květenství a plocha listu. Naopak ve znaku tloušťka
lodyh překonal tento původ statisticky vysoce průkazně obě zkoušené odrůdy. V hmotnosti
trsu v suché hmotě byl zjištěn nejvyšší výnos u odrůdy Třebíčský a rozdíl mezi touto odrůdou
a odrůdou Pamir byl statisticky neprůkazný. Naopak ve znaku délka lodyh opět dominovala
odrůda Třebíčský, avšak mezi ní a odrůdou Pamir byl zjištěn statisticky vysoce průkazný
rozdíl. Ve výšce trsu byla nejvyšší střední hodnota zaznamenána u odrůdy Pamir a nebyl
zjištěn statistický rozdíl mezi touto odrůdou a odrůdou Třebíčský. Ve znaku počet lodyh
v trsu dominoval původ označený sběrovým číslem CZESUM 287/94 a tento statisticky
vysoce průkazně překonal odrůdu Pamir. Konečně v počtu květenství na lodyze byl nejvyšší
počet zaznamenán u původu se sběrovým číslem CZETROU 51/01 a tento původ statisticky
vysoce průkazně překonal odrůdu Pamir.
Druh Anthyllis vulneraria se vyznačoval vyšší nevyrovnaností uvnitř hodnocených původů.
Zjištěné hodnoty variačních koeficientů pro rozsáhlost neuvádíme, pouze v tab. 2 jsou
uvedeny tyto hodnoty pro české odrůdy Třebíčský a Pamir. Nejvyrovnanější byly zkoušené
původy ve znacích počet květů v květenství (Vx: 7,5 – 15,7 %), délka lodyh (9,1 – 39,9 %) a
plocha listu (13,6 – 44,9 %). Naopak největší variabilita se ukázala u znaků hmotnost trsu
v zelené hmotě (46,2 – 78,7 %) a hmotnost trsu v suché hmotě (29,0 – 83,0 %). U znaku
výška trsu se variační koeficienty pohybovaly od 7,6 do 60,7 %, u počtu lodyh od 17,4 do
62,5 %, tloušťky lodyh od 10,71 do 47,53 % a u počtu květenství na lodyze od 14,5 do 67,1
%. Při porovnání variability uvnitř původů u odrůd Třebíčský a Pamir byla větší vyrovnanost
zjištěna u staré odrůdy Třebíčský, oproti nové odrůdě Pamir, i kdyţ rozdíly nebyly výrazné.
Z devíti hodnocených znaků vykázala odrůda Třebíčský vyšší vyrovnanost v sedmi znacích.
Pouze u znaků hmotnost trsu v suché hmotě a plocha listů vykázala větší vyrovnanost odrůda
Pamir. Vysoká variabilita obou zkoušených odrůd ve srovnání s planými formami byla
zjištěna u znaků hmotnost trsu v suché hmotě a počet květů v květenství, naopak niţší
hodnoty variačních koeficientů zkoušených odrůd byly zjištěny u znaků hmotnost trsu
v zelené hmotě, výška trsu, délka lodyh a tloušťka lodyh.
Závěr
Uvedené výsledky ukazují, ţe plané formy úročníku jsou cenným zdrojem materiálů pro
šlechtitelské vyuţití. Hodnoty některých hodnocených znaků jsou jednak vyšší oproti
hodnotám odrůd Třebíčský a Pamir, ale také variabilita v rámci původů je u některých znaků
vysoká, coţ dává předpoklad úspěšné selekce. Data získaná při hodnocení sortimentu druhu
Anthyllis vulneraria poslouţí spolu s daty dalších druhů rodu ke tvorbě klasifikátoru pro
hodnocení rodu.
Dedikace
Výsledky byly získány za částečné institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace a částečně z prostředků Národního programu konzervace a vyuţití
genetických zdrojů kulturních rostlin a agrobiodiverzity, financovaného MZe ČR.
Pouţitá literatura
http://genbank.vurv.cz/genetic/resources/
Slavík B. et al. (1995): Květena České republiky. Díl 4., Academia, Praha
186
„Úroda 12/2011, vědecká příloha―
Vacek V. (1963): Studium, udrţování a vyuţití světových sortimentů pícních rostlin. I. Planá
flóra, A. Čeleď motýlokvěté (Papilionaceae). Dílčí závěrečná zpráva, Výzkumná stanice
pícninářská v Troubsku.
Tab. 1: Přehled bodových odhadů středních hodnot zkoušených původů v jednotlivých
hodnocených znacích
počet
nost nost
tloušť- květen- květů v
trsu trsu plocha výška počet délka
ka
ství květenz. hm. s. hm. listu trsu lodyh lodyh lodyhy na
ství
(kg) (kg) (cm2) (cm)
(cm) (mm) lodyze
hmot- hmot-
Pamir
Třebíčský
CZETROU 13/03
CZEBES 515/99
CZEBES 560/99
SVNJULALP 288/99
SVNTRG 18/00
HRVISTRA 17/02
CZEPAL 79/03
SVKPIEN 13/05
SVKPIEN 14/05
SVKPIEN 60/05
CZEPAN 43/07
CZEPAN 57/07
CZEPAN 82/07
CZEPAL 101/03
CZETROU 6/03
SVKMUR 41/04
CZETROU 255/95
SVKPIEN 94/05
SVKROH 131/00
CZETROU 51/01
CZETROU 61/96
182/1996
CZESUM 287/94
BZ Salzburg
0,21
0,42
0,25
0,26
0,34
0,15
0,15
0,16
0,13
0,21
0,29
0,42
0,45
0,30
0,55
0,18
0,16
0,16
0,59
0,44
0,19
0,34
0,30
0,47
0,48
0,29
0,04
0,13
0,04
0,05
0,07
0,03
0,03
0,03
0,02
0,04
0,06
0,09
0,09
0,06
0,11
0,04
0,03
0,03
0,09
0,08
0,04
0,08
0,06
0,10
0,10
0,05
počet
23,50
18,07
28,71
11,79
17,32
12,01
15,66
13,63
16,52
16,28
19,88
20,19
22,54
18,52
21,85
20,06
15,55
19,48
27,56
22,99
22,99
20,68
18,03
17,38
16,62
22,66
57,70
51,00
23,17
26,25
31,44
9,10
11,71
33,38
15,10
12,20
30,30
31,00
33,30
31,57
36,40
13,75
20,60
18,00
34,00
33,90
16,30
47,14
40,17
41,30
38,00
37,25
187
70,3
113,2
43,8
70,3
81,0
64,2
53,9
65,9
28,7
71,5
87,0
85,1
86,1
68,0
126,1
55,8
51,8
59,5
100,6
123,6
71,6
68,9
87,8
112,5
154,7
90,3
32,5
51,8
33,0
45,6
40,2
32,8
29,1
26,9
25,1
23,8
40,7
42,6
47,6
37,9
46,4
27,1
25,1
28,4
48,4
41,1
24,8
43,6
42,6
48,9
43,6
42,3
3,04
3,19
4,42
2,88
3,30
2,64
2,30
2,50
2,85
2,78
3,00
3,90
3,89
3,39
3,81
2,63
2,67
3,34
4,51
3,10
3,09
3,12
2,72
3,27
3,15
3,37
8,0
11,8
5,5
11,3
10,7
10,1
8,4
8,6
8,9
7,7
11,0
11,9
13,5
11,4
14,1
8,3
8,4
9,1
13,4
9,4
9,5
14,7
10,7
11,3
7,1
10,5
24,8
24,5
33,2
23,8
28,8
18,9
17,1
16,6
24,1
31,4
26,1
32,0
30,2
25,0
31,7
11,0
23,6
22,1
36,8
25,1
24,1
23,7
23,2
25,1
21,8
20,0
„Úroda 12/2011, vědecká příloha―
Tab. 2: Porovnání hodnot variačních koeficientů (v %) mezi odrůdami Třebíčský a Pamir
Znak
Hmotnost trsu v zelené hmotě
Hmotnost trsu v suché hmotě
Plocha listu
Výška trsu
Počet lodyh v trsu
Délka nejdelší lodyhy
Tloušťka lodyhy
Počet květenství na lodyze
Počet květů v květenství
Kontaktní adresa:
Ing. Simona Raab
Zemědělský výzkum, spol. s r.o.
Zahradní 1
66441 Troubsko
[email protected]
188
Třebíčský
46,25
82,99
32,43
7,62
35,53
13,40
21,21
28,75
13,50
Pamir
56,79
47,22
29,66
9,84
39,59
17,86
23,51
32,81
15,73
„Úroda 12/2011, vědecká příloha―
ÚPRAVA OSIVA METODOU iSEED A JEJÍ VLIV NA KLÍČENÍ A
POČÁTEČNÍ VÝVOJ LIPNICE LUČNÍ A KOSTŘAVY ČERVENÉ
The influence of iSeed treatment on the germination and initial
development of kentucky bluegrass and red fescue
Sochorec M., Knot P.
Ústav výţivy zvířat a pícninářství, AF, Mendelova univerzita v Brně
Abstrakt
V laboratorních podmínkách byl sledován vliv úpravy obilek metodou iSeed na dynamiku klíčení,
celkovou klíčivost a délku nadzemní a kořenové části u odrůd kostřavy červené - Darwin, Moccasin a
lipnice luční - Yvette, Miracle. Z výsledků je zřejmé, ţe ošetření metodou iSeed nemělo průkazný vliv
na prakticky všechny sledované charakteristiky. Na rychlost klíčení mělo ošetření iSeed spíše
negativní vliv, ale hodnoty celkové klíčivosti nebyly průkazně odlišné. Délka nadzemní části byla
větší u ošetřených odrůd Yvette, Miracle a Darwin. Naproti tomu ošetřená odrůda Mocassin měla
statisticky průkazně kratší nadzemní část. U délek kořenové části nebyly zjištěny průkazné rozdíly.
Klíčová slova: ošetření osiva, klíčivost, iSeed
Abstract
The influence of iSeed treatment on the dynamics of germination, total germinability, root length and
above-ground biomass of the varieties of red fescue - Darwin, Mocassin, and kentucky bluegrass Yvette, Miracle was observed in laboratory. The results indicated that the treatment method iSeed did
not have significantly effect on almost all observed characteristic. The influence of iSeed on
germination rate was rather negative, but the values of the total germination were not significantly
different. Length of the above-ground parts were found greater for Yvette, Miracle a Darwin treated by
iSeed. In contrast, for variety Mocassin the length of the above-ground parts was statistically
significantly shorter. In the case of the root lengths, there were not found any statistically significant
differences.
Key words: seed treatment, germination, iSeed
Úvod
V současné době se při zakládání trávníků vyuţívají různými metodami upravená osiva, která
by měla mít v porovnání s neupravenými osivy zlepšenou polní vzcházivost (ČERNOCH,
2009). Mezi tato ošetření patří rovněţ i metoda iSeed. Je zaloţená na obalení obilek hnojivem.
Vzcházející rostlina má ţiviny ihned k dispozici díky tomu, ţe se nacházejí v její nejtěsnější
blízkosti. Ţiviny se uvolňují postupně a nedochází tedy k poškození rostlin jejich vysokou
koncentrací.
Metodou iSeed se dostane na hektar vyseté plochy aţ 40 kg hnojiva. Výhodou této úpravy je
snadnější výsev, lepší kontakt s půdou a při přesevu poškozeného trávníku lepší pronikání
obilek přes nadzemní část drnu, ochrana před odfouknutím větrem a před ztrátami poţerem
ptáků (KNOT, 2008).
Materiál a metodika
V laboratorních podmínkách byl sledován vliv úpravy obilek metodou iSeed na dynamiku
klíčení, celkovou klíčivost a délku nadzemní a kořenové fytomasy u odrůd kostřavy červené Darwin, Moccasin a lipnice luční - Yvette, Miracle. Na Petriho misky s navlhčeným
filtračním papírem bylo umístěno pro kaţdou variantu 20 obilek ve třech opakováních. Pokus
byl zaloţen na klíčidle TZ 8-046, kde byl nastaven denní reţim 16 hodin při teplotě 25 °C a
noční reţim 8 hodin při teplotě 15°C. Počet vyklíčených obilek byl sledován 7., 10., 13., 16. a
20. den po zaloţení. Po ukončení pokusu 20. den bylo z kaţdé varianty vybráno 5 největších
jedinců, u kterých byla změřena výška nadzemní fytomasy a délka kořene. Poněvadţ byly
189
„Úroda 12/2011, vědecká příloha―
výsledky klíčení ve formě relativní četnosti a zjištěné procentické hodnoty nejdou vyjádřit
pomocí Gaussova rozdělení, bylo provedeno přepočítání pomocí Arcussinus-odmocninné
transformace (GOMEZ a GOMEZ, 1984). K testu signifikace byla pouţita ANOVA
(STATISTIKA, verze 8) a následný Tukeyův test (p≤0,05).
Výsledky a diskuze
Z výsledků pokusu (tabulka 1, 2) je zřejmé, ţe vliv ošetření metodou iSeed zvyšuje hodnoty
celkové klíčivosti kostřavy červené u odrůdy Darwin (+1 %) a u lipnice luční Yvette (+7,6
%). Rozdíly v klíčivosti jsou však v obou případech statisticky neprůkazné. Naproti tomu u
kostřavy červené ošetřené Mocassin byly hodnoty u ošetřené varianty niţší o 7,1 % a rovněţ u
lipnice luční Miracle, byl počet vyklíčených obilek niţší o 8 %. Ani zde ale nebylo prokázáno
průkazné sníţení klíčivosti. KNOT (2010) při ověřování vlivu ošetření obilek metodou
Proradix u lipnice luční (Yvette a Miracle) zjistil rovněţ statisticky neprůkazné zvýšení
klíčivosti. Rychlejší nástup klíčení byl zjištěn u všech neošetřených variant, coţ je zřejmě
způsobeno absencí obalové vrstvy, která můţe bránit pronikání vody v počáteční fázi klíčení.
V celkovém průběhu klíčení (průměr obou odrůd) nebyl zjištěn průkazný rozdíl mezi
ošetřenou a neošetřenou variantou.
Dvacátý den po zaloţení pokusu byly měřeny délka nadzemní fytomasy a délky kořenů (graf
2 a 3). Nadzemní část byla u neošetřeného osiva Mocassin průkazně delší o 14 mm. Průkazný
rozdíl v délce nadzemní části byl sledován mezi pouţitými odrůdami lipnice luční. V průměru
odrůd byla délka nadzemní a kořenové části větší u ošetřené varianty lipnice luční. Naproti
tomu odrůdy kostřavy červené byly v případě pouţití ošetření kratší. Zjištěné délky nadzemní
a kořenové části nebyly statisticky průkazné (graf 1).
Tabulka 1: Dynamika klíčení a hodnoty celkové klíčivosti kostřavy červené
Varianta
7. den
10. den 13. den 16. den 20. den
Darwin iSeed
52,9 ab 56,8 a
59,0 a
59,0 a
59,0 a
Darwin
56,0 b
57,0 a
57,0 a
57,0 a
58,0 a
Mocassin iSeed 38,2 a
45,0 a
47,9 a
48,8 a
48,8 a
Mocassin
46,9 ab 48,9 a 53,9 a 55,9 a 55,9 a
Různá písmena ve sloupcích představují statisticky průkazný rozdíl, Tukeyův test (p≤0,05)
Tabulka 2: Dynamika klíčení a hodnoty celkové klíčivosti lipnice luční
Varianta
7. den 10. den 13. den 16. den 20. den
Yvette iSeed 29,9 a 53,1 ab 66,0 ab 66,0 ab 67,2 a
Yvette
37,2 a 47,9 a 56,3 a 56,3 a 59,6 a
Miracle iSeed 53,8 b 67,4 bc 70,1 ab 70,1 ab 70,1 a
Miracle
53,8 b 73,8 c 78,1 b 78,1 b 78,1 a
Různá písmena ve sloupcích představují statisticky průkazný rozdíl, Tukeyův test (p≤0,05)
190
„Úroda 12/2011, vědecká příloha―
Graf 1: Porovnání délek nadzemní a kořenové části u kostřavy červené a lipnice luční
(průměr odrůd)
Různá písmena ve sloupcích představují statisticky průkazný rozdíl, Tukeyův test (p≤0,05)
Graf 2: Délka nadzemní a kořenové fytomasy u kostřavy červené
Délka (mm)
b
ab
80,0
ab
a
60,0
A
A
Darwin
iSeed
Darwin
A
A
výška nadzemní
části (mm)
délka kořenové
části (mm)
40,0
20,0
0,0
Mocassin
iSeed
Mocassin
Různá písmena ve sloupcích představují statisticky průkazný rozdíl, Tukeyův test (p≤0,05)
Graf 3: Délka nadzemní a kořenové fytomasy u lipnice luční
b
60,0
Délka (mm)
50,0
a
výška nadzemní
části (mm)
a
40,0
30,0
b
A
A
A
A
délka kořenové
části (mm)
20,0
10,0
0,0
Yvette
iSeed
Yvette
Miracle
iSeed
Miracle
Různá písmena ve sloupcích představují statisticky průkazný rozdíl, Tukeyův test (p≤0,05)
191
„Úroda 12/2011, vědecká příloha―
Závěr
Byl zjištěn statisticky neprůkazný vliv ošetření metodou iSeed na klíčivost obilek kostřavy
červené a lipnice luční. Ošetření zvýšilo klíčivost u odrůd Darwin (+1 %) a Yvette (+6,7 %)
ale sníţilo klíčivost u odrůd Mocassin (-7,1 %) a Miracle (-8 %). Délka nadzemní fytomasy
byla průkazně větší u neošetřené odrůdy Mocassin o 21,6 %. Pozitivní vliv ošetření na
klíčivost i rychlost počátečního vývoje se nepodařilo prokázat. Tato metoda ošetření se ale
můţe pozitivně projevit v pozdějším stádiu vývoje, coţ bude předmětem dalšího výzkumu.
Dedikace
Příspěvek byl zpracován s podporou Výzkumného záměru č. MSM6215648905 „Biologické a
technologické aspekty udrţitelnosti řízených ekosystémů a jejich adaptace na změnu klimatu―
uděleného Ministerstvem školství, mládeţe a tělovýchovy České republiky.
Pouţitá literatura
Černoch V., (2009): Nové technologie přípravy osiv. In HRABĚ, F. et al., Trávníky pro
zahradu, krajinu a sport, 1 vyd., Olomouc: Vydavatelství Ing. Petr Baštan, s 62-64.
Gomez, K. A.
, Gomez, A. A., (1984): Statistical procedures for agricultural research. 2nd ed. J. Willey &
Sons, New York, Chichester, Brisbane, Toronto.
Knot P., Vrzalová J., Hrabě F., (2008): Moderní technologie ošetření obilek lipnice luční.
Zahradnictví : Záhradníctvo : Měsíčník pro profesionální zahradníky. Odborný
recenzovaný časopis. sv. 7/2008, č. 7, s. 40-41. ISSN 1213-7596.
Knot P., (2010): Vliv odrůdy a stáří osiva na klíčivost lipnice luční. Úroda. sv. LVIII,
č. 9/2010, s. 42-44. ISSN 0139-6013.
Statsoft Inc., (2007): Statistica data analysis software system, version 8.0., www.statsoft.com
Kontaktní adresa:
Ing. Martin Sochorec
Mendelova univerzita v Brně
Zemědělská 1, 613 00 Brno
[email protected]
192
„Úroda 12/2011, vědecká příloha―
IDENTIFIKACE HMW- A LMW- GLUTENINOVÝCH PODJEDNOTEK
METODOU HPLC/UV PRO ÚČELY URČOVÁNÍ ODRŦD PŠENICE
The identification of HMW- and LMW- glutenin subunits for wheat variety
determination using HPLC/UV
Štočková L.
Výzkumný ústav rostlinné výroby, v.v.i., Praha – Ruzyně
Abstrakt
Komparativní HPLC/UV analýzou souboru 30 odrůd pšenice se známým gluteninovým sloţením byly
stanoveny retenční časy píků charakterizujících vybrané HMW- a LMW- gluteninové podjednotky.
Celkem bylo identifikováno 11 HMW-gluteninových podjednotek a 11 LMW-gluteninových
podjednotek vyskytujících se na lokusech Glu- A1, Glu-B1 a Glu-D1, resp. Glu-A3, Glu-B3 a Glu-D3.
Na lokusu Glu-D1 nebylo moţno odlišit HMW podjednotky 3+12 od podjednotek 2+12 a na lokusu
Glu-A1 podjednotku 2* od podjednotky 1. Podobně identické byly píky charakterizující LMW
podjednotky f a g na lokusu Glu-B3. Metodu je i přesto moţné pouţít pro identifikaci odrůdy
porovnáním chromatogramu se standardem, stejně jako ke stanovení gluteninového sloţení
neznámého vzorku. Výhodou oproti pouţití klasické SDS-PAGE elektroforézy jsou rychlost,
bezpečnost analýz a moţnost automatizace metody.
Klíčová slova: pšenice, glutenin, identifikace odrůdy, HPLC
Abstract
The retention times of peaks that represent particular HMW- and LMW-glutenin subunits were
determined using comparative HPLC/UV analysis of the 30 different wheat varieties with a known
glutenin patterns. 11 HMW- and 11 LMW-glutenin subunits occurring in Glu- A1, Glu-B1 a Glu-D1,
Glu-A3, Glu-B3 a Glu-D3 loci resp. were identified. Regarding HWM glutenins, in Glu-1D locus,
subunit 3+12 could not be distinct from 2+12 and in Glu-1A locus, subunit 2* could not be distinct
from subunit 1. Same situation was noticed in LMW-glutenin subunit g and f in allele Glu-B3. In spite
of this problem, presented method can be used for variety identification using comparative analysis of
standard sample as well as for the glutenin patterns determination in unknown sample. Faster and safer
work and prompt and digitalized results are the advantages of chromatographic method in compare to
SDS-PAGE electrophoresis.
Keywords: wheat, glutenin, variety identification, HPLC
Úvod
Gluteniny patří mezi zásobní proteiny pšenice a jako skupina jsou charakterizovány svou
rozpustností ve slabě zředěných kyselinách a zásadách. Jsou tvořeny polymerními řetězci
bílkovin dosahujících hmotnosti řádově desítky aţ stovky kilodaltonů. Působením redukčních
činidel (např. DTT) se rozpadají na vysokomolekulární (HMW-GS) a nízkomolekulární
(LMW-GS) podjednotky.
Gluteniny mají spolu s gliadiny zásadní význam pro technologickou kvalitu zrna a konkrétní
sloţení podjednotek charakterizuje danou odrůdu, proto je vývoj metod stanovujících tyto
podjednotky stále aktuální (Payne et al., 1988; Holt et al., 1988). Osvědčenou metodou pro
stanovení HMW- i LMW- podjednotek gluteninů je SDS elektroforéza v polyakrylamidovém
gelu (SDS-PAGE). Alternativou poskytující především sníţení doby analýzy a omezení
expozice nebezpečnými chemikáliemi pouţívanými při přípravě vzorku a analýze metodou
SDS-PAGE jsou chromatografické metody, tj. SE-HPLC (Huebner et al., 1991) a RP-HPLC
(Wang et al., 2006).
Zatímco elektroforetické metody a SE-HPLC separují gluteniny především podle velikosti
bílkovinného řetězce, RP-HPLC metoda rozděluje bílkoviny podle afinity k oktadecylové
stacionární fázi, tedy prakticky podle polarity molekuly v poměru k její velikosti (Sadouki et
193
„Úroda 12/2011, vědecká příloha―
al., 2005). Identifikace podjednotek na výsledném chromatogramu je proto obtíţná a nelze při
ní příliš vycházet z uspořádání pruhů při pouţití SDS-PAGE (Wiesner et al., 1998; Naeem,
Sapirstein, 2007).
Pro vyuţití HPLC/UV metody ke kvalitativním analýzám, konkrétně pro určování odrůd, je
nutné identifikovat píky charakterizující jednotlivé podjednotky, které se vyskytují
v sortimentu pšeničných odrůd pěstovaných v ČR. Charakteristické píky je třeba určit pomocí
retenčního času za stanovených chromatografických podmínek.
Materiál a metody
Pro identifikaci nejběţnějších podjednotek byl vybrán soubor třiceti domácích a zahraničních
odrůd uspořádaných do párů lišících se mezi sebou v HMW nebo LMW gluteninovém sloţení
vţdy pouze v jedné podjednotce. Opakovaným porovnáváním chromatogramu takových párů
pak byly identifikovány píky příslušející rozdílným podjednotkám HMW- a LMW- gluteninů.
Jednotlivé analýzy byly provedeny ve třech opakováních.
Pro přípravu vzorku a chromatografickou analýzu byla pouţita modifikovaná metoda dle
Naeema et. al. (2007). Krátce, 50 mg vzorku bylo pro odstranění albuminů, globulinů a
gliadinů extrahováno třikrát 500 µl 50% propanolu po dobu 15 minut. Po kaţdé extrakci byl
vzorek centrifugován a supernatant odstraněn. Peleta byla následně extrahována extrakčním
pufrem (tj. směsí 50% propanolu s pufrem TRIS: HCl s pH 7,6 v poměru 1:1). K peletě bylo
přidáno 150 µl 1% dithiotreitolu v extrakčním pufru, vzorek byl homogenizován a ponechán
reagovat po dobu 30 minut při 60 °C. K této suspenzi bylo přidáno 150 µl 4% 4-vinylpyridinu
v extrakčním pufru a suspenze opět zahřívána na teplotu 60 °C po dobu 30 minut. Po
centrifugaci bylo 150 µl supernatantu odebráno k analýze HMW a LMW gluteninových
podjednotek a ke zbytku přidáno 200 µl acetonu. Reakce supernatantu s acetonem probíhala
10 minut a suspenze byla opět centrifugována. 150 µl supernatantu bylo odebráno pro analýzu
LMW gluteninových podjednotek. Supernatant u všech vzorků před i po sráţení acetonem byl
analyzován za pouţití stejných chromatografických podmínek tak, aby bylo moţné určit
oblast HMW a LMW gluteninů. Vzorky byly analyzovány na koloně Zorbax Poroshell
300SB-C8 75 x 2,1 mm a jako mobilní fáze byla pouţita směs acetonitrilu a vody
v přítomnosti 0,1% trifluoroctové kyseliny (TFA) s gradientovou elucí (viz tab. 1). Průtok
mobilní fáze byl konstantně 0,7 ml/min a objem nástřiku 4 µl. Gluteninové podjednotky byly
detekovány UV spektrometrickou detekcí při vlnové délce 210 nm. Pro zpracování byl pouţit
chromatografický software Empower.
Tab. 1: Průběh gradientové eluce
Čas(min) 0
1
3
11
23
23
30
44
%A
77
77
70
56
%B
A…0,1% TFA v acetonitrilu; B…0,1% TFA ve vodě
12
23
77
15
23
77
Výsledky a diskuze
Celkem bylo analyzováno a porovnáno 31 párů odrůd lišících se ve sloţení HMW gluteninů
nebo LMW gluteninů právě v jedné podjednotce. Toto porovnání umoţnilo identifikaci 11
HMW gluteninových podjednotek z celkových 13 které se vyskytovaly v analyzovaném
souboru a 11 LMW podjednotek z celkových 12 vyskytujících se v analyzovaném souboru.
Retenční časy píků charakteristických pro jednotlivé HMW a LMW gluteninové podjednotky
jsou uvedeny v tabulce 2 resp. v tabulce 3.
194
„Úroda 12/2011, vědecká příloha―
Tab. 2: Identifikované HMW podjednotky a retenční časy jejich charakteristických píků
Lokus
Glu-B1
HMW-GS
7
6+8
20
14+15
17+18
7+8
5,90
6,40
4,99
6,05
4,15
6,86
7,20
7,02
6,82
Tr (min)
Lokus
Glu-B1
Glu-D1
Glu-A1
HMW-GS
7+9
5+10
2+12
3+12
0
1
2*
7,95
8,15
6,60
5,24
6,10
NI
5,18
4,65
NI
Tr (min)
Tr…retenční čas; NI…neidentifikován charakteristický pík
Tab 3: Identifikované LMW podjednotky a retenční časy jejich charakteristických píků
Lokus
Glu-A3
Glu-B3
e
LMW-GS
a
d
f
b
9,35
9,54
10,38
10,15
10,48
8,73
10,02
Tr (min)
Glu-B3
Glu-D3
LMW-GS
d
g
j
f
a
b
c
9,89
8,14
10,08
NI
9,37
8,15
8,98
9,14
Tr (min)
Tr…retenční čas; NI…neidentifikován charakteristický pík
Na lokusu Glu-B1 nebylo moţno odlišit HMW podjednotky 3+12 od podjednotek 2+12 a
podjednotku 2* od podjednotky 1. Podobně identické byly při pouţití popsané analytické
metody LMW podjednotky Glu-B3f a Glu-B3g. To, ţe některé podjednotky nebylo moţno
rozlišit, lze připsat faktu, ţe nejsou separovány na stejném principu jako při pouţití metody
SDS a tak se jejich píky mohou překrývat.
Relativní směrodatná odchylka (RSD) se pro retenční čas pohybovala na úrovni okolo 2%,
coţ je dostatečně nízké pro identifikaci podjednotek. Absolutní plocha píků byla vysoce
proměnlivá (aţ 100%) i přesto, ţe pro analýzu bylo pokaţdé odváţeno stejné mnoţství zrna,
nicméně RSD relativní plochy píků se pohybovala v rozmezí 2,5 – 20%, coţ neztěţuje
významně identifikaci podjednotek, ale víceméně to znemoţňuje pouţití této
chromatografické metody pro kvantifikaci. Variabilitu plochy lze částečně vysvětlit
variabilitou sloţení zásobních proteinů v různých zrnech.
Chromatografické metody k analýze HMW- a LMW- podjednotek jsou jiţ delší dobu
publikovány (Huebner et al., 1994; Wiesner et al., 1998; Sadouki et al., 2005), nicméně
katalogy retenčních časů chromatografických píků dosud zveřejněny nebyly a publikované
práce se zabývají především identifikací odrůdy srovnáním analyzovaného a standardního
chromatogramu. Systematický přístup k identifikaci odrůd pomocí určení přítomnosti resp.
nepřítomnosti jednotlivých podjednotek v gluteninovém spektru však umoţňuje pouţít tuto
metodu i na vzorky neznámých odrůd a tím rozšiřuje moţnosti aplikace metody.
Závěr
Prezentovaná chromatografická metoda s UV detekcí můţe být pouţita k určení odrůdy
porovnáváním se standardními spektry, stejně jako ke kvalitativní analýze gluteninového
spektra neznámé odrůdy. Pouţití metody limituje fakt, ţe v ojedinělých případech některé
podjednotky nelze rozlišit (zřejmě kvůli jinému způsobu separace, neţ je vyuţíván při SDS
elektroforéze). Na druhou stranu má pouţití této metody několik výhod, mezi něţ patří
především moţnost automatizace, zvýšení rychlosti analýz a zvýšení bezpečnosti práce.
195
„Úroda 12/2011, vědecká příloha―
Dedikace
Tato práce byla podpořena řešením výzkumného záměru MZe ČR 0002700604 a projektu
MZe ČR – NAZV QH 92155
Pouţitá literatura
Holt A., Kratiger A.F., Carillo R.M. (1988): Relationships between seed quality
characteristics and HMW glutenin subunit composition determined using wheats grown in
Spain. Journal of Cereal Science, 7: 229-235.
Huebner F.R., Christianson D.D., Nelsen T.C., Bietz J.A. (1994): Gliadin and glutenin
analysis by SE-HPLC for wheat classification. In: Gluten Proteins, AACC, Minnesota,
USA 1994; ISBN: 0-913250-71-6.
Naeem H.A., Sapirstein H.D. (2007): Ultra-fast separation of wheat glutenin subunits by
reversed-phase HPLC using a superficially porous silica-based column. Journal of Cereal
Science, 46: 157-168.
Payne P.I., Lawrence G.J. (1983): Catalogue of alleles of the complex loci, Glu-A1, Glu-B1
and Glu-D1 which coded for high-molecular-weight subunits of glutenin in hexaploid
wheat. Cereal Research Communications, 11: 29–35.
Payne P.I., Lookhart G.L., Forsyth S.A. (1988): The high molecular weight glutenin subunit
composition of two closely related lines of wheat that have contrasting breadmaking
qualities, Journal of Cereal Science, 8: 285-288.
Sadouki H., Cazalis R., Azzout B. (2005): Fractionation of Algerian common wheat proteins
by HPLC and SDS gel electrophoresis; relationship with technological duality. LWT Food Science and Technology, 38: 829-841.
Wang Y., Liu L., Zhao H., Sun G., Guo A. (2006): Purification of wheat flour highmolecular-weight glutenin subunits by fast protein liquid chromatography. Journal of
Cereal Science, 44: 174-181.
Wieser H., Antes S., Seilmeier W. (1998): Quantitative determination of gluten protein types
in wheat flour by reversed-phase high-performance liquid chromatography. Cereal
Chemistry, 75: 644–650.
Kontaktní adresa:
Ing. Lenka Štočková
VÚRV,v.v.i., Praha – Ruzyně
Drnovská 507, 161 06 Praha 6 –Ruzyně
e-mail: [email protected]
196
„Úroda 12/2011, vědecká příloha―
CO OVLIVŇUJE VITALITU OBILEK JEČMENE?
What Influences seed vigour of barley?
Ullmannová K., Chloupek O., Pávková Z.
Mendelova univerzita v Brně, Ústav pěstování, šlechtění rostlin a rostlinolékařství
Abstrakt
Vysoká vitalita ječmene je předpokladem rychlého a vyrovnaného vzcházení a dobré sladovnické
jakosti. Cílem této práce bylo vyhodnotit vliv genotypu a prostředí na vitalitu obilek sladového
ječmene. Vitalita byla hodnocena jako procento klíčivosti za stresových podmínek při nízké teplotě
(10 °C) a za sucha (-0,2 MPa, tj. za bodu trvalého vadnutí) u 133 dihaploidních linií (DHL) ječmene
a jejich rodičů v šesti prostředích. Na proměnlivosti kvantitativně zaloţené vlastnosti, kterou vitalita
je, se podílelo prostředí (ročník a lokalita) 51 %, linie 8 % a interakce 37 % z celkové proměnlivosti.
Zrno DHL sklizené v Ţelešicích dosahovalo průměrné vitality 94 %, z Hrubčic bylo zrno vitálnější s
průměrnou hodnotou 95 %. Odrůda Derkado jako lepší rodič prokázal vyšší vitalitu z horší lokality
(Ţelešice). Uvedené výsledky jsou předpokladem pro vyuţití vitality jako selekčního kritéria ve
šlechtění; genetická proměnlivost byla pro tento znak vyšší, neţ je obvyklé pro výnos zrna (3-4%).
Klíčová slova: vitalita, sladový ječmen, klíčivost
Abstract
High seed vigour is a precondition for fast and homogenous field emergence and good malting quality
in barley. We evaluated the influence of 135 genotypes, 2 locations and 3 harvest years on grain
vigour of malting barley. The vigour was evaluated as germination percentage under stress conditions
at 10 °C and drought stress at -0,2 MPa (permanent wilting point) in 133 double haploid lines (DHL)
of barley and their parents Derkado and B83. The lines were grown in two locations and harvested in
2008 - 2010. The effects of genotypes and environments were estimated by analysis of variance. The
results showed that the vigour was influenced mostly by environment (51%), less by the lines (8%)
and their interaction (37%) of the total variation. Average seed vigour of DHL reached 94% when
harvested in Ţelešice and 95% from Hrubčice. Parental variety Derkado as better parent in seed vigour
showed higher vigour in worse location Ţelešice.
Keywords: seed vigour, malting barley, germination
Úvod
Stále proměnlivější počasí jednotlivých let vyţaduje pouţívání kvalitního osiva, které je
základem pro optimální zaloţení porostu, jeho rychlé a uniformní vzejití a předpoklad pro
budoucí kvalitní a rentabilní sklizeň. V praxi je kvalita osiva v systému certifikace osiv
vyjádřena semenářskými hodnotami jako je klíčivost, čistota, HTS, zdravotní stav, vlhkost,
odrůdová pravost a čistota. Klíčivost je objektivní test, který se hodnotí za standardních
optimálních laboratorních podmínek. Polní podmínky však pouze zřídkakdy odpovídají
podmínkám laboratorním. Rozdíl mezi laboratorní klíčivostí a polní vzcházivostí je zapříčiněn
jak vnitřními podmínkami osiva, tak kombinací faktorů vnějšího prostředí. Korelace klíčivosti
s polní vzcházivostí je často nízká a závisí na podmínkách při vzcházení a na vitalitě osiva.
Malé rozdíly v procentu klíčivosti mohou odráţet velké rozdíly v kvalitě osiva a dosud
nevyjasněný koncept vitality by k tomu měl v budoucnu přispět (Landjeva 2010).
Vitalita semen je hodnocena jako potenciál semen pro rychlé a uniformní vzejití a pro vývoj
normálního semenáčku za širokého spektra polních podmínek (Chloupek 2003). Black
a Bewley (2000) uvádějí, ţe vitalita není jednoduše měřitelná vlastnost, ale pojem popisující
několik charakteristik, které zahrnují rychlost a jednotnost klíčit a růst, toleranci ke stresovým
podmínkám po zasetí a délku udrţení vitality během skladování. Existují testy vitality, které
měří pouze jeden faktor, a proto nespolehlivě určují vitalitu semen. Jen kombinace několika
faktorů můţe dát dobrou předpověď polní vzcházivosti (Hampton a Coolbear 1990) právě
197
„Úroda 12/2011, vědecká příloha―
proto, ţe vitalita je dána mnoha faktory. Vhodné jsou pouze takové testy, které mají
významný vztah mezi laboratorním testem vitality a polním výnosem nebo skladovacím
potenciálem a jestliţe tyto vztahy jsou těsnější neţ mezi laboratorní klíčivostí a výnosem na
poli (ISTA 2001).
Vitalita je ovlivněna jak genetickými, tak enviromentálními podmínkami (Bewley 2000, aj.).
Výzkumu vlivu prostředí na vitalitu semen se věnovalo a věnuje značné úsilí (Sinniah et al.
1998), avšak genetická kontrola vitality je méně známá. Proto se v posledních letech
soustřeďuje značné úsilí i na studium heritability (Edney a Mather 2004) a jsou jiţ známy
i QTL související s vitalitou obilovin (Landjeva 2010), které mohou být pomocníkem pro
šlechtitelskou praxi, protoţe je z nich patrné, se kterými vlastnostmi je v genetické vazbě.
Kvalita a vitalita zrna ječmene jarního hraje důleţitou roli při sladování, neboť poţadavky
zpracovatelského průmyslu na kvalitu zrna sladového ječmene jsou stanoveny v normě ČSN
461100-5, která poţaduje 98 % klíčivost. Vysoká vitalita je předpokladem dobré kvality
semen a dobrého skladovacího potenciálu i rychlého a homogenního klíčení. Pouze zdravá
semena mohou dosáhnout vysoké vitality semen (Chloupek 2003). Nízká klíčivost negativně
ovlivňuje kvalitu sladu, protoţe nevyklíčená zrna jsou substrátem pro rozvoj plísní a jiných
neţádoucích mikroorganismů, mohou zde také vznikat jedovaté mykotoxiny, které se
přenášejí aţ do piva.
Materiál a Metody
Pro test vitality obilek bylo pouţito 133 DHL jarního ječmene (Hordeum vulgare L.),
z kříţení odrůdy Derkado a linie B 83/5, které nesou rozdílné geny polozakrslosti sdw1 a ariee.GP. Rodičovské linie a DHL byly poskytnuty Dr. B. P. Forsterem ze Scottish Crop
Research Institute Dundee a pouţity pro společný výzkum (Chloupek et al. 2006). Rodiče
a DHL byly pěstovány v šesti prostředích, tj. ve třech ročnících (2008, 2009, 2010) a na dvou
pokusných lokalitách (Hrubčice a Ţelešice). V plné zralosti byly klasy vystříhány a následně
vymláceny na klasové mlátičce. Po ukončení dormance obilek (cca po 100 dnech) byly
vzorky podrobeny laboratornímu testu vitality, která byla stanovena jako procento klíčivosti
ve stresových podmínkách, tj. při chladu 10 oC a za fyziologického sucha -0,2 MPa ve
vodním roztoku polyethylenglykolu (PEG 6000), tato koncentrace představuje limit trvalého
vadnutí rostlin. Metodika stanovení byla popsána pro ječmen Chloupkem et al. 2003.
Výsledky a diskuze
Zjištěné rozdělení četnosti vitality DHL (graf 1) odpovídá normálnímu rozdělení (Gaussově
křivce) a data mohla být zhodnocena analýzou variance. Hodnoty DHL leţí převáţně mezi
hodnotami rodičů, coţ svědčí o převaţující aditivní činnosti genů řídící tuto vlastnost, coţ je
pro šlechtění výhodné. Je zde patrný efekt heteroze, neboť 29 DHL přesahuje lepšího z obou
rodičů, coţ je důleţitým předpokladem šlechtění na zlepšení dané vlastnosti.
Průměrná hodnota vitality obilek odrůdy Derkado ze všech prostředí byla 96 % a statisticky
významně se lišila od linie B83 (91,5 %). Průměrná hodnota Derkada ze Ţelešice byla 97 %
a z Hrubčicích byla niţší (95 %). Avšak průměrná hodnota linie B83 ze Ţelešic byla 91 %,
kdeţto z Hrubčic 92 %. Průměrná vitalita všech DHL ze všech šesti prostředí byla 94,5 %,
z Hrubčic 95,1 % a ze Ţelešic významně méně (93,9 %, graf 2).Vitalita Derkada s vyšší
vitalitou oproti horšímu rodiči B83 a DHL byla vyšší ze Ţelešic, tj. z horšího prostředí. To
potvrzuje výsledky Chloupka et al. (2003), ţe vliv odrůdy na vitalitu obilek byl větší
v nepříznivém prostředí.
198
„Úroda 12/2011, vědecká příloha―
Graf průměrné vitality na lokalitách
2008 - 2010
Gaussova křivka průměrných hodnot vitality semen
(hodnoty přepočtené ARCSIN)
95,6
Očekáv ané normální
95,4
800
95,2
95,0
vitalita semen %
700
Počet pozor.
600
500
94,8
94,6
94,4
94,2
94,0
400
93,8
93,6
300
93,4
200
Ţeleš ic e
Hrubč ic e
lokalita
Derkado
B83
100
Graf. č. 2: Průměrné hodnoty
vitality DHL ze Ţelešic a Hrubčic.
0
50
55
60
65
70
75
80
Průměr
Průměr±0,95 Int. spolehl.
85
90
x <= hranice kategorie
Graf. č. 1: Gaussova křivka průměrných hodnot vitality DHL ve srovnání s rodičovskými odrůdami
Vliv odrůdy zjištěný celkovou analýzou variance pro ročníky 2008 aţ 2010 činil 7,7 %
(v jednotlivých letech 12 – 31 %, v roce 2008 13,4 % , v 2009 12 % a v 2010 31,4 %).
Z celkové analýzy variance vyplývá vliv lokality 32,1 % (v 2008 70,3 %, v 2009 67,5 %
a v 2010 28 %). Jak uvádí Sinniah et al. (1998), vitalita je polygenně zaloţený znak, coţ se
projeví ve vyšším vlivu prostředí (ročníku a lokality) na tuto vlastnost, neţ tomu je u znaků
a vlastností, které jsou řízeny jedním nebo jen několika geny. Vliv ročníků činil 19 %
a interakcí a chyby 37,1 %. Tento podíl genetické proměnlivosti na celkové proměnlivosti byl
poměrně vysoký, např. Laidig et al. (2008) v rozsáhlých oficiálních pokusech s výnosem
jarního ječmene v Německu vypočítali vliv odrůdy na 3,5 %. To je předpokladem úspěšného
šlechtění na vyšší vitalitu. Hrstková (2004) uvádí, ţe v pokusech testování osiva ječmene
zkouškou kontrolované deteriorizace byly nejvýznamnější odrůda, lokalita a ročník. Vitalita
v našich pokusech byla poměrně vysoká, ale v předchozích sedmi letech dosáhla ve třech
z nich jen 61-86 %, v ostatních přesáhla 94 %. V těchto špatných letech měly vysokou vitalitu
Jubilant, Kompakt, Krona a Akcent (Chloupek et al. 2003).
Tab.č. 1 Celková analýza variance hodnot vitality obilek ječmene zjištěných pro rok 2008 – 2010.
Stupně volnosti Variance
F
Průkaznost
Podíl faktorů na proměnlivosti (%)*
Ročník
2
456
19,5
0,000000
18,82
Lokalita
1
1334
57,2
0,000000
32,10
Odrůda
132
78
3,3
0,000000
7,74
axb
2
627
26,9
0,000000
21,98
axc
264
42
1,8
0,000000
5,72
bxc
132
28
1,2
0,069957
4,66
axbxc
264
29
1,2
0,011370
4,76
Chyba
798
23
4,22
a - ročník, b - lokalita, c - odrůda, * Podíl jednotlivých faktorů na celkové proměnlivosti na celkové variabilitě
byl vypočten z hodnot směrodatné odchylky (tj. z druhé odmocniny variance).
Vitalita obilek, stanovená za uvedených podmínek, můţe slouţit jako selekční kritérium při
šlechtění sladových odrůd, neboť postihuje stres sníţenou teplotou: zkouška je totiţ
prováděná při 10 °C. Jak uvádí Pelikán et al. (2004) při technologii máčení a klíčení jsou
zrna ječmene při výrobě sladu vystavena teplotám 12 aţ 15 °C.
199
„Úroda 12/2011, vědecká příloha―
Závěr
Naše výsledky potvrzují významný genetický základ této vlastnosti a jsou předpokladem pro
vyuţití vitality jako selekčního kritéria ve šlechtění. Výzkum a šlechtění na zlepšení vitality
jsou však komplikované, vzhledem ke kvantitativní povaze dané vlastnosti a absenci metod,
které jsou doporučeny organizací ISTA pro hodnocení vitality u obilovin. Jak uvádí nejen
Finch-Savage (1995) vitalita semen však přispívá k ekonomickému úspěchu komerčně
vyuţívaných plodin a semenářské společnosti mají zájem mít způsob získávání objektivních
odhadů vitality.
Dedikace
Výzkum byl podpořen projekty 1M0570 a MSM 6215648905
Pouţitá literatura
Laiding F., Drobek T., Meyer U. (2008):Genotypic and environmental variability for cultivars
from 30 different crops in German official variety trials. Plant Breeding 127: 541 – 547.
Edney M. J., Mather D. E. (2004): Quantitative trait loci affecting germination traits and malt
friability in a two-rowed by six-rowed barley cross. Journal of Cereal Science 39: 283-290.
Hampton J. G, Coolbear P. (1990): Potential versus actual seed performance – can vigour
testing provide an answer? Seed Sci. Technol. 18: 215-228.
Bettey M., Finch-Savage W.E., King G. J. Lynn J. R. (2000): Quantitative genetic analysis of
seed vigour and pre-emergence seedling growth traits in Brassica oleracea. New Phytol.
148: 277-286.
Finch-Savage W.E. (1995): Influence of seed quality on crop establishment, growth and yield.
In: Basra AS, ed. Seed quality. Basic mechanisms and agricultural implications. New
York, USA: Haworth Press: 361.
Hrstková P., Chloupek O., Bébarová, J. (2004): Effects of cultivar and provenance on vigour of
barley seed. Czech journal of genetics and plant breeding 40: 168.
Chloupek O., Hrstková P., Jurečka D. (2003): Tolerance of barley seed germination to cold- and
drought-stress expressed as seed vigour. Plant Breeding 3: 199-203.
Chloupek O., Forster B. P. (2006): The effect of semi-dwarf genes on root system size in fieldgrown barely. Theor Appl Genet 112:779 – 786.
Landjeva S., Lohwasser U., Börner A. (2010): Genetic mapping within the wheat D genome
reveals QTL for germination, seed vigour and longevity, and early seedling growth.
Euphytica 171:129 – 143.
Venter A. (2001): Seed vigour Testing. ISTA News Bulletin 122, September 2001: 12 – 14.
Pelikán, M., Dudáš, F., Míša, D. (2004): Technologie kvasného průmyslu. 2. vyd. Brno:
Mendelova univerzita, 2004.
Sinniah U., Ellis R., John P. (1998): Irrigation and seed quality development in rapid-cycling
brassica: seed germination and longevity. Annals of Botany 82: 309 – 314.
Kontaktní adresa:
Ing. Kamila Ullmannová
MENDELU v Brně
Zemědělská 1, Brno 613 00
[email protected]
200
„Úroda 12/2011, vědecká příloha―
HODNOCENÍ HOSPODÁŘSKÝCH ZNAKŦ A UKAZATELŦ NOVÝCH
DONORŦ NESLADOVNICKÉHO JEČMENE PRO POTRAVINÁŘSKÉ
A KRMNÉ VYUŢITÍ
Evaluation of agronomic traits and characters of new non-malting barley
donors for food and feed use
Vaculová K.1, Ehrenbergerová J.2, Smutná P.2
1
Agrotest fyto s.r.o., Kroměříţ
Mendelova univerzita v Brně
2
Abstrakt
Rozsáhlý soubor nově vytvořených pokročilých linií nesladovnického ječmene s genotypicky
změněným chemickým sloţením zrna (celkem 71) byl hodnocen na dvou pěstebních lokalitách
(Kroměříţ, Ţabčice) v letech 2008-2010. Byla v praxi potvrzena moţnost tvorby nových donorů
zdrojů ječmene jarního pro perspektivní potravinářské nebo krmné vyuţití s vyšší úrovní hospodářsky
významných znaků a ukazatelů. Kombinace vyššího počtu nutričně ţádoucích faktorů v jediném
genotypu, spojená s niţší výnosovou schopností, vyţaduje další kříţení.
Klíčová slova: ječmen jarní, nové genetické zdroje, nutriční kvalita, hospodářsky významné znaky a
ukazatele
Abstract
A wide set of newly developed advanced non-malting barley lines with genotypically changed grain
chemical composition (total of 71) were evaluated in the field conditions of two localities (Kroměříţ,
Ţabčice), in the years 2008-2010. In practice was confirmed the possibility to develop new donors of
spring barley for prospective food or feed use with higher level of agronomically important traits and
characters. The combination of a higher number of nutritionally required factors in a single barley
genotype associated with lower yield ability requires further hybridization.
Key words: spring barley, new genetic resources, nutritional quality, agronomic important traits and
characters
Úvod
Rozšíření sortimentu odrůd ječmene o genotypy vhodné pro přímé potravinářské nebo jiné
nesladovnické vyuţití je jednou z moţných cest obnovení zájmu pěstitelů a zpracovatelů o
tuto plodinu. Poţadavky na obsah nutričně významných látek zrna ječmene pro zdravou
výţivu lidí se významně liší nejen od parametrů poţadovaných sladaři, ale často i od
mnohých ukazatelů kvality pro krmení zvířat (Prugar et al. 2008). Z tohoto důvodu se při
tvorbě nových nesladovnických odrůd ječmene často nelze obejít bez introgrese různých
netradičních a exotických výchozích zdrojů. Nezbytnou vlastností kaţdé nové odrůdy je její
hospodářská hodnota, kterou neodmyslitelně tvoří schopnost poskytnout stabilní a vysoký
výnos zrna. Od nových výchozích donorů pro šlechtění se proto očekává nejen poţadovaná
nutriční kvalita zrna, ale i kombinace s dalšími hospodářsky významnými znaky a parametry.
V našem příspěvku přinášíme výsledky studia vlastních nově vytvořených výchozích
genetických zdrojů ječmene, hodnocených z tohoto pohledu.
Materiál a metody
Vlastní, nově vytvořené pokročilé linie ječmene jarního (celkem 71) s pluchatým a
bezpluchým typem zrna, standardním vs. waxy typem škrobu (se sníţeným poměrem
polysacharidů škrobu, amylózy a amylopektinu) a dalšími nutričně významnými parametry
(zvýšený podíl aminokyseliny lyzínu v N-látkách, sníţený obsah kyseliny fytové - lpa),
pluchaté (Annabell, Xanadu) a bezpluché kontrolní odrůdy (Taiga) a vybrané rodičovské
formy (No94609D7 a Nordus s pluchatým zrnem a Wanubet, CDCCandle, HB803, Merlin s
bezpluchým a waxy typem zrna) byly pěstovány v letech 2008-2010 na dvou lokalitách
201
„Úroda 12/2011, vědecká příloha―
úhrn sráţek - Ţab.
prům. teplota - KM
sráţky (mm)
VII.10
V.10
VI.10
III.10
IV.10
VII.09
V.09
VI.09
III.09
IV.09
VII.08
V.08
úhrn sráţek - KM
VI.08
220
200
180
160
140
120
100
80
60
40
20
0
III.08
24
22
20
18
16
14
12
10
8
6
4
2
0
-2
-4
-6
-8
-10
IV.08
teplota (°C)
(Kroměříţ, Ţabčice – 2 opak. x 5 m2) za pouţití standardní pěstební technologie. Průběh
počasí je uveden na Obr. 1. Po sklizni byl stanoven výnos zrna (t.ha-1), podíl předního zrna na
sítě 1,8 mm (%), hmotnost 1000 zrn (HTZ, g). Přítomnost recesivní alely genu waxy, kódující
sníţený podíl amylózy, byla potvrzena molekulárními markery (Vaculová et al. 2008).
Experimentální data byla vyhodnocena software STATISTICA, verze 8.0 (StatSoft, Inc.,
Tulsa, Oklahoma, USA).
prům. teplota - Ţab.
Obr. 1 Průběh počasí v letech 2008-2010 na lokalitách Kroměříţ (KM) a Ţabčice (Ţab.)
Výsledky a diskuse
Průměrný výnos zrna kolísal v závislosti na genotypu (2,8 aţ 6,1 t.ha-1), lokalitě (3,6 aţ 5,1
t.ha-1) i ročníku (3,9 aţ 6,8 t.ha-1). Nejvyšší průměrný výnos zrna byl stanoven u rodičovské
odrůdy Nordus v roce 2008 na lokalitě Kroměříţ (8,4 t.ha-1), nejniţší výnos měla v roce 2010
linie KM1057-1906.225.1.05 (=KM1282/ Hiproly; 1,2 t.ha-1). V celém souboru hodnocených
odrůd a nových genetických zdrojů byla nejvyšší variabilita (V=34,8%) naměřena u výnosu
zrna, zatímco variabilita podílu zrna na sítě a HTZ byla významně niţší (V=6,6 a 12,6%).
Zařazení dvou lokalit s rozdílným průběhem počasí v hlavních vegetačních fázích vedlo k
tomu, ţe vybrané bezpluché linie ječmene překonaly v průměru pluchaté kontrolní odrůdy
Annabell a Xanadu (např. linie KM2283=1576EMM/KM2012-2703 a KM2551=HB
803/No92K0015D22), i kdyţ v souvislosti s vysokou variabilitou výnosu zrna nebyly tyto
diference průkazné. V celém souboru se tak vyčlenily pouze linie s vyšším obsahem lyzínu
(KM1057=1282/Hiproly), které se od většiny materiálů liší nejen výnosem, ale i nízkou HTZ
a slabým podílem zrna na sítě (Obr. 2). Proto byly z dalšího hodnocení vyloučeny.
V porovnání s kontrolní odrůdou bezpluchého ječmene Taiga i vybranými rodičovskými
odrůdami (Wanubet, CDCCandle, HB803 a Merlin) byla detekována řada nových linií s
významně vyšším výnosem zrna i lepším tříděním nebo HTZ (KM2551,
KM2624=HB803/Nordus,
KM2640=No94609D7/CDCCandle,
KM2645=CDCCandle/
Nordus, a.j.).
Z pohledu dalšího pokroku v procesu tvorby nových donorů nesladovnického ječmene je
důleţité znát a umět vyuţívat existující rozdíly v reakci genotypů s odlišným genetickým
původem na ročníkové změny i vliv lokality. V Tab. 1 jsou shrnuty výsledky hodnocení
vybraných agronomických znaků a ukazatelů ve skupinách nových donorů s odlišným typem
zrna. Zatímco typ škrobu ani genotyp nových donorů neprokázal zřejmý vliv na hodnocené
ukazatele u pluchatých materiálů, v případě bezpluchého zrna byl vyšší výnos i HTZ zjištěna
pouze u typů se standardním škrobem.
202
„Úroda 12/2011, vědecká příloha―
8
Podíl, % (Y2);
Výnos zrna, t.ha-1 (Y1);
HTZ, g (Y2)
Y2
Y1
7
6
5
4
3
N+ N+
N+ N+
PL
PL PL
PL
PL
PL PL
1
Wanubet
KM1282 x Hiproly
CDC Candle x Washonubet
HB 803 x Nordus
No94609D7 x Merlin
Nordus x HB 803
No94609D7 x HB 803
CDC Candle x Nordus
Nordus x CDC Candle
No94609D7 x CDC Candle
CDC Candle x No94609D7
Nordus
HB 803 x No92K0015D22
CDC Candle
HB 803
Merlin
Wanubet x KM1057
Nordus x Merlin
No94609D7
(Wb x Wshnb) x Wshnb
KM1628C-23/90 x CE599
KM1057-1924 x GALAN
1576EMM x KM2012-2703
M422 x KM2311
M422 x KM2283
Margit x KM2283
KM2283-75/96 x Alize
KM2311 x M635
KM2084 x A-84/99
HE1386 x Marlen
Annabell
Xanadu
Taiga
M635 x KM2283
2
110
100
90
80
70
60
50
40
30
20
Obr. 2 Průměrné hodnoty vybraných hospodářsky významných znaků a ukazatelů nových
donorů (členěných dle pedigree), kontrolních a rodičovských odrůd a linií (Kroměříţ, Ţabčice,
2008-2010; PL: pluchatý, N+: bezpluchý i pluchatý, bez označení: pouze bezpluchý typ zrna)
Vliv rozdílného genotypu se projevil hlavně ve skupině bezpluchých materiálů. Zde byl
nejvyšší výnos zrna dosaţen u linií se sníţeným obsahem kyseliny fytové a nejvyšší HTZ
měly linie se standardním genotypem, tedy bez introdukce dalších genů, které ovlivňují
nutriční jakost zrna.
Tab. 1 Průměrné hodnoty vybraných agronomických znaků a průkaznost diferencí mezi
zdroji variability u nových donorů nesladovnického ječmene s rozdílným typem zrna
pluchatý typ zrna
bezpluchý typ zrna
výnos zrna podíl na sítě HTZ výnos zrna podíl na sítě HTZ
zdroj variability
%
g
%
g
t.ha-1
t.ha-1
93,7a
43,2a
5,2b
90,6a
43,4b
typ škrobu1) stand.
5,2a2)
waxy
5,4a
94,9a
41,9a
4,3a
90,6a
39,1a
genotyp
lpa
5,6a
94,7a
43,2a
5,2b
92,3a
41,2bc
lyz
N
N
N
5,1ab
93,7a
47,5d
lyz,waxy
N
N
N
4,3ab
87,2a
37,0a
waxy
5,4a
94,9a
41,9a
4,9ab
90,8a
39,2ab
stand.
5,1a
93,1a
43,2a
4,1a
90,4a
43,3c
lokalita
KM
5,8b
93,3a
42,8a
5,2b
89,a
41,7b
Z
4,6a
96,4b
41,5a
3,6a
93,3b
39a
rok
2008
7,4b
94,0ab
44,2b
7,0b
89,7a
44,0c
2009
4,8a
93,5a
41,9a
4,2a
90,3ab
39,0a
2010
4,8a
95,7b
41,8a
3,9a
91,c
40,9b
1)
- viz. Materiál a metodika; 2) - homogenní skupiny označené odlišnými písmeny se průkazně
liší (P<0.05)
Výsledky hodnocení souboru, rozčleněného do skupin podle typu škrobu, potvrdily, ţe
introdukce recesivní alely genu waxy zřejmě nemá významný vliv na výnos, ani na další
hospodářsky významné znaky. Ve shodě s našimi dřívějšími poznatky (Vaculová et al. 2008)
byly zjištěny průkazné rozdíly mezi pluchatými a bezpluchými materiály pouze ve skupině s
waxy typem škrobu (Tab. 2).
203
„Úroda 12/2011, vědecká příloha―
Tab. 2 Průměrné hodnoty vybraných agronomických znaků a průkaznost diferencí mezi
zdroji variability u nových donorů nesladovnického ječmene s rozdílným typem škrobu
standardní typ škrobu
waxy typ škrobu
výnos zrna podíl na sítě HTZ výnos zrna podíl na sítě HTZ
zdroj variability
-1
-1
%
g
%
g
t.ha
t.ha
1)
2)
bezpl.
90,6a
43,4a
4,3a
90,5a
39,1a
typ zrna
5,2a
pluch.
5,6a
93,7b
43,2a
5,4b
94,9b
41,9b
genotyp
lpa
5,3a
93,5b
42,2a
N
N
N
lyz
4,a
93,7ab
47,5b
N
N
N
lyz,waxy
N
N
N
4,1a
87,2a
37,0a
waxy
N
N
N
4,5a
91,6b
39,7b
stand.
5,2a
90,61a
43,3a
N
N
N
lokalita
KM
5,6b
89,7a
44,2b
4,9b
90,3a
39,8a
Z
3,9a
94,6b
41,2a
3,7a
93,5b
39,0a
rok
2008
7,4b
89,0a
46,7c
6,7b
91,5a
41,6b
2009
4,5a
90,7a
41,2a
4,1a
91,0a
38,4a
2010
4,4a
92,5b
43,3b
3,7a
91,6a
39,4a
1)
2)
- viz. Materiál a metodika; - homogenní skupiny označené odlišnými písmeny se
průkazně liší (P<0.05)
Proces tvorby nových donorů se zvýšeným obsahem esenciálních aminokyselin a waxy typem
škrobu (genotyp: lyz, waxy) nebyl doposud úspěšně ukončen a bude nezbytné dále pokračovat
v hybridizaci s produktivními donory ječmene, které dosahují výnosu zejména pomocí prvků
produktivity klasu, zvláště zvýšené hmotností obilek. Bez ohledu na rozčlenění souborů a
genetický původ nových donorů s odlišnou determinací jakosti zrna, byl vliv lokality
(Kroměříţ) i pěstebního ročníku (2008) významný zejména pro výnos zrna a HTZ.
Závěr
Byly hodnoceny vybrané hospodářsky významné znaky a ukazatele nově vytvořených
pokročilých linií ječmene jarního, donorů diferencovaného typu zrna, škrobu a dalších
nutričně významných sloţek zrna. Dosaţené výsledky v praxi prokázaly reálnost tvorby odrůd
ječmene s bezpluchým zrnem i cíleně změněným chemickým sloţením pro přímé
potravinářské nebo jiné nesladovnické vyuţití. Současně však ukázaly, ţe u genotypicky
odlišných materiálů lze očekávat různou reakci na pěstební i ročníkové odchylky. Kombinace
několika poţadovaných nutričně cenných faktorů v jediném genotypu je spojená s niţší
výnosovou schopností a při pouţití tradičních šlechtitelských postupů bude náročnější
zejména z časového hlediska.
Dedikace
Příspěvek byl vypracován za finanční podpory projektu MZe ČR-NAZV QH91053.
Pouţitá literatura
Prugar. J. a kol. (2008). Kvalita rostlinných produktů na prahu 3. tisíciletí, VÚPS 2008, 326 s.
Vaculová K., Ehrenbergerová J., Pouch M. (2008). Proceedings to the Meeting of the
Eucarpia Cereal Section, Lleida (Spain), 13-17 November 2006, Eds.: J.L. Molina Cano et al.,
Zaragoza, p. 289-293. Options méditerranéennes, SERIE A: Séminaires Méditerranéens,
Numéro 81 (2008).
Kontaktní adresa:
Ing. Kateřina Vaculová, CSc., Agrotest fyto, s.r.o., Havlíčkova 2787/121, 767 01 Kroměříţ,
[email protected]
204
„Úroda 12/2011, vědecká příloha―
NÁVRH A TESTOVÁNÍ SPECIFICKÝCH PRIMERŦ PRO DETEKCI
KARANTÉNNÍ BAKTERIE XANTHOMONAS VESICATORIA
Design and testing of primers specific for detection of quarantine bacterium
Xanthomonas vesicatoria
Beran P.1,2, Mráz I.1
1
Biologické centrum AV ČR, České Budějovice
Jihočeská univerzita v Českých Budějovicých
2
Abstrakt
V této studii popisujeme vývoj metody PCR pro detekci karanténní bakterie Xanthomonas vesicatoria,
která je patogenní pro rajče a papriku. Pár primerů XV1F a XV1R byl navrţen na základě DNA
sekvence genu atpD (získané ze sbírkového kmenu Xv CCM 2102) tak, aby byl specifický pouze pro
detekci Xanthomonas vesicatoria. Tyto námi navrţené primery poskytovaly (výsledný) amplifikační
produkt o velikosti 356 bp a rovněţ vykazovaly vysokou specifičnost. Při testování primerů na
specifičnost soubor testovaných bakterií zahrnoval mnoho bakterií patogenních pro rajče a papriku
(včetně rodu Xanthomonas) a některé další bakterie. K pozitivní PCR reakci však docházelo pouze
tehdy, byla.-li pouţita templátová DNA vyizolovaná z Xanthomonas vesicatoria. Dodrţením
protokolu popsaném v tomto článku lze rychle a spolehlivě identifikovat bakterii Xanthomonas
vesicatoria. Dle dostupných informací se jedná o první dvojici primerů, detekující specificky pouze
bakteriální druh Xanthomonas vesicatoria.
Klíčová slova: Xanthomonas vesicatoria, PCR, primery, detekce
Abstract
In this study we present development of PCR method for detection of Xanthomonas vesicatoria, the
bacteria pathogenic for tomato and pepper. Primer pair XV1F and XV1R was designed based on DNA
sequence of atpD gene (obtained from Xv CCM 2102 collection strain) in order to be specific for
detection of Xanthomonas vesicatoria. PCR product of 326 bp was observed only if DNA isolated
from Xanthomonas vesicatoria was used as a template. Collection of bacteria tested contained a lot of
bacteria pathogenic for tomato and pepper (including Xanthomonas genus) and some other bacteria.
Following the protocol described in this article Xanthomonas vesicatoria can be identified rapidly and
reliably. To date, there is no report of such primers for specific detection of Xanthomonas vesicatoria.
Keywords: Xanthomonas vesicatoria, PCR, primers, detection
Úvod
Bakteriální skvrnitost papriky a rajčete se vyskytuje v mnoha zemích po celém světě. Největší
ekonomický význam má v oblastech teplého a vlhkého klimatu (Jones et al., 1998). Hlavním
příznakem tohoto onemocnění jsou nekrotické léze, vyskytující se na listech, stoncích,
plodech a květech (Pohronezny, Volin, 1983).
Bakteriální skvrnitost papriky a rajčete způsobuje poměrně různorodá skupina
fytopatogenních bakterií rodu Xanthomonas. Taxonomická nomenklatura a klasifikace
bakterií rodu Xanthomonas, které infikují rajčata a papriky, prošla v minulých letech
značnými změnami. V současné době jsou tyto patogeny řazeny do čtyř skupin (A, B, C a D)
v rámci rodu Xanthomonas. Zatímco skupiny A a B jsou celosvětově rozšířeny,
xanthomonády ze skupiny C se nacházejí především v USA, Mexiku, Brazílii, Koreji a ve
státech na pobřeţí Indického oceánu a xanthomonády ze skupiny D se nacházejí na území
bývalé Jugoslávie, v Kanadě, Kostarice, USA, Brazílii a v oblastech u Indického oceánu.
Uvedené čtyři skupiny byly na základě fyziologických a molekulárně biologických
charakteristik klasifikovány jako jednotlivé druhy Xanhomonas následovně: Xanthomonas
euvesicatoria Jones et al. 2006 (skupina A), Xanthomonas vesicatoria (ex Doidge 1920)
205
„Úroda 12/2011, vědecká příloha―
Vauterin et al. 1995 (skupina B), Xanthomonas perforans Jones et al. 2006 (skupina C), a
Xanthomonas gardneri (ex Sutic 1957) Jones et al. 2006 (skupina D) (Jones et al., 2004).
Vzhledem k potenciálním ekonomickým ztrátám při propuknutí bakteriální skvrnitosti, je
důleţitá včasná a spolehlivá detekce patogena. Metody jako sklíčková aglutinace,
biochemické testy, analýza mastných kyselin, metabolické analýzy, ELISA nebo průtoková
cytometrie jsou pro detekci patogena pouţitelné, ale jsou časově náročné a pracné (Doorn et
al., 1999; Chase et al., 1992; Chitarra et al., 2002). Polymerázová řetězová reakce (PCR) však
nabízí moţnost rychlé, specifické a citlivé detekce určité sekvence DNA a je proto velice
vhodná pro detekci patogena v rostlině (Hartung et al., 1993).
V tomto článku prezentujeme analýzu zaloţenou na PCR, kterou lze pomocí specifických
primerů detekovat DNA sekvenci typickou pro Xanthomonas vesicatoria (skupina B). Tato
sekvence se nachází uvnitř genu atpD, který je nezbytný pro produkci energie.
Materiál a metody
Bakteriální kmeny a jejich kultivace
Bakteriální kmeny (Tab. 1.) byly získány z Belgian Co-ordinated Collections of Microorganisms (BCCM/LMG), National Collection of Plant Pathogenic Bacteria (NCPPB), Gent,
Collection Francaise de Bactéries Phytopathogénes (CFBP), Beaucouze, České sbírky
mikroorganismů v Brně (CCM) a sbírky Výzkumného ústavu rostlinné výroby (CRI) v Praze.
Všechny kmeny byly kultivovány na MPAg (masopeptonovém agaru s glukosou: 40g ţivného
agaru č.2, 5,2 g kvasničného autolyzátu, 10 g glukózy, 20 g agaru, doplněno dH2O do 1 litru)
při 28°C po dobu 1 aţ 3 dnů.
Izolace DNA
DNA z čerstvě narostlých bakteriálních kultur byla izolována pomocí komerčně dostupného
kitu Wizard® SV Genomic DNA Purification System (Promega, USA). Bylo postupováno
podle protokolu přiloţeného výrobcem.
Návrh primerů a PCR
Oligonukleotidové primery nazvané XV1F (5‗ – CAGTCCTCCAGCACCGAAC – 3‗) a
XV1R (5‗- TCTCGTCGCGGAAGTACTCA – 3‗) byly navrţeny (syntetyzováno GeneriBiotech, ČR) do oblasti genu atpD podle sekvence DNA námi získané z Xanthomonas
vesicatoria (Xv CCM 2102). Očekávaný PCR produkt vykazoval velikost 326 bp. Reakční
směs PCR byla připravována do celkového objemu 15 μl v následujícím sloţení: 7,5 μl 2x
PPP MasterMix Combi (Top-Bio, ČR), 4,5 μl sterilní destilované H2O, 1 μl templátové DNA
a 1 μl kaţdého z primerů (10 pmol). Program PCR se skládal z úvodní denaturace při 94°C
trvající 5 minut následované 25 cykly, z nichţ kaţdý sestával ze 3 fází: 45 s při 94°C, 45 s při
69°C a 40 s při 72°C. Celý program byl zakončen závěrečnou elongací při 72°C po dobu 10
minut. Po dokončení programu byly vzorky zchlazeny a udrţovány při 4°C.
Elektroforéza
Po PCR byla kaţdá z reakcí smíchána s interkalačním činidlem SYBR Green I (Lonza, USA)
a nanesena na 1% agarózový gel. Elektroforéza probíhala 70 minut při 90 V (4 V / cm).
Agarózový gel byl vizualizován pomocí UV prosvěcovací lampy a dokumentačního zařízení
od firmy Kodak.
206
„Úroda 12/2011, vědecká příloha―
Tab. 1. Pouţité bakteriální kmeny pro testování specifičnosti primerů XV1F a XV1R
Pořadí
Název bakteriálního izolátu uváděný ve sbírce
Sbírka a číslo
Geografický
původ
Detekováno
primery
1.
Xanthomonas vesicatoria
BCCM/LMG 916
Nový Zéland
ANO
2.
Xanthomonas vesicatoria
BCCM/LMG 919
Zimbabwe
ANO
3.
Xanthomonas vesicatoria
BCCM/LMG 920
Itálie
ANO
4.
Xanthomonas vesicatoria
BCCM/LMG 925
Maďarsko
ANO
5.
Xanthomonas vesicatoria
CCM 2101
Maďarsko
ANO
6.
Xanthomonas vesicatoria
CFBP 2537
Nový Zéland
ANO
7.
Xanthomonas vesicatoria
NCPPB 2595
Brazílie
ANO
8.
Xanthomonas axonopodis pv. vesicatoria
BCCM/LMG 667
Nový Zéland
NE
9.
Xanthomonas axonopodis pv. vesicatoria
BCCM/LMG 668
Cookovy ostrovy
NE
10.
Xanthomonas axonopodis pv. vesicatoria
BCCM/LMG 909
Pobřeţí slonoviny
NE
11.
Xanthomonas axonopodis pv. vesicatoria
BCCM/LMG 922
Florida, USA
NE
12.
Xanthomonas axonopodis pv. vesicatoria
BCCM/LMG 931
USA
NE
13.
Xanthomonas axonopodis pv. vesicatoria
BCCM/LMG 933
Brazílie
NE
14.
Xanthomonas axonopodis pv. vesicatoria
CCM 2101
Maďarsko
NE
15.
Xanthomonas axonopodis pv. vesicatoria
CFBP 1604
Guadeloupe
NE
16.
Xanthomonas axonopodis pv. vesicatoria
CFBP 3274
Guadeloupe
NE
17.
Xanthomonas campestris pv. vesicatoria
BCCM/LMG 918
Indie
NE
18.
Xanthomonas campestris pv. vesicatoria
BCCM/LMG 921
Long Islond, USA
NE
19.
Xanthomonas campestris pv. vesicatoria
BCCM/LMG 927
Zambie
NE
20.
Xanthomonas campestris pv. vesicatoria
BCCM/LMG 928
USA
NE
21.
Clavibacter michiganensis subsp. michiganensis
BCCM/LMG 5727
Bulharsko
NE
22.
Clavibacter michiganensis subsp. michiganensis
BCCM/LMG 7333
Maďarsko
NE
23.
Dickeya sp.
CCM 989
NE
24.
Erwinia amylovora
CCM 1133
NE
25.
Pantoea agglomerans
CCM 2406
Česká republika
NE
26.
Pantoea dispersa
CCM 4414
Česká republika
NE
27.
Pectobacterium atrosepticum
CCM 322
Francie
NE
28.
Pectobacterium carotovorum subsp. carotovorum
CCM 1008
Dánsko
NE
29.
Pseudomonas corrugata
CRI 8892-85Re
Česká republika
NE
30.
Pseudomonas fluorescens
CCM 2115
Velká Británie
NE
31.
Pseudomonas marginalis pv. marginalis
BCCM/LMG 2210
USA
NE
32.
Pseudomonas syringae pv. phaseolicola
CRI 186/2
Česká republika
NE
33.
Pseudomonas syringae pv. pisi
NCPPB 3496
USA
NE
34.
Pseudomonas syringae pv. tomato
CRI 2/1/99Re
Česká republika
NE
35.
Pseudomonas viridiflava
BCCM/LMG 2352
Švýcarsko
NE
36.
Rahnella aquatilis
CCM 4086
Česká republika
NE
Výsledky a diskuse
Primery XV1F (19-mer) a XV1R (20-mer) byly testovány s DNA vyizolovanou
z Xanthomonas vesicatoria. Podle očekávání se v PCR tvořil produkt o velikosti 326 bp u
všech 7 testovaných kmenů Xanthomonas vesicatoria. K otestování specificity primerů byl
pouţit soubor bakterií dalších druhů i rodů (Tab. 1). Z nich většina je patogenních pro rajče
nebo papriku, nicméně otestovány byly i další bakterie, které se na rajčeti nebo paprice
nenacházejí. U ţádné z necílových bakterií však nebyl výsledek pozitivní.
Vývoj specifických detekčních primerů byl jiţ publikován pro mnoho fytopatogenních
bakterií včetně Xanthomonas campestris pv. vesicatoria a Xanthomonas axonopodis pv.
vesicatoria (Xanthomonas euvesicatoria, skupina A) (Park et al., 2009). Pomocí dosud
publikovaných primerů však nelze spolehlivě detekovat bakterii Xanthomonas vesicatoria
(skupina B), která se podobně jako Xanthomonas euvesicatoria vyskytuje celosvětově.
207
„Úroda 12/2011, vědecká příloha―
Dvojice primerů XV1F a XV1R byla navrţena do oblasti genu atpD podle sekevnce DNA
získané z Xanthomonas vesicatoria (sbírkový kmen Xv CCM 2102). Sekvence toho genu je
hojně vyuţívána pro fylogenetické analýzy mnoha bakterií včetně bakterií rodu Xanthomonas
(Young et al., 2008). Odlišnost sekvencí DNA tohoto genu je u různých bakteriálních kmenů
dostatečná k navrţení specifických primerů.
Závěr
Primery XV1F a XV1R byly navrţeny do oblasti genu atpD tak, aby byly specifické pro
detekci Xanthomonas vesicatoria. Jedná se o první primery detekující pouze Xanthomonas
vesicatoria.
Dedikace
Tato práce byla podporována grantem č. QH71229 Ministerstva zemědělství ČR a grantem č.
AV0Z50510513 Grantové agentury AV ČR.
Pouţitá literatura
Chase AR, Stall RE, Hodge NC, Jones JB. (1992) Characterization of Xanthomonas
campestris strains from aroids using physiological, pathological and fatty acid analyses.
Phytopathology, 82, 754–9.
Chitarra LG, Langerak CJ, Bergervoet JHW, van den Bulk RW. (2002) Detection of the plant
pathogenic bacterium Xanthomonas campestris pv. campestris in seed extracts of Brassica
sp. applying fluorescent antibodies and flowcytometry. Cytometry, 47, 118–26.
Doorn J, Ojanen-Reuhs T, Hollinger TC, Reuhs BL, Schots A, Boonekamp PM, et al. (1999)
Development and application of pathovar-specific monoclonal antibodies that recognize
the lipopolysaccharide O antigen and the Type IV fimbriae of Xanthomonas hyacinthi.
Appl Environ Microbiol, 65, 4171–80.
Hartung JS, Daniel JF, Pruvost OP. (1993) Detection of Xanthomonas campestris pv. citri by
the polymerase chain reaction method. Appl Environ Microbiol, 59, 1143–8.
Jones JB, Bouzar H, Stall RE, Almira EC, Roberts PD, Bowen BW, Sudberry J,
Strickler PM, Chun J. (2000) Systematic analysis of xanthomonads (Xanthomonas spp.)
associated with pepper and tomato lesions. Int J Syst Evol Microbiol, 50, 1211-1219.
Jones JB, Lacy GH, Bouzar H, Stall RE, Schaad NW. (2004) Reclassification of the
xanthomonads associated with bacterial spot disease of tomato and pepper. Syst Appl
Microbiol, 27, 755-762.
Jones JB, Stall RE, Bouzar H. (1998) Diversity among Xanthomonads pathogenic on pepper
and tomato. Annu Rev Phytopathol, 36, 41–58.
Park DS, Shim JS, Kim JS, Lim CK, Shrestha R, Hahn JH, Kim HG. (2009) Sensitive and
specific detection of Xanthomonas campestris pv. vesicatoria by PCR using pathovarspecific primers based on rhs family gene sequences. Microbiological Research, 164, 3642.
Pohronezny K, Volin RB. (1983) The effect of bacterial spot on yield and quality of fresh
market tomatoes. Hort Science, 18, 69-70.
Stall RE. (1995) Pathogenesis and host specificity inplant diseases: histopathological,
biochemical, genetic and molecular bases. K, K., eds., Pergamon Press, 167–84.
Young J, Park DC, Shearman H, Fargier E. (2008) A multilocus sequence analysis of the
genus Xanthomonas. Systematic and Applied Microbiology, 31, 366 - 377.
Kontaktní adresa: Ing. Pavel Beran, Biologické centrum AV ČR, Ústav
molekulární biologie rostlin, oddělení rostlinné virologie, Branišovská 31, 370 05 České
Budějovice, e-mail: [email protected]
208
„Úroda 12/2011, vědecká příloha―
POLNÍ ODOLNOST ČESKÝCH ODRŦD VOJTĚŠKY SETÉ K
CHOROBÁM KOŘENE V POLOPROVOZNÍCH PODMÍNKÁCH –
LOKALITA LODĚNICE U OPAVY
The field resistance of Czech lucerne varieties to disease of root system –
locality Loděnice at Opava
Hakl J., Mášková K., Šantrŧček J.
Česká zemědělská univerzita v Praze
Abstrakt
Cílem tohoto příspěvku je porovnat polní odolnost ke komplexu patogenů poškozujících
kořenový systém v sortimentu českých odrůd vojtěšky seté na lokalitě Loděnice u Opavy.
Polní poloprovozní pokus s 10 českými odrůdami byl zaloţen na jaře roku 2007. Ve třetím
uţitkovém roce byly po třetí seči odebrány vzorky rostlin pro hodnocení celkové odolnosti ke
komplexu kořenových patogenů. Mezi odrůdami byly zaznamenány průkazné rozdíly v polní
odolnosti s rozdílem přes 10 %. V černozemní půdě při silném napadení chorobami byly
nejvíce odolné odrůdy Vlasta, Oslava a Niva, naopak nejniţší odolnost byla vyhodnocena u
odrůdy Kamila, Magda a Morava. Ostatní hodnocené odrůdy vykázaly průměrnou odolnost
okolo 72 %. Při porovnání s lokalitou Bystřice u Jičína byly zjištěny rozdílné výsledky u
jednotlivých odrůd, coţ ukazuje, ţe polní odolnost musí být vţdy hodnocena v kontextu
s dalšími ukazateli, např. hustotou porostu. Tyto výsledky bude třeba doplnit i o další
vyhodnocené rostliny na dalších lokalitách.
klíčová slova: pícniny, šlechtění, kořenové choroby
Abstract
The goal of this study was to investigate the differences in root disease field resistance among
Czech alfalfa varieties in locality Loděnice at Opava. The field experiment was established in
2007 and sampling were carried out in 2010 with five replicates of each alfalfa variety. The
resistances to root disease and stand density were evaluated. There were significant
differences among resistance of varieties when the highest resistance was observed for Vlasta,
Oslava and Niva variety. Other varieties have average level of resistance 72 %. The different
results from locality Bystřice were shown that root disease field resistance should be
evaluated in relation to other factors such as stand density. For generally conclusion, the
including of other localities is necessary.
Key-words: forage, breeding, root disease
Úvod
Efektivnost pěstování vojtěšky ovlivňuje především vytrvalost porostů (Smith et al., 1995).
Podle Táborské (2003) je napadení rostlin chorobami kořene a kořenového krčku důleţitým
stresovým faktorem ovlivňujícím vytrvalost a výnosnost vojtěšky seté a Kenneth et al. (1988)
popisují se i jeho značný ekonomický dopad. Mezi nejvýznamnější původce těchto
onemocnění patří v ČR houba Verticilium albo-atrum a některé houby rodu Fusarium
(Táborská, 2003). Od počátku infekce k odumření rostliny uplynou zpravidla 1 aţ 2 roky
(Kůdela, 1978), takţe negativní vliv chorob je tedy dán vlastním úbytkem rostlin ale také
sníţením produktivity rostlin v různých fázích infekce. Hakl et al. (2004) uvádějí, ţe s
rostoucí intenzitou onemocnění dochází k průkaznému sniţování počtu lodyh na rostlině.
Redukce počtu lodyh se při maximálním napadení pohybuje na úrovni 80% a k průkaznému
sníţení oproti zdravým rostlinám dochází od středního stupně napadení.
209
„Úroda 12/2011, vědecká příloha―
Do současné doby není známa ţádná přímá metoda ochrany proti tomuto komplexu chorob,
proto je vlastní odolnost odrůdy vedle preventivní agrotechniky velmi důleţitou vlastností
(Hakl, 2006). Odolnost vojtěškových odrůd je proto jedním z parametrů ve šlechtění, ale
v následném hodnocení polní odolnosti odrůd v provozních podmínkách dosud nebyl ţádný
systematický výzkum prováděn. Pro objektivní porovnání je nutné pěstování porovnávaných
odrůd na společné lokalitě a minimálně střední tlak choroby. Optimální je moţnost zahrnout
více různých lokalit. Porovnání polní odolnosti českých odrůd vojtěšky seté k chorobám
kořene a kořenového krčku v hnědozemi na stanovišti v Bystřici u Jičína uvádějí Hakl et al.
(2008). Cílem tohoto příspěvku je doplnit tyto výsledky o porovnání odolnosti českých odrůd
vojtěšky v černozemní půdě na lokalitě Loděnice u Opavy.
Materiál a metody
Polní poloprovozní pokus byl zaloţen na jaře v roce 2007 s výsevkem 14 kg na hektar na
pozemcích zemědělského podniku ZD Hraničář v Loděnicích u Opavy. Stanoviště se nachází
v nadmořské výšce 270 m nad mořem, v řepařské výrobní oblasti. Půda je střední, půdní typ
je černozem. Průměrná roční teplota je 8,1 ºC, roční úhrn sráţek kolísá okolo 640 mm.
V pokuse bylo zařazeno 10 českých odrůd vojtěšky seté registrovaných v roce 2007: Pálava,
Morava, Magda, Jitka, Jarka, Zuzana, Vlasta, Oslava, Kamila a Niva. Pokus byl zaloţen ve
schématu dlouhých parcel o rozměrech 8 x 190 m s plochou 0,152 ha.
Výnosy byly v letech 2008 a 2009 stanoveny váţením hmoty z dlouhých parcel, bohuţel
v roce 2010 nebyly v důsledku nepříznivého deštivého počasí při sklizních provedeny. Ve
třetím uţitkovém roce v říjnu 2010 byly odebrány vzorky rostlin z ploch 0,25 m2, vţdy v pěti
opakováních pro kaţdou odrůdu. U odebraných vzorků byl stanoven počet rostlin a na
příčném průřezu kořene byl u kaţdé rostliny na základě symptomů subjektivně stanoven
stupeň napadení. Byl sledován výskyt zdravých rostlin a intenzita napadení u cévního vadnutí,
nekrózy krčku a kořene, krčkových a kořenových hnilob podle metodiky (Kůdela, 1978).
Celkové napadení chorobami bylo stanoveno tak, ţe stupně napadení jednotlivých chorob
byly následně sjednoceny podle uváděné škodlivosti a v případě společného výskytu chorob
na jedné rostlině sečteny. Průměrný stupeň napadení byl vypočten váţeným průměrem.
Celková polní odolnost jednotlivých odrůd vojtěšek ke komplexu půdních patogenů pak byla
vypočtena podle metodiky Kůdely (1970) pro stanovení odolnosti k cévnímu vadnutí.
Výsledky byly statisticky zpracovány jednoduchou analýzou rozptylu a testy dobré shody.
Výsledky a diskuze
Celkem bylo z odběru vyhodnoceno 817 vojtěškových rostlin, ze kterých bylo 776 rostlin
napadeno patogeny poškozujících kořenový systém. (tab. 1). U 79 % napadených rostlin bylo
zjištěno cévní vadnutí, coţ potvrzuje tuto chorobu v našich podmínkách jako nejvýznamnější
(Kůdela, 1978; Hakl, 2006). U 41 % napadených rostlin (časté jsou i směsné infekce) byly
zaznamenány krčkové a kořenové hniloby, nekrózy krčku a kořene nebyly při hodnocení
zjištěny. Z výsledků celkového výskytu chorob je zřejmé, ţe na dané lokalitě bylo v třetím
uţitkovém roce pouze 5 % rostlin zdravých a 95 % rostlin vykazovalo různé příznaky
napadení. Hakl et al. (2008) u českých odrůd vojtěšky ve třetím uţitkovém roce na stanovišti
v Bystřici u Jičína zjistili 17 % zdravých rostlin a také celkově niţší výskyt krčkových a
kořenových hnilob (u 3 % rostlin). Silnější celkový výskyt chorob a kořenových hnilob na
stanovišti v Opavě byl zřejmě způsoben velmi vlhkým ročníkem 2010.
Vypočtené polní odolnosti jednotlivých odrůd jsou prezentovány v tab. 2. Vzhledem k tomu,
ţe se jedná o výsledky poloprovozního pokusu, je nutné postupovat při interpretaci výsledků
opatrně. Z těchto důvodů jsou odrůdy při hodnocení členěny pouze do tří kategorií
(nadprůměr/průměr/podprůměr) a nelze posuzovat jejich pořadí v rámci kategorií.
210
„Úroda 12/2011, vědecká příloha―
Intenzita napadení chorobami je hodnocena jako nespojitá kategoriální veličina a z tohoto
důvodu byly pro statistické zpracování pouţity testy dobré shody (Pearsonův χ2 test). V polní
odolnosti byly mezi odrůdami zjištěny statisticky průkazné rozdíly (P = 0,046).
V podmínkách polního pokusu byly nejvíce odolné odrůdy Vlasta, Oslava a Niva, naopak
nejniţší odolnost byla vyhodnocena u odrůdy Kamila, Magda a Morava. Ostatní hodnocené
odrůdy vykázaly průměrnou odolnost okolo 72 %. Hakl et al. (2008) uvádějí na stanovišti
v Bystřici jako nejodolnější odrůdu Jitku a Zuzanu a nejméně odolné odrůdy Vlasta a Niva při
průměrné odolnosti všech odrůd 74 %. Tyto rozdíly ukazují, ţe samotná vypočtená polní
odolnost má malou vypovídací hodnotu, a proto musí být hodnocena v kontextu s hustotou a
dalšími ukazateli.
Tabulka 1. Četnost výskytu rostlin v jednotlivých třídách celkového napadení komplexem
kořenových chorob u hodnocených odrůd („zdravá― = rostliny bez příznaků napadení).
stupeň celkového napadení kořenovými chorobami
odrůda
zdravé
1
2
3
4
5
6
celkem
Jarka
8
20
19
25
16
7
5
100
Jitka
2
18
20
27
14
2
1
84
Kamila
2
11
20
21
4
7
6
71
Magda
5
12
11
21
8
9
4
70
Morava
2
12
22
21
10
9
3
79
Niva
8
14
25
12
4
3
6
72
Oslava
4
16
28
20
9
2
3
82
Pálava
3
15
31
20
12
4
4
89
Vlasta
2
18
25
24
5
5
2
81
Zuzana
5
13
26
27
15
1
2
89
celkem
41
149
227
218
97
49
36
817
Tabulka 2. Hodnocení odrůd z hlediska hustoty porostu a polní odolnosti vůči komplexu
kořenových chorob. (PSN = průměrný stupeň napadení všech rostlin; odolnost vypočtena
podle Kůdely (1970); hodnocení: „+― = nadprůměr, „0― = průměr, „-― = podprůměr)
odrůda
PSN
odolnost
hustota
-2
%
hodnocení
r.m
hodnocení
Jarka
2,62
70,3
0
80
+
Jitka
2,51
74,0
0
67
0
Kamila
2,83
67,8
57
Magda
2,83
65,9
56
Morava
2,81
68,3
63
0
Niva
2,32
76,1
+
58
Oslava
2,39
76,3
+
66
0
Pálava
2,57
73,4
0
71
0
Vlasta
2,43
75,2
+
65
0
Zuzana
2,51
74,4
0
71
0
průměr
2,58
72,3
0 = ± 2,5%
65
0 = ± 6 r.
Výsledky hodnocení hustoty porostu pomocí jednoduché analýzy rozptylu ukázaly
neprůkazný rozdíl mezi odrůdami (P = 0,104), s 90%-ní pravděpodobností lze však
povaţovat rozdíly v hustotě za významné (tab. 2). Vypočtená vysoká odolnost ale nízká
hustota porostu u odrůdy Niva můţe ukazovat i na rychlý úhyn napadených rostlin a
v důsledku toho pak „vyšší― odolnost těch zbývajících.
211
„Úroda 12/2011, vědecká příloha―
Bohuţel nebylo moţné vyhodnotit souvislost mezi napadením a výnosem sušiny ve třetím
uţitkovém roce. Jak uvádějí Hakl et al. (2008), výnos je výsledkem společného vlivu
odolnosti odrůdy, dosaţené hustoty porostu, ale i dalších faktorů vnějšího prostředí. Důleţitou
roli hraje také velikost rostlin, neboť jejich produktivita koreluje zejména s průměrem
hlavního kořene a aţ následně se stupněm napadení chorobou (Hakl et al., 2004). Pozitivní
vliv odolnosti k chorobám na výnos sušiny potvrzují výsledky Hakla et al. (2008), v souladu
s poznatky Smitha et al. (1995) o negativním vlivu kořenových chorob s následným
nepříznivým ovlivněním ekonomiky pěstování.
Závěr
Z výsledků vyplývá, ţe v sortimentu českých odrůd vojtěšky seté existují průkazné rozdíly
v polní odolnosti ke komplexu kořenových chorob s rozdílem v odolnosti přes 10 %.
V černozemní půdě při silném napadení chorobami byla nejvyšší polní odolnost zaznamenána
u odrůd Vlasta, Oslava a Niva, naopak nejniţší odolnost byla vyhodnocena u odrůdy Kamila,
Magda a Morava. Ostatní hodnocené odrůdy vykázaly průměrnou odolnost okolo 72 %. Při
porovnání s lokalitou Bystřice u Jičína byly zjištěny rozdílné výsledky u jednotlivých odrůd.
Tyto výsledky bude třeba pro vyslovení konečných závěrů doplnit i o další vyhodnocené
rostliny na dalších lokalitách.
Poděkování
Sběr a vyhodnocení dat bylo financováno z výzkumného záměru MSM 6046070901.
Poděkování patří především Ing. Marii Hrubé a Ing. Zbyňkovi Petrečkovi za zaloţení a vedení
poloprovozního pokusu.
Pouţitá literatura
Hakl, J. (2006): Pícninářská charakteristika a uplatnění vybraných českých novošlechtění
vojtěšek. Česká zemědělská univerzita v Praze, disertační práce, 88 s.
Hakl, J., Krajíc, L., Hrubá, M., Zemánek, O. (2008): Polní odolnost českých odrůd vojtěšky
seté k chorobám kořene v poloprovozních podmínkách – lokalita Bystřice u Jičína. In.
Aktuální poznatky v pěstování, šlechtění, ochraně rostlin a zpracování produktů. Vědecká
příloha Úrody, Profipress, 12, s. 175 – 178.
Hakl, J., Šantrůček, J., Kalista, J. (2004): Počet a délka lodyh u rostlin vojtěšky seté ve vztahu
k intenzitě napadení chorobami kořenového systému. In. Vliv abiotických a biotických
stresorů na vlastnosti rostlin 2004. Sborník příspěvků z vědecké konference. AF ČZU,
Praha, s 142 – 145.
Kenneth, TL, Donald, CE, Gerald, DG (1988): Diseases and nematodes. In: Hanson A. A. et
al.: Alfalfa and alfalfa improvement, Madison, Wisconsin, USA, s. 621 – 662.
Kůdela, V. (1970): Způsob hodnocení odolnosti odrůd vojtěšky vůči cévnímu vadnutí.
Rostlinná výroba, 16, 9, s. 1041 – 1050.
Kůdela, V. (1978): Soustava ochranných opatření proti cévnímu vadnutí vojtěšky. UVTIZ,
Praha. 25 s.
Smith, EG, Acharya, SN, Huangh, HC (1995): Economics of growing verticillium wiltresistant and adapted alfalfa cultivars in western Canada. Agronomy Journal, 1995, 87: 6,
s. 1206-1210.
Táborská, M (2003): Karanténní choroby a škůdci vojtěšky a rostlinolékařská kontrola.
Úroda, 11, s. 6-7
Kontaktní adresa: Ing. Josef Hakl, Ph.D., Katedra pícninářství a trávníkářství, Česká
zemědělská univerzita v Praze, Kamýcká 129, Praha 6 - Suchdol, 16521 [email protected]
212
„Úroda 12/2011, vědecká příloha―
ANTIFUNGÁLNÍ POTENCIÁL NÍZKOMOLEKULÁRNÍCH PROTEINŦ
A PEPTIDŦ HLÍZ BRAMBORU (SOLANUM TUBEROSUM L.)
Antifungal potential of low molecular proteins and peptides gained from
potato tubers (Solanum tuberosum L.)
Kamenová A., Bártová V., Bárta J.
Jihočeská univerzita v Českých Budějovicích, Zemědělská fakulta
Abstrakt
Příspěvek se zabýval antifungálními účinky skupiny termostabilních proteinů a peptidů s převahou
inhibitorů proteas, které byly izolovány z hlízové vody (vedlejší produkt průmyslového zpracování
brambor na škrob, odrůdová směs Solanum tuberosum L.). Pro izolaci proteinů byla vyuţita
kombinace sníţení pH a vysoké teploty (100°C). Izolované proteiny byly detekovány analýzou SDSPAGE na peptidovém gelu v oblasti od 6 do 17 kDa. Majoritní podíl těchto proteinů byl v oblasti
17 kDa a další výrazný band byl zaznamenán v oblasti okolo 6,5 kDa. Testovaný vzorek byl aplikován
v různých koncentracích ke třem kmenům fytopatogenní houby Fusarium solani a ke dvěma kmenům
fytopatogenní houby Fusarium oxysporum. Byl zaznamenán inhibiční účinek na tyto kmeny hub u
všech testovaných koncentrací účinné látky.
Klíčová slova: hlízová voda, Solanum tuberosum L., antifungální aktivita, inhibitory proteas
Abstract
The contribution deals with antifungal activities of group of termostable proteins and peptides with a
predominance of protease inhibitors recovered from potato fruit juice (by-product of industrial potato
starch production, cultivar mixture of Solanum tuberosum L.). Combination of high temperature
(100°C) and pH adjustment was used for protein isolation. Isolated proteins were detected in the SDSPAGE analysis on peptide gel in range of 6 - 17 kDa. Two major significant bands were detected. First
in 17 kDa area and second significant band was detected in area about 6,5 kDa. These proteins and
peptides seem to be the major part of the isolated protein mixture. Different protein concentrations
were applied to three different phytopathogenic fungal strains of Fusarium solani and two different
phytopathogenic fungal strains of Fusarium oxysporum. Verifiable inhibition effect of all
concentrations of active substance was marked on these fungi strains.
Key words: potato fruit juice, Solanum tuberosum L., antifungal activity, protease inhibitors
Úvod
Hlízová voda je vedlejší produkt výroby bramborového škrobu, obsah sušiny se pohybuje
v rozsahu 5 aţ 6 %, obsah proteinů (N x 6,25) v sušině se pohybuje kolem 27 % a peptidů
kolem 4 % (Bárta, Bártová 2007). Hlízové proteiny byly rozděleny dle práce Pots (1999)
následovně: proteiny patatinového komplexu (molekulová hmotnost kolem 43 kDa),
inhibitory proteas (molekulová hmotnost 8-25 kDa) a tzv. ostatní proteiny (molekulová
hmotnost nad 45 kDa). Některé ze skupin inhibitorŧ proteas se vyznačují vysokou
termostabilitou a optimální aktivitou i při zpracování za vysokých teplot. Inhibitory proteas
jsou podle práce Jongsma (1995) klasifikovány na principu aktivního místa, které inhibují
(serinové, cysteinové, aspartátové, metalloproteasové), dle práce Pots (1999) jsou členěny na
tři podtřídy podle molekulové velikosti, nebo dle práce Pouvreau et al. (2001) do sedmi tříd
podle molekulové hmotnosti, stavby molekuly, hodnoty isoelektrického bodu a počtu
sulfidických můstků.
Rostlinné inhibitory proteas jsou variabilní skupinou proteinů s mnoha funkcemi –
v rostlinách jsou syntetizovány konstitutivně i indukovaně jako reakce na poranění, mohou
mít funkci zásobních proteinů, ale často jsou také součástí obranných reakcí rostlin a vykazují
inhibiční aktivitu vůči mnoha organismům, působí jako regulátory endogenní proteolytické
aktivity a jsou nezastupitelné ve vývojových procesech včetně buněčné smrti (Hraška et al.
213
„Úroda 12/2011, vědecká příloha―
2006). Inhibitory proteas představují v hlízách bramboru velmi významnou, převáţně
konstitutivně syntetizovanou sloţku hlízových proteinů. Antimikrobiální vlastnosti byly
dosud popsány pouze u některých skupin hlízových inhibitorů proteas - Speranskaya et al.
(2006) popsali ve své práci vliv hlízových inhibitorů Kunitzova typu na růst a vývoj
fytopatogenní houby Fusarium culmorum; Kim et al. (2005) ve své práci potvrdili
antimikrobiální aktivitu bramborového inhibitoru proteas I (PI-1) proti fytopatogenní houbě
Rhizoctonia solani Cílem příspěvku bylo studium antifungální aktivity termostabilních
proteinů hlíz brambor s převahou inhibitorů proteas získaných z hlízové vody testovaných
na fytopatogenních houbách Fusarium solani a Fusarium oxysporum.
Materiál a Metody
Rostlinným materiálem pro zdroj proteinů byla hlízová voda z průmyslového zpracování
brambor na škrob (směs odrůd druhu Solanum tuberosum L.), která byla získána z podniku
Lyckeby Amylex a. s., Horaţďovice. Tento materiál byl centrifugací a filtrací zbaven škrobu,
vlákniny a dalších ve vodě nerozpustných látek. Následně byla upravena reakce na pH 5
a tepelnou koagulací se provedla deproteinizace (oddělení majoritních, termolabilních
proteinů) vytemperováním vzorku ve vodní lázni na 100°C. Po ukončení koagulace se
provedla dialýza získaného supernatantu (Slide-A-Lyzer Dialysis Cassette, Thermo Scientific)
a vzorek se zakoncentroval lyofilizací. Získaná směs proteinů a peptidů byla rozpuštěna
v ultra čisté vodě, roztok byl sterilizován bakteriálním filtrem (22 µl, Millipore) a aplikován v
objemu 30μl do kaţdé z jamek, které byly přesně umístěny na okraj rostoucího mycelia.
U kaţdé varianty pokusu byla jako kontrola aplikována sterilní, destilovaná voda.
Antifungální testy byly prováděny na třech kmenech fytopatogenní houby Fusarium solani
a na dvou kmenech fytopatogenní houby Fusarium oxysporum. Uvedené kmeny byly získány
z České sbírky mikroorganismů v Brně. Izolovaná směs termostabilních proteinů byla
aplikována v koncentracích 1mg/ml, 5 mg/ml a 10 mg/ml a byl sledován vliv na růst
mikroskopických hub. Antifungální aktivita byla hodnocena po 24 a 48 hodinách kultivace při
26°C (Huynth et al. 1996). Izolované termostabilní peptidy a proteiny byly detekovány
pomocí SDS-PAGE na peptidovém gelu.
Výsledky a diskuze
Termostabilní proteiny a peptidy byly detekovány pomocí SDS-PAGE na peptidovém gelu
v oblasti od 6 do 17 kDa v pěti výrazných zónách (obrázek 1). Nejintenzivnější band se
nacházel v oblasti kolem 14 kDa, coţ naznačuje majoritní podíl těchto peptidů ve směsi.
Pravděpodobně se jedná o hlízové inhibitory proteas II (PI-2), serinové inhibitory proteas 2
a inhibitory proteas Kunitzova typu. Další výrazné bandy se nachází v oblasti kolem 6 kDa.
V tomto případě by se mohlo jednat o hlízové inhibitory proteas I (PI-1) a serinové inhibitory
proteas. Kim et al. (2005) ve své práci uvádí detekci antimikrobiálních termostabilních
peptidů o molekulové hmotnosti 5,6 kDa.
Antifungální aktivita izolované směsi peptidů a proteinů získaných z hlízové vody byla
testována na čtyřech kmenech fytopatogenní houby F. solani (kmeny 1036, 8014 a 8079)
a F. oxysporum (kmeny 17, F-65). U všech kmenů byla zaznamenána tvorba inhibiční zóny
po 24 hodinách kultivace (obrázek 2) a byla měřena hodnota rozpětí inhibiční zóny-RIZ
(znázorněno na obrázku 2). Největší RIZ bylo naměřeno u varianty s koncentrací 10 mg/ml
a to v rozpětí RIZ=16 aţ 24 mm v porovnání všech testovaných mikroskopických hub.
214
„Úroda 12/2011, vědecká příloha―
Obr. 1: Detekce termostabilních
proteinů a peptidů pomocí SDSPAGE na peptidovém gelu.
Obr. 2: Ukázka měření RIZ a vytvořené inhibiční zóny
na okrajích mycelia kultury F. solani u koncentrací
10 mg/ml, 5 mg/ml a 1 mg/ml.
HM – hmotnostní marker; PFJ – deproteinizovaná odrůdová směs S. tuberosum L.;
RIZ – rozpětí inhibiční zóny
Inhibiční zóna byla zřetelná i u varianty koncentrace 5 mg/ml (rozpětí RIZ=11 aţ 21), méně
zřetelný byl účinek testované látky o koncentraci 1 mg/ml, kdy bylo zpomalení růstu mycelia
patrné aţ po 48 hodinách kultivace u všech testovaných kmenů kromě kmenů F. solani 8079
a F. oxysporum 17, u nichţ se projevila zvýšená citlivost k niţší koncentraci účinné látky jiţ
po 24 hodinách kultivace, na rozdíl od ostatních testovaných kmenů. Při vzájemném
porovnání působení směsi proteinů na testované kmeny rodu F. solani, jako typického
patogena druhu S. tuberosum, a testovanými kmeny F. oxysporum nebyly zaznamenány ţádné
výrazné rozdíly jak při porovnání obou rodů navzájem, tak při vzájemném porovnání
jednotlivých kmenů, byla však zaznamenána zvýšená citlivost kmenů F. solani 8079
a F. oxysporum 17 na niţší koncentraci účinné látky (1 mg/ml). Z výsledků vyplývá,
ţe termostabilní frakce hlízových proteinů izolovaná z „odpadního― produktu škrobárenského
průmyslu vykazuje zajímavé antifungální vlastnosti, které je nutné dále podrobněji studovat,
neboť tyto proteiny by mohly být v budoucnu vyuţitelné v řadě biotechnologických aplikací.
Závěr
Příspěvek se zabýval antifungální aktivitou nízkomolekulárních proteinů a peptidů získaných
z hlízové vody. Izolované proteiny byly analýzou SDS-PAGE na peptidovém gelu detekovány
v oblasti 14 kDa a v oblasti kolem 6 kDa, tedy v oblasti výskytu inhibitorů proteas. Tyto
proteiny si i přes expozici teplotě 100°C uchovaly svou antifungální aktivitu, která byla
prokázána na fytopatogenních druzích hub Fusarium solani a Fusarium oxysporum tvorbou
inhibičních zón u koncentrací 10 a 5 mg/ml po kultivaci 24 hodin při teplotě 26°C a u kmenů
F. solani 8079 a F. oxysporum 17 byla pozorována tvorba inhibiční zóny jiţ při koncentraci
1 mg/ml po kultivaci 24 hodin. Po kultivaci 48 hodin (26°C) bylo zpomalení růstu
pozorováno i u ostatních kmenů při koncentraci 1mg/ml testované látky. Získané výsledky
naznačují zajímavý potenciál termostabilní frakce hlízových proteinů s moţným budoucím
vyuţitím v mnoha biotechnologických aplikacích.
215
„Úroda 12/2011, vědecká příloha―
Dedikace
Výsledky byly získány v rámci řešení výzkumných projektů GAČR 522/09/1693, GAJU
064/2010/Z a výzkumného záměru MSM 6007665806.
Pouţitá literatura
Bárta J., Bártová V. (2007): Bílkoviny hlíz bramboru (Solanum tuberosum L.). Jihočeská
univerzita v Českých Budějovicích, 116 s.
Hraška M., Rakouský S., Čurn V. (2006): Inhibitory proteas, mechanismy účinku
a perspektivy jejich vyuţití v transgenozi rostlin. Chemické Listy 100: 501-507.
Huynth Q. K., Borgmeyer J. R., Smith C. E., Bell L. D., Shah D. M (1996): Isolation
andcharacterization of a 30 kDa protein with antifungal activity from leaves of Engelmannia
pinnatifida. Biochemical Journal, 316: 723-727.
Jongsma M. A. (1995): The resistance of insect to plant proteinase inhibitors. Centre for Plant
Breeding and Reproduction. Wageningen. Wageningen University.
Kim J.-Y., Park S.-C., Kim M.-H., Lim H.-T., Park Y., Hahm K.-S. (2005): Antimicrobial
activity studies on a trypsin-chymotrypsin protease inhibitor obtained from potato.
Biochemical and Biophysical Research Communications, 330: 921-927.
Liu G., Chen N., Kaji A., Bode A. M., Ryan C. A., Dong Z. (2001): Proteinase inhibitors I
and II from potatoes block UVB-induced AP-1 activity by regulating the AP-1 protein
compositional patterns in JB6 cells. Proceedings of National Academy of Sciences of the
United States of America, 10: 5786-5791.
Pots A. M. (1999): Physico-chemical properties and thermal aggregation of patatin, the major
potato tuber protein. Ph. D thesis. Wageningen Agricultural university, Wageningen, The
Netherlands, 123 p.
Pouvreau L., Gruppen H., Piersma S. R., Broek van der L.A.M., Koningsvald van G.A.,
Voragen A. G. J. (2001): Relative abundance and inhibitory distribution of protease
inhibitors in potato fruit juice from cv. Elkana. Journal of Agriculture and Food Chemistry,
49: 2864–2874.
Speranskaya A. S., Krinitsina A. A., Revina T. A., Gerasimova N. G., Keruchenko Y. A. S.,
Shevelev A. B., Valueva T. A. (2006): Heterologous expression, purification, and properties
of a potato protein inhibitor of serine proteinases. Biochemisty (Moscow), 11: 1176-1182.
Kontaktní adresa:
Ing. Andrea Kamenová
Oddělení pěstování rostlin
Katedra rostlinné výroby a agroekologie
Zemědělská fakulta
Jihočeská univerzita v Českých Budějovicích
Studentská 13
370 05 České Budějovice
email: [email protected]
216
„Úroda 12/2011, vědecká příloha―
VLIV HYBRIDU NA INFEKCI OBILEK KUKUŘICE (ZEA MAYS L.)
HOUBAMI RODU FUSARIUM
Influence of hybrid on infection by Fusarium in maize grains
Kmoch M.1, Šafránková I.1, Polišenská I.2, Pokorný R.1
1
Mendelova univerzita v Brně, Ústav pěstování, šlechtění rostlin a rostlinolékařství
2
Agrotest fyto, s.r.o., Kroměříţ
Abstrakt
Houby rodu Fusarium, které jsou rozšířenými patogeny kukuřice, mohou kromě sníţení výnosu
produkovat nebezpečné mykotoxiny. Cílem práce bylo stanovení vlivu konvenčních a transgenních
Bt-hybridů na intenzitu napadení obilek kukuřice houbami rodu Fusarium a jejich druhové spektrum v
přirozeně infikovaných porostech České republiky. Pro determinaci druhů byla pouţita
mikrobiologická metoda. Z obilek hybridů kukuřice bylo izolováno šest druhů: F. subglutinans, F.
verticillioides, F. avenaceum, F. graminearum, F. poae a F. proliferatum. Zastoupení jednotlivých
druhů v rodě Fusarium bylo v obilkách konvenčních a Bt-hybridů rozdílné. Druhy F. verticillioides a
F. graminearum byly méně zastoupeny v rodě u Bt-hybridů, F. avenaceum a F. poae u hybridů
konvenčních. V intenzitě napadení obilek konvenčních a Bt-hybridů nebyl zjištěn statisticky
významný rozdíl. Předpokládaná výrazně niţší úroveň infekce transgenních hybridů nebyla potvrzena.
Klíčová slova: Fusarium spp., hybridy, kukuřice setá
Abstract
Species of Fusarium are widespread fungi pathogens of maize. Except for yield reduction they can
produce mycotoxins. The aim was to determine the effect of conventional hybrids and transgenic Bthybrids in the infected intensity of maize grains by Fusarium and their representation of natural
infected stands in Czech Republic. Microbiological method was used for the determination of species.
F. subglutinans, F. verticillioides, F. avenaceum, F. graminearum, F. poae and F. proliferatum (six
species) were isolated from hybrid grains. Representation of Fusarium species in conventional and Btmaize hybrids grains was different. F. graminearum and F. verticillioides were represented less in Bthybrids; F. avenaceum and F. poae were represented less in conventional hybrids. The intensity of
infected grains of conventional hybrids and Bt-hybrids was not statistically significant difference. The
estimated lower level of infection of transgenic hybrids has not been confirmed significantly.
Key words: Fusarium spp., hybrids, maize
Úvod
Houby rodu Fusarium jsou rozšířenými patogeny kukuřice ve všech evropských oblastech
jejího pěstování. Způsobují dva druhy hnilob palic kukuřice – červenou a růţovou (Logrieco
et al., 2002, Bottalico, 1998). Převaţujícími druhy, které způsobují červenou hnilobu jsou F.
graminearum (teleomorfa Gibberella zeae), F. culmorum, F. cerealis a F. avenaceum (t. G.
avenacea). Druhy izolované z růţové hniloby jsou F. verticillioides (t. G. moniliformis), F.
proliferatum (t. G. intermedia) a F. subglutinans (t. G. subglutinans). Mezi další druhy
způsobující oba typy hnilob patří F. equiseti (t. G. intricans), F. poae, F. sporotrichioides, F.
acuminatum (t. G. acuminata), F. semitectum, F. solani (t. Nectria haematococca) a F.
oxysporum (Logrieco et al., 2002). Kromě sniţování výnosů (Qiang et al., 2008) jsou druhy
rodu Fusarium schopny produkovat sekundární metabolity, tzv. mykotoxiny, které mohou
způsobit závaţná akutní a chronická onemocnění člověka a zvířat (D'Mello et al., 1999). Mezi
nejběţnější mykotoxiny rodu Fusarium patří trichotheceny, zearalenony a fumonisiny
(Logrieco, 2003). Jedním ze způsobů ochrany kukuřice před houbami r. Fusarium je výběr
vhodného hybridu. Transgenní Bt-hybridy, které jsou vysoce odolné vůči poranění zavíječem
kukuřičným (Ostrinia nubilalis), vykazují podle některých autorů (např. Munkvold et al.,
1999) niţší hladiny výskytu hnilob palic v porovnání s hybridy konvenčními. Cílem práce
bylo stanovení vlivu konvenčních hybridů a odvozených transgenních Bt-hybridů kukuřice na
217
„Úroda 12/2011, vědecká příloha―
intenzitu napadení obilek patogenními houbami rodu Fusarium a druhové spektrum v
přirozeně infikovaných porostech České republiky.
Materiál a metody
Do pokusu bylo zařazeno 28 vzorků hybridů kukuřice seté (Zea mays L.) ze čtyř lokalit (Čejč,
Hodonín, Otrokovice a Rostěnice), které reprezentovaly hlavní pěstitelskou oblast kukuřice na
zrno v České republice. Na kaţdé lokalitě byly zastoupeny páry (konvenční hybrid a
odvozený Bt-hybrid). Celkem bylo vytvořeno 14 párů. Vzorky byly získány z přirozeně
infikovaných porostů ve fázi plná zralost (BBCH 89) v roce 2009. Obilky kukuřice byly
povrchově dezinfikovány (60 sec, 5% chlornan sodný), následně 2× opláchnuty sterilní
destilovanou vodou a umístěny do Petriho misek na bramboro-dextrózový agar (PDA), vţdy
10 ks/PM, pět opakování. Inkubace probíhala při laboratorní teplotě (20-22°C). Izolace
patogenů z obilek byla provedena čtvrtý aţ sedmý den a poté byly vypěstovány čisté kultury
z monosporických izolátů pro identifikaci. Pro mikrobiologickou determinaci druhů rodu
Fusarium byly vyuţity především morfologické znaky makrokonidií (tvar a velikost, tvar
koncové buňky, počet přehrádek) a mikrokonidií (tvar, jednobuněčné nebo dvoubuněčné,
tvořeny jednotlivě nebo v řetězcích). Hodnotila se i přítomnost fialid. Uvedené znaky byly
doplněny o charakteristiky kolonie houby (rychlost růstu, barva). Identifikace byla provedena
podle Leslie et Summerell (2006). Pro identifikaci patogenů byl pouţit optický mikroskop
(Olympus, zvětšení 200-400×). Pomocí mikrobiologické metody byly zjišťovány sumy
izolátů jednotlivých druhů hub v obilkách hybridů kukuřice (intenzita napadení). Statistické
vyhodnocení rozdílů mezi konvenčními a Bt-hybridy v intenzitě napadení bylo provedeno
pomocí analýzy rozptylu a mnohonásobného porovnávání (Tukey-HSD; α = 0,05), program
UNISTAT 5.1.
Výsledky a diskuze
Napadení obilek konvenčních hybridů kukuřice druhy rodu Fusarium bylo v průměru 17 %.
Napadení obilek Bt-hybridů bylo niţší (14 %). V intenzitě napadení obilek konvenčních
hybridů a Bt-hybridů houbami rodu Fusarium nebyl většinou zjištěn statisticky průkazný
rozdíl (tab. 1). Nelson et De´fago (2006), kteří identifikovali houby r. Fusarium ve stoncích
kukuřice, rovněţ neprokázali rozdíly mezi konvenčními a Bt-hybridy. Gatch et Munkvold
(2002) zjistili u Bt-hybridní kukuřice, která je méně náchylná k zavíječi kukuřičnému niţší
úroveň infekce druhy F. subglutinans a F. verticillioides neţ u hybridů bez transgenu. Naopak
u druhu F. graminearum prokázali vyšší úroveň infekce Bt-hybridů. V našich případech bylo
zjištěno nejvyšší napadení obilek u druhu F. subglutinans, který infikoval obilky klasických
hybridů 7,9 % a Bt-hybridů 6,6 %. U druhu F. verticillioides byla intenzita napadení obilek
klasických hybridů 4,9 %, Bt-hybridů 3,0 %. Intenzita napadení obilek druhem F. poae byla u
konvenčních hybridů 0,7 % a u Bt-hybridů 1,9 %. F. graminearum infikovalo obilky
klasických hybridů 2,0 %, Bt-hybridů 0,7 %. F. avenaceum napadlo obilky konvenčních
hybridů 1,3 % a Bt-hybridů 1,9 %. Infekce obilek druhem F. proliferatum byla zjištěna pouze
u konvenčních hybridů (0,3 %). Intenzita napadení obilek konvenčních hybridů a Bt-hybridů
druhy r. Fusarium je uvedena v grafu 1. Nejvyšší zastoupení druhu v rodě Fusarium bylo
zjištěno v obilkách konvenčních hybridů u druhu F. subglutinans (46,2 %) a F. verticillioides
(28,6 %). F. graminearum bylo zastoupeno v obilkách konvenčních hybridů (11,8 %), F.
avenaceum (7,6 %), F. poae (4,2 %) a F. proliferatum (1,7 %). V obilkách Bt-hybridů byly
v rodě Fusarium také nejvíce zastoupeny druhy F. subglutinans (46,9 %) a F. verticillioides
(21,4 %). Dále bylo zastoupeno F poae (13,3 %), F. avenaceum (13,3 %) a F. graminearum
(5,1 %). Podle autorů Lew et al. (2001) a Logrieco et al. (2002) patří F. subglutinans, F.
verticillioides a F. graminearum k nejčastější izolovaným druhům na kukuřici v Evropě.
Celkově byly v obilkách konvenčních a Bt-hybridů zastoupeny druhy v rodě Fusarium
218
„Úroda 12/2011, vědecká příloha―
v následujícím pořadí: F. subglutinans (46,5 %), F. verticillioides (25,3 %), F. avenaceum
(10,1 %), F. graminearum (8,8 %), F. poae (8,3 %) a F. proliferatum (0,9 %). Zastoupení
jednotlivých druhů v rodě Fusarium v obilkách konvenčních a transgenních Bt-hybridů
kukuřice je znázorněno v grafu 2 a 3.
Graf 1 Intenzita napadení obilek hybridů kukuřice houbami rodu Fusarium
Konvenční hybridy
Bt-hybridy
10,0
9,0
Napadení obilek (%)
8,0
7,0
6,0
5,0
4,0
3,0
2,0
1,0
0,0
F.
F.
subglutinans verticillioides
F. poae
F.
F. avenaceum
F.
graminearum
proliferatum
Druh patogenu
Tab. 1 Intenzita napadení obilek hybridů kukuřice houbami rodu Fusarium (průměry)
Hybrid / Lokalita
DKC 3511
DKC 3512 YG
DKC 4490
NC 4702 KDDZ
DK 440
DKC 4442 YG
DK 315
DKC 3946 YG
DKC 3420
DKC 3421 YG
Rostěnice
Otrokovice
H
Bt
H
Bt
H
Bt
H
Bt
H
Bt
ab
ab
1,2
1,4ab
1,4ab
1,4ab
1,0ab
0,2a
2,2b
1,2ab
2,6b
2,6b
F.
grami
nearu
m…
F.
poae
13%
F.
vertici
llioide
s…
a
1,2
1,6ab
1,4ab
1,4ab
1,0ab
0,2a
2,2b
1,2ab
NT
NT
Graf 2 Spektrum druhů v rodě Fusarium – Bt-hybridy
Hodonín
1,2
1,0a
2,2a
3,0a
2,0a
0,8a
NT
NT
NT
NT
Čejč
3,8a
2,8a
1,2a
1,6a
NT
NT
NT
NT
NT
NT
Graf 3 Spektrum druhů v rodě Fusarium – konvenční
F.
avena
F.
ceum
subgl 13%
utinan
s…
219
F. F.
avena
grami
ceum
nearu
m…
F.7%
poae
4%
F.
vertici
llioide
s…
F.
prolif
F.
eratu
subgl m…
utina
ns…
„Úroda 12/2011, vědecká příloha―
Závěr
V obilkách hybridů kukuřice bylo pomocí mikrobiologické metody identifikováno šest druhů
rodu Fusarium (F. subglutinans, F. verticillioides, F. avenaceum, F. graminearum, F. poae a
F. proliferatum). V intenzitě napadení obilek konvenčních a Bt-hybridů kukuřice houbami
rodu Fusarium nebyl zjištěn statisticky průkazný rozdíl. Předpokládané výrazně niţší
napadení Bt-hybridů patogeny rodu Fusarium nebylo potvrzeno. Niţší intenzita infekce Bthybridů s porovnáním s hybridy konvenčními byla zaznamenána u druhu F. subglutinans, F.
verticillioides a F. graminearum (bez statistické průkaznosti). Nejvyšší intenzita infekce
obilek hybridů kukuřice byla druhy F. subglutinans a F. verticillioides. Zastoupení
jednotlivých druhů v rodě Fusarium v obilkách konvenčních a transgenních Bt-hybridů
kukuřice bylo rozdílné. F. verticillioides a F. graminearum bylo zastoupeno méně u Bthybridů, naopak druhy F. avenaceum a F. poae byly v obilkách transgenních hybridů
zastoupeny více neţ v obilkách konvenčních hybridů.
Příspěvek byl zpracován s podporou projektu č. IP 14/2010 Interní grantové agentury
Mendelovy univerzity v Brně a Výzkumného záměru č. MSM6215648905 „Biologické
a technologické aspekty udrţitelnosti řízených ekosystémů a jejich adaptace na změnu
klimatu“ uděleného Ministerstvem školství, mládeţe a tělovýchovy České republiky.
Pouţitá literatura
Bottalico, A. 1998. Fusarium diseases of cereals: Species komplex and related mycotoxin profiles in
Europe. Journal of Plant Pathology 80: 85–103.
D'Mello, J., P., F., Placinta, C., M., Macdonald, A., M., C. 1999. Fusarium mycotoxins: a reviewof
global implications for animal health, welfare and productivity. Anim. Feed Sci. Technol 80, 183–
205.
Gatch, E., W., Munkvold, G., P. 2002. Fungal species composition in maize stalks in relation to
European corn borer injury and transgenic insect protection. Plant Disease 86: 1156-1162.
Leslie, J., F., Summerell, B., A., Bullock, S. 2006. The Fusarium Laboratory Manual. Oxford:
Blackwell Publishing. 388 s.
Lew, H., Adler, A., Thimm, N., Kkrska, R., Wiedner, G., Schuh, M. 2001. Occurrence of toxigenic
fungi and related mycotoxins in plants, food and feed in Austria. In Logrieco [ed.], Occurrence of
toxigenic fungi and mycotoxins in plants, food and feed in Europe, Brussels, s. 25-36.
Logrieco, A., Bottalico, A., Mulé, G., Moretti, A., Perrone, G. 2003. Epidemiology of toxigenic fungi
and their associated mycotoxins for some Mediterranean crops. European Journal of Plant
Pathology 109: 645–667.
Logrieco, A., Mul`e, G., Moretti, A., Bottalico, A. 2002. Toxigenic Fusarium species and mycotoxins
associated with maize ear rot in Europe. European Journal of Plant Pathology 108: 597–609.
Munkvold, G., P., Hellmich, R., L. 1999. Comparison of fumonisin concentrations in kernels of
transgenic Bt maize hybrids and nontransgenic hybrids. Plant Dis. 83, 130–138.
Naef, A., De´fago, G. 2006. Population structure of plant-pathogenic Fusarium species in
overwintered stalk residues from Bt-transformed and non-transformed maize crops. European
Journal of Plant Pathology 116:129–143.
Qiang, D., J.; Ming, W., X.; Chander, S.; Bing, Y., J.; Sheng, L., J. 2008. QTL mapping of resistance
to Fusarium ear rot using a RIL population in maize. Molecular-Breeding 22 (3): 395-403.
Kontaktní adresa
Ing. Martin Kmoch
Mendelova univerzita v Brně
Zemědělská 1/1665
613 00 Brno
e-mail: [email protected]
220
„Úroda 12/2011, vědecká příloha―
PRŦZKUM BAKTERIÁLNÍHO VADNUTÍ RAJČETE V ČR A
SPOLEHLIVOST DETEKCE CLAVIBACTER MICHIGANENSIS SUBSP.
MICHIGANENSIS Z RAJČAT RŦZNÝMI DIAGNOSTICKÝMI
TECHNIKAMI
The survey of bacterial canker of tomato in CR and detection reliability of
Clavibacter michicganensis subsp. michiganensis from tomato plants using
various diagnostic techniques
Kokošková B.1, Mráz I.2, Pouvová D.3, Beran P.2
1
Výzkumný ústav rostlinné výroby, v.v.i., Praha - Ruzyně
2
Biologické centrum AV ČR, České Budějovice
3
Česká zemědělská univerzita v Praze
Abstrakt
Průzkum bakteriálního vadnutí rajčete prováděný v letech 2009-2010 v 22 lokalitách ČR
prokázal výskyt choroby celkem v 6 lokalitách Jiţní a Střední Moravy a Středních Čech na
indeterminantních rajčatech pěstovaných jak ve sklenících, tak na polích. Celkem ze 113
vzorků rajčat s příznaky choroby se u 68 % vzorků rostlin prokázalo onemocnění. Pomocí IIF
byl C. m. subsp. michiganensis spolehlivě detekován do ředění 1:1000, zatímco pomocí
ELISA do ředění 1:100 (nepřímá ELISA a DAS-ELISA) a 1:10 (PTA-ELISA). Nepřímá
ELISA pomocí MAbs byla citlivější neţ PTA-ELISA s PAbs. Optimalizovaná PCR s
komerčními i našimi vlastními primery byly srovnatelné. Patogen byl spolehlivěji detekován z
bází, stonků a řapíků neţ z listů nemocných rostlin rajčat.
Klíčová slova: bakteriální vadnutí rajčete, detekce, ELISA, IF, PCR
Abstract
Based on the surveys of disease in 22 localities over 2009-2010 vegetation seasons, C. m.
subsp. michiganensis was found in 6 localities of the South and the Central Moravia and the
Central Bohemia in total on indeterminate tomatoes planted in greenhouses and fields. In
total, 113 symptomatic tomato samples were tested, from which 68 % were positive samples.
Using IIF Cmm was reliably detected to dilution 1:1000, but using ELISA to dilution 1:100
(Indirect ELISA and DAS-ELISA) and 1:10 (PTA-ELISA). Indirect ELISA using MAbs was
more sensitive than PTA-ELISA using PAbs. Optimized PCR with commercial and our
laboratory-generated primers were comparable. The pathogen was more reliably detected
from bases, stems and petioles than from leaves of diseased tomato plants.
Key words: bacterial canker of tomato, detection, ELISA, IF, PCR
Úvod
Bakteriální vadnutí rajčete, jehoţ původcem je karanténní bakterie Clavibacter michiganensis
subsp. michiganensis (Cmm) je významnou chorobou způsobující váţné hospodářské škody v
oblastech produkčního pěstování rajčat v celém regionu EPPO včetně České republiky
(Gleason et al. 1993; EPPO/CABI 1997).
Patogen se specializuje na kolonizaci cévních svazků rajčete. Prvotním příznakem
onemocnění je unilaterální vadnutí jednotlivých lístků zpeřených listů, které je zpočátku
reverzibilní, později ireverzibilní. Následně dochází k vadnutí, usychání a hnědnutí celých
listů, stonků a nakonec celé rostliny. Při napadení starších rostlin způsobuje bakterie nekrózy
listů a skvrnitost plodů (Kokošková 2008).
Bakterie Cmm přeţívá dlouhodobě na infikovaných rostlinných zbytcích v půdě a šíří se i
kontaminovaným nářadím a nádobami (Gleason et al. 1993). Za hlavní zdroj nákazy je však
221
„Úroda 12/2011, vědecká příloha―
povaţováno infikované osivo a sazenice (OEPP/EPPO 2005). Proto semena a sazenice
podléhají fytosanitární kontrole a jejich zásilky musí obsahovat osvědčení o zdravotním stavu.
Inspekční metody zahrnující detekci patogena z rostlin a semen jsou většinou zaloţeny na
imunochemických, molekulárních a biologických testech (OEPP/EPPO 2005; Dreier et al.,
1995; Kokoskova et al., 2010).
Cílem práce byl průzkum bakteriálního vadnutí rajčete v České republice a posouzení
spolehlivosti detekčních metod pouţívaných pro určení původce choroby.
Materál a metody
Sledování choroby bylo prováděno v hlavních produkčních oblastech indetermintních rajčat
pěstovaných ve skleníkových i polních podmínkách v celé ČR. Příznaky napadení byly
hodnoceny podle čtyřbodové stupnice (viz mapa). Vzorky byly připraveny z různých částí
příznakových rostlin jako báze, stonek, řapík (příčné řezy) a list (okrajové nekrózy)
v ředěních 1:10 aţ 1:10.000 (viz graf). Detekce Cmm byla prováděna různými diagnostickými
technikami podle diagnostických protokolů uvedených firem.
První z pouţitých technik byla optimalizovaná PCR (polymerázová řetězová reakce) s
komerčními (Dreier et al. 1995) a vlastními primery (Kokoskova et al. 2010). Druhou
technikou byla nepřímá imunofluorescence (IIF) s polyklonálními protilátkami (PAbs) od
firmy Neogen Europe Ltd. (UK). Dalšími metodami byly PTA-ELISA (nepřímá enzymatická
imunosorpční analýza) s PAbs od firmy Neogen Europe Ltd. (UK), nepřímá ELISA s
monoklonálními protilátkami (MAbs) a DAS-ELISA (dvojitá sendvičová ELISA) s PAbs od
firmy Agdia Inc. (USA).
Výsledky a diskuse
Průzkum bakteriálního vadnutí rajčete prováděný v letech 2009-2010 v 22 lokalitách ČR
prokázal výskyt choroby celkem v 6 lokalitách Jiţní a Střední Moravy a Středních Čech na
indeterminantních rajčatech pěstovaných jak ve sklenících, tak na polích. Celkem bylo
testováno 113 podezřelých vzorků rajčat, z nichţ 68 % se prokázalo jako vzorky pozitivní.
Pomocí IIF bylo Cmm spolehlivě detekováno do ředění 1:1000 a pomocí ELISA do ředění
1:100 (nepřímá ELISA a DAS-ELISA) a 1:10 (PTA-ELISA). Všechny tři typy ELISA technik
jsou doporučovány pro prověření příznakových vzorků rajčat na přítomnost Cmm. Na základě
našich výsledků však nepřímá ELISA pomocí MAb byla citlivější neţ PTA-ELISA s PAb. IIF
byla cca 10x citlivější neţ ELISA techniky, coţ odpovídá literárním údajům (Alvarez 2004).
Optimalizovaná PCR s komerčními (Dreier et al. 1995) i našimi vlastními primery pro PCR z
genu tomatinázy bakterie Cmm (Kokoskova et al. 2010) byly srovnatelné.
Patogen byl spolehlivěji detekován z bází, stonků a řapíků neţ z listů nemocných rostlin
rajčat. Mohlo to být způsobeno tím, ţe analýzy infikovaných rostlin byly prováděny na konci
vegetační sezóny a u některých rostlin byly k dispozici uţ jen seschlé listy. Bakterie Cmm se
nacházely ještě v hojné míře ve vaskulárních svazcích, ale nikoliv v listových pletivech.
Závěr
Bez ohledu na detekční techniku pro rutinní rozbory rostlinných vzorků rajčat podezřelých na
přítomnost Cmm, které se provádějí v laboratořích Státní rostlinolékařské správy,
doporučujeme analyzovat cévní svazky, v nichţ patogen přeţívá mnohem déle neţ v listech.
222
„Úroda 12/2011, vědecká příloha―
Mapa: Rozšíření bakteriálního vadnutí rajčete v České republice v letech 2009-2010
Práce byla podporována MZE ČR, projektem QH71229.
Pouţitá literatura
Alvarez, A.M. 2004. Integrated approaches for detection of plant pathogenic bacteria and
diagnosis of bacterial diseases. Annu. Rev. Phytopathol. 42: 339-366.
Dreier, J., Bermpohl, A., Eichenlaub, R.. 1995. Southern hybridization and PCR for specific
detection of phytopathogenic Clavibacter michiganensis subsp. michiganensis.
Phytopathology 85: 462-468.
EPPO/CABI: Quarantine pests for Europe, 2nd. Ed. (J.M.Smith, D.G. Mc Namara, P.R. Scott,
M. Holderness Eds), pp. 981- 984. CAB International, Wallingford (UK) 1997.
Gleason, M.L., Gitaitis, R.D., Ricker, M.D. 1993. Recent progress in understanding and
controlling bacterial canker of tomato in Eastern North America. Pl. Dis. 77: 1069-1075.
Kokošková, B. 2008. bakteriální choroby plodové zeleniny. Zahradnictví, 11: 20-21.
Kokošková, B., Mráz, I., Fousek, J. 2010. Comparison of specificity and sensitivity of
immunochemical and molecular techniques for determination of Clavibacter
michiganensis subsp. michiganensis. Folia Microbiol. 55: 239-244.
OEPP/EPPO. 2005. Clavibacter michiganensis subsp. michiganensis. OEPP/EPPO Bull. 35:
275-283.
Kontaktní adresa:
Ing. Blanka Kokošková, CSc.
Laboratoř diagnostiky a epidemiologie mikroorganismů
Odbor rostlinolékařství
Výzkumný ústav rostlinné výroby, v.v.i,
Drnovská 507
16106 Praha 6
e-mail: [email protected]
223
„Úroda 12/2011, vědecká příloha―
Detekce Clavibacter michiganensis subsp. michiganensis z rostlin rajčat
Nepřímá ELISA
DAS-ELISA
PTA-ELISA
Nepřímá IF
Optimalizovaná PCR
100
Pozitivní vzorky (%)
90
80
báze
70
60
stonek
50
řapík
40
list
30
20
10
0
1:10
1:100 1:1000
1:10
1:100 1:1000
1:10
1:100 1:1000
1:100 1:1000 1:10000
DprimersKprimers
Primerové sety
Ředění
224
„Úroda 12/2011, vědecká příloha―
hODNOCENÍ STUPNĚ NAPADENÍ ROSTLIN POMOCÍ PROGRAMU
ASSESS 2.0
Evaluation of infected plant level using Assess 2.0
Koláčková A., Kmoch M., Šafránková I., Krédl Z., Pokorný R.
Mendelova univerzita v Brně
Abstrakt
V posledních letech byl zaznamenán trend tvorby specializovaných počítačových programů určených
pro hodnocení stupně napadení rostlin patogeny, které odstraňují nedostatky subjektivního hodnocení
pozorovatelů a jsou objektivní, rychlé a přesné. Cílem práce bylo hodnocení stupně napadení
vybraných rostlin patogeny pomocí softwaru Assess 2.0 a následné porovnání s konvenční subjektivní
metodou pomocí diagramatické stupnice. Objektivní hodnocení stupně napadení vybraných rostlin
patogeny pomocí počítačového programu Assess 2.0 bylo přesnější neţ hodnocení pomocí
diagramatické stupnice. Shoda subjektivního hodnocení s programem se pohybovala od pouhých 18 %
do 100 %. V průměru byla nalezena shoda ve 40 % hodnocení. Kvalita vstupního obrazového
materiálu byla rozhodující pro přesnost hodnocení softwarem.
Klíčová slova: obrazová analýza, stupeň napadení, Assess 2.0
Abstract
There was noticed trend of specialized computer programs for assessing the level of infestation
plant pathogens in recent years. They eliminate the shortcomings of subjective evaluation and
objective observers and are fast and accurate. The aim was to assess the degree of infestation of
selected plant pathogens using software ASSESS 2.0 and subsequent subjective and comparison with
the conventional method using diagrammatic scale. Objective assessment of infested degree of
selected plant pathogens was more accurate by a computer program ASSESS 2.0 than using the
rating diagrammatic scale. Compliance with the subjective evaluation of the program has been ranged
from 18% to 100%. There was found out 40% agreement on average. The quality of the visual
material was deciding on the accurate evaluation software.
Key words: image analysis, the level of infestation, Assess 2.0
Úvod
Vizuální hodnocení napadení orgánů rostlin podle patometrických stupnic je v současné době
nejčastěji vyuţívanou metodou. Patometrie se zabývá měřením (hodnocením) intenzity
chorob. Intenzita choroby, resp. intenzita napadení je plocha nebo objem rostlinného pletiva
postiţeného patogenem. Intenzita choroby se měří počítáním lézí nebo pouţíváním
kvantitativních diagramatických stupnic vypracovaných pro jednotlivé choroby. Jednotlivé
stupně této škály vyjadřují procento postiţené plochy orgánu, kde se intenzita choroby stanoví
vizuálním porovnáním s diagramatickým nákresem (Kůdela et al., 1989, Kůdela et al., 2007).
Lidské oko pozoruje prostředí kolem nás a přitom rozlišuje detaily podle kontrastu, velikosti,
barvy (chromatičnosti a jasu), tvaru, vzdálenosti atd. Velkou roli při hodnocení obrazu hraje
paměť a zkušenost pozorovatele, zrakem však neumíme hodnotit detaily kvantitativně.
Hodnocení je jen subjektivní a můţe být i časově proměnné (psychofyziologický proces)
(Jeřábková, 2006). Obrazová analýza umoţňuje nahrazení subjektivního posuzování obrazů
pomocí objektivních charakteristik (Lukáš et al., 2008). Její podstatou je digitalizace obrazu a
zpracování vzniklého souboru dat v počítači (Jeřábková, 2006). V posledních letech je
zaznamenán trend tvorby specializovaných programů a metod, které odstraňují nedostatky
subjektivního hodnocení pozorovatelů. Počítačový program Assess 2.0 je optimalizován pro
měření listové plochy, procentuální vyjádření napadené plochy listu, délky kořenového
systému a procentuální pokryvnost půdy. Cílem práce bylo hodnocení stupně napadení
vybraných rostlin patogeny pomocí programu Assess 2.0 a následné porovnání s konvenční
225
„Úroda 12/2011, vědecká příloha―
subjektivní metodou pomocí diagramatické stupnice. Dalším cílem bylo porovnání kvality
vstupního obrazového materiálu získaného fotoaparátem a scannerem.
Materiál a metody
V první etapě řešení projektu byly vybrány modelové rostliny s příznaky daných chorob a byl
odebrán potřebný rostlinný materiál. Obraz potřebný pro analýzu byl získán
nafotografováním postiţených částí rostlin pomocí digitálního fotoaparátu (Canon Powershot
G12 IS), nebo naskenováním napadených částí rostlin za pomoci scanneru (Epson Perfection
V500). Bylo provedeno porovnání kvality vstupního obrazového materiálu získaného
fotoaparátem nebo scannerem. V programu Assess 2.0 bylo provedeno vyhodnocení stupňů
napadení rostlin patogeny. Následným krokem bylo porovnání objektivní metody hodnocení
stupně napadení rostlin patogeny s konvenční subjektivní metodou pomocí diagramatické
stupnice. Získané výsledky byly statisticky vyhodnoceny a vizuálně zpracovány.
Výsledky a diskuze
Příprava materiálu pro vyhodnocení stupně napadení v programu Assess 2.0
Jako modelová rostlina pro hodnocení stupně napadení byla zvolena třešeň, konkrétně listy
třešně napadené houbou Blumeriella jaapii, která způsobuje skvrnitost listů třešně. Při
porovnání kvality získaného vstupního obrazového materiálu bylo zjištěno, ţe obrazový
materiál pořízený scannerem vykazuje lepší kvalitu pro následnou analýzu programem Assess
2.0. Listy se tlakem scanneru narovnají, a proto nevykazují neţádoucí stíny a deformace, coţ
je problém při zachycování vzorků prostřednictvím fotoaparátu. Před vlastní dokumentací je
vhodné listy nejprve krátce lisovat pro dosaţení dostatečné kvality vyrovnání vzorků.
Vlastní práce s programem Assess 2.0
Prvním krokem při vyhodnocení obrazového materiálu je příprava pracovního prostředí
Assessu 2.0. Na výběr je několik kombinací nástrojové lišty a uţivatelských nástrojových
panelů, přičemţ kaţdá varianta je specificky konfigurována pro různé typy pouţití aplikace.
K vyhodnocení napadení u listů třešně byl vybrán klasický nástrojový panel (classic panel),
který umoţňuje individuální nastavení jednotlivých funkcí a tím nejširší spektrum nastavení
hodnot. Po nahrání obrázku do programu Assess 2.0 (obr. 1a) bylo nutné vyznačit si oblast
zájmu (AOI – Area of interest). Výhodou klasického panelu je individuální nastavení hodnot
prahů při určení barevného prostoru tak, ţe dojde k přesnému zaměření oblasti zájmu –
v našem případě celého listu odděleného od pozadí (obr. 1b). Přepnutím nastavení klasického
panelu na léze s nastavením oblasti zájmu přesně na list dochází k eliminaci míst, která by
byla ve stejném barevném spektru jako léze (např. řapík listu). V tomto případě lze také
individuálně nastavit prahové hodnoty barevného spektra dle velikostí lézí (obr. 1c). Pomocí
funkce měření procent výskytu lézí na vzorku listu (%Area) bylo zjištěno procentuální
zastoupení lézí na ploše oblasti zájmu (obr. 1d).
Obr. 1 (a-d)
Postup
při
hodnocení
stupně
napadení
programem
Assess 2.0
a
b
c
226
d
„Úroda 12/2011, vědecká příloha―
Porovnání objektivní metody hodnocení stupně napadení s metodou subjektivní
Jako modelová rostlina byl zvolen jahodník, konkrétně listy napadené houbou
Mycosphaerella fragariae, která způsobuje bílou skvrnitost listů jahodníku. Bylo vybráno 10
rostlin s různým stupněm napadení, u kterých byl vyhodnocen stupeň napadení programem
Assess 2.0. Pro zjištění subjektivního hodnocení byl vytvořen dotazník, který byl zadán
vzorku 22 respondentů. Pro tyto účely byla vytvořena následující stupnice: 1 – bez příznaků 0
%; 2 – 1 %; 3 – 3 %; 4 – 5 %; 5 – 10 %; 6 – 15 %; 7 – 20 %; 8 – 30 %; 9 – 50 %. Úzké
rozmezí hodnot bylo zvoleno pro demonstraci výskytu chyb v subjektivním hodnocení.
Přesto, ţe hodnoty stupně napadení byly do 20 %, byly záměrně zvoleny také hodnoty 30 % a
50 % k lepšímu odhalení subjektivního chybování.
a
f
b
g
c
d
h
e
ch
h
i
Obr. 2 (a – i) Obrázky pouţité při porovnání objektivní metody hodnocení stupně napadení
227
„Úroda 12/2011, vědecká příloha―
100
%
90
80
1
70
2
60
3
50
4
40
5
30
6
20
7
10
8
0
9
1
2
3
4
5
6
7
8
9
10
Rostliny
Graf 1 Porovnání objektivní a subjektivní metody hodnocení stupně napadení. Na ose x je
znázorněno procentuální vyjádření preferencí jednotlivých stupňů napadení u jednotlivých
rostlin. Sloupečky, které jsou černě ohraničené, vyjadřují stupeň napadení, který byl
vyhodnocen jako správný také programem Assess 2.0.
Srovnání subjektivního hodnocení s hodnocením programem Assess 2.0 je uvedeno v Grafu
1. Rostlina č. 7 vyhodnocená Assess 2.0 (stupeň napadení 1, obr. 2g) byla správně hodnocena
ve 100 % případech subjektivního hodnocení. Rostliny č. 3 a 10 (obr. 2c a 2i) hodnocené
programem stupněm 4 byly subjektivně správně hodnoceny v 38,6 % případech. Ve 29,5 %
případů došlo k podhodnocení o jeden, ve 4,5 % o dva a ve 2,3 % o tři stupně. V 18,2 % došlo
k nadhodnocení o jeden stupeň, ve 2,3 % o dva a ve 4,5 % o tři stupně. Rostliny č. 2 a 5 (obr.
2b a 2e) hodnocené programem stupněm 3 byly správně subjektivně vyhodnoceny ve 38,6 %
případů. Ve 36,4 % případech došlo k podhodnocení o jeden stupeň. V 18,2 % případech byly
rostliny nadhodnoceny o jeden stupeň, v 4,5 % případech o dva a ve 2,3 % případech o tři
stupně. Rostliny č. 1 a 9 (obr. 2a a 2ch) vyhodnocené programem stupněm 7 byly správně
subjektivně hodnoceny ve 36,4 % případech. V 18,2 % případů byly podhodnoceny o jeden,
v 15,9 % o dva a v 9,1 % o tři stupně. V 13,6 % došlo k nadhodnocené o jeden a v 6,8 % o
dva stupně. Rostlina č. 4 (obr. 2d) vyhodnocená programem stupněm 5 byla subjektivně
shodně hodnocena v 50 % případů. V 18,2 % došlo k podhodnocení o jeden a v 13,6 % o dva
stupně. V 9,1 % došlo k nadhodnocení o jeden a v 9,1 % o dva stupně. Rostliny č. 6 a 8 (obr.
2f a 2h) vyhodnocené programem stupněm napadení 6 byly hodnoceny subjektivně shodně
pouze v 15 % případech hodnocení. Ve 40,9 % případech docházelo v podhodnocení o jeden,
v 9,1 % o dva, v 4,5 % o tři a v 2,3 % o čtyři stupně. V 20,5 % případech došlo
k nadhodnocení o jeden stupeň a v 6,8 % o dva stupně napadení. Shoda subjektivního
hodnocení s programem se pohybovala od pouhých 18 % (rostlina č. 6) do 100 % (rostlina č.
7). V průměru byla nalezena shoda ve 40 % hodnocení.
Závěr
Počítačový program Assess 2.0 umoţňuje rychlou a snadnou kvantifikaci příznaků chorob na
rostlinném materiálu. Vzhledem k tomu, ţe se jedná o počítačem zpracovanou obrazovou
analýzu, dochází k eliminaci chyb vzniklých subjektivním hodnocením jednotlivých
pozorovatelů, která byla zjištěna v námi zorganizovaných hodnoceních. U některých vzorků
228
„Úroda 12/2011, vědecká příloha―
byly jednotlivými hodnotiteli vyuţity téměř všechny vybrané stupně napadení. Shoda
subjektivního a objektivního hodnocení se pohybovala od pouhých 18 % do 100 % (v
průměru byla nalezena ve 40 % hodnocení). Je však nutné upozornit, ţe rozhodující pro
přesnost hodnocení napadení tímto softwarem byla kvalita vstupního obrazového materiálu.
Software Assess 2.0 můţe být také vyuţitelný v procesu šlechtění především při hodnocení
úrovně rezistence rostlin, případně virulence patogenů.
Příspěvek byl zpracován s podporou projektu č. 3112/G4 „Multimediální pomůcka pro výuku
předmětů zaměřených na fytopatologii“ uděleného Ministerstvem školství, mládeţe a tělovýchovy
České republiky.
Pouţitá literatura
Jeřábková, P. 2006. Studium vlastností biologického materiálu pomocí metod obrazové
analýzy. Vysoké učení technické v Brně.
Kůdela (eds.). 2007. Česko-anglická rostlinolékařská terminologie. První vydání. Praha:
Academia. ISBN: 978-80-200-1550-1. 874 stran.
Kůdela, V., Bartoš, P., Čača, Z., Dirlbek, J., Frič, F., Lebeda, A., Šebesta, J., Ulrychová, M.,
Valášková, E., Veselý, D. 1989. Obecná fytopatologie. První vydání. Praha: Academia,
1989. ISBN: 80-200-0156-5. 388 stran.
Lukáš, J. 2008. Vyuţití obrazové analýzy v rostlinolékařské praxi. Praha: Výzkumný ústav
rostlinné výroby v.v.i., 2008. ISBN: 978-80-87011-69-0.
Kontaktní adresa
Ing. Anna Koláčková
Mendelova univerzita v Brně, 613 00 Brno
e-mail: [email protected]
229
„Úroda 12/2011, vědecká příloha―
230
„Úroda 12/2011, vědecká příloha―
NOVÉ ZPŦSOBY OCHRANY PROTI NOSATČÍKŦM RODU APION
V POROSTECH JETELE LUČNÍHO
New protection against insect pests genus Apion in red clover
Kolařík P., Rotrekl J.
Zemědělský výzkum, spol. s r.o. Troubsko
Abstrakt
V letech 2010 a 2011 jsme na provozních porostech jetele lučního ověřovali účinnost
vybraných insekticidních přípravků na nosatčíky rodu Apion. Vliv aplikace pouţitých
přípravků byla vyhodnocována na základě rozborů odebraných vzorků z bylinného patra
jetele pomocí entomologického smýkadla v době před aplikací a v jednotlivých termínech po
aplikaci přípravků a následně i při rozborování hlávek na početnost larev nosatčíků. Vybrané
přípravky v porovnání s jediným registrovaným přípravkem proti tomuto škůdci vykazovaly
velmi vysokou účinnost proti dospělcům s následným vlivem na nízkou přítomnost larev v
rozborovaných hlávkách.
Klíčová slova: ochrana;hmyzí škůdci;jetel luční; nostačíci rodu Apion;
Abstract
In 2010 and 2011 we verified in red clover the effectiveness of some insecticides against
clover seed weevils genus Apion. Effect of application of the products used were evaluated by
analysis of samples at time before the application and in terms after the application. There
were counted adults and then after a months in buds the larvae. Selected products in
comparison with the only one product registred to control this pests have shown very high
efficacy againts adults with subsequent influence on the low presence of larvae in buds.
Keyword: plant protection, insect pests; red clover; clover seed weevils genus Apion
Úvod
Jetel luční (Trifolium pratense) se řadí vedle vojtěšky seté k nejrozšířenějším vytrvalým
pícninám pěstovaným na našem území. Jeho vyuţití je především ve sklizni na píci a pro
produkci semen. U pěstování jetele lučního na semeno je zvláště důleţité dodrţovat všechny
technologické prvky pro semenné porosty s cílem získat vysoký výnos semene.
Mezi hlavní hmyzí škůdce patří nosatcovití brouci rodu Apion a to především nosatčík
jetelový (Apion triforii) a nosatčík obecný (Protapion apricans). Oba druhy jsou si velice
příbuzní, mají obdobnou bionomii a na jeteli lučním ţijí společně (Rotrekl, Kolařík, 2011).
Přezimují brouci na nejrůznějších místech, na jaře se stěhují do porostů jetele, kde následně
provádí úţivný ţír na listech, které jsou proděravěny drobnými okrouhlými nebo oválnými
dírkami. V průběhu května začínají klást vajíčka do ještě nerozkvetlých zelených kvítků
v době, kdy se jiţ začínají ukazovat růţové květní plátky. Vylíhlé larvičky se ţiví na
bazálních částech kvítků, vyţírají základ semeníku a základy semene a přelézají dále do
sousedních kvítků. Jedna larva svou činností v jetelové hlávce je schopna během svého
vývoje zničit průměrně 7 aţ 11 kvítků. Napadená květenství jsou viditelně menší, květy se
mění v tvrdou uzlovitou hmotu. Ve strboulu se pak následně larvy kuklí a v průběhu června a
července se líhnou brouci nové generace. (Rotrekl, 2000). Hlavní škody u tohoto škůdce
způsobují larvy, které u semenných porostů způsobují velmi významné sníţení výnosů
(Hansen, L. M, Boelt, B, 2008). Co se týče ochrany proti tomuto škůdci je nutné provádět
důsledně prognózu i signalizace ošetření proti němu. Prognóza jejich výskytu se uskutečňuje
před první sečí, signalizace ošetření před květem semenné seče v době výskytu prvních
kvetoucích hlávek jetele. V současnosti je registrován pouze jeden insekticidní přípravek
231
„Úroda 12/2011, vědecká příloha―
Karate se Zeon technologii 5 CS v dávce 0,2 l/ha (Anonymus, 2008). U tohoto přípravku se
musí dbát na optimálně zvolenou dobu aplikace, protoţe jeho účinnost je závislá na
povětrnostních podmínkách v době aplikace, především na teplotě. Současně s tím se při
aplikaci stále stejného přípravku zvyšuje moţnost vzniku rezistence vůči němu.
Materiál a metody
V letech 2010 a 2011 byly zaloţeny poloprovozní pokusy v jeteli lučním na ověřování
účinnosti vybraných insekticidních přípravků proti tomuto hmyzímu škůdci, s cílem vybrat co
nejvhodnější spektrum insekticidních přípravků pro nejúčinnější ošetření a s co nejvyšší
tolerancí vůči necílovým organismům (včely aj.) i jeteli samotnému. V roce 2010 se
sledovaná lokalita nacházela poblíţ obce Litostrov. Testované varianty byly následující: 1 neošetřená kontrola, 2 - Mospilan 20 SP (úč.l. acetamiprid – 20 %) v dávce 150 g/ha, 3 Mavrik 2 F (úč.l. tau-fluvalinate 240 g/l) v dávce 0,2 l/ha, 4 - Biscaya 240 OD (úč.l.
thiacloprid 240 g/l) v dávce 0,3 l/ha a 5 - Karate se Zeon technologií 5 CS (úč.l. lambdacyhalothrin 50 g/l) v registrované dávce 0,2 l/ha. V následujícím roce 2011 se sledovaná
lokalita nacházela poblíţ obce Lesní Hluboké a jednotlivé testované varianty byly: 1 neošetřená kontrola, 2 - Proteus 110 OD (úč.l. thiacloprid 100 g/l a deltamethrin 10 g/l) v
dávce 0,5 l/ha, 3 - Mospilan 20 SP v dávce 150 g/ha, 4 - Biscaya 240 OD v dávce 0,3 l/ha a 5
- Karate se Zeon technologií 5 CS v dávce 0,2 l/ha. U všech variant bylo vţdy k jednotlivým
přípravkům přidáno smáčedlo Silmet v dávce 0,06 l/ha. Velikost jednotlivých pokusných
variant byla od 1 do 5 ha. Vlastní termín aplikace insekticidních přípravků proběhl dle
signalizace v období těsně před květem aţ objevení se prvních rozkvetlých kvítků. Těsně před
vlastní aplikací byly odebrány pomocí entomologického smýkadla z bylinného patra jetele
vzorky entomofauny z předpokládaných jednotlivých variant. V laboratoří byly usmrceny
v parách octanu ethylnatého a rozborovány. Jednotlivá následná hodnocení byla prováděna po
aplikaci v termínech 1, 3 a 9 - 11 dnech stejným způsobem jako při hodnocení před aplikací.
Po 1 měsíci od aplikace byly z porostu z jednotlivých variant odebráno na 8 místech vţdy 5
jetelových hlávek (40 hlávek/ 1 variantu) a rozborovány v laboratoři na přítomnost larev
nosatčíků. Bylo provedeno statistické vyhodnocení účinnosti (Henderson-Tilton) jednotlivých
variant v porovnání s neošetřenou kontrolou.
Výsledky a diskuze
V roce 2010 byly první vzorky z porostu odebrány dne 8. července. Nejvyšší mnoţství
nosatčíků před ošetřením bylo zjištěno na variantě s přípravkem Mospilan - 2070 jedinců na
100 smyků, nejméně pak na kontrolní variantě - 1670 jedinců/100 smyků. Následný den byla
provedena v odpoledních hodinách aplikace jednotlivých přípravků s tím, ţe varianta
s přípravkem Karate se Zeon technologii byla provedena aţ jako poslední z důvodu velmi
vysoké teploty vzduchu v den aplikace. V termínech 12.7. a následně pak 19.7. byly odebrány
vzorky hmyzu z jednotlivých variant. Nejvyšší účinnost byla v porovnání s neošetřenou
kontrolou, kde bylo zjištěno 1260 jedinců/100 smyků, u varianty s přípravkem Biscaya 240
OD, kde nebyl zaznamená ţádný jedinec, u variant Mospilan a Mavrik bylo zjištěno 10
jedinců/100 smyků. Nejhorší varianta byla s přípravkem Karate se Zeon technologii, kde na
100 smyků bylo zjištěno 235 jedinců. V následujícím termínu hodnocení (10. den po aplikaci)
byla účinnost nejvyšší u přípravku Biscaya 240 OD (70 jedinců/100 smyků) a Mospilan 20 SP
(120 jedinců/100 smyků). U dvou pyretroidních přípravků byla účinnost niţší, u přípravku
s Karate jiţ v tomto termínu byl opět překročen práh škodlivosti pro tohoto škůdce. Dne
29.července byly dle zvolené metodiky odebrány z jednotlivých variant hlávky jetele a
v laboratoři pak rozborovány. Na neošetřené kontrole bylo zjištěno 4,5 larev/1 hlávku. U
variant ošetřených pyrethroidními přípravky bylo zjištěno 3,6 larev/1 hlávku. Nejméně larev
232
„Úroda 12/2011, vědecká příloha―
bylo zjištěno u varianty s přípravkem Biscaya 240 - 1,2 larvy/1hlávku a u přípravku Mospilan
s 1,4 larvy/1 hlávku. Uvedené výsledky jsou v tabulace 1.
Tabulka 1 - Vliv aplikace insekticidů na početnost nosatčíků rodu Apion v roce 2010
Varianta/datum
8.7.2010
12.7.2010
19.7.2010
29.7.2010
počet
počet
počet
počet larev
jedinců/100 jedinců/100 účinnost jedinců/100 účinnost
na jednu
smyků
smyků
(v %)
smyků
(v %)
hlávku
kontrola
1670
1260
X
1260
X
4,5
Mospilan 20 SP
2070
10
99,3
120
92,14
1,4
Mavrik 2 F
1150
10
98,9
620
28,5
3,6
Biscaya 240 OD
1670
0
100
70
94,5
1,2
Karate se Zeon
technologií
1700
235
81,7
830
35,3
3,6
V roce 2011 bylo na základě signalizace provedeno ošetření dne 28. června. Na všech
testovaných variantách bylo v průměru na 100 smyků zjištěno 518 jedinců nosatčíku rodu
Apion. V porovnání s minulým rokem byly v den aplikace velmi vhodné povětrnostní
podmínky. Následný den po aplikaci byly odebrány vzorky entomofauny a rozebrány. Na
neošetřené kontrole bylo zjištěno celkem 1165 jedinců/100 smyků. Nejméně jedinců bylo na
variantě s přípravkem Mospilan (15 jedinců/100 smyků). Účinnost u jednotlivých variant se
pohybovala od 85,4 % u přípravku Karate do 98,9 % u přípravku Mospilan 20 SP. Při
hodnocení 3. den po aplikaci nebyl zjištěn na variantě s přípravkem Proteus 110 OD ţádný
jedinec a i na ostatních variantách byla zaznamenána velmi nízká početnost pohybující se od
5 do 10 jedinců na 100 smyků. Při posledním hodnocení devátý den po aplikaci byla u všech
testovaných variant zjištěna velmi vysoká účinnost přípravků pohybují se od 92,6 % u
varianty s Mospilanem do 100 % u varianty s přípravkem Biscaya 240 OD. Uvedené
výsledky uvádí tabulka 2.
Tabulka 2 - Vliv aplikace insekticidů na početnost nosatčíků rodu Apion v roce 2010
Varianta/datum 28.6.2011
1.7.2011
7.7.2011
26.7.2011
počet
počet
počet
počet larev
jedinců/100 jedinců/100 účinnost jedinců/100 účinnost
na jednu
smyků
smyků
(v %)
smyků
(v %)
hlávku
kontrola
430
1135
X
950
X
2
Proteus 110 OD
510
75
94,6
80
92,9
0,4
Mospilan 20 SP
490
15
98,9
80
92,6
0,2
Biscaya 240 OD
640
40
97,7
0
100
0,1
Karate se Zeon
technologií
520
205
85,4
10
99,1
2,1
Hlávky jetele lučního byly odebrány 26.7. 2011. Na kontrole byl v porovnání s rokem 2010
zjištěn relativně nízký počet larev - 2 larvy/hlávku. Z ošetřených variant bylo nejvíce larev
zjištěno u varianty s přípravkem Karate se Zeon technologií - průměrně 2,1 larev/ hlávku. U
ostatních variant byla zjištěna velmi nízká početnost. Nejméně larev bylo u varianty
s přípravkem Biscaya 240 OD a to pouze 0,1 larev/hlávku, coţ je při celkovém 70% napadení
na neošetřené kontrolní variantě velmi vysoká účinnost. Početnost u dalších dvou testovaných
variant byla také velmi nízká – u přípravku Mospilan 0,2 larev/hlávku a u přípravku Proteus
110 OD 0,4 larev/hlávku.
233
„Úroda 12/2011, vědecká příloha―
Při porovnání účinnosti jednotlivých přípravků v roce 2010 byl znát rozdíl v účinnostech u
pyrethroidních přípravků v porovnání s ostatními testovanými insekticidy s odlišnými
účinnými látkami. V tomto roce se projevil vliv povětrnostních podmínek při aplikaci. V den
aplikace panovalo teplé počasí s průměrnou denní teplotou 22,3°C a maximální teplotou
27,8°C. Pyrethroidní přípravky díky svým vlastnostem vykazovaly velmi nízkou účinnosti a i
početnost larev v hlávkách jetele byla u těchto variant vysoká. V následujícím roce, kdy byly
ideální podmínky při aplikaci, tak i pyrethroidní přípravky vykazovaly výbornou účinnost
v porovnání s ostatními testovanými přípravky při rozborování hmyzí entomofauny. Při
následném hodnocení hlávek na přítomnost larev byl zjištěn velmi vysoký počet larev u
varianty s přípravkem Karate a tak i při vhodných povětrnostních podmínkách byla jeho
účinnost na larvy zcela minimální. Velmi vysokou účinnost vykazoval téţ přípravek Proteus
110 OD i v jeho niţší dávce 0,5 l/ha. Z uvedených dvouletých výsledků lze konstatovat, ţe
výskyt nosatčíků byl v roce 2010 velmi vysoký a tak v pozdějším termínu hodnocení nebyla
účinnost u testovaných přípravků tak vysoká jako v následujícím roce 2011. V tomto roce byl
výskyt také vysoký, ale testované přípravky jej dokázaly velmi dobře potlačit pod
ekonomický práh škodlivosti a zvýšit tak mnoţství a kvalitu sklizeného semene, coţ je pro
zemědělskou praxi zcela zásadní.
Závěr
Vlivem dlouhotrvajícího pouţívání pyrethroidního přípravku v porostech jetele lučního a
restrikcí dalších povolených přípravků se nosatčíci stali zcela zásadním problémem při
pěstování jetele lučního na semeno. Z výsledků lze konstatovat, ţe testované přípravky
vykazovaly velmi dobrou účinnost na výskyt tohoto škůdce v porostu a následně i při
rozborech hlávek na nízkou početnost larev. Ţádný z testovaných přípravků neměl negativní
vliv na porost jetele lučního. Lze předpokládat, ţe v brzké době bude portfolio moţných
pouţitelných přípravků rozšířeno o další, které jsou dnes jiţ běţně pouţívány v ostatních
polních plodinách pro minimalizaci škod způsobovaných hmyzími škůdci.
Výsledek byl získán za institucionální podpory na dlouhodobý koncepční rozvoj
výzkumné organizace.
Literatura
Anonymus (2008) Metodická příručka ochrany rostlin proti chorobám, škůdcům a plevelům.
Česká společnost rostlinolékařská, ISBN 978-80-02-02087-05, 504s
Hansen, L. M, Boelt, B, (2008) Thresholds of economic damage by clover seed weevil
(Apion fulvipes Geoff.) and lesser clover leaf weevil (Hypera nigrirostris Fab.) on white
clover (Trifolium repens L.) seed crops, Grass and forage science, Volume 63 (2008) Issue
4, p 433-437
Dostupné
z:
http://apps.webofknowledge.com/summary.do?SID=V1nhEDgAHEobAajBI%40M&produ
ct =WOS&qid=1&search_mode=GeneralSearch [online]. [27.7.2011]
Rotrekl, J., Kolařík, P. (2011) Významní hmyzí škůdci v semenných porostech jetele lučního,
Agromanuál 7, s. 32 - 33
Rotrekl, J. (2000) Zemědělská entomologie. Mendelova zemědělská a lesnická univerzita
v Brně, ISBN 80-7157-473-2, 84s
Kontaktní adresa:
Ing. Pavel Kolařík
Agriculture Research , Ltd. Troubsko, 664 41 Troubsko, Zahradní 1, [email protected]
234
„Úroda 12/2011, vědecká příloha―
REAKCE ODRŦD BRAMBORU NA PEKTINOLYTICKOU BAKTERII
ERWINIA CAROTOVORA SUBSP. ATROSEPTICA
The reaction of potato varieties to pectolytic bacterium
Erwinia carotovora subsp. atroseptica
Krejzar V.1, Pánková I.1, Kŧdela V.1, Hausvater E.2, Doleţal P.2
1
Výzkumný ústav rostlinné výroby, v.v.i., Praha-Ruzyně
Výzkumný ústav bramborářský s.r.o., Havlíčkův Brod
2
Abstrakt
Rezistence odrůd bramboru k pektinolytické bakterii Erwinia carotovora subsp. atroseptica (=
Pectobacterium carotovorum subsp. atrosepticum) byla stanovena testováním plátků hlíz. Z celkového
počtu testovaných 144 odrůd a novošlechtění bylo vůči kmenu E. c. subsp. atroseptica CCM 322
rezistentních 37, slabě náchylných 59, náchylných 44 a silně náchylných 4. Z celkového počtu
testovaných 144 odrůd a novošlechtění bylo vůči kmenu E. c. subsp. atroseptica DSM 18077T
rezistentních 27, slabě náchylných 67, náchylných 42 a silně náchylných 8.
Klíčová slova: brambor; bakteriální měkké hniloby; Erwinia carotovora subsp. atroseptica;
rezistence;
Abstract
The resistance of potato cultivars to soft rot caused by Erwinia carotovora subsp. atroseptica (=
Pectobacterium carotovorum subsp. atrosepticum) bacterium was assessed in tuber slice test. Of 144
potato cultivars and selections were resistant 37, low susceptible 59, susceptible 44 and high
susceptible 4 to E. c. subsp. atroseptica, strain CCM 322. Of 144 potato cultivars and selections were
resistant 27, low susceptible 67, susceptible 42 and high susceptible 8 to E. c. subsp. atroseptica, strain
DSM 18077T.
Key words: potatoes; bacterial soft rot; Erwinia carotovora subsp. atroseptica; resistance;
Úvod
Ve vědecké příloze časopisu Úroda č. 12 byl v roce 2010 uveřejněn článek: „Stanovení
rezistence odrůd bramboru k bakterii Erwinia carotovora subsp. carotovora testováním
plátků hlíz―, ve kterém byla zjišťována a porovnávána hladina rezistence 134 odrůd bramboru
vůči dvěma kmenům bakterie E. c. subsp. carotovora (=Pectobacterium carotovorum subsp.
carotovorum). Tato publikace přináší informaci o hladině rezistence 144 odrůd a
novošlechtění bramboru vůči dvěma kmenům pektinolytické bakterie E. c. subsp. atroseptica
(=P. c. subsp. atrosepticum).
Pektinolytické fytopatogenní bakterie rodu Erwinia (=Pectobacterium, Dickeya) způsobují na
rostlinách bramboru čtyři typy příznaků: hnilobu matečných rostlin a klíčků před vzcházením;
černání báze stonku spojené s vadnutím, zakrnělostí a chlorózou nadzemních částí; hnilobné
léze na stoncích, řapících a čepelích listů nemající spojitost s černáním báze stonku; měkkou
hnilobu hlíz (COTHER, SIVASITHAMPARAN 1983). Kromě sníţení výnosu způsobují ztráty
během transportu a skladování hlíz. Regulační opatření ke sníţení jejich škodlivosti spočívají
v redukci poškození hlíz během manipulace s hlízami; ve vhodných podmínkách během
skladování hlíz; ve výsadbě méně náchylných odrůd.
Z rodu Erwinia způsobují měkkou hnilobu bakterie E. c. subsp. carotovora, E. c. subsp.
atroseptica a E. chrysanthemi (= P. chrysanthemi, D. chrysanthemi). Teplotní optimum
pektinolytických bakterií z rodu Erwinia se pohybuje v rozmezí 21 - 35 °C. Pouze druh E. c.
subsp. atroseptica je hostitelsky specializovaný na brambor, ostatní druhy jsou polyfágní.
Průzkum provedený v roce 2010 na 5 lokalitách s výskytem černání stonku bramboru v okolí
Havlíčkova Brodu prokázal, ţe z hlediska četnosti získaných izolátů byla bakterie E. c. subsp.
atroseptica izolována jako třetí v pořadí za druhy E. c. subsp. carotovora a E. chrysanthemi.
235
„Úroda 12/2011, vědecká příloha―
Z celkového počtu 120 testovaných izolátů pocházejících z 52 vzorků odebraných na celkem
5 lokalitách v sezóně 2010 bylo 6 % identifikováno jako E. c. subsp. atroseptica (KREJZAR et
al. 2010, nepublikováno). Obdobných výsledků bylo dosaţeno při průzkumu provedeném na
2 dalších lokalitách havlíčkobrodska v červenci 2011. Z celkového počtu 41 testovaných
izolátů pocházejících ze vzorků odebraných na 2 lokalitách bylo 5 % identifikováno jako E. c.
subsp. atroseptica. Ostatní izoláty byly z 56 % identifikovány jako E. c. subsp. carotovora,
z 32 % jako Pseudomonas fluorescens a 7 % izolátů nebylo spolehlivě identifikováno.
(KREJZAR et al. 2011, nepublikováno).
Podle hladiny rezistence odrůdového sortimentu bramboru lze nepřímo usuzovat na
potenciální škodlivost jednotlivých pektinolytických bakterií. Pro stanovení hladiny
rezistence byla pouţita metoda inokulace plátků hlíz bramboru (SCHAAD et al. 2001).
Cílem tohoto příspěvku je: (i) posoudit hladinu rezistence odrůd bramboru k pektinolytické
bakterii E. c. subsp. carotovora testováním na plátcích hlíz bramboru; (ii) na základě hladiny
rezistence stanovit pořadí testovaných odrůd bramboru od rezistentních po náchylné k
testovaným kmenům bakterie E. c. subsp. atroseptica; (iii) u kaţdé testované odrůdy
bramboru stanovit rozdíly v hladině rezistence vůči jednotlivým testovaným kmenům bakterie
E. c. subsp. atroseptica.
Materiál a metody
Odrůdy bramboru. Celkem bylo testováno 144 genotypů bramboru pocházejících z
pokusných pozemků Výzkumného ústavu bramborářského v Havlíčkově Brodě (tab. 2).
Bakteriální kmeny. Do testů byly začleněny tyto kultury bakterií: (i) typový kmen E. c. subsp.
atroseptica DSM 18077T; (ii) sbírkový kmen E. c. subsp. atroseptica CCM 322. Jako
kontroly byly pouţity: (i) typový kmen nepektinolytického druhu Pseudomonas fluorescens
CCM 2115T; (ii) plátky hlíz bramboru, do nichţ byla nakapána sterilní destilovaná voda.
Pouţité kmeny bakterií pocházely z České sbírky mikroorganizmů při Masarykově univerzitě
v Brně (CCM) a z Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
(DSMZ).
Postup při testování. Hladina rezistence odrůd bramboru k bakterii E. c. subsp. atroseptica
byla stanovena inokulací plátků hlíz bramboru (SCHAAD et al. 2001). Oloupané hlízy
bramboru byly jednorázově ponořeny do 95% ethanolu a po vytaţení protaţeny plamenem.
Poté byly hlízy ve sterilních podmínkách nařezány na plátky o síle 10 mm a vloţeny na
filtrační papír do sterilních Petriho misek. Uprostřed plátku byl sterilním korkovrtem vyříznut
důlek o průměru a hloubce 4 mm, do kterého byla nakapána suspenze testované
pektinolytické bakterie. Filtrační papír v Petriho miskách byl přelit sterilní destilovanou
vodou. Petriho misky s inokulovanými plátky bramboru byly uchovávány v termostatu při
teplotě 28 °C. Po 24 hodinách byla měřena šíře zóny rozloţeného pletiva plátku.
Kritéria pro hodnocení hladiny rezistence. Podle průměrné šířky zóny rozloţeného pletiva
dvou plátků od jedné odrůdy byly testované odrůdy bramboru rozděleny do 4 skupin: (i)
rezistentní (0 - 5,9 mm); (ii) slabě náchylné (6 - 11,9 mm); (iii) náchylné (12 - 17,9 mm);
(iv) velmi náchylné (18 - 25 mm).
Výsledky a diskuse
Hladina rezistence odrůd bramboru vůči bakteriálnímu černání byla v minulosti zjišťována
DOBIÁŠEM (1970). Z celkového počtu 198 testovaných odrůd byla vůči bakterii označené jako
Erwinia carotovora hodnocena většina odrůd jako náchylné aţ velmi náchylné (DOBIÁŠ
1970). Výsledky testování 144 odrůd bramboru vůči jednotlivým kmenům bakterie E. c.
subsp. atroseptica při pouţití metody inokulace podle SCHAADeho et al. (2001) jsou uvedeny
v tabulce 1. Z celkového počtu 144 testovaných odrůd bramboru bylo hodnoceno: (i) vůči
kmenu E. c. subsp. atroseptica CCM 322 37 odrůd jako rezistentní, 59 odrůd jako slabě
236
„Úroda 12/2011, vědecká příloha―
náchylných, 44 odrůd jako náchylných a 4 odrůdy jako silně náchylné; (ii) vůči kmenu E. c.
subsp. atroseptica DSM 18077T 27 odrůd jako rezistentní, 67 odrůd jako slabě náchylných, 42
odrůd jako náchylných a 8 odrůd jako silně náchylných (tab. 1).
Tab. 1 Hladina rezistence genotypŧ bramboru vŧči kmenŧm pektinolytických bakterií
Erwinia carotovora subsp. atroseptica
Hladina
Šířka zóny
Počet
rezistence
(mm)
Eca CCM 322
Eca DSM 18077T
Eca (Ø)
Rezistentní
0 - 5,9
37
27
20
Slabě náchylné
6 - 11,9
59
67
86
Náchylné
12 - 17,9
44
42
38
Silně náchylné
18 - 25
4
8
0
Eca - Erwinia carotovora subsp. atroseptica
Reakce odrůd bramboru na inokulaci kmeny E. c. subsp. atroseptica byla obdobná (tab. 1).
Podíl náchylných a silně náchylných odrůd se u obou testovaných kmenů patogena pohyboval
v rozmezí 33 - 35 %, podíl rezistentních a slabě náchylných v rozmezí 65 - 67 %. V tabulce 2
jsou uvedeny odrůdy, jejichţ reakce vůči testovaným kmenům E. c. subsp. atroseptica byla
rezistentní, slabě náchylná, náchylná a silně náchylná. Jako silně náchylné vůči kmenu E. c.
subsp. atroseptica CCM 322 byly hodnoceny odrůdy Riviera, Patricia, Evita a Primadonna.
Jako silně náchylné vůči kmenu E. c. subsp. atroseptica DSM 18077T byly hodnoceny odrůdy
Sirius, Toccata, Danuta, Ludmila, Amado, Ingrid, Merida a Sprint. Z výsledků dále vyplývá,
ţe i kdyţ soubor testovaných odrůd reagoval na oba kmeny pektinolytické bakterie E. c.
subsp. atroseptica obdobně, reakce jednotlivých odrůd nebyla identická. Např. odrůda Ingrid,
která byla hodnocena jako silně náchylná vůči kmenu DSM 18077T, byla slabě náchylná vůči
kmenu CCM 322. Stejně tomu bylo i u odrůd Ludmila a Sirius. Obě odrůdy hodnocené jako
silně náchylné vůči kmenu DSM 18077T, byly slabě náchylné vůči kmenu CCM 322.
K oběma testovaným kmenům pektinolytické bakterie E. c. subsp. atroseptica bylo
z celkového počtu 144 testovaných odrůd bramboru hodnoceno: 20 odrůd jako rezistentních,
86 odrůd jako slabě náchylných a 38 odrůd jako náchylných. Ţádná z testovaných odrůd
nebyla silně náchylná k oběma testovaným kmenům bakterie E. c. subsp. atroseptica (tab. 1,
2).
Výsledky potvrdily, ţe v testovaném odrůdovém sortimentu bramboru převládají odrůdy,
které jsou k pektinolytické bakterii E. c. subsp. atroseptica rezistentní a slabě náchylné (74
%) (tab. 2) oproti výsledkům dosaţeným při testování bakterie E. c. subsp carotovora v roce
2010. Z celkového počtu 134 testovaných genotypů bramboru bylo vůči bakterii E. c. subsp.
carotovora hodnoceno dle stejných kritérií více neţ 99 % jako náchylné aţ silně náchylné
(KREJZAR et al. 2010). Výsledky dále potvrdily, ţe v rámci rodu Erwinia má větší potenciální
škodlivost bakterie E. c. subsp. carotovora neţ bakterie E. c. subsp. atroseptica.
Získané výsledky hodnocení odrůdového sortimentu na rezistenci vůči pektinolytické bakterii
E. c. subsp. atroseptica mohou být vyuţity jednak jako jeden z podkladů při šlechtění odrůd
bramboru, jednak jako podklad při výběru odrůd pro výsadbu v provozních podmínkách.
Význam rezistentních odrůd bramboru v regulaci bakteriálních měkkých hnilob kriticky
zhodnotili CZAIKOWSKI et al. (2011). Dosavadní výsledky šlechtění na rezistenci povaţují za
neuspokojivé. Za slibné však povaţují pouţití genetických modifikací, pokud to bude
politicky přijatelné.
237
„Úroda 12/2011, vědecká příloha―
Tab. 2 Rezistentní, slabě náchylné, náchylné a silně náchylné genotypy bramboru vŧči
testovaným kmenŧm Erwinia carotovora subsp. atroseptica
Hladina
rezistence
rezistentní
slabě
náchylné
náchylné
silně
náchylné
Genotyp
Keřkovské rohlíčky, Leontine, Juwel, Francisca, Finka, Monika, Finessa,
Ţofie, Elfe, Eurostarch, Kuras, Campina, Anuschka, Olga, Cecile, Heidi,
Chopin, Agata, Marcela, Mirage
Jolana, Krone, Tizzia, Vienna, Caruso, Saviola, Fabia, Festival, Granada, Opal,
YP 02-31, Crisps four all, Gala, Aspirant, Carerra, Esprit, KE 14/11, Marylin,
Arnova, Jitka, Madona, Volumia, Cascada, HZ 99-387, Omega, Burana, Terka,
Gourmandine, Signum, Suzan, Barbora, Franceline, Markies, Toscana,
Ewelina, Vlasta, Husar, Stayer, Aktiva, Axa, Fabiola, Jelly, Opera, Roberta,
Tabea, Bellarosa, David, Challenger, Janet, Madeleine, Orbit, Tosca, Adelina,
Andante, Camilla, HZ 00-1430, Natascha, Sylvana, Bellaprima, Forza,
Lambada, Lydia, Nomade, Rosagold, Arabella, Excellent, Romanze, Venezia,
Golf, Ramos, Valeria, Martina, Monaco, Radana, Europrima, Kiebitz, Marisca,
Rumba, 01.13/4, Euroflora, Spirit, Wega, Bernardette, Dominátor, Red
Fantasy, Sinora
Arizona, Bernard, Birgit, Sprint, Baccara, NÖS 3085/03, Turdus, Verdi,
Crisper, Ludmila, Ambition, Vendula, Verne, Almera, Pirol, Soraya, Bella,
Sirius, VDZ 01-413, BIW 02-82, Lolita, Arcona, Euronova, Lanorma, Nancy,
Poutník, Ingrid, Kiwi, Zuzana, Marketa, Amado, Evita, Danuta, Primadonna,
Merida, Patricia, Toccata, Riviera
-
Dedikace
Tato práce vznikla za finanční podpory Ministerstva školství, mládeţe a tělovýchovy ČR,
projekt č. 2B08083.
Pouţitá literatura
Cother E. J., Sivasithamparan K. (1983): Erwinia: the „carotovora― group. In FAHY, D.C. PERSLEY, G.T.: Plant Pathogenic Bakteria. A Diagnostic Guide, New York, Academic
Press.
Czajkowski R., Pérombelon M. C. M., van Veen J. A., wan der Wolf J. M. (2011): Control of
blackleg and tuber soft rot of potato caused by Pectobacterium and Dickeya species: a
review. Plant Pathology, 60: 125-133.
Dobiáš, K. (1970): Odolnost světového sortimentu odrůd brambor proti mokré hnilobě hlíz
[Erwinia carotovora (Jones) Holand]. Sb. ÚVTI - Genetika a šlechtění, 4: 139-146.
Krejzar V., Pánková I., Kůdela V., Hausvater, E., Doleţal P. (2010): Stanovení rezistence
odrůd bramboru k bakterii Erwinia carotovora subsp. carotovora testováním plátků hlíz.
Úroda 12, 2010, vědecká příloha, s. 305-308.
Schaad N. W., Jones J. B.,Chun W. (eds) (2001): Laboratory Guide for Identification of Plant
Pathogenic Bacteria. 3rd ed. St. Paul, MN, USA: APS Press.
Kontaktní adresa
Ing. Václav Krejzar, Ph.D.
Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507, 161 06 Praha 6-Ruzyně, e-mail: [email protected]
238
„Úroda 12/2011, vědecká příloha―
VARIABILITA POPULACE RAMULARIA COLLO-CYGNI NA ÚZEMÍ
ČESKÉ REPUBLIKY
Variability of Ramularia collo-cygni population in the Czech Republic
Leišová-Svobodová L.1, Matušinsky P.2, Kučera L.1
1 Výzkumný ústav rostlinné výroby, v.v.i., Drnovská 507, 161 06 Praha 6 – Ruzyně
2 Agrotest fyto, s.r.o., Havlíčkova 2787, 767 01 Kroměříţ
Abstrakt
Ramularia collo-cygni je v současné době povaţována za závaţného patogena jarního i ozimého
ječmene ve střední a severní Evropě. Pomocí metody AFLP byla detekována vysoká míra genetické
variability populace R.. collo-cygni v České republice, coţ je u patogena, u kterého je znám pouze
klonální způsob rozmnoţování, překvapivé. Existence sexuálního stádia je předpokládána a zřejmě
tedy rekombinace hraje významnou úlohu při utváření struktury populace R. collo-cygni.
Klíčová slova: Ramularia collo-cygni, ţivotní cyklus, detekce, PCR, rezistence, fungicidy
Abstract
Ramularia collo-cygni is now considered to be a serious spring and winter barley in central and
northern Europe. A high level of genetic variability of the population of Ramularia collo-cygni in the
Czech Republic was found using AFLP analysis. It is unusual for the pathogen that is known only in
anamorph stadium. Nevertheless, the teleomorph stadium of the fungus is supposed, therefore the
recombination play an important role in a generation of R. collo-cygni population structure.
Key words: Ramularia collo-cygni, life cycle, detection, PCR, resistance, fungicides
Úvod
Ramularia collo-cygni (Cav.) Sutton & Waller (RCC) se v posledním desetiletí stává
závaţným patogenem ječmene způsobujícím značné hospodářské ztráty zejména v severní a
severozápadní Evropě (Sachs 2006). V České republice byla tato houba poprvé nalezena ve
šlechtitelské stanici ve Stupicích v roce 1998 a v následujících letech na několika dalších
lokalitách České republiky (Minaříková et al. 2002). Systematický průzkum jejího výskytu a
studium variability populace tohoto patogena je však prováděn aţ v posledních pěti letech.
Variabilitu populace ovlivňuje zejména fakt, ţe je Ramularia collo-cygni nepohlavním
stádiem houby mnoţící se klonálně pomocí konidií, které se šíří větrem a jsou povaţovány za
primární zdroj infekce. Nicméně do další vegetační sezony se přenáší buď osivem, výdrolem,
přenosem mezi obilninami, zejména mezi jarním a ozimým ječmenem, nebo přezimováním
v planých druzích trav. R. collo-cygni byla nalezena např. v pýru plazivém (Walters et al.
2008).
AFLP (Amplified Fragment Length Polymorphism) je metoda, která je často vyuţívána pro
studium variability a struktury populací rostlin, ţivočichů i mikroorganismů (Vos et al. 1995;
Graves 2009).
Předmětem této práce bylo zjistit míru variability populace Ramularia collo-cygni v České
republice pomocí metody AFLP.
Materiál a metody
Ze sběrů z let 2007 – 2009 bylo celkem získáno 347 izolátů Ramularia collo-cygni z 15
oblastí České republiky, ze Slovenska, Německa, Švýcarska a Anglie. DNA byla extrahována
pomocí optimalizovaného protokolu za pouţití detergentu CTAB. Kvalita a koncentrace
extrahované DNA byla ověřena elektroforeticky v 0,7 % agarózovém gelu porovnáním
s velikostním standardem λHindIII. Byl optimalizován postup AFLP včetně primerových
kombinací. Pro analýzu bylo vybráno 9 primerových kombinací. Byla provedena vlastní
239
„Úroda 12/2011, vědecká příloha―
analýza, produkty amplifikace byly separovány pomocí kapilární elektroforézy v přístroji ABI
PRISM310 (Perkin-Elmer) a analyzovány pomocí programů GeneScan a Genotyper. Na
základě přítomnosti či nepřítomnosti signálu v dané velikostní kategorii byla získána binární
tabulka, na jejímţ základě byly vypočteny genetické vzdálenosti a sestrojen dendrogram.
Výsledky a diskuze
Analýzou 347 izolátů RCC devíti primerovými kombinacemi bylo detekováno celkem 383
polymorfních signálů. Průměrná hodnota počtu signálů na primerovou kombinaci činí 42,6.
Největší míru variability vykazovaly reakce s primerovou kombinací CAC/AC (Tabulka 1).
Dendrogram sestrojený na základě získaných dat je tvořen šesti větvemi, které zahrnují
izoláty ze všech oblastí sběru (Obrázek 1). Variabilitu populace RCC není moţno v tomto
prvním přiblíţení vysvětlit ani místem či rokem sběru ani odrůdou hostitelské rostliny, coţ
odpovídá studii Hjortshoj et al. (2009), která je vůbec první studií zabývající se variabilitou
populace R. collo-cygni.
V naší studii byla nalezena překvapivě vysoká míra genetické variability, vzhledem k faktu,
ţe je u R. collo-cygni známo pouze anamorfní stádium, nicméně je existence teleomorfního
stádia předpokládána (Salamati a Reitan, 2006). Pokud budeme jednotlivé izoláty
z jednotlivých lokalit povaţovat za samostatné populace, pak můţeme říci, ţe je míra
variability větší v rámci populací neţ mezi nimi. To svědčí o značném toku genů mezi
populacemi. Tento předpoklad je třeba následnými výpočty potvrdit, nicméně je známo, ţe se
R. collo-cygni šíří sporami unášenými větrem na velké vzdálenosti a rovněţ i osivem
(Salamati a Reitan, 2006).
Detailnější statistické analýzy pro zjištění, jak velké zastoupení mají jednotlivé způsoby
rozmnoţování a jaké jsou další vlivy na utváření struktury populace tohoto patogena jsou
předmětem dalšího studia.
Tabulka 1 – Analýza AFLP 347 izolátů RCC – souhrn
Kód
MseI
A
CAG
B
CAC
C
CAA
EcoRI
Počet
Rozsah
polymorf.
kategorií
kategorií
TG
80 - 492
AA
85 - 497
AT
88 - 500
AC
66 - 412
AA
80 - 492
AT
89 - 465
TG
75 - 493
AA
80 - 486
AT
75 - 489
CELKEM:
240
49
49
52
51
31
37
44
34
36
383
„Úroda 12/2011, vědecká příloha―
Obrázek 1 – Dendrogram sestrojený na základě analýzy AFLP souboru 347 izolátů Ramularia
collo-cygni (modře – zahraniční izoláty; zeleně – Chlumec; červeně Kroměříţ; ţlutě – Velká
Bystřice; oranţově – oblast Haná; černě – Stupice; růţově – Luţany; fialově – Přerovsko;
šedě – Staňkov)
Závěr
Populace R. collo-cygni v České republice vykazuje vysokou míru variability, danou zejména
moţnostmi šíření houby na značné vzdálenosti jak sporami tak i osivem.
Dedikace
Tento výzkum byl podpořen finančními prostředky projektu NAZV č. QH91054.
Pouţitá literatura
Graves J. (2009): Deeper AFLPs. Heredity 103: 99.
Hjortshoj R.L., Stukenbrock E.H., Ravnshoj A.R., Nyman M., Havis N., Backes G., Orabi J.,
Pinnschmidt H., Stougaard J. (2009): Genetic diversity in populations of Ramularia collocygni assessed by AFLP fingerprinting. Aspect of Applied Biology 92: 97-101.
Minaříková V., Mařík P., Stemberková L. (2002): Occurrence of a new fungal pathogen on
barley, Ramularia collo-cygni, in the Czech Republic. In: Proceedings, 2nd Intenational
Workshop on Barley Leaf Blights, 2004, pp. 376-380. Aleppo, Syria.
Sachs E. (2006): The history of research into Ramularia leaf spot on barley. In: Book of
Abstracts of the First European Ramularia Workshop, Gottingen, Germany, March 2006.
Salamati S., Reitan L. (2006): Ramularia collo-cygni on spring barley, an overview of its
biology and epidemiology. In: Book of Abstracts of the First European Ramularia
Workshop, Gottingen, Germany, March 2006.
241
„Úroda 12/2011, vědecká příloha―
Vos P., Hogers R., Bleeker M., Reijans M., Van de Lee T., Hornes M., Frijters A., Pot J.,
Peleman J., Kuiper M., Zabeau M. (1995): AFLP: New technique for DNA fingerprinting.
Nucleic Acids Research 23: 4407-4414.
Walters R., Havis N.D., Oxley S.J.P. (2008): Ramularia collo-cygni: the biology of an
emerging pathogen of barley. FEMS Microbiology Letters 279: 1-7.
Kontaktní adresa:
RNDr. Leona Leišová-Svobodová
Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507, 161 06 Praha 6 – Ruzyně
e-mail: [email protected]
242
„Úroda 12/2011, vědecká příloha―
ÚČINNOST DVOUSLOŢKOVÝCH FUNGICIDŦ NA VYBRANÉ
IZOLÁTY COLLETOTRICHUM ACUTATUM
Efficacy of two-component fungicides on selected Colletotrichum acutatum
isolates
Novotná K.1, Staňková B.1, Víchová J.1, Vejraţka K.2, Pokorný R.1
1
2
Mendelova univerzita v Brně
Zemědělský výzkum, spol. s r.o., Troubsko
Abstrakt
V laboratorních in vitro testech byla testována účinnost přípravků s mancozebem a folpetem, přičemţ
byly testovány i kombinace těchto látek s dalšími účinnými látkami. K testům bylo pouţito šest
vybraných izolátů Colletotrichum acutatum z různých plodin. Byla zjištěna různá citlivost
jednotlivých izolátů tohoto patogena k fungicidům s účinnými látkami mancozeb, mancozeb +
metalaxyl-M, mancozeb + cymoxanil, folpet a folpet + azoxystrobin. U přípravků s mancozebem
nebyl zjištěn vliv další látky na zvýšení jejich účinnosti, naopak u folpetu azoxystrobin zvyšoval jeho
účinnost.
Klíčová slova: Colletotrichum acutatum, mancozeb, folpet, účinnost
Abstract
The efficacy of fungicides with active ingredients mancozeb or folpet was tested in laboratory in vitro
tests, whereas the combinations with other active ingredients were used. Six Colletotrichum acutatum
isolates originating from different plant species were used for these tests. The different sensitivity of
particular pathogen isolates to fungicides with active ingredients mancozeb, mancozeb + metalaxyl-M,
mancozeb + cymoxanil, folpet and folpet + azoxystrobin was determined. The influence of the second
a.i. on the efficacy was not proved in fungicides with mancozeb. On the other hand a.i. azoxystrobin
increased efficacy of folpet.
Keywords: Colletotrichum acutatum, mancozeb, folpet, efficacy
Úvod
Colletotrichum acutatum J. H. Simmonds 1968 (syn. C. simmondsii R. G. Shives & Y. P. Tan,
sp. nov. 2009) se řadí mezi polyfágní houbové patogeny s kosmopolitním rozšířením
způsobující významné ztráty na produkci hospodářských plodin (Peres et al., 2005) jako jsou
jahodník velkoplodý (Fragaria x ananassa Duch.), jabloň (Malus pumila Mill. a Malus
sylvestris Mill.), třešeň (Prunus cerasus L.), paprika roční (Capsicum annuum L.), rajče jedlé
(Lycopersicon esculentum Mill.), lupina mnoholistá (Lupinus polyphyllus Lindl.)
(Sreenivasaprasad, Talhinhas, 2005), mandloň obecná (Prunus dulcis Mill.), olivovník
evropský (Olea europaea L.), papája melounová (Carica papaya L.), citrusy (Citrus spp.),
některé okrasné rostliny a jehličnany (Guerber et al., 2003). Staňková et al. (2011) zjistili, ţe
izoláty tohoto patogena z různých plodin jsou schopny infikovat různé druhy rostlin. C.
acutatum je v současnosti hospodářsky také nejzávaţnějším patogenem světlice barvířské
(Carthamus tinctorius L.) (Víchová, 2009).
Jednou z moţností ochrany plodin vůči patogenu je pouţití fungicidních přípravků. V ČR je
registrován pouze jediný fungicid proti C. acutatum – Ortiva (ú.l. azoxystrobin) do jahodníku.
Cílem práce proto bylo stanovit účinnost některých dvousloţkových fungicidů na několik
izolátů tohoto patogena.
243
„Úroda 12/2011, vědecká příloha―
Materiál a metody
Na základě předběţných testů byly zvoleny v příslušných koncentracích čtyři různé
dvousloţkové fungicidy, pro srovnání působení přidané účinné látky byly pouţity dva
jednosloţkové fungicidy (Tab. 1). Účinnost vybraných fungicidních přípravků byla in vitro
zkoušena na šesti izolátech C. acutatum různého původu (Tab. 2). Ze všech izolátů patogena
byly připraveny monosporické izoláty a kultury byly kultivovány na PDA (Potato Dextrose
Agar) za vhodných podmínek pro sporulaci – teplota 25 ± 2 °C.
Pro testy účinnosti bylo z izolátů odebráno potřebné mnoţství mycelia a oranţových mas
konidií a ve sterilní destilované vodě byla připravena jejich suspenze. V případě větších částí
mycelia byla suspenze homogenizována. Sterilní laboratorní kličkou byla suspenze rozetřena
kříţovým roztěrem na Petriho misky o průměru 100 mm s PDA. Na misky byly rozmístěny
do čtverce čtyři sterilní terčíky z filtračního papíru o průměru 8 mm. Na tři terčíky bylo
aplikováno 12,5 μl fungicidu o dané koncentraci pomocí automatické pipety, jeden terčík byl
kontrolní a byla na něj aplikována sterilní voda. Petriho misky byly přemístěny do kultivační
místnosti a kultivovány při teplotě 25 ± 2 °C. Průměr inhibičních zón (cm) v okolí terčíků byl
změřen po 4, 7 a 14 dnech ode dne zaloţení pokusu.
Výsledky účinnosti jednotlivých fungicidů na jednotlivé izoláty byly statisticky zpracovány
jednofaktorovou analýzou rozptylu a porovnání účinnosti jednotlivých fungicidů mezi sebou
dvoufaktorovou analýzou rozptylu přes průměr všech izolátů. Při obou typech analýz byly
výsledky porovnávány Tukey-HSD testem. K výpočtům byl pouţit program UNISTAT.
Tab. 1 Fungicidní přípravky pouţité při testování
Účinná látka
folpet (50%), azoxystrobin (9,4%)
mancozeb (64%), metalaxyl-M (4%)
mancozeb (60%), dimethomorph (9%)
mancozeb (68%), cymoxanil (4,5%)
mancozeb (80%)
folpet (80%)
Základní
koncentrace (%)
0,2
1,25
0,5
0,5
0,4
0,4
Tab. 2 Testované izoláty Colletotrichum acutatum a jejich původ
Izolát
CBS 786.86
PCF231
PCF437
710
1109
1209
Rostlina
Malus sylvestris
Fragaria x ananassa
Lupinus alba
Hypericum perforatum
Carthamus tinctorius
Carthamus tinctorius
Dodavatel
CBS
PCFruit
PCFruit
ÚPŠRR MENDELU Brno
ÚPŠRR MENDELU Brno
ÚPŠRR MENDELU Brno
Výsledky a diskuse
Fungicidy s účinnou látkou mancozeb
Jak je zřejmé z Tabulky 3, průměr inhibičních zón se v průběhu testování u všech kombinací
fungicid a izolát C. acutatum mírně sniţoval. Rovněţ se u některých fungicidů projevila jejich
různá účinnost na jednotlivé izoláty tohoto patogena. U přípravku obsahující pouze mancozeb
byl ve všech termínech hodnocení výrazně citlivý izolát PCF437, v posledním termínu
hodnocení se rovněţ projevila vyšší citlivost izolátu 710, naopak CBS 786.86 a PCF231 byly
méně citlivé (Tab. 3A). U fungicidu s účinným látkami mancozeb a dimethomorph nebyly ve
všech termínech hodnocení zjištěny ţádné rozdíly v citlivosti jednotlivých izolátů (Tab. 3B).
244
„Úroda 12/2011, vědecká příloha―
U fungicidu s mancozebem a cymoxanilem byl ve všech termínech hodnocení rovněţ nejvíce
citlivý izolát PCF437, naopak v prvním termínu hodnocení byl nejméně citlivý izolát
PCF231 a ve všech termínech izolát 1109 (Tab. 3C). Také u kombinace mancozeb a
metalaxyl-M se projevila vyšší citlivost izolátu PCF437 a niţší citlivost izolátu PCF231 a také
izolátu 710 (Tab. 3D).
Při srovnání vlivu druhé sloţky fungicidu přidané k základní účinné látce mancozeb na jejich
účinnost nebyly zjištěny statisticky významné rozdíly (Tab. 4).
Tab. 3 – Účinnost fungicidů s ú. l.mancozeb na izoláty C. acutatum (průměr inhibičních zón v cm)
A. mancozeb (80%)
Izolát
1.měření
1109
2,30a
1209
2,37a
710
2,67a
CBS.786.86
2,08a
PCF231
2,27a
PCF437
4,10b
2.měření
2,20a
1,87a
2,27a
1,90a
1,67a
4,00b
C. mancozeb (68%), cymoxanil (4,5%)
Izolát
1.měření 2.měření
1109
1,80a
1,77a
ab
1209
2,00
1,90ab
710
2,37abc
2,13ab
bc
CBS.786.86
2,60
2,50ab
a
PCF231
1,87
1,83ab
c
PCF437
2,80
2,60b
3.měření
1,83ab
1,77ab
2,10b
1,27a
1,30a
4,00c
B. mancozeb (60%), dimethomorph (9%)
Izolát
1.měření 2.měření 3.měření
1109
2,13a
2,07a
2,03a
a
a
1209
2,00
1,97
1,93a
a
a
710
2,00
2,13
1,93a
a
a
CBS.786.86 2,63
2,37
2,13a
a
a
PCF231
2,07
1,93
1,83a
PCF437
2,53a
2,43a
2,43a
3.měření
1,67a
1,90ab
2,10ab
2,40ab
1,77ab
2,50b
D. mancozeb (64%), metalaxyl-M (4%)
Izolát
1.měření 2.měření 3.měření
1109
2,53a
2,27ab
1,80a
a
a
1209
2,27
2,20
2,17ab
710
2,27a
1,83a
1,30a
a
ab
CBS.786.86 2,93
2,27
2,03ab
a
a
PCF231
2,70
1,93
1,67a
a
b
PCF437
3,13
3,03
3,03b
Tab. 4 – Srovnání účinnosti fungicidů s ú.l. mancozeb na C. acutatum (průměr inhibičních zón v cm)
Přípravek
1.měření 2.měření 3.měření
mancozeb
mancozeb + dimethomorph
mancozeb + cymoxanil
mancozeb + metalaxyl-M
2,63a
2,23a
2,24a
2,64a
2,32a
2,15a
2,12a
2,26a
2,04a
2,05a
2,06a
2,00a
Mancozeb je látka, u které byla prokázána účinnost vůči některým patogenům z rodu
Colletotrichum spp., např. C. capsici (Shukla et al., 2010), C. truncatum (PotDukhe, 2010) a
C. lindemuthianum (Rajesha et al., 2010). Na druhé straně u patogena C. gloeosporoides byla
prokázána rozdílná citlivost izolátů vůči této účinné látce (Boyer et al., 2007), přičemţ byl
determinován jeden izolát, který byl k ní vysoce tolerantní (Suvarna et al., 2009). Na základě
výše uvedených výsledků můţeme předpokládat, ţe fungicidy s touto účinnou látkou mají
potenciál v ochraně některých plodin vůči druhu C. acutatum.
Fungicidy s účinnou látkou folpet
Rovněţ u těchto fungicidů se v průběhu testování sniţoval průměr inhibičních zón (Tab. 5 A a
B). V případě fungicidu s účinnou látkou folpet byl v prvních dvou termínech hodnocení
zjištěn významný rozdíl v citlivosti mezi izoláty, přičemţ PCF231 a PCF437 prokázaly
nejvyšší citlivost a izolát 710 citlivost nejmenší. U fungicidu s další látkou azoxystrobin byl
ve všech třech termínech hodnocení rovněţ nejvíce citlivý izolát PCF437 a nejméně citlivý
izolát 1209. Při srovnání dvou fungicidů s účinnou látkou folpet je z Tabulky 6 zřejmé, ţe
přídavná sloţka azoxystrobin výrazně zvýšila účinnost přípravku.
245
„Úroda 12/2011, vědecká příloha―
Tab. 5 – Účinnost fungicidů s ú. l.folpet na izoláty C. acutatum (průměr inhibičních zón v cm)
A. folpet (80%)
Izolát
1109
1209
710
CBS.786.86
PCF231
PCF437
1.měření
1,83ab
2,20bc
1,63a
1,87ab
2,23bc
2,43c
2.měření
1,83ab
1,98b
1,47a
1,77ab
2,08bc
2,43c
3.měření
1,63a
1,70a
1,30a
1,57a
1,73a
1,83a
B. folpet (50%), azoxystrobin (9,4%)
Izolát
1.měření 2.měření 3.měření
1109
2,20ab
2,20ab
1,77a
a
a
1209
1,73
1,67
1,67a
abc
ab
710
2,23
2,07
1,93a
cd
cd
CBS.786.86 2,90
2,90
2,47ab
PCF231
2,53bc
2,50bc
1,83a
d
d
PCF437
3,33
3,30
3,17b
Tab. 6 – Srovnání účinnosti fungicidů s ú.l. mancozeb na C. acutatum (průměr inhibičních zón v cm)
Přípravek
folpet
folpet + azoxystrobin
1.měření 2.měření 3.měření
2,03a
1,93a
1,63a
b
b
2,49
2,44
2,14b
Někteří autoři uvádějí, ţe účinnost folpetu vůči C. acutatum je nízká (např. Freeman et al.,
1997). I v našich testech byla šířka inhibičních zón poměrně malá, zvláště v termínu 14 dní po
inokulaci, ale byla výrazně zvýšena u přípravku v kombinaci s azoxystrobinem, coţ odpovídá
údajům o dobré účinnosti této látky (např. Kloutvorová, Kupková, 2009; Mari et al., 2009).
Azoxystrobin je účinnou sloţkou fungicidu Ortiva, který je v současné době povolen
k ochraně jahod vůči tomuto patogenu. Nicméně i zde existuje reálné nebezpečí rozšíření
tolerantních populací patogenů rodu Colletotrichum spp., jak bylo prokázáno u příbuzného
druhu C. cereale (Young et al., 2010).
Závěr
V laboratorních in vitro testech byla zjištěna rozdílná citlivost izolátů polyfágního patogena
Colletotrichum acutatum k fungicidním přípravkům obsahujícím účinné látky mancozeb a
folpet. Lze však konstatovat, ţe ţádný z pouţitých izolátů nebyl tolerantní k pouţitým
přípravkům. Přesto při testování účinnosti fungicidů doporučujeme vyuţít více izolátů
sledovaného patogena, čímţ se sníţí riziko moţnosti překonání jejich účinnosti. Laboratorní
testy lze pouţívat pouze jako předběţná zjištění, účinnost musí být vţdy ověřena v polních
testech. I zde bychom doporučili umělé inokulace více izoláty příslušného patogena.
Dedikace
Příspěvek byl zpracován s podporou Výzkumného záměru č. MSM6215648905 „Biologické a
technologické aspekty udrţitelnosti řízených ekosystémů a jejich adaptace na změnu klimatu―
uděleného Ministerstvem školství, mládeţe a tělovýchovy České republiky. a NAZV MZe ČR
č. QH81029 "Inovace ochrany světlice barvířské (Carthamus tinctorius L.) proti významným
houbovým patogenům".
Pouţitá literatura je k dohledání v archivu autorů.
Kontaktní adresa:
doc. Ing. Radovan Pokorný, Ph.D.
Mendelova univerzita v Brně
61300 Brno
[email protected]
246
„Úroda 12/2011, vědecká příloha―
INDUKCE MRAZOVÉHO POŠKOZENÍ RÉVY VINNÉ INA+
BAKTERIEMI VE SPOJITOSTI S NÁSLEDNOU TUMOROGENEZÍ
VYVOLANOU BAKTERIEMI RODU AGROBACTERIUM
The induction of frost damage to INA+ bacteria in connection with tumorinducing to bacteria of Agrobacterium genera in grapevine
Pánková I., Krejzar V., Kŧdela V., Ackermann P.
Výzkumný ústav rostlinné výroby, v.v.i., Praha-Ruzyně
Abstrakt
V letech 2004 - 2007 byl v Českých a Moravských vinicích zaznamenán zvýšený výskyt bakteriální
nádorovitosti révy vinné, způsobované bakteriemi Agrobacterium tumefaciens a A. vitis. Bakteriální
nádory se nezřídka nacházely na rostlinách, u nichţ bylo zároveň patrné poškození mrazem. S cílem
objasnit souvislost mrazového poškození révy vinné s následnou tvorbou nádorů vyvolanou
bakteriemi rodu Agrobacterium byly pro pokusné účely shromáţděny rostliny dvou odrůd révy vinné,
Müller Thurgau a Svatovavřinecké, u nichţ bylo poškození mrazem a bakteriální nádorovitost
zaznamenána v přirozených podmínkách v největší četnosti. Rostliny révy vinné byly inokulovány
jednak kulturami typových kmenů a vlastními izoláty bakterií A. tumefaciens a A. vitis a jednak
směsnou kulturou ze dvou vlastních izolátů ledově nukleačně aktivní (INA +) bakterie Pseudomonas
syringae pv. syringae. Inokulované rostliny révy vinné byly následně vystaveny účinku mrazu
v podmínkách chladové místnosti. Rostliny byly poté umístěny do venkovních podmínek a
v pravidelných intervalech hodnoceny. Nádory způsobované bakteriemi rodu Agrobacterium byly
následně zaznamenány na 80 % rostlin révy vinné.
Klíčová slova: réva vinná; bakteriální nádorovitost; poškození mrazem; Agrobacterium tumefaciens;
A. vitis; Pseudomonas syringae pv. syringae; INA+ bakterie;
Abstract
During 2004 - 2007 was recorded the increment of occurrence of crown gall on grapevine in the Czech
and Moravian vineyards. Crown galls were observed in plants of grapevine with spring frost damage
lesions. Xylem sap samples were collected during spring bleeding from plants with samples of crown
gall and frost damage in vineyards. In tested samples were identified crown gall bacteria A.
tumefaciens and A. vitis and ice nucleation active (INA+) bacteria from Pseudomonas genera. The
objective of this study were find out connection between frost damage caused by INA + bacteria of
grapevine and tumour of crown gall inception to bacteria of Agrobacterium genera.
Key words: grapevine; crown gall; frost damage; Agrobacterium tumefaciens; A. vitis; Pseudomonas
syringae pv. syringae; ice-nucleation active bacteria;
Úvod
Bakteriální nádorovitost révy vinné (Vitis vinifera L.) je způsobována dvěma druhy bakterií
z rodu Agrobacterium, bakterií A. tumefaciens Beijerinck & van Delden 1902 a bakterií
Agrobacterium vitis Ophel & Kerr 1990. Na Českých a Moravských vinicích byl v minulosti
zaznamenaný výskyt bakteriální nádorovitosti často doprovázen mrazovým poškozením keřů.
Nádory se na jednotlivých rostlinách často nacházely přímo v místě mrazového poškození. Na
lokalitách postiţených bakteriální nádorovitostí docházelo k předčasnému odumírání keřů
révy vinné. Celkové ztráty na zasaţených vinicích se mohou pohybovat v rozmezí od
několika keřů aţ k téměř 100 % (BURR 1998). V xylémové tekutině odebrané na jaře
z jednoletých výhonů postiţených keřů těsně před rašením oček nebo na začátku rašení byla
zjištěna jednak přítomnost bakterií A. tumefacians a A. vitis, jednak přítomnost ledově
nukleačně aktivních (INA+) bakterií z rodu Pseudomonas (KREJZAR, PÁNKOVÁ 2008).
Cílem tohoto příspěvku je objasnit souvislost mrazového poškození révy vinné s následnou
tvorbou nádorů vyvolanou bakteriemi rodu Agrobacterium.
247
„Úroda 12/2011, vědecká příloha―
Materiál a metody
Odrůdy révy vinné. Do testů bylo začleněno celkem 20 rostlin révy vinné: (i) 10 rostlin
odrůdy Müller Thurgau; (ii) 10 rostlin odrůdy Svatovavřinecké.
Bakteriální kmeny. Do testů byly začleněny tyto kultury bakterií: (i) typové kmeny bakterií
Agrobacterium tumefaciens LMG 187T a A. vitis LMG 8750T; (ii) kmen bakterie A.
tumefaciens DD2/2/10 získaný vlastní izolací; (iii) kmen bakterie A. vitis VK 125/2G získaný
vlastní izolací; (iv) směsná kultura INA+ kmenů bakterie Pseudomonas syringae pv. syringae
DD10/1/10 (teplota ledové nukleace při -4,9°C) a Ţ 3/1 (teplota ledové nukleace při -3,8°C),
získaných vlastní izolací.
Typové kmeny bakterií A. tumefaciens LMG 187T a A. vitis LMG 8750T pocházely z Bacteria
Collection Laboratorium Microbiologie, Universiteit Gent, Belgium (LMG).
Postup při testování. Získané sazenice révy vinné byly na jaře 2010 vysázeny do vegetačních
nádob o rozměrech 18 x 18 x 18 cm a umístěny na venkovním stanovišti. Na začátku
července 2010 byla provedena infekce rostlin testovanými bakteriálními kmeny. Rostliny
byly inokulovány segmenty ţivného agaru o velikosti cca 1 x 1cm s příslušnou bakterií, které
byly vkládány pod korová pletiva po provedení t řezu ve vzdálenosti 5 a 10 cm nad bází
rostliny. Místa inokulace byla po dobu 6 týdnů překryta parafilmem. Varianty pokusu
s počtem infikovaných rostlin jsou uvedeny v tabulce 1.
Tab. 1: Varianty pokusu a počet inokulovaných rostlin v roce 2010
Počet rostlin
Müller Thurgau
Svatovavřinecké
1 Kontrola
1
1
2 Pss
1
1
3 Směs At 187T+Pss
2
2
T
4 Směs Av 8750 +Pss
2
2
5 Směs At DD2/2/10+Av VK125/2G+Pss
2
2
6 Směs Av VK125/2G+Pss
2
2
+
Pss - směsná kultura INA kmenů bakterie Pseudomonas syringae pv. syringae DD10/1/10 a
Ţ 3/1 získaných vlastní izolací; At 187T – typová kultura bakterie Agrobacterium tumefaciens;
Av 8750T – typová kultura bakterie A. vitis; At DD2/2/10, Av VK 125/2G – kmeny A.
tumefaciens a A. vitis získané vlastní izolací;
Varianta pokusu
Na podzim 2010 po poklesu denních teplot pod 15°C byly pokusné rostliny révy vinné
přeneseny do chladové místnosti a postupně během 6 hodin ochlazeny z teploty 12°C na
teplotu -2°C. Po 2 hodinách byla teplota opět postupně zvyšována na 12°C a rostliny byly
následující den vráceny na venkovní stanoviště. Pokusné rostliny byly průběţně hodnoceny.
Na jaře 2011 bylo provedeno závěrečné vyhodnocení pokusu.
Výsledky
Výskyt a četnost nádorŧ na rostlinách révy vinné
Z celkového počtu 20 pokusných rostlin révy vinné byly nádory zaznamenány na celkem 16
rostlinách, tj. na 80 % (tab. 2a, b). Z celkového počtu 10 pokusných rostlin révy vinné odrůdy
Müller Thurgau byly nádory zaznamenány na 8 rostlinách, tj. na 80 % (tab. 2a). Z celkového
počtu 10 pokusných rostlin révy vinné odrůdy Svatovavřinecké byly nádory zaznamenány na
8 rostlinách, tj. na 80 % (tab. 2b). Výskyt nádorů byl zaznamenán ve všech variantách pokusu
včetně kontroly.
248
„Úroda 12/2011, vědecká příloha―
Tab. 2a: Výskyt a četnost nádorŧ na rostlinách révy vinné odrŧdy Müller Thurgau
Varianta pokusu
1 Kontrola
2 Pss
Počet rostlin
1
1
3 Směs At 187T+Pss
2
4 Směs Av 8750T+Pss
2
5 Směs At DD2/2/10+Av VK125/2G+Pss
2
6 Směs Av VK125/2G+Pss
2
Rostlina
1
2
3
4
5
6
7
8
9
10
Četnost nádorŧ
1
2
0
1
1
1
1
1
0
1
Tab. 2b: Výskyt a četnost nádorŧ na rostlinách révy vinné odrŧdy Svatovavřinecké
Rostlina Četnost nádorŧ
11
1
12
1
13
0
3 Směs At 187T+Pss
2
14
2
15
1
4 Směs Av 8750T+Pss
2
16
1
17
1
5 Směs At DD2/2/10+Av VK125/2G+Pss
2
18
1
19
0
6 Směs Av VK125/2G+Pss
2
20
1
Pss - směsná kultura INA+ kmenů bakterie Pseudomonas syringae pv. syringae DD10/1/10 a
Ţ 3/1 získaných vlastní izolací; At 187T – typová kultura bakterie Agrobacterium tumefaciens;
Av 8750T – typová kultura bakterie A. vitis; At DD2/2/10, Av VK 125/2G – kmeny A.
tumefaciens a A. vitis získané vlastní izolací;
Varianta pokusu
1 Kontrola
2 Pss
Počet rostlin
1
1
Diskuse
Bakterie rodu Agrobacterium indukují u rostlin morfogenetické změny. Do rostlinného
genomu vnášejí geny lokalizované na části Ti nebo Ri plazmidu, která se nazývá T-DNA
(transferred DNA) (ONDŘEJ 1992). U transformovaných rostlinných buněk, do jejichţ genomu
se integrovala T-DNA, dochází k hypertrofii (zvětšení) a hyperplazii (zmnoţení), coţ vede ke
vzniku nádoru.
Důleţitými faktory pro vznik nádorů na révě vinné jsou: i) dostatečná půdní vlhkost a teplé
počasí v předjaří, které vede k vytlačování vody spolu s patogenem do nadzemních orgánů
rostliny; ii) náhlý pokles teploty na hodnoty -4 aţ -6°C, který má za následek tvorbu ledových
krystalů v xylému a poranění okolních dřevních parenchymatických buněk; iii) poranění,
které vyvolá proces transformace rostlinných buněk (po integraci genů obsaţených
v plazmidu bakteriálních buněk do buněk rostlinných) a vede ke vzniku nádoru (KŮDELA et
al. 2005).
V cévních svazcích rostlin révy vinné se nacházejí ledově nukleačně aktivní (INA+) bakterie,
patřící k druhům Pseudomonas fluorescens a P. syringae které napomáhají tvorbě ledových
krystalů v xylému a způsobují mrazové poškození rostlin révy vinné jiţ při teplotách
v rozmezí - 2 aţ -3°C (KREJZAR, PÁNKOVÁ 2008).
249
„Úroda 12/2011, vědecká příloha―
Při průzkumu provedeném v letech 2007 - 2010 byl na sledovaných lokalitách pěstování révy
vinné v xylémové tekutině odebrané na jaře před rašením opakovaně prokázán jednak výskyt
bakterií A. tumefaciens a A. vitis a jednak INA+ bakterií P. syringae pv. syringae. K izolaci
agrobakterií a INA+ pseudomonád byla pouţita ţivná média a postupy podle SCHAAD et al.
(2001).
Získané kmeny INA+ bakterie P. s. pv. syringae s nejvyšší teplotou ledové nukleace byly
spolu s typovými kulturami a vlastními kmeny obou agrobakterií pouţity pro pokus vyvolání
tumorogeneze po předchozím mrazovém poškození způsobeném INA+ bakteriemi P. s. pv.
syringae při teplotě - 2 °C v chladové místnosti. Z celkového počtu 20 pokusných rostlin révy
vinné byly nádory zaznamenány na celkem 16 rostlinách, tj. na 80 %. Nádory byly
zaznamenány ve všech variantách pokusu u celkem 16 rostlin (80 %) včetně kontrolních.
K masovému výskytu a rozšíření bakterií A. tumefaciens a A. vitis došlo v minulých letech
vlivem pouţívání systémově infikovaného materiálu při obnově a zakládání nových vinic
(KREJZAR et al. 2009). Toto zjištění vysvětluje skutečnost, ţe bakteriální nádory způsobované
oběma bakteriemi se v našem pokusu vyskytly i na kontrolních rostlinách révy vinné.
Dodatečně bylo zjištěno, ţe pro přípravu sazenic révy vinné, které byly pouţity v našem
pokusu, byl pouţit reprodukční materiál z podnoţové vinice, kde byl námi opakovaně
potvrzen výskyt obou patogenů z rodu Agrobacterium v letech 2007 – 2008.
Dedikace
Tato práce vznikla za finanční podpory Ministerstva zemědělství ČR, projekt NAZV č.
QH71248.
Pouţitá literatura
Burr T. J. (1998): Crown gall. In: PEARSON R. C., COHEEN A. C.: Compendium of Grape
Diseases. St. Paul, APS Press, 1998: 41-42.
Krejzar V., Pánková I. (2008): Vliv mrazového poškození na výskyt bakteriální nádorovitosti
révy vinné. In: Sborník z konference: „Vliv biotických a biotických sresorů na vlastnosti
rostlin 2008―, Praha, 12.-13. 2. 2008, ISBN 978-80-87011-18-8: 245-248.
Krejzar V., Pánková I., Ackermann P., Korba J., Kůdela V. (2009): Systémové šíření
Agrobacterium vitis a A. tumefaciens v xylémových cévách révy vinné. Věd. příloha čas.
Úroda, p.:165-169.
Kůdela V., Krejzar V., Krejzarová R., Pánková I. (2005): Bakteriální nádorovitost v nových
výsadbách révy vinné. In: Vinařský obzor 98 (č. 6), 2005: 306-307.
Ondřej M. (1992): Genové inţenýrství kulturních rostlin. Praha, Academia, ISBN 80-2000310-X.
Schaad N.W, Jones J.B, Chun W. (eds) (2001): Laboratory Guide for Identification of Plant
Pathogenic Bacteria. 3rd ed. St. Paul, MN, USA: APS Press.
Kontaktní adresa:
Ing. Iveta Pánková, Ph.D.
Výzkumný ústav rostlinné výroby, v.v.i.
Drnovská 507, 161 06 Praha 6-Ruzyně
e-mail: [email protected]
250
„Úroda 12/2011, vědecká příloha―
VÝSKYT FOMOVÉ HNILOBY (LEPTOSPHAERIA MACULANS, L.
BIGLOBOSA) NA SEVERNÍ MORAVĚ (ŠUMPERSKO, OPAVSKO)
V POSLEDNÍCH LETECH
The phoma stem cancer (Leptosphaeria maculans, L. biglobosa) incidence
in Northern Moravia (Šumperk and Opava region) in recent years
Poslušná J. 1, Plachká E. 2
1
Agritec Plant Research, s.r.o., Šumperk
2
OSEVA vývoj a výzkum s.r.o., Opava
Abstrakt
V průběhu let 2006 aţ 2011 byl ve vybraných regionech ČR prováděn monitoring výskytu
významných chorob ozimé řepky zejména fomové hniloby brukvovitých (původce Phoma lingam –
anamorpha; Leptosphaeria maculans, L. biglobosa – teleomorpha). V příspěvku jsou shrnuty údaje za
posledních 5 let průzkumu, které vypovídají o míře infekce řepkových porostů patogenem
L.maculans/L. biglobosa na Šumpersku a Opavsku. Výskyt této choroby v jednotlivých letech silně
závisel na zdroji infekce a průběhu povětrnostních podmínek. Míra škodlivosti choroby se pohybovala
ve sledovaných letech na nízké aţ střední úrovni, přesto i nadále hlavní roli hraje správně načasovaná
fungicidní ochrana porostů, která zabrání vyšším ztrátám na výnosu. Druhové zastoupení patogena je
na obou lokalitách zastoupeno rovnoměrně, PCR analýza odebraných posklizňových vzorků
napadených stonků prokázána přítomnost Leptosphaeria maculans tak i L. biglobosa.
Klíčová slova: fomová hniloba brukvovitých, Leptosphaeria maculans, L. biglobosa, Šumpersko,
Opavsko, míra infekce
Abstract
During the years 2006 to 2011 was conducted the monitoring of important diseases of winter oilseed
Brassica especially phoma stem cancer (caused by Phoma lingam – anamorpha; Leptosphaeria
maculans, L. biglobosa - teleomorpha) in selected regions of the Czech Republic. The paper
summarizes data for the last 5 years of survey, showing a phoma stem cancer infection rate of rape
vegetation in Šumperk and Opava districts. The incidence of this disease each year depends heavily on
the source of infection and the weather conditions. The rate of disease, the harmfulness of the
monitored ranged from a low to moderate levels, yet still plays a major role properly timed fungicide
protection of vegetation, which prevents the loss of higher yield. Generic representation of the
pathogen at both locations are represented equally, PCR analysis of samples taken from infected crop
stalks demonstrated the presence of Leptosphaeria maculans and L. biglobosa too.
Keywords: phoma stem cancer, Leptosphaeria maculans, L. biglobosa, Šumperk region, Opava
region, pest severity
Úvod
Od 90. let minulého století se řepka olejka běţně pěstuje i v ČR a její plochy se kaţdoročně
zvyšují. Dnes je řepka druhou nejrozšířenější plodinou v ČR s podílem na struktuře osevních
ploch 15,0 %. V roce 2010 bylo oseto 368 824 ha. Pěstování komodity se zakládá především
na pěstování ozimé řepky, jarní řepka je v minimálním zastoupení do 1 % osetých ploch
(Anonym, 2010). Průzkum intenzity výskytu chorob byl proveden ve dvou regionech
pěstování ozimé řepky v ČR – na Opavsku a Šumpersku. Sklizené plochy řepky v těchto
oblastech byly 5674 ha a 2535 ha, coţ činilo v průměru 2,42 % sklizené zemědělské plochy
řepky olejky v ČR v roce 2010. Výnosy v těchto regionech byly 2,35 t/ha a 2,75 t/ha (Zeman,
2010).
Fomová hniloba brukvovitých (původce Phoma lingam – anamorpha; Leptosphaeria
maculans a L. biglobosa – teleomorpha) je významnou chorobou řepky olejky i v ČR. Její
251
„Úroda 12/2011, vědecká příloha―
výskyt v jednotlivých letech je silně závislý na zdroji infekce a průběhu povětrnostních
podmínek, je rozdílný na lokalitách s různou intenzitou pěstování řepky. Zvýšená míra
infekce porostu chorobami sníţí předpokládaný výnos v průměru o 10 %, v letech se silným
výskytem chorob aţ o 30-50 % dle míry napadení (Kazda et al., 2008).
Ţivotní cyklus patogena začíná na podzim, kdy z posklizňových zbytků se při určité teplotě a
zejména dostatečné vlhkosti uvolňují z pseudothecií askospory patogena. Ty pak napadají
vzešlé rostlinky. Při vhodné vlhkosti začínají askospory klíčit a hyfy prorůstají do pletiva
řepky. Patogen se šíří z míst primárního napadení do celé rostliny. Zřetelné symptomy
choroby jsou na podzim viditelné zejména na listech. Jedná se o okrouhlé skvrny se šedým
středem, na kterém se utvářejí pyknidy nepohlavního stadia. Z pyknid se uvolňují konidie,
které se šíří dále do porostu. Při silném infekčním tlaku lze jiţ na podzim potvrdit infekci
patogenem rozříznutím kořene, kdy napadené pletivo je typicky načernalé z důvodu
rozšiřující se nekrózy, která můţe být pozorovatelná i vně kořene a kořenového krčku. Takto
poškozené rostliny špatně přezimují a dochází často k jejich hnití a odumírání. Pro šíření
patogena v rostlině je důleţitá teplota. Patogen je aktivní od 5 °C, při niţší teplotě se jeho
aktivita výrazně zpomaluje, aţ úplně ustává. Na jaře se patogen v rostlině šíří jejím růstem. Po
odkvětu ve fázi tvorby šešulí (BBCH 75 – 85), začínají být pozorovatelné symptomy na
stoncích a kořenech. Ve středech skvrn se vytvářejí černé tečky s pohlavním stadiem patogena
tzv. pseudothecia. Kořeny a kořenové krčky rostlin trouchnivějí a po rozříznutí jsou patrné
znaky nekróz, na kterých je moţné také pozorovat pseudothecia. Při vysokém napadení
rostliny předčasně odumírají a nouzově dozrávají (Poslušná, Plachká, 2009).
Monitoringem původců fomové hniloby řepky na území ČR s vyuţitím specifické PCR
analýzy pro detekci a diferenciaci L. maculans a L. biglobosa byla ve sledovaných
moravských regionech potvrzena přítomnost obou forem patogena (Ryšánek et al., 2010).
Materiál a metody
Na lokalitách Šumperk (Loc. 49,9858333° N, 17,00555555° E) a Opava (Loc. 49°54´34.832´´
N, 17°5424.847´´ E) je dlouhodobě sledován výskyt fomové hniloby brukvovitých. Lokalita
Opava leţí v řepařské výrobní oblasti, oblasti s teplejším klimatem v podmínkách ČR.
Průměrná denní roční teplota je +8,23°C, průměrná roční suma sráţek je 592,6 mm. Vybrané
pozemky na Šumpersku leţí v blízkosti obce Rapotín v 325 m n.m. Lokalita spadá do
bramborářské výrobní oblasti. Průměrná roční teplota činí +7,27°C a průměrný roční úhrn
sráţek je 702,2 mm.
Byly hodnoceny první příznaky choroby na podzim a napadení stonků a kořenů před sklizní.
Hodnocení probíhala v letech 2006 aţ 2011 v maloparcelkových pokusech s ozimou řepkou
ve čtyřech opakováních. Hodnocení byla prováděna v neošetřených zónách pokusů. Velikost
jedné parcely/opakování byla vţdy minimálně 25 m2. Bylo hodnoceno 4 × 25 rostlin.
Hodnocení intenzitu výskytu choroby vycházelo z metodiky EPPO PP 1/78(3) a bylo
zařazeno do pěti tříd poškození v procentech: 0 %: bez výskytu, ţádná poškození; 25 %:
okolo 25 % obvodu kořene vykazuje symptomy korkovatění nebo 25 % pletiva stonku jeví
příznaky choroby; 50 %: 50 % obvodu kořene vykazuje korkovatění nebo 50 % stonku jeví
příznaky choroby, rostliny jsou stále zelené; 75 %: okolo 75 % kořene a/nebo 75 % stonku
vykazuje symptomy choroby, obvykle jsou viditelné i pyknidy, rostliny ţloutnou; 100 %:
okolo 100 % kořenového pletiva a/nebo 100 % stonku vykazuje symptomy choroby, rostliny
nouzově dozrávají nebo jsou jiţ odumřelé. Na základě získaných údajů byla vypočtena
frekvence a intenzita výskytu choroby v %. Frekvence výskytu udává počet rostlin s příznaky
choroby. Intenzita výskytu udává průměrný výskyt choroby na hodnocených rostlinách.
V průběhu let nebyl zajištěn výsev stejné odrůdy. Pozorování na jedné odrůdě na obou
lokalitách bylo zajištěno aţ od roku 2008. Pouţité odrůdy jsou středně citlivé k napadení. Na
Opavsku byla hodnocení v letech 2006 aţ 2008 prováděna na odrůdě Lisek a od podzimu
252
„Úroda 12/2011, vědecká příloha―
2008 na odrůdě Benefit. Na Šumpersku byla do roku 2008 testována odrůda Oponent, později
odrůda Benefit. Osevní odstup v pěstování řepky a jiných brukvovitých byl 5 let a více.
Pokusy byly zasety v agrotechnických termínech pro dané oblasti. Vliv termínu setí na výskyt
choroby nebyl předmětem pozorování.
Sledovaná meteorologická data byla získána z automatických meteorologických stanic ČHMI
Otice a Šumperk. Sledované lokality leţely ve vzdálenosti 3 aţ 7 km.
Výsledky byly statisticky vyhodnoceny metodou Correll (Microsoft Excel 2007). Pro
posouzení korelací byly pouţity korelační koeficienty (Rod, Vondráček 1975).
Výsledky a diskuse
První příznaky choroby na listech řepky na podzim byly na lokalitě Opava sledovány od
konce září a v průběhu října. V Šumperku to bylo od konce října do poloviny listopadu. První
výskyty následovaly po delší dešťové periodě. Čím byly sráţkové dny dříve, tím byly
příznaky na listech pozorovány dříve. Intenzita výskytu fomové hniloby brukvovitých na
kořenech a stoncích byla ve sledovaných letech nízká aţ střední. Převaţovalo povrchové
napadení stonku, kdy napadení patogenem bylo v závislosti na lokalitě a počasí od 18 % do
49 % obvodu stonku. Konkrétní data prvních výskytů a míry napadení jsou uvedeny
v Tabulce č. 1.
Byly vyhodnoceny vzájemné vztahy mezi počtem dní od výskytu prvních příznaků na podzim
na listech, sumou sráţek v září, průměrnou denní teplotou v říjnu a konečným výskytem
choroby před sklizní. Bylo vyhodnoceno celé sledované období a zvlášť ročníky s odrůdou
Benefit (2008-2011). Byla potvrzena pozitivní korelace mezi průměrnou denní teplotou
v říjnu v letech 2006-2010 a intenzitou výskytu choroby, dále byla potvrzena pozitivní
korelace mezi průměrnou denní teplotou v říjnu v letech 2008 aţ 2010 a frekvencí a
intenzitou výskytu choroby. Výsledky jsou uvedeny v Tabulce č. 2.
Opava
Šumperk
Lokalita
Tabulka č. 1: Výskyt fomové hniloby brukvovitých na Šumpersku a Opavsku v letech 2007 – 2011
Datum Suma Průměrná
Počet dnů
Počet
prvních sráţek
denní
od
Frekvence
Intenzita
odumřelých
Sezóna výskytů
září
teplota
1. výskytu
%
%
rostlin
na
říjen
do 30.6.
ze 100
podzim [mm]
[°C]
2006/07
23.11.
7,2
9,1
219
75
35
15
2007/08
30.10.
54,2
7,23
243
75
27
5
2008/09*
25.9.
22,7
8,27
278
79
40
11
2009/10* 13.10.
10,9
7,2
260
55
18
2
2010/11* 24.10.
83,2
6,2
249
66
24
0
2006/07
15.10.
16
11,2
258
82
44
12
2007/08
5.10.
128
7,8
268
100
49
0
2008/09*
29.9.
76,5
10,1
274
100
41
0
2009/10* 25.10.
14,8
8
248
82
32
0
2010/11* 11.10.
86,8
6,3
262
57
19
0
* Ročníky, kdy byla hodnocení prováděna na obou lokalitách na jedné odrůdě.
253
„Úroda 12/2011, vědecká příloha―
20082011
20062011
Tabulka č. 2: Vypočtené korelační hodnoty pro posouzení korelace mezi počtem dnů od prvních
výskytů příznaků fomové hniloby brukvovitých, sledovanými meteorologickými údaji a frekvencí (4.
sloupec), intenzitou výskytu fomové hniloby brukvovitých (5. sloupec) a počtem odumřelých rostlin
(6. sloupec)
Počet dní
0,283178
0,267255
-0,37227
Suma sráţek v září
0,317784
0,14668
-0,63078
Vypočtené
Průměrná denní teplota v říjnu
0,590054
0,538918
0,709251
korelační
Počet dní
0,395518
0,577265
0,638317
hodnoty
Suma sráţek v září
0,037741
-0,10301
-0,4573
Průměrná denní teplota v říjnu
0,173022
0,901133
0,846882
Korelační koeficient P0,05 pro n = 6 (2008-2011) je 0,8114; pro n = 10 (2006-2011) je 0,6319 (Rod, Vondráček
1975). Tučně zvýrazněné hodnoty znamenají, ţe byla potvrzena pozitivní korelace mezi sledovaným faktorem a
výskytem choroby.
Závěr
1) Byla pozorována závislost mezi prvními výskyty fomové hniloby brukvovitých na podzim
na listech a intenzitou napadení v době zrání řepky. Čím byl časnější výskyt choroby na
listech na podzim, tím byla vyšší frekvence i intenzita napadení kořenů a stonků v době
dozrávání řepky. Tento vztah nebyl potvrzen statisticky.
2) Byla statisticky potvrzena pozitivní korelace mezi průměrnou denní teplotou v říjnu a
výskytem fomové hniloby brukvovitých před sklizní.
3) Ve sledovaných letech dosáhla škodlivost patogena niţší aţ střední úrovně. Nejvíce
napadené porosty byly pozorovány v letech 2007 a 2008 na Opavsku a v roce 2009 na
Šumpersku. V posledních 2 letech choroba nezpůsobila na sledovaných lokalitách
významné hospodářské ztráty z důvodu nepříznivých podmínek pro vývoj patogena.
Dedikace
Výsledky byly mimo jiných zdrojů získány za finanční podpory Mze ČR NAZV projekt
QH81127.
Pouţitá literatura
Anonym, 2011: Definitivní údaje o sklizni zemědělských plodin za rok 2010 [online]. [cit. 2011-0314].Dostupné z:http://www.czso.cz/csu/2011edicniplan.nsf/t/3400236EF1/$File/21021101.pdf
European and Mediterranean Plant Protection Organization (2003): Efficacy evaluation of fungicides.
Root, stem, folia rand pod diseases of rape. 2003 OEPP/EPPO. Bulletin 33, 25-32.
Kazda J., Škeřík J. a kol. (2008): Metodika integrované ochrany řepky. SPZO s.r.o., Praha, 78 s.
Poslušná J., Plachká E., 2009: Odolnost vybraných genotypů ozimé řepky olejky vůči fomové hnilobě
brukvovitých (Leptosphaeria maculans)a bílé hnilobě řepky (Sclerotinia sclerotiorum)
hodnocených na zkušebních lokalitách v Šumperku a Opavě, Úroda 12/2009, vědecká příloha s.
191-194
Rod J., Vondráček J., 1975: Polní pokusnictví. Státní pedagogické nakladatelství Praha. 230 s.
Ryšánek P., Urban J., Mazáková J., Zouhar M., Plachká E., Poslušná J., Pokorný R., Spitzer T., 2010:
Monitoring výskytu Leptosphaeria maculans a L. biglobosa na území České republiky. Úroda
12/2010, vědecká příloha s. 343-346
Zeman J., 2010: Výsledky pěstování řepky v České republice v roce 2009/2010. Sborník 25.26.11.2010 Hluk. 27. Vyhodnocovací seminář Systém výroby řepky a Systém výroby slunečnice.
Svaz pěstitelů a zpracovatelů olejnin, SPZO s.r.o. s. 3-19.
Kontaktní adresa
Ing. Jana Poslušná, Agritec Plant Research s.r.o., Zemědělská 2520/16, 787 01 Šumperk
e-mail: [email protected]
254
„Úroda 12/2011, vědecká příloha―
KONSTRUKTY PRO INDUKCI REZISTENCE VŦČI VIRŦM A
POŢEROVÉMU HMYZU U HRACHU
Constructs for induction virus and insect resistance in pea
Rohrer M., Břusková H., Hanáček P., Reinöhl V.
Mendelova univerzita v Brně
Abstrakt
V naší práci vyuţíváme k tvorbě hrachu rezistentního vůči virózám (PSbMV a PEMV) a hmyzím
škůdcům transformačních metod. Do vektorového systému pHannibal byly mezi 35S promotor a OCS
terminátor postupně vkládány vybrané sekvence cDNA fragmentů genů virů v sense/antisense
orientaci. Tato kazeta pak byla klonována do vektorového systému pGREEN (Hellens et al., 2000),
který jiţ obsahuje reportérový (uidA) a selekční (bar) gen (konstrukt pWell12). Tento konstrukt by
měl vlivem posttranskripčního utišení genů (PTGS) navodit rezistenci k virům PSbMV a PEMV.
Stejná kazeta byla vloţena do plazmidu pWELL11B, který nese kromě reportérového genu (uidA) a
selekčního genu (bar), mezi trojnásobným 35S promotorem a OCS terminátorem gen pro inhibici
hmyzích serinových proteáz (SPI2) fúzovaný s genem pro zelenou fluorescenci GFP. Výsledný
konstrukt pWELL14B by měl indukovat rezistenci vůči oběma virům a proti poţerovému hmyzu.
Klíčová slova: hrách, transformace, A. tumefaciens, posttranskripční utišení genů, rezistence
Abstract
In this work we are exploiting genetic modification to achieve the induction of resistance to viral
diseases (PSbMV and PEMV) and insect pests in pea plants. Into the vector system pHannibal chosen
cDNA fragments of both viruses were stepwise inserted in sense/antisense orientation between the 35S
promoter and CAMV terminator. This cassette was cloned into the pGreen II vector system (Hellens et
al., 2000) that already includes reporter (uidA) and selection (bar) genes (construct pWell12). This
construct should induce resistance against both PSbMV and PEMV due to posttranscriptional gene
silencing (PTGS). The same cassette was inserted also into pWELL11B, that incorporates besides the
reporter (uidA) and selection (bar) genes also between the triple 35S promoter and OCS terminator the
inhibitor of insect serine proteases (SPI2) gene fused to the green fluorescent protein (GFP) gene. The
final construct pWELL14B should induce resistance against both viruses and also against insect pests.
Key words: pea, transformation, A. tumefaciens, post-transcriptional gene silencing, resistance
Úvod
Hrách setý (Pisum sativum L.) patří k nejrozšířenějším luskovinám a vyznačuje se cennými
agronomickými vlastnostmi. Luskoviny jsou obecně dobrou předplodinou především pro
pšenici a představují významný zdroj rostlinných bílkovin a pro jejich vhodný poměr
k sacharidům jsou důleţitou sloţkou v krmných směsích ţivočišné výroby, nebo pro přímou
konzumaci v lidské výţivě. V zemědělství jsou kladeny stále větší nároky na objem a kvalitu
produkce.
Jednou z nejčastějších viróz hrachu setého v ČR je enační mozaika hrachu (PEMV), často
v komplexu se semenem přenosnou mozaikou hrachu (PSbMV). Tyto mohou být příčinou aţ
80% ztráty na výnosu semen. Jedním z přenašečů těchto viróz je kyjatka hrachová
(Acyrthosiphon pisum Harris), která je právě z tohoto důvodu vnímána jako nejzávaţnější
hmyzí škůdce hrachu v ČR (Seidenglanz, 2011). Další z řad hmyzích škůdců jsou třásněnky
(Thripidae), listopas čárkovaný (Sitona lineatus L.), nebo zrnokaz hrachový (Bruchus
pisorum L.).
Chemická ochrana rostlin proti škůdcům a patogenům je značně nákladná a má negativní vliv
na ţivotní prostředí. Vhodnější je pěstování rezistentních odrůd zemědělských plodin.
Jednou z metod pouţívaných v genovém inţenýrství pro tvorbu rezistentních rostlin vůči
virovým onemocněním je vyuţívání posttranskripčního utišení genů invertovanými
255
„Úroda 12/2011, vědecká příloha―
sekvencemi (PTGS). Při vnesení fragmentů genů virů do genomu rostlin v sense/antisense
orientaci spojených smyčkou dochází k vytvoření vlásenkové hairpinRNA (hpRNA). Vzniklá
dvouvláknová hpRNA je štěpena dsRNázou na 21–23 nukleotidové siRNA (small interfering
RNA). SiRNA je poté začleněna do nukleázového komplexu RISC (RNA-induced silencing
complex), který podle siRNA sekvence degraduje ssRNA se stejnou sekvencí. Tím by se měla
indukovat virová rezistence u rostlin.
Proteolytické enzymy katalyzují štěpení molekuly bílkoviny na menší řetězce a posléze aţ na
jednotlivé aminokyseliny. Serinové proteasy byly nalezeny v zaţívacím traktu mnohých
zástupců hmyzu, zejména řádu motýlů (Lepidoptera), který zahrnuje celou řadu významných
škůdců kulturních rostlin. Inhibitory proteas inhibují proteasovou aktivitu těchto trávicích
enzymů a sniţují tak mnoţství strávených proteinů. Inhibice proteas zároveň vede
k nadprodukci trávicích enzymů, coţ má za následek vyčerpání rezerv sirných aminokyselin.
Výsledkem těchto pochodů je oslabení hmyzu, jeho omezený vývoj a často i smrt. Inhibitory
serinových proteas mají optimální pH prostředí 9-11, coţ koresponduje s obvyklým pH
střevního traktu řady zástupců Lepidoptera. Jedním z vhodných genů pro navození rezistence
rostlin vůči poţerovému hmyzu je SPI2 izolovaný ze zavíječe voskového (Galleria mellonella
L.) (Nirmala et al., 2001).
V této práci bylo vyuţito jak PTGS, tak i inhibitorů proteas k vytvoření transgenních rostlin
hrachu, s předpokladem vzniku rezistence rostlin vůči virům PSbMV a PEMV a současně
vůči hmyzím škůdcům.
Materiál a metody
Práce byla rozdělena na dvě části. První část spočívala v tvorbě konstruktu pWELL12
obsahující kazetu 35S::cpPSbMV:mpPEMV:cpPEMV.
Druhá část práce zahrnovala přenesení této kazety se z pWELL12 do jiţ dříve vytvořeného
konstruktu pWELL11B, který obsahuje gen (SPI2) pro inhibitor serinových proteas.
Konstrukt pWELL12 byl vytvořen na základě vektorového systému pGREEN II. Do
restrikčního místa NotI byla vloţena kazeta 35S::cpPSbMV:mpPEMV:cpPEMV. Pro
sestavování této kazety byly vybrány sekvence cDNA virů PSbMV a PEMV a to: fragmenty
cDNA genů pro cp (coat protein) virů PEMV (131 bp) a PSbMV (137 bp) a fragment cDNA
genu mp (movement protein) PEMV (149 bp). Ty byly amplifikovány pomocí PCR za pouţití
primerů obsahujících přidané cílové sekvence pro vhodné restrikční endonukleázy. Produkty
PCR byly po agarózové elektroforéze izolovány a přečištěny z gelu pomocí kitu Invisorb
Fragment CleanUp (Invitek). Koncentrace DNA byla stanovena fluorimetricky. Jednotlivé
fragmenty byly pomocí DNA-ligázy vloţeny do vektoru pGEM-T (Promega). Elektroporací
byly plazmidy pGEM-T transformovány elektrokompetentní buňky Escherichia coli kmen
Top 10. Vybrané kolonie byly namnoţeny v tekutém LB mediu a pomocí GeneJET Plasmid
Miniprep Kit (Fermentas) z nich byla izolována plazmidová DNA.
Jednotlivé fragmenty virové cDNA byly postupně klonovány za sebe do vektoru pBluescript.
Celá vloţená sekvence byla amplifikována pomoci PCR za pouţití primerů s jinými
přidanými cílovými sekvencemi pro restrikční endonukleázy. To umoţnilo vloţení takto
vzniklé sekvence do vektorového systému pHANNIBAL (CSIRO) v orientaci sense/antisense
mezi 35S promotor a OCS terminátor tak, ţe jsou od sebe odděleny intronem. Průběţně bylo
prováděno testování pomoci PCR, restrikční analýzy a sekvenace. Nakonec byla celá kazeta
35S::cpPSbMV:mpPEMV:cpPEMV přenesena do vektorového systému pGREENII. Hotový
konstrukt byl nazván pWELL12 (Obr. 1).
Elektroporací byly konstruktem pWELL12 spolu s pomocným plazmidem pSoup
transformovány kompetentní buňky Agrobacterium tumefaciens kmen EHA 105. Pro ověření
funkčnosti byl konstruktem pWELL12 transformován tabák virginský (Nicotina tabacum)
kmen SR-1, jako modelová rostlina pro transformace pomocí A. tumefaciens. Tabák byl
256
„Úroda 12/2011, vědecká příloha―
transformován metodou transformace listových disků a několik málo disků bylo po třech
dnech pouţito na histochemický GUS test podle Fütterera et al. (1995). Po třech týdnech byly
regenerované rostliny přeneseny na selekčním medium MS 0,1/1 s augmentinem a
fosfinotricinem.
Dále byl vytvořen konstrukt pWELL14B (Obr. 3). Ze zhotoveného konstruktu pWELL12
byla
pomocí
restrikční
endonukleázy
NotI
vyjmuta
kazeta
35S::cpPSbMV:mpPEMV:cpPEMV a poté byla vloţena do jiţ dříve zhotoveného konstruktu
pWELL11B (Obr. 2). Tento konstrukt byl také zaloţen na vektorovém systému pGREENII
0229 a obsahoval navíc gen pro inhibitor serinových proteas SPI2 fúzovaný s reporterovým
genem GFP. Tyto dva geny byly regulovány trojnásobným promotorem 35S (triple X) a
terminátorem OCS. Hotový konstrukt pWELL14B byl opět průběţně testován pomocí PCR,
restrikční analýzy, sekvenace a poté pomocí transformace rostlinných disků tabáku.
LB
35
˜
t
np
EcoRI
KpnI
XbaI
ClaI
EcoRI
HindIII
HindIII
EcoRV
EcoRI
PstI
SmaI
BamHI
SpeI
XbaI
NotI
Co
XhoI
EcoRI
HindIII
EcoRI
XbaI
EcoRI
KpnI
HindIII
Obr. 2: pWELL11B
HindIII
FP
BamHI
SpeI
XbaI
NotI
EcoRI
ClaI
pWell14B
XhoI
Obr. 1: pWELL12A, B
35s-GUS
2501 bp
KpnI
ClaI
EcoRI
HindIII
KpnI
A
oly
Sp
bp
778
HindIII
XbaI
ClaI
pWell12A
˜ 12350 bp
PS
b
PE MV
se M V 43 nse
9b
p
OC
A
oly
Sp
bp
778
HindIII
XbaI
EcoRI
PstI
pWell14A
35sPSbM
VP
sense- EMV
antisen
se
˜ 3800 bp
te r
mo
ro p
sp 3b
35 135
VPSbM
PEMV
se
antisen
4
43 bp
XhoI
Intron
796 bp
PS
b
PE MV
se M V 43 nse
9b
p
r
te
mo
ro bp
sp 3
35 135
SacI
SacII
NotI
EcoRV
X
sle
SP
trip bp
0
16 I2-G
56
25
F
bp P
VPSbM
PEMV
se
antisen
434 bp
35sPSbM
VP
sense- EMV
antisen
se
˜ 3800 bp
Intron
796 bp
10725 bp
lacZ
˜
SacI
SacII
NotI
RB
35s-GUS
2501 bp
pWell12B
lEI ori
Fragment 725
bp
477 bp
ColE
725 I ori
bp
lacZ
Fragment
477 bp
RB
BamHI
SmaI
KpnI
-G
O
a - bp
pS 36
5
I
12
52
bp
52
RI
lacZ
Fragment
285 bp
ter OCS
min
ato
r
a 5
Fr 28
12
ar
nos-b bp
1150
SP
I2
tI
ClaI
HindIII
PstI
LB
KpnI
ApaI
XhoI
SalI
ClaI
HindIII
EcoRV
t
cZ en
la gm bp
np
KpnI ApaI XhoI SalI
no
115s-ba
0b r
p
OC
I
pSa-OR
536 bp
EcoRI
XhoI
Obr. 3: pWELL14A,B
Výsledky a diskuze
V první části této práce se podařilo na základě vektorového systému pGREENII 0229 vytvořit
konstrukt pWELL12, který nese fragmenty cDNA genů pro cp virů PEMV a PSbMV
a fragment cDNA genu mp PEMV v sense/antisense orientaci mezi 35S promotorem a OCS
terminátorem. Při tvorbě konstruktu byl vyuţit plazmid pHANNIBAL. Dále konstrukt
obsahuje reportérový gen uidA vhodný pro rychlé testování transformovaných rostlin
(například pomocí histochemického GUS testu), selekční gen nos-bar navozující rezistenci
transgenní rostliny k herbicidům s účinnou látkou fosfinotricin, gen NptI pro bakteriální
rezistenci k antibiotiku kanamycin, lacZ gen kódující ß-galaktosidázu pro modrobílou selekci
bakterií a dále obsahuje mnohonásobné klonovací
místo (polylinker). Pro umoţnění replikace v E. coli a
A. tumefaciens plazmid dále nese dvě ori místa.
Pomocí restrikční analýzy jsme rozlišili dvě varianty
konstruktu a to pWELL12A a pWELL12B (Obr. 4).
Tyto plazmidy se liší ve směru čtení kazety
35S::cpPSbMV:mpPEMV:cpPEMV.
Hotovým
konstruktem pWELL12 byl poté metodou
transformace listových disků podle Dombrowského
et al. (1994) transformován tabák jakoţto modelová
rostlina pro transformace pomocí Agrobacterium
Obr. 4: Restrikční analýza (XhoI)
tumefaciens. Úspěšnost transformace byla prokázána
M –1Kb DNA Ladder (Invitrogen)
pomocí pozitivního GUS testu listových disků tabáku.
1,4,5,6,7,9,11,12,13 – pWell12A
Po regeneraci celistvých rostlin bude GUS test
2,3,8,10 – pWell12B
opakován a doplněn PCR a dalšími testy. Tento
257
„Úroda 12/2011, vědecká příloha―
konstrukt by měl u cílové rostliny, coţ je hrách setý, který se bude transformovat metodou
transformace hrachových semen in vitro podle Švábová et al. (2005), vyvolat rezistenci vůči
virům PSbMV a PEMV způsobenou vlivem posttranskripčního utišení genů (PTGS).
V druhé části práce byl vyuţit vytvořený konstrukt pWELL12 a dříve vytvořený konstrukt
pWELL11B k tvorbě vektoru, který by spojil indukci rezistence k virům PSbMV a PEMV
s indukcí rezistence proti poţerovému hmyzu, která by měla být vyvolána konstruktem
pWELL11B. Zhotovený vektor pWELL14B byl opět v průběhu práce testován pomocí PCR,
restrikční analýzy a sekvenováním. Schopnost transformovat dvouděloţné rostliny byla i
tentokrát testována pomocí transformace listových disků tabáku a následného GUS testu,
kterým byly získány pozitivní výsledky. Další práce bude spočívat v transformování rostlin
hrachu zhotoveným konstruktem pWELL14B.
Závěr
Podařilo se připravit konstrukt pWELL12, který nese fragmenty cDNA genů pro cp virů
PEMV a PSbMV a fragment cDNA genu mp PEMV v sense/antisense orientaci mezi 35S
promotorem a OCS terminátorem a transformovat tímto vektorem rostliny tabáku. Dále byl
vytvořen konstrukt pWELL14B, který navíc obsahuje gen pro inhibitor serinových proteas
SPI2 a reportérový gen pro GFP taktéţ pod regulací trojnásobného 35S promotoru a OCS
terminátoru. Tento konstrukt by měl spojovat navození rezistence vůči hmyzím škůdcům a
virózám, které by měl indukovat v transformovaných rostlinách hrachu. Vzhledem
k obtíţnosti transformace hrachu je to významný krok k usnadnění přípravy transgenních linií
rezistentních vůči uvedeným chorobám a škůdcům.
Dedikace
Tato práce byla řešena za podpory NAZV projektu QI91A229 a projektu IGA AF
MENDELU TP 7/2011.
Pouţitá literatura
Dombrowski, J.E., Gomez, L., Chrispeels, J., Raikhel, N.V. (1994): Targeting of proteins to
the vacuole. In: Gelvin, S.B., Schilperoort, R.A. (1995): Plant molecular biology manual,
Kluwer academic publishers, Dordrecht.
Fütterer, J., Gisel, A., Iglesias, V., Klöti, A., Kost, B., Mittelsten S, O., Neuhaus, G.,
Neuhaus-Url, G., Schrott, M., Shillito, R., Spangenberg, G., Wang, Z.Y. (1995): Standard
Molecular Techniques for the Analysis of Transgenic Plants. In: Potrykus, I., Spangenberg,
G. (1995): Gene transfer to plants. Springer-Verlag, Berlin.
Hellens, R. P., Edwards, E. A., Leyland N. R., Bean, S., Mullineaux P. M. (2000): pGreen: a
versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation.
Plant Mol. Bio., 42, 819-832.
Nirmala, X., Kodrik, D., Zurovec, M., Sehnal, F. (2001): Insect silk contains both a Kunitztype and a unique Kazal-type proteinase inhibitor. Eur. J. Biochem., 268, 2064-2073.
Seidenglanz, M., Huňady, I., Poslušná, J., Loes, A. (2011) Influence of Intercropping with
Spring Cereals on the Occurrence of Pea Aphids (Acyrthosiphon pisum Harris, 1776) and
their Natural Enemies in Field Pea (Pisum sativum L.). Plant Protect. Sci., 47, 25-36.
Švábová, L., Smýkal, P., Griga, M., Ondřej, V. (2005): Agrobacterium-mediated
transformation of Pisum sativum in vitro and in vivo. Biol. Plant, 49, 361-370.
Kontaktní adresa:
Ing. Michal Rohrer,
Ústav biologie rostlin, Agronomická fakulta, MENDELU, 61300 Brno, Zemědělská 1
e-mail: [email protected]
258
„Úroda 12/2011, vědecká příloha―
ŠKODLIVOST KVĚTILKY CIBULOVÉ (DELIA ANTIQUA) A
KRYTONOSCE CIBULOVÉHO (OPROHINUS SUTURALIS)
NA ČESNEKU KUCHYŇSKÉM
V RŦZNÝCH NADMOŘSKÝCH VÝŠKÁCH
Harmfulness of Delia antiqua and Oprohinus suturalis on garlic
in various altitudes
Sapáková E., Šefrová H.
MENDELU v Brně
Abstrakt
Škodlivost květilky cibulové (Delia antiqua) a krytonosce cibulového (Oprohinus suturalis) na
česneku byla studována ve vegetačních sezónách 2010 a 2011 v oblasti střední a jihovýchodní
Moravy. Pět studijních ploch se nacházelo v různých nadmořských výškách: Nedakonice (178 m),
Olomouc (241 m), Dolní Němčí (256 m), Suchá Loz (304 m) a Vápenky (484 m). Výskyt škůdců byl
sledován kontrolou rostlin, pomocí barevných misek a lepových desek. Početnost květilky cibulové
nekorelovala s nadmořskou výškou, nejvyšší abundance dosáhla na plochách Dolní Němčí a Suchá
Loz. Krytonosec cibulový byl početnější v niţších polohách (Olomouc, Nedakonice), s rostoucí
nadmořskou výškou jeho abundance klesala. Rozdíly v prvním výskytu květilky cibulové mezi
plochami bylo 8 dní (10.5.–18.5.), krytonosce cibulového 9 dní (24.4.–3.5.). Napadení květilkou bylo
prokazatelně vyšší na okraji porostů.
Klíčová slova: česnek kuchyňský, krytonosec cibulový, květilka cibulová
Abstract
Harmfulness of Delia antiqua and Oprohinus suturalis on garlic was evaluated in central and southern
Moravia during growing seasons 2010 and 2011. Five study areas were delimited in various altitudes:
Nedakonice (178 m), Olomouc (241 m), Dolní Němčí (256 m), Suchá Loz (304 m) and Vápenky
(484 m). Occurrence of pests was monitored by inspection of plants, using colour bowls, and sticky
boards. Abundance of Delia antiqua was not correlated with the altitude, with the highest values in
Dolní Němčí and Suchá Loz. Oprohinus suturalis was most numerous in lower areas (Olomouc,
Nedakonice), its abundance decreased with the altitude. Differences in the first occurrence of Delia
antiqua were 8 days (10.5.–18.5.) between individual areas, in Oprohinus suturalis 9 days (24.4.–
3.5.). Infestation by Delia antiqua was higher on edges of cultures.
Key words: Allium sativum, Oprohinus suturalis, Delia antiqua
Úvod
Na česneku kuchyňském (Allium sativum) škodí poměrně široké spektrum škůdců z různých
skupin ţivočichů. Mezi nejvýznamnější se tradičně řadí háďátko zhoubné (Ditylenchus
dipsaci Kühn, 1857) a houbomilka česneková (Suillia lurida Meigen, 1830), případně
houbomilka S. univittata (von Roser, 1840). Háďátku zhoubnému se u nás věnoval např.
Douda (2005). Bionomií, morfologií a škodlivostí houbomilky česnekové se u nás zabýval
Dušek (1963), příp. Martinek (1972). Těmto druhům mohou být připisovány škody způsobené
jinými škůdci cibulovin. Škůdcům, jako jsou např. molík česnekový (Acrolepiopsis assectella
Zeller, 1839), krytonosec cibulový (Oprohinus suturalis Fabricius, 1775), květilka cibulová
(Delia antiqua Meigen, 1826), vrtalka pórová (Phytomyza gymnostoma Loew, 1858),
vlnovník česnekový (Aceria tulipae Keifer, 1938) se u nás věnovali např. Dušek (1969),
Matlák (1992), Černý (1995) a Vlk & Černý (2001). Polyfágní druhy, příleţitostně napadající
také česnek, např. larvy kovaříků, mšici broskvoňovou (Myzus persicae Sulzer, 1776) a
třásněnku zahradní (Thrips tabaci Lindeman, 1889) studovali např. Jagemann (1951), Pelikán
(1952) a Beránková & Kocourek (1989).
259
„Úroda 12/2011, vědecká příloha―
V tomto příspěvku předkládáme výsledky studia škodlivosti květilky cibulové (Delia antiqua)
a krytonosce cibulového (Oprohinus suturalis) na česneku, především se zřetelem na moţnou
závislost jejich početnosti, škodlivosti a fenologie na nadmořské výšce.
Materiál a metody
Výzkum byl prováděn v letech 2010 a 2011. Studijní plochy se nacházely na střední a
jihovýchodní Moravě v různé nadmořské výšce, všechny v obilnářské oblasti: Nedakonice
(178 m, roční průměrná teplota vzduchu 8,5 °C, roční úhrn sráţek 550 mm, rovina), Olomouc
(241 m, 8,5 °C, 583 mm, rovina), Dolní Němčí (256 m, 8,1 °C, 752 mm, nízká pahorkatina),
Suchá Loz (304 m, 7,6 °C, 650 mm, pahorkatina) a Vápenky (484 m, 6,1 °C, 750 mm, vyšší
pahorkatina). Na všech studijních plochách byly vysazeny ozimé odrůdy česneku: Dukát,
Mojmír, Záhorský, Bjetin, Benátčan a Dţambul. Zdravotní stav porostů byl hodnocen
vizuálně od konce února v pravidelných týdenních intervalech. Porost byl podle velikosti
plochy procházen po řádcích nebo úhlopříčně a kontrolován počet vývojových stadií škůdců
a příznaky poškození na rostlinách. Výskyt dospělců byl také zjišťován pomocí barevných
(červená, zelená, ţlutá) PVC misek po pěti opakováních, rozmístěných 5–9 metrů od sebe
rovnoměrně na náhodně zvolených místech, naplněných 4% formalínem. Barevné lepové
desky (ţlutá, modrá, bílá) byly umístěny na okrajích pěstebních ploch. Misky a lepové desky
byly v průběhu května a června kontrolovány 2× týdně.
Intenzita napadení květilkou cibulovou byla zjišťována podle počtu larev v jednotlivých
paličkách česneku. Při kaţdé kontrole bylo sledováno 100 rostlin. Linie rostlin na okraji
studijní plochy byly označeny jako varianty v1 a v5. Linie rostlin uvnitř porostu byly
označeny jako varianty v2, v3 a v4. Rostlina, která vykazovala charakteristické příznaky
poškození květilkou, byla vytaţena z půdy i s kořenovým systémem. Palička česneku byla
očištěna od obalových slupek a rozdělena na jednotlivé strouţky, mezi kterými migrovaly
larvy květilky. Determinace larev květilky byla prováděna v laboratoři podle ústních háčků
(Dušek, 1969). Larvy květilky byly v laboratoři umístěny do uzavřených nádob překrytých
jemnou textilií a odchovány do dospělosti. Početnost krytonosce cibulového byla zjišťována
také prostým hodnocením výskytu imag v porostu a podle příznaků poškození vţdy na 10
rostlinách v řádku.
Výsledky byly statisticky vyhodnoceny programem UPAV (jednofaktorová ANOVA a
Tukey-HSD testem (α = 0,05).
Výsledky a diskuze
Nejvyšší početnost květilky cibulové byla zaznamenána na lokalitě Dolní Němčí. Průměrné
napadení rostlin bylo 30 % a podle variant se pohybovalo v rozmezí 12 – 55 %. Průměrný
počet larev na napadenou rostlinu byl 14, maximální 28, coţ je v souladu s výzkumy
Ishikawy a kol. (1999), kteří zaznamenali aţ 30 larev. V Suché Lozi bylo průměrné napadení
rostlin 15 % s rozmezím 13 aţ 16 %. Průměrný počet larev na napadenou rostlinu byl 12, s
maximem 23. Na zbývajících třech plochách napadení nepřesahovalo 0,5 % rostlin.
Statisticky nebyla prokázána závislost početnosti na nadmořské výšce, tj. mezoklimatických
podmínkách stanoviště, patrně ji výrazně ovlivňují další faktory (mikroklima, expozice,
okolní porosty apod.). První výskyt imag květilky cibulové byl zaznamenán 10.5.2011 na
studijní ploše v Dolním Němčí a poslední 18.5.2011 na studijní ploše v Suché Lozi. Rozmezí
prvního výskytu mezi studijními plochami bylo 8 dní (10.5.–18.5.) a ani v tomto případě
nekorelovaly první výskyty s nadmořskou výškou. Intenzita napadení květilkou byla
statisticky významně vyšší na okrajích pěstebních ploch neţ ve středových částech (obr. 1).
Nebyly zjištěny statisticky významné rozdíly v napadení mezi odrůdami. Jako nejvhodnější
metoda monitoringu květilky cibulové se ukázala kontrola napadení rostlin a ţluté lepové
desky.
260
„Úroda 12/2011, vědecká příloha―
Nejvyšší početnost krytonosce cibulového byla pozorována na lokalitě Nedakonice (aţ 103
imag v 5 ţlutých miskách), dále v Olomouci (aţ 98 imag v 5 ţlutých miskách) (obr. 2). Mezi
plochami Nedakonice a Olomouc nebyl v početnosti krytonosce staticky významný rozdíl. V
Dolním Němčí dosahovala početnost maximálně 45 imag v 5 ţlutých miskách a v Suché Lozi
20 imag. Na ploše Vápenky druh nebyl pozorován. Abundance statisticky významně
korelovala s nadmořskou výškou, přičemţ v niţších polohách je druh výrazně početnější.
První výskyt imag krytonosce cibulového byl zaznamenán 24.4.2011 na studijní ploše
v Olomouci a poslední 3.5. v Suché Lozi. Rozmezí prvního výskytu mezi studijními plochami
bylo 9 dní (24.4.–3.5.) a fenologie druhu korelovala s nadmořskou výškou, tj. mezoklimatem
stanoviště. Výsledky ukazují, ţe klimatické podmínky jsou rozhodujícím faktorem určujícím
početnost krytonosce cibulového. Rozdíly mezi odrůdami nebyly statisticky významné, stejně
tak nebyly zjištěny rozdíly mezi okrajovými a středovými částmi ploch. Nejvhodnější
metodou monitoringu tohoto druhu byly ţluté misky.
Obr. 1: Početnost larev květilky cibulové na česneku na studijní ploše v Dolním Němčí (v1,
v 5 okraje; v2, v3, v4 střed)
250
prŧměrný počet larev
200
150
100
50
0
v1
v2
v3
varianta
v4
v5
Obr. 2: Početnost imag krytonosce cibulového na studijních plochách v Nedakonicích a
v Olomouci
120
100
početnost
80
60
40
20
0
24.4.
29.4.
6.5.
10.5.
datum
Nedakonice
261
Olomouc
20.5.
27.5.
„Úroda 12/2011, vědecká příloha―
Závěr
Početnost a tím i míra škodlivosti květilky cibulové (Delia antiqua) není prvořadě ovlivněna
nadmořskou výškou stanoviště (mezoklimatem). Rozmezí prvního výskytu mezi plochami
v různých nadmořských výškách činil 8 dní. Intenzita napadení květilkou byla statisticky
významně vyšší v okrajových částech pěstebních ploch neţ v jejich středu. To ukazuje na
poměrně malou pohyblivost květilky a vyplývá z toho zásada sázet česnek pokud moţno
dostatečně daleko od loňských ploch pěstování. Nejvhodnější metodou monitoringu květilky
cibulové byla kontrola napadení rostlin a ţluté lepové desky.
Početnost krytonosce cibulového statisticky významně korelovala s nadmořskou výškou,
vyšší je v niţších polohách. Rozmezí prvního výskytu mezi plochami bylo 9 dnů. Mezi okraji
a středovými částmi ploch nebyly zjištěny rozdíly. Nejvhodnější metodou monitoringu byly
ţluté misky.
Výzkum byl prováděn dvě vegetační období, proto je nutné povaţovat předloţené výsledky
za předběţné.
Příspěvek byl zpracován v rámci řešení výzkumného záměru MSM6215648905.
Pouţitá literatura
Beránková J. & Kocourek F., 1989: Ţivotní cyklus mšice broskvoňové Myzus persicae
(Sulzer). Plant Protect. Sci., 62(1): 279–288.
Černý M., 1995: Srovnání evropských druhů čeledi Agromyzidae na druzích rodu Allium.
Plant Protect. Sci., 31(1): 69–73.
Douda O., 2005: Host range and growth of stem and bulb nematode (Ditylenchus dipsaci)
population isolated from garlic andchicory. Plant Protect. Sci., 41(3): 104–108.
Dušek J., 1963: Suillia lurida (Meigen) (Dipt.: Heleomyzidae) ein neuer Knoblauchschädling
in der ČSSR. Zoologické listy, 12(3): 189–194.
Dušek J., 1969: Präimaginale Stadien mitteleuropäischer Anthomyiiden (Diptera) I.
Československá akademie věd, Praha, 37 s.
Ishikawa I., Yamashita T. & Nomura M., 1999: Characteristics of summer diapause in the
onion maggot, Delia antiqua (Diptera: Anthomyiidae). Journal of Insect Physiology, 46
(2000): 161–167.
Jagemann E., 1951: Klíč k určování drátovců (Col. Elateridae) ţijících v našich polních
půdách. Entomologické listy, 14: 62–73.
Martinek V., 1972: Suillia lurida (Meigen) a Suillia univittata (von Roser) (Diptera,
Heleomyzidae), two different central European species. Sborník Jihočeského muzea
v Českých Budějovicích. Přírodní vědy., 12(suppl. 2): 95–102.
Matlák J., 1992: Ako rozlíšit mínerku pórovú od kvetárky cibulové. Zahradníctvo, 17(9): 340
Pelikán J., 1952: Přehled třásňokřídlých z Československa. Zoologické a entomologické listy,
1(15): 185–194.
Vlk R. & Černý M., 2001: Agromyzidae. Acta Universitatis Carolinae Biologica, 45: 193–
197.
Kontaktní adresa:
Ing. Bc. Eva Sapáková
Mendelova univerzita v Brně, Zemědělská 1, Brno 613 00
[email protected]
262
„Úroda 12/2011, vědecká příloha―
VLIV TERMÍNU APLIKACE NA ÚČINNOST VYBRANÝCH
INSEKTICIDŦ NA STONKOVÉ KRYTONOSCE
(C. pallidactylus; C. napi) V ŘEPCE OZIMÉ
The effect of the spraying term on the effectiveness of several insecticides on
stem weevils (C. pallidactylus; C. napi) in winter oilseed rape
Seidenglanz M.1, Havel J.2, Hrudová E.3
1
Agritec výzkum, šlechtění a sluţby, Šumperk
2
OSEVA vývoj a výzkum s.r.o., Zubří
3
Mendelova univerzita v Brně
Abstrakt
Podrobný monitoring letové aktivity stonkových krytonosců (C. pallidactylus; C. napi) přispívá ke
zpřesnění načasování insekticidních aplikací na tyto škůdce. Zjišťování celkového mnoţství samiček
ve sběrech umoţňuje určit nebezpečnost náletu, sledování postupného zvyšování podílu zralých
samiček umoţňuje zpřesnit termín aplikace. Vliv termínu aplikace na účinnost insekticidů na stonkové
krytonosce byl vyhodnocen v polních pokusech zaloţených v roce 2010 na lokalitách Šumperk,
Troubsko a Opava.
Klíčová slova: C.pallidactylus, C. napi, termín postřiku, monitoring letové aktivity
Abstract
Detailed monitoring of fly activity of stem weevils (C. pallidactylus; C. napi) contributes to more
precise timing of insecticidal sprays on the insect pests. Recording the total amounts of females in
catches enables to find out a dangerousness of the pest occurrence and the recording the progressive
increase of matured females in the catches enables to make the term of spraying more precise. The
effect of more detailed monitoring on making insecticidal applications more precise was assessed in
field trials founded on localities Šumperk, Troubsko and Opava in 2010.
Key words: C.pallidactylus, C. napi, timing of spraying, monitoring of fly activity
Úvod
Stonkoví krytonosci (k. řepkový, CEUTNA a k. čtyřzubý, CEUTQU) jsou povaţováni za
velmi důleţité škůdce řepky ozimé. Co se týče ochrany porostů proti těmto škůdcům,
největším problémem není samotná účinnost insekticidů, ale spíše volba vhodného termínu
aplikace. V ČR pravděpodobně velmi často dochází k chybnému načasování aplikací na tyto
škůdce, coţ má samo o sobě řadu negativních dopadů (Seidenglanz et al, 2009). I kdyţ
existuje metodika ochrany proti těmto škůdcům zaloţená na monitoringu letové aktivity imag,
v praxi není příliš vyuţívána. Je povaţována jednak za pracnou, jednak za nepříliš
spolehlivou. Avšak podle našeho názoru, monitorování letové aktivity krytonosců v porostech
rozhodně není zbytečně vynakládanou aktivitou. Tento příspěvek je zaměřen na vyuţití
výsledků podrobnějších rozborů sběrů imag obou druhů zachycovaných ve ţlutých miskách
během monitoringu jejich letové aktivity v porostech ke spolehlivějšímu určení vhodného
termínu aplikace insekticidů.
Materiál a Metody
V roce 2010 byly na lokalitách Šumperk - Rapotín, Troubsko a Opava zaloţeny přesné
maloparcelkové pokusy zaměřené na hodnocení účinnosti insekticidů na stonkové krytonosce:
krytonosce čtyřzubého (C. pallidactylus; CEUTQU) a krytonosce řepkového (C. napi;
CEUTNA). Termíny aplikací byly v kaţdém pokusu voleny v závislosti na aktuálních
výsledcích monitoringu letové aktivity obou druhů na pokusné lokalitě. Monitoring letové
aktivity byl prováděn pomocí ţlutých Moerickeho misek (3 na pokus) vybíraných 2 x týdně.
Sběry byly bezprostředně po získání rozborovány v laboratořích (Agritec, ZVT, Opava,
263
„Úroda 12/2011, vědecká příloha―
MZLU) a byly stanovovány tyto údaje: 1) průměrný počet CEUTQU resp. CEUTNA / misku
/ 3 dny, 2) průměrný počet samiček CEUTQU resp. samiček CEUTNA / misku / 3 dny, 3)
průměrný počet samiček CEUTQU resp. CEUTNA připravených ke kladení / misku / 3 dny
(samičky připravené ke kladení = samičky se zralými vajíčky v ovariolech). Na základě
výsledků monotoringu byly pro kaţdý pokus v průběhu jara zvoleny čtyři po sobě následující
termíny insekticidních postřiků. Hodnocení napadení rostlin larvami sledovaných druhů bylo
provedeno po jejich zjištění (většina larev ve II. – III. instaru; před hromadným opouštěním
rostlin) v rostlinách kontrolní varianty. U kaţdé rostliny se hodnotil 1) počet listů napadených
larvami, 2) počet larev ve stonku a 3) stupeň poškození stonku (popis stupňů na graf 7 a 10).
Statistické zpracování dat bylo provedeno pomocí software Statistica version 8. Byla
provedena analýza variance (one-way ANOVA) pro všechny sady dat a následně Tukey test
za účelem násobného srovnání průměrů variant mezi sebou (P < 0,05).
Výsledky a diskuze
Graf 1: Výsledky monitoringu letové aktivity CEUTQU na lokalitě Šumperk - Rapotín
v roce 2010.
20
15
10
5
0
CEUTQU - totally
29.4.
26.4.
22.4.
19.4.
15.4.
12.4.
8.4.
5.4.
1.4.
29.3.
25.3.
CEUTQU - females
totally
22.3.
no. of ind./trap/3 days
Průběh letové aktivity CEUTQU na lokalitě Šumperk v
roce 2010
CEUTQU - females
with mature eggs
Graf 2: Výsledky monitoringu letové aktivity CEUTQU (na tomto grafu pouze samičky) na
lokalitě Troubsko v roce 2010.
6
CEUTQU - samičky
4
2
0
22.3.
25.3.
29.3.
1.4.
6.4.
9.4.
13.4.
20.4.
23.4.
27.4.
30.4.
4.5.
7.5.
počet ind/2,5 misky/3
dny
Průběh letové aktivity CEUTQU - samičky na lokalitě
Troubsko v roce 2010
CEUTQU - samičky
zralé
V roce 2010 na lokalitě Šumperk - Rapotín CEUTQU naprosto dominoval nad CEUTNA,
letová aktivita CEUTNA byla zcela zanedbatelná. Z garfu 1 je patrné, kdy byly zaznamenány
vrcholy letové aktivity CEUTQU (samci + samice) celkem (vrcholy modré křivky), samiček
CEUTQU celkem (vrchol červené křivky) a samiček připravených ke kladení (vrcholy zelené
křivky). Období kladení započalo kolem 5.4.10 a trvalo aţ do 29.4.10 (moţná i déle, avšak
dále jiţ nemonitorováno).
I na lokalitě Troubsko CEUTQU dominoval nad CEUTNA (i kdyţ výskyt CEUTNA zde
nebyl zcela zanedbatelný, graf 2 a 3). Z grafu 2 je patrné, kdy byl zaznamenán vrchol letové
264
„Úroda 12/2011, vědecká příloha―
aktivity samiček CEUTQU celkem (vrchol tmavě červené křivky; 8.4.11) a samiček
připravených ke kladení (vrchol světle červené křivky; 20.4.11). Pravděpodobná délka období
kladení trvala od 25.3. do 30.4.10.
Graf 3: Výsledky monitoringu letové aktivity CEUTNA na lokalitě Troubsko v roce 2010.
10
CEUTNA - celkem
5
CEUTNA - samičky
0
22.3.
25.3.
29.3.
1.4.
6.4.
9.4.
13.4.
20.4.
23.4.
27.4.
30.4.
4.5.
7.5.
počet ind/2,5 misky/3
dny
Průběh letové aktivity CEUTNA na lokalitě Troubsko v
roce 2010
Vrchol letové aktivity CEUTNA (samci + samice) celkem byl zaznamenán 25.3.10 (vrchol
modré křivky), samiček CEUTNA celkem také 25.3. (vrchol červené křivky) a samiček
připravených ke kladení 20.4.11 (vrchol zelené křivky) na lokalitě Troubsko. Pravděpodobná
délka období kladení trvala od 25.3. do 27.4.10 (graf 3).
Graf 4: Výsledky monitoringu letové aktivity CEUTQU na lokalitě Opava v roce 2010.
počet ind. / 1 misku /
3 dny
Průběh letové aktivity CEUTQU na lokalitě Opava v
roce 2010
10
CEUTQU - celkem
5
0
CEUTQU - samičky
Letová aktivita na lokalitě Opava byla v roce 2010 celkově velmi nízká. Vrchol letové
aktivity CEUTQU (samci + samice) celkem byl zaznamenán 25.3.10 (vrchol modré křivky),
samiček CEUTQU celkem také 25.3. (vrchol červené křivky) a samiček připravených ke
kladení 19.4.11 (vrchol zelené křivky). Pravděpodobná délka období kladení byla velmi
krátká: od 12.4. do 19.4.10. Intenzita kladení byla velmi nízká. Zástupci CEUTNA se na této
lokalitě vůbec nevyskytli.
Graf 5: Srovnání průměrných počtů larvami CEUTQU napadených listů u jednotlivých
porovnávaných variant na lokalitě Šumperk – Rapotín v roce 2010
265
„Úroda 12/2011, vědecká příloha―
Graf 6: Srovnání průměrných počtů larev CEUTQU ve stoncích rostlin u jednotlivých
porovnávaných variant na lokalitě Šumperk – Rapotín v roce 2010
Graf 7: Srovnání průměrných stupňů poškození stonků (důsledek ţíru larev CEUTQU) u
jednotlivých porovnávaných variant na lokalitě Šumperk – Rapotín v roce 2010
Z výsledků hodnocení pokusu na lokalitě Šumperk - Rapotín vyplývá vliv termínu aplikace na
účinnost porovnávaných insekticidů. Vzhledem k letové aktivitě CEUTQU na této lokalitě a
délce období kladení bylo poměrně sloţité optimální termín aplikace insekticidů stanovit. Z
výsledků hodnocení pokusu provedených ve dvou termínech (listy: 18.5.10; stonky: 10.6.10)
vyplývá, ţe čtvrtý termín aplikace (14.4.10) byl vhodnější neţ třetí termín (8.4.10) aplikace a
to pro všechny tři porovnávané insekticidy (graf 5 – 7). První dva termíny (24.3.10 a 1.4.10
byly v tomto smyslu předčasné. Při aplikaci 8.4. bylo přibliţně 32% samiček přítomných v
porostu připravených ke kladení, při aplikaci 14.4. byl tento podíl jiţ výrazně vyšší (téměř
100%), i kdyţ letová aktivita zrovna v tomto termínu byla velmi nízká (to však není
podstatné, neboť z předcházejícího monitoringu bylo moţné vyvozovat relativně vysoký
výskyt samiček v porostu – viz letová aktivita k 8.4.: 5,66 samiček / 1 misku / 3 dny).
Graf 8: Srovnání průměrných počtů larvami CEUTQU napadených listů u jednotlivých
porovnávaných variant na lokalitě Troubsko v roce 2010
266
„Úroda 12/2011, vědecká příloha―
Graf 9: Srovnání průměrných počtů larev CEUTQU + CEUTNA ve stoncích rostlin u
jednotlivých porovnávaných variant na lokalitě Troubsko v roce 2010
Graf 10: Srovnání průměrných stupňů poškození stonků (důsledek ţíru larev CEUTQU +
CEUTNA) u jednotlivých porovnávaných variant na lokalitě Troubsko v roce 2010
I z výsledků hodnocení pokusu v Troubsku vyplývá vliv termínu aplikace na účinnost
insekticidu ( 8 – 10). Vzhledem k letové aktivitě CEUTQU a CEUTNA a délce období
kladení ( 2 a 3) bylo i na této lokalitě relativně sloţité určit optimální termín postřiku.
Z výsledků vyplývá, ţe IV. termín ošetření (19.4.10) byl nejvhodnější z hlediska ochrany
listů (tj zdroj pro pozdější napadení stonků) ( 8). Z hlediska ochrany stonků byl vhodnější III.
termín ošetření (7.4.10) ( 9 a 10). Ke 2.4.10 bylo cca 30% přítomných samiček CEUTQU
v porostu připravených ke kladení, k 7.4. resp. 19.4. to bylo jiţ téměř 100% resp. 100%.
Graf 11: Srovnání průměrných počtů larev CEUTQU ve stoncích rostlin u jednotlivých
porovnávaných variant na lokalitě Opava v roce 2010
Srovnání prům. počtů larev CEUTQU ve stoncích (Opava;
27.5.10; BBCH 69)
přípravek: Vaztak 10 SC
2
1
0
1,19
kontrola
0,53
0,41
0,64
apl.
24.3.10
apl.
31.3.10
apl.
7.4.10
1,25
apl.
19.4.10
Výsledky hodnocení opavského pokusu ( 11) jsou především poznamenány obecně velmi
nízkým napadením rostlin larvami CEUTQU, coţ odpovídá výsledkům monitoringu letové
267
„Úroda 12/2011, vědecká příloha―
aktivity na této lokalitě ( 4). Charakteristické je především velmi nízké zastoupení samiček ve
sběrech (max. 1,44 samiček / 1 misku / 3 dny; nebezpečná je hodnota aţ kolem 4 samiček / 1
misku / 3 dny).
Zde uvedené výsledky (především lokality Šumperk a Troubsko) do jisté míry potvrzují
postupy ochrany proti CEUTQU (resp. CEUTNA) zaloţené na nutnosti podrobnějšího
monitoringu letové aktivity těchto škůdců (především pak samiček; Büchs, 1998; Klukowski,
2006 ) a jsou i v souladu s některými našimi jiţ dříve zjištěnými výsledky (Seidenglanz et al.,
2009).
Závěr
1) Termín insekticidního postřiku směřovaného na stonkové krytonosce (zejména
CEUTQU) nelze spolehlivě odvodit jen obecně od prostého mnoţství jedinců
krytonosců zachycených ve ţlutých miskách, tak jak např. uvádí běţné evropské
metodiky (nejen české). Tento postup často vede k předčasným aplikacím.
2) Spolehlivější metodou je podrobnější rozbor sběrů ze ţlutých misek zaměřený na
zjištění mnoţství samic a na určení stavu jejich připravenosti ke kladení.
Dedikace
Výsledky uvedené v této práci bylo moţné získat díky těmto grantům: QH81218 (NAZV
MZe ČR) a 1M06030.
Pouţitá literatura
Bűchs, W. (1998): Strategies to control the cabbage stem weevil (Ceutorhynchus
pallidactylus) and the oilseed rape stem weevil (Ceutorhynchus napi) by a reduced input of
insecticides. IOBC Bulletin, 21 : 205 – 220.
Klukowski, Z. (2006): Practical aspects of migration of stem weevils on winter oilseed rape.
In International Symposium on Integrated Pest Management in Oilseed Rape Proceedings,
3-5 April 2006, BCPC, Gottingen, Germany, ISBN 1 901396 09 6.
Seidenglanz, M., Poslušná, J., Hrudová, E. (2009): The importance of monitoring the
Ceutorhynchus pallidactylus female fly activity for the timing of insecticidal treatment.
Plant Protect. Sci., Vol. 45, No. 3, 103 - 112.
Kontaktní adresa:
Marek Seidenglanz
AGRITEC; Zemědělská 16
Šumperk 78701
[email protected]
268
„Úroda 12/2011, vědecká příloha―
PREDIKCE AKTIVITY BÁZLIVCE KUKUŘIČNÉHO V ZÁVISLOSTI
NA TEPLOTÁCH PŦDY
Western corn rootworm activity prediction in dependence
on soil temperature
Středa T.1,2, Středová H.1, Roţnovský J.1
1
Český hydrometeorologický ústav, pobočka Brno
2
Mendelova univerzita v Brně
Abstrakt
Preventivní ochrana proti bázlivci kukuřičnému (Diabrotica virgifera virgifera LeConte)
spočívá ve vyloučení dlouhodobého pěstování kukuřice po kukuřici na jednom pozemku.
V souvislosti s prudkým růstem počtu bioplynových stanic v ČR je však pravděpodobné
zvýšení podílu kukuřice v osevních postupech, včetně víceletých monokultur. Pro kvantifikaci
termických nároků a predikci výskytu bázlivce kukuřičného (DVV) byl v letech 2006 a 2008
– 2011 monitorován první výskyt dospělců DVV ve vazbě na sumy hodinových efektivních
teplot půdy. Sumy efektivních teplot (SET) půdy v hloubkách 2, 5, 10 a 20 cm byly počítány
pro spodní práh vývoje 5; 7,5; 10 a 12,5 °C. Pohybovaly se od 7807 hodinových stupňů (pro
12,5 °C ve 20 cm v roce 2011) do 31890 hodinových stupňů (pro 5 °C v 5 cm v roce 2010).
Nejmenší disperze hodnot (variační koef. 5,7 %) byla u dat z 10 cm hloubky pro SET 5 °C.
Klíčová slova: bázlivec kukuřičný, Diabrotica virgifera virgifera, suma efektivních teplot
Abstract
Preventive protection against western corn rootworm (Diabrotica virgifera virgifera LeConte)
is based on the exclusion of long-term cultivation of maize after maize on one field. In
connection with rising number of biogas stations in the CR an increase of maize in crop
rotation including multi-annual monocultures is supposed. First appearance of adults in
relation to the DVV hourly sums of effective soil temperatures (SETs) was monitored in 2006
and 2008 to 2011 for quantification of thermal requirements and prediction of the DVV. The
SETs at depths of 2, 5, 10 and 20 cm were calculated for the lower threshold of development
of 5, 7.5, 10 and 12.5°C. The SETs varied from 7807 degree hours (for 12.5°C at 20 cm in
2011) to 31890 degree hours (for 5°C at 5 cm in 2010). The lowest dispersion values
(coefficient of variation 5.7%) was observed for data from 10 cm depth for the SET 5°C.
Key words: western corn rootworm, Diabrotica virgifera virgifera, effective temperature sum
Úvod
Od 90. let 20. století, kdy byl bázlivec kukuřičný (Diabrotica virgifera virgifera LeConte)
„western corn rootworm―, zavlečen do Evropy, se jeho areál kaţdoročně rozšiřuje. V ČR jsou
vymezeny oblasti kontinuálního šíření DVV (Morava a Slezsko, část jiţních a Východních
Čech), nárazníkové pásmo a oblast doposud nezamořená. Hospodářské škody způsobené
DVV nebyly doposud v ČR potvrzeny. Při pěstování kukuřice v dlouhodobé monokultuře
(aktuálně zejména pro potřeby bioplynových stanic) je však pravděpodobné, ţe populační
hustota DVV dosáhne v některých oblastech prahu hospod