Korešpondenčný seminár
z biológie
3.kolo
2011/2012
Korešpondenčný seminár z biológie
organizuje
Prírodovedecká fakulta
Univerzity Komenského v Bratislave
Ústav anorganickej chémie
Slovenskej akadémie vied
Korešpondenčný seminár z biológie
podporuje
Dostali sa k Vám zadania úloh záverečného 3.kola. Potom, ako nám ich pošlete
vyriešené, v priebehu niekoľkých týždňov najlepších z Vás pozveme na sústredenie.
Súčasne budú postupne zverejňované výsledkové listiny jednotlivých kôl.
Skontrolujte si počty udelených bodov a v prípade otázok nás kontaktujte. Študenti,
ktorí sa nezaregistrovali do súťaže elektronicky, sú vo výsledkovej listine označení
farebne. Dodatočne sa zaregistrujte.
Chceme Vás poprosiť, aby ste neodpisovali. Podľa Vašich riešení je úplne jasne
vidieť kto opisoval. Pozrite si na stránke diskusiu k tejto téme v starších príspevkoch.
Opisovanie monitorujeme a bude zohľadnené v závere súťaže. Ak riešia seminár
viacerí študenti z jednej školy, je normálne, že hľadajú informácie spolu,
problematiku rozkonzultujú. Veď je to dobré prediskutovať problém, ktorý riešim, s
iným človekom, niektorí to považujú za základ vedeckej prace.
Ale keď problematiku rozoberáte spoločne, čo je dobre, tak samotné úlohy už
vyriešte každý sám. Verte, že aj keď ste informácie hľadali spolu, riešenia budú
odlišné, aj keď budú viesť k rovnakému výsledku. Takto je to správne, len tak môžete
mat úprimnú radosť z výsledku súťaže.
Pripomíname, že kategória juniori je určená pre študentov 1. a 2. ročníka stredných
škôl, resp. zodpovedajúcim ročníkom viacročných gymnázií. V prípade, že úlohy tejto
kategórie budú riešiť starší žiaci, ich riešenia nebudú akceptované.
Riešenie úloh píšte výhradne na odpoveďové hárky, ktorých predtlač nájdete na
http://bio.korsem.sk.
Podrobnejšie pravidlá korešpondenčného seminára boli uvedené v 1. brožúre, ktorej
elektronická verzia je na http://bio.korsem.sk .
V prípade nejasností k organizácii seminára alebo k riešeniu úloh môžete volať na
číslo telefónu 02/59 410 487, môžete sa informovať na e-mailovej adrese
[email protected] alebo na stránke http://bio.korsem.sk .
Vyriešené úlohy 3. kola posielajte do 2.4.2012 na adresu:
Korešpondenčný seminár z biológie
Prírodovedecká fakulta UK
Mlynská dolina
842 15 Bratislava 4
Veľa úspechov vám prajú autori a organizátori
1. Ekológia rias
Túto
úlohu
začneme
príbehom, na míle vzdialeným od
vodného
sveta
opísaného
v minulých častiach, ktorý ste
(dúfame že) dôverne spoznali....
V časoch dávno minulých,
t.j. 60. rokoch 19. storočia, švédsky
vynálezca a chemik, dnes už
celosvetovo známy Alfred Nobel
vyrobil nitroglycerín a prišiel na to,
že má dobre využiteľné výbušné vlastnosti. Avšak, mal mierne problémy
s kontrolovaním explózií.... Počas jednej zo svojich ciest umiestnil skúmavky
s nitroglycerínom do nádoby naplnenej kremelinou. Keď sa jedna zo skúmaviek
omylom rozbila, zistil, že kremelina nasiakla nitroglycerínom a tak ho uchránila pred
nechceným výbuchom. Tak prišiel na spôsob, ako stabilizovať inak veľmi nestály
nitroglycerín. V roku 1867 si vzniknutú zmes látok dal patentovať pod názvom
dynamit.
1. Otázka pre biológov znie – čím je tvorená kremelina? Stačí ak uvediete
slovenský a latinský názov triedy, do ktorej dané organizmy patria.
2. Ak sa troška pohráte so slovíčkami, zistíte, že latinský názov tejto skupiny
organizmov predurčuje aj ich geologický význam... Aký je názov horniny, ktorý
vytvárajú?
Organizmy, ktoré takto významným spôsobom prispeli k výrobe dynamitu
a nechtiac podporovali vojnu, sú inak veľmi mierumilovné stvorenia žijúce hojne
v sladkých aj slaných vodách ako súčasť fytoplanktónu.
3. Akou chemickou látkou je tvorená ich schránka? Z akých dvoch častí sa
skladá?
Predpokladáme, že ste sa už dopracovali k morfologickej charakteristike
týchto žltohnedých potvoriek a určite vás neskutočne zaujíma ich spôsob
rozmnožovania. Nepohlavným rozmnožovaním sa ich veľkosť neustále zmenšuje,
kedže vždy si bunka „dorobí“ menšiu časť schránky. Tieto stvorenia sú však tak milé,
že sa nechcú zmenšiť do úplne miniatúrnej podoby, ale stále chcú byť pekne
viditeľné v konkurencii iných vyparádených rias v sklíčku pod mikroskopom.
4. Ako pokračuje nepohlavné delenie keď sa bunky dostanú do štádia
najmenšej možnej veľkosti bunky? Ako sa nazýva útvar, ktorý vznikne?
Neboli by to však vodné stvorenia, keby nemali aj ekologický význam
a nepomáhali nám indikovať stav životného prostredia.
5. Bioindikátormi akého životného prostredia sú spomínané organizmy? Našli
by sme ich aj napr. v rieke Nitre v jej dolnej časti toku? Kedy dosahujú na Slovensku
maximá ich výskytu?
Ak by vás niekedy napadlo urobiť si exkurziu za polárny kruh alebo do
alpských oblastí, mohli by ste spozorovať krvavočervené stopy v snehu. Možno by
vás napadlo, že sa tu nachádzajú divé zvery.... alebo ste sa práve stali svedkom
nejakého brutálneho zločinu... No ako to v prírode býva, možno si z vás jednoducho
vystrelili opäť nevinné mikroskopické stvorenia a rozhodli vám pomotať hlavu. Tento
fenomén nechal lámať si hlavu už Aristotelovi a našim predkom, ktorí to považovali
za symbol zla alebo prichádzajúcej vojny.
6.
Uveďte
rodový
a druhový
latinský
názov
organizmu
spôsobujúceho
červené
sfarbenie
snehu.
daný
organizmus
Zároveň
zaraďte do systému – napíšte
jeho rod a triedu.
Červené krycie sfarbenie
tohto zaujímavého organizmu
však nie je čisto náhodné, ako
vždy, predstavuje to preň aj isté
výhody a tým nemyslíme odstrašovanie turistov.
7. Akou látkou je spôsobené jeho červené sfarbenie? Čomu napomáha – resp.
akú výhodu preň predstavuje?
Okrem toho, že sneh sa naozaj sfarbí dočervena, vytvoria sa v ňom aj diery,
ako si môžete všimnúť aj na obrázku.
8. Prečo sa spomínané prepadliny v snehu vytvárajú?
Doplňujúce otázky pre seniorov:
V minulom dieli ste mali popísať mechanizmus svetelného šoku u modelového
organizmu Chlamydomonas reinhardtii. S tým súvisí aj odlišná odpoveď toho istého
organizmu tiež na svetlo, ktoré však nemá takú silnú intenzitu, aby spôsobilo svetelný
šok. Táto reakcia bola popísaná aj u niektorých nálevníkov, napr. rodov Stentor,
Fabrea a Chlamydodon.
9. Aký druh pohybu spôsobuje svetlo u Chlamydomonas reinhardtii?
10. Čím sa táto odpoveď odlišuje od procesu svetelného šoku? Akým smerom
sa bude riasa pohybovať? Zmenou koncentrácie akých iónov je pohyb bičíkov
vyvolaný?
11.
Vystrihnite
si
nasledujúce
obrázky
znázorňujúce
odpoveď
Chlamydomonas reinhardtii na svetlo (Pozor: Nie mechanizmus svetelného šoku!).
Prvý obrázok je A, pričom tie ostatné (B,C a D) musíte usporiadať a podľa potreby aj
otočiť tak, aby v postupnom slede znázorňovali reakciu Chlamydomonas reinhardtii
na svetlo. V usporiadanom poradí ich potom vlepte do odpoveďového hárka,
v prípade nedostatku miesta na osobitný hárok papiera. K poslednému obrázku
nakreslite šípku, ktorá bude ukazovať smer pohybu riasy (svetlo sa stále bude
nachádzať na pravej strane).
Zároveň aspoň na jednom z obrázkov popíšte bunku Chlamydomonas
reinhardtii a šípkou ukážte aspoň na 3 odlišné štruktúry jej bunky.
2. Biológia bunky
J2. Juniori: Mitochondrie a plastidy
Symbióza môže mať rôzne podoby. Najužšou z nich
je endosymbióza, čiže prípad, keď jeden organizmus
žije vo vnútri tela toho druhého. Ale vôbec
najtesnejšou formou endosymbiózy je vnútrobunková
endosymbióza (keďže vedci radi všetko pomenúvajú,
stretnete sa aj s názvom endocytobióza). Určite ste
už prišli na to, že reč je práve o pôvode mitochondrií
a plastidov.
Možno
by
ste
ale
nepredpokladali,
že
endosymbiotická hypotéza má už svoje roky. Teda
minimálne hypotéza o takomto pôvode chloroplastov.
Už v roku 1905 ju v primitívnej podobe navrhol ruský
biológ Konstantin Sergejevič Merežkovskij, ktorý vo
vtedajšej obdobe časopisu Nature, menom Biologisches Centralblatt, publikoval
svoje myšlienky, ktoré obsahovali okrem iného aj jednu šokujúcu rovnicu: živočíchy +
chloroplasty = rastliny. Týmto okamžite vyvolal búrlivé reakcie v radoch svojich
kolegov, ktorí endosymbiózu uvrhli do nemilosti. Veď kto by mohol veriť takému
nezmyslu, že rastliny sú „zlepencom“ živočíchov a chloroplastov? Na ich obranu
treba povedať, že neboli k dispozícii žiadne dôkazy pre Merežkovského kacírske
myšlienky. Až o 60 rokov bola endosymbiotická hypotéza postupne vzkriesená
zásluhou nových objavov a známej popularizátorky vedy Lynn Margulisovej, ktorá v
jednom svojom článku (odmietnutom 15-timi vedeckými časopismi) interpretovala
nové mikrobiologické poznatky v prospech tejto hypotézy a zároveň trošku poopravila
a rozvinula Merežkovského rovnice. Vďaka pribúdajúcim novým objavom a
vytrvalosti Lynn Margulisovej teda endosymbióza začala svoje víťazné ťaženie do
vedeckých kruhov a učebníc.
1. Napíšte latinský alebo slovenský názov jedného organizmu, ktorý má vo svojom
tele (ale nie vo vnútri buniek) endosymbionta a napíšte aj názov symbionta.
2. Dnes už máme mnoho poznatkov, ktoré podporujú endosymbiotický pôvod
mitochondrií a plastidov – napíšte aspoň 4 takéto poznatky
3. Najmenej cez koľko membrán musí prejsť molekula, ak sa pohybuje zo strómy
chloroplastu do matrix mitochondrie? U niektorých organizmov by však musela prejsť
viacerými membránami, prečo?
Zaujímavým fenoménom je, že počas evolúcie sa gény mitochondrií a plastidov
postupne presúvali do jadra. Vysvetlenie je jednoduché – keďže tieto organely sa
autonómne rozmnožujú a majú vlastnú genetickú informáciu, ktorá môže mutovať,
bude medzi mutovanými organelami dochádzať k súťaženiu o čo najrýchlejšie
rozmnožovanie. Tak sa stane, že v bunke prevládnu síce rýchlo sa rozmnožujúce
organely, ale rýchlo sa rozmnožujúce aj na úkor svojich ostatných funkcií. Teda čím
menej génov, tým menšia šanca, že sa organely zvrhnú.
4. Otázkou ale je, prečo si napriek tomu organely zachovali niektoré svoje gény?
(Pomôcka: prebiehajú v nich procesy, ktoré sú pre bunku nevyhnutné, ale aj
nebezpečné)
Ako to už medzi organizmami chodí. sú parazity exoti takmer vo všetkom a teda aj v
tom, aké majú mitochondrie a plastidy.
5. U niektorých anaeróbnych parazitov napr u žardie črevnej (Giardia intestinalis) boli
nájdené podivné organely nazvané mitozómy, zatiaľ s nejasnou úlohou. Ktoré z
nasledujúcich možností podporujú pôvod mitozómov z mitochondrií.
a.) mitozómy sa autonómne nedelia
b.) mitozómy obsahujú niektoré typické mitochondriálne proteíny
c.) žardie žijú v tráviacom trakte hostiteľa
d.) jadro žardií obsahuje gény mitochondriálneho pôvodu
e.) žiadna z predchádzajúcich možností nepodporuje tvrdenie o pôvode mitozómov z
mitochondrií
6. U výtrusovcov (Apicomplexa) bola popísaná jedna zaujímavá organela, ktorá je
súčasťou ich špeciálneho tzv. apikálneho komplexu a viedla niektorých vedcov k
myšlienke liečiť maláriu herbicídmi a existuje mnoho štúdií, ktorých výsledky
poukazujú na to, že by to zrejme možné bolo. Ako sa volá táto organela a prečo by
sme vďaka nej chceli na maláriu útočiť práve herbicídmi?
S2. Seniori: Bunková signalizácia a komunikácia
Anglický chemik John Dalton je známy predovšetkým
z učeníc chémie svojou atómovou teóriu. Do učebníc
biológie sa však dostal len v podobe jedného
nepatrného názvu pre farbosleposť – daltonizmus,
hoci bol prvý kto ju, sám na sebe, vedecky popísal.
Ako každý vedec rád formuloval rôzne hypotézy,
preto vymyslel aj vysvetlenie pre svoju farbosleposť.
Trpel pomerne nezvyčajnou formou tohto ochorenia,
keďže nerozlišoval modrú. Vymyslel teda hypotézu,
že jeho sklovec je sfarbený namodro. Lenže ako to
otestovať? A vtom prišiel na geniálny nápad – urobí
experiment takpovediac z rakvy. Želal si, aby po jeho
smrti boli jeho oči vybrané, rozrezané a zistená farba
sklovca. Prianie sa mu splnilo deň po smrti, 28. júla 1844 keď Jospeh Ransome
rozrezal jeho oči a zistil, že sklovec bol bezfarebný a priehľadný ako v očiach iných
ľudí,čím, samozrejme, vyvrátil Daltonovu hypotézu. Ransome zase nerád vyhadzoval
vzorky a preto uložil Daltonove oči do konzervačného roztoku. O 150 rokov neskôr z
nich bola izolovaná DNA a amplifikáciou špecifických sekvencií sa zistilo, že mu
chýbal gén pre jeden z opsínov, molekúl zabezpečujúcich prijatie svetelného signálu
v bunkách sietnice.
Bunky musia byť schopné prijímať množstvo signálov, nielen z prostredia ako bunky
sietnice, ale aj signálov od iných buniek. Mechanizmy, čiže takzvané signálne dráhy,
ktoré na to používajú sú si vo všetkých prípadoch veľmi podobné. Na začiatku každej
signálnej dráhy stojí receptor a jeho ligand, čiže signálna molekula, ktorá sa naňho
viaže.
1. Ak sa rozprávajú dvaja ľudia, je veľmi jednoduché, aby ich (od)počúval niekto tretí.
Ak sa „rozprávajú“ dve bunky, pričom jedna vysiela signál a druhá naň odpovedá, nie
je až také jednoduché aby ich „odpočúvala“ nejaká iná bunka, ktorej signál nie je
určený. Prečo?
2. Receptor môže na svoje ligandy číhať buď na povrchu, alebo vo vnútri bunky. To
je dané predovšetkým vlastnosťami signálnej molekuly (=ligandu). Aké vlastnosti by
mal mať podľa vás ligand, ktorého receptor sa nachádza vo vnútri bunky.
3. Máte kultúry dvoch typov buniek, označme ich bunky N a bunky S. Bunky N sú
schopné odpovedať na noradrenalín. Bunky S sú schopné odpovedať na testosterón.
Urobíte takéto experimenty:
Ia. Noradrenalín je podaný bunkám N do kultivačného média
Ib. Noradrenalín je podaný bunkám N vnútrobunkovo
IIa. Testosterón je podaný bunkám S do kultivačného média
IIb. Testosterón je podaný bunkám S vnútrobunkovo
V ktorých prípadoch vyvolá stimulácia príslušnú bunkovú odpoveď a prečo?
(Pomôcka: uvažujte ktorý z dvojice použitých hormónov spĺňa podmienky z
predhchádzajúcej otázky.
Od receptoru je k cieľu v bunke, resp. ku konkrétnej odpovedi ešte ale ďaleká cesta.
Prvým krokom k objasneniu, čo sa v bunke deje po naviazaní ligandu na receptor
bola práca Earla Sutherlanda a jaho kolegov, ocenená Nobelovou cenou. Títo vedci
sledovali aktiváciu enzýmu glykogén
fosforylázy adrenalínom (=epinefrín).
Glykogén fosforyláza katalyzuje rozklad
glykogénu uloženého v pečeňových
bunkách, čo má za následok uvolnenie
glukózy do krvi. Tento enzým je
normálne prítomný v cytoplazme
hepatocytov, ale v neaktívnej forme.
Sutherland s kolegami zistili, že
adrenalín môže aktivovať glykogén
fosforylázu aj v rozbitých bunkách, ale
iba v prípade, že sú prítomné aj
fragmenty cytoplazmatickej membrány.
Predpokladali teda, že existuje nejaký
chemický posol, ktorý prenáša správu o
naviazaní adrenalínu na receptor k
efektorovému enzýmu. Aby overili toto
tvrdenie, urobili elegantný experiment
(obr. vpravo). Z rozbitých pečeňových
buniek
odseparovali
frakciu
cytoplazmatickej membrány (1), ktorú
inkubovali v roztoku s obsahom ATP.
Potom na membránovú frakciu pôsobili
adrenalínom (2) a odstránili membrány
(3). Následne roztokom, v ktorom boli
membrány inkubované, pôsobili na
druhú frakciu (4) získanú z rozbitých
buniek a výsledkom bolo, že týmto
roztokom boli schopní aktivovať
glykogénfosforylázu. Neskôr tiež zistili,
že druhým poslom (ako nazvali tieto
malé
látky)
je
cAMP
(cyklický
adenozínmonofosfát).
Dnes
už
poznáme aj ďalšie kroky tejto dráhy
(pozri obrázok vľavo):
(1.) Adrenalín sa viaže na receptor,
ktorý je spriahnutý s tzv. G-proteínom
(2.) G proteín je aktivovaný a „kĺže“ sa
pozdĺž membrány, potom aktivuje
enzým adenylyl cyklázu
(3.) Adenylyl cykláza vytvára cAMP z
ATP
(4.) cAMP
aktivuje
cAMP-závilú
proteínkinázu A
(5.) Proteínkináza A aktivuje fosforylázakinázu
(6.) Fosforylázo-kináza
aktivuje
glykogénfosforylázu
(7.) Glykogénfosforyláza katalyzuje lýzu
glykogénu
4. Určite ste si v schéme dráhy všimli, že aktivácia/deaktivácia enzýmov sa deje
pridaním resp. odobratím fosfátovej skupiny. Tento spôsob regulácie je pre
organizmy dôležitý nielen v signálnych dráhach, ale aj v metabolizme všeobecne.
Napr. približne 5% ľudského genómu tvoria gény pre kinázy – enzýmy, ktoré na
rôzne látky „prilepujú“ fosfátové zvyšky. Otázkou je, ako môže takáto realtívne
nepatrná zmena spôsobiť (de)aktiváciu enzýmu. Prvá možnosť je priestorová fosfátová skupina môže napr. zabrániť vstupu substrátu do aktívneho miesta.
Fosforylácia však môže zmeniť aktivitu enzýmu aj bez toho, aby sa fosfát viazal v
aktívnom centre. Predstavte si napríklad enzým, v ktorého sekvencii sa nachádza aj
takáto časť ...Gly-Ile-Val-Pro-Ser-Ala-Ala-Gly... pričom na serínový zvyšok sa pripojí
fosfát. Ako sa zmení interakcia tejto časti proteínu s vodou? Ak by mala susediaca
doména proteínu sekvenciu ...Thr-Asp-Asp-Cys-Glu-Ala-Glu-Glu..., ako sa
fosforyláciou zmenia interakcie týchto častí navzájom? (Pomôcka: táto otázka nie je
až taká ťažká, ako môže na prvý pohľad vyzerať – uvažujte o polárnych vlastnostiach
a nábojoch na bočných reťazcoch aminokyselín)
Ďalšia vlastnosť, nápadná pri prvom pohľade na schému je jej kaskádový charakter.
Jednou z výhod takéhoto usporiadania je amplifikácia signálu, keďže katalyzátory
aktivujú ďalšie katalyzátory
5. Prečo je pre bunku výhodné amplifikovať (zosilňovať) signál?
6. Napíšte ešte jednu výhodu kaskádovitého usporiadania signálnych dráh?
Kaskádové usporiadanie so sebou prináša aj určité nevýhody, napríklad vyžaduje,
aby bol systém dostatočne robustný, teda aby dokázal udržať svoju funkčnosť
napriek náhlym zmenám v prostredí. Asi ste už niekedy videli kresby Reubena
„Rube“ Goldberga, amerického karikaturistu a držiteľa Pulitzerovej ceny. Jeho
vynálezy pracujú síce kaskádovo, ale robustnosťou veľmi neoplývajú. Posúďte sami:
Vynález 1 – Zjednodušené strúhadlo na ceruzky
Ovorte okno A a vypustite šarkana B, šarkan potiahne lanko C, ktoré otvorí dvierka
na krabici D a vypustí mole E. Mole zožerú kabát F, ktorý sa stane ľahším a spustí
nižšie topánku G. Topánka zapne spínač H žehličky I, žehlička prepáli košeľu J. Dym
sa cez rúru K dostane do stromu L a vydymí vačicu M. Vačica zoskočí do košíka N
pričom potiahne šnúru O a zodvihne klietku P. Tým uvolní ďatla Q a ten odzobe
prebytočné drevo z ceruzky R, až sa ukáže tuha. Pohotovostný nožík S je vždy
poruke v prípade, že vačica alebo ďatel ochorejú, či nepracujú správne.
Vynález 2 – Ako zabrániť šéfovi, aby si všimol, že meškáte do práce
O 9:00 vykukne z hodín kukučka A a pobozká živého kukučiaka B sediaceho na
bidielku. Kukučiak sa zľakne, že by ho mohla v priestupnom roku požiadať o ruku
(podľa tradície anglicky hovoriacich krajín môžu ženy požiadať muža o ruku len v
priestupnom roku) a preto odletí, pričom vytiahne háčik C, ktorý uvolní mechanickú
ruku D - tá vyhodí plechovku E, ktorá dopadne na rameno vahadla F a preváži ho,
čo spôsobí zdvihnutie krytu G z písacieho stroja H a šéf si bude myslieť, že ste v
práci, ale momentálne ste niekam odbehli
7. Jeden z týchto dvoch Goldbergových vynálezov je robustnejší než ten druhý,
pretože doň zaradil spätnú väzbu. Ktorý vynález to je a ktorý jeho prvok predstavuje
spätnú väzbu?
Na záver trochu matematiky. Okrem spätnej väzby je v signálnych dráhach
zabezpečená robustnosť aj citlivým vyladením afinity ligandu k jeho receptoru v
priebehu evolúcie. Túto afinitu môžeme vyjadriť pomocou disociačnej konštanty (Kd)
pre dvojicu receptor-ligand. Keďže ligand sa viaže na receptor, môžeme ich
interackiu vyjadriť takto [R] + [L] ↔ [RL], kde [R] je počet neobsadených receptorov,
[L] je koncentrácia ligandu a [RL] je počet obsadených receptorov. Potom pre
Kd =
[ R][ L]
[ RL ]
disociačnú konštantu platí
. Ďalší vzťah, ktorý vyplýva z
predchádzajúceho vzťahu je, že počet všetkých receptorov RT = [R] + [RL]. Potom
môžeme pomer obsadených receptorov ku všetkým receptorom vyjadriť takto
[RL ] =
RT
[L ]
(Kd + [L ])
8. Čím silnejšia je väzba ligandu na receptor, tým bude Kd väčšia/menšia
(zakrúžkujte)
9. Normálna koncentrácia adrenalínu v krvi človeka je približne 0,5 µmol/l, Kd pre
väzbu adrenalínu na príslušný receptor je 5 µmol/l. S použitím posledného vzorca
môžete teraz vypočítať, ako sa relatívne malé zmeny v Kd môžu podpísať na
intenzite bunkovej odpovede
a.) Vypočítajte koľko % receptorov je normálne obsadených pri hodnotách v zadaní?
b.) Koľko % receptorov je obsadených ak koncentrácia adrenalínu vzrastie 10x (teda
na 5 µmol/l)?
c.) Čo by sa však mohlo stať ak sa Kd zmenší 10x (teda 0,05 µmol/l)? Koľko %
receptorov bude obsadených pri fyziologickej koncentrácii adrenalínu (0,5 µmol/l)?
d.) Koľko % receptorov bude obsadených pri 10x nižšej Kd (0,05 µmol/l), ak
koncentrácia adrenalínu 10x vzrastie (5µmol/l )?
e.) Aké následky by teda, na základe vašich výpočtov, malo zmenšenie Kd pre
bunkovú signalizáciu?
10. Bonusová otázka. (Nemusíte ju riešiť, ale za správne riešenie sa vám pripočítajú
body, ak ste niekde v tejto úlohe stratili). Napíšte akými úpravami prvých dvoch
vzťahov sa dá dostať k tretiemu, pomocou ktorého ste počítali obsadenosť
receptorov.
3. Modelové organizmy v biológii
Keď pršalo, mrholilo, žabiatko sa narodilo
Juniori: 1a), 3, 4a), 4b), 5
Seniori: 1, 2, 3, 4, 6, 7
Kŕk! zamrazilo nádejnú diplomantku
Xéniu pri spomienke na básničku,
ktorú musela ako sedemročná
recitovať
na
školskom
kole
Hviezdoslavovho Kubína. Každý
predsa vie, že žaby sa vyvíjajú
nepriamo, cez larválne štádium. No
dobre, v trópoch sa predsa len
niekedy malá žubrienka vyvíja vo
vajíčku a z vajíčka vyskočí až
metamorfovaná žabka a existujú
dve výnimky z Afriky (rod Nimbaphrynoides a Nectophrynoides), ktoré sú dokonca
živorodé, prípadne vajcoživorodé. Ale to paní Ľudmila nemohla ani tušiť, keď poznala
len tie slovenské žaby.
Xénia kráčala dlhou tmavou chodbou v druhom suteréne starej budovy, až
došla ku dverám, ktoré otvorila tajným vstupným kódom (1234). Zasvietila svetlo,
všetky šváby sa rozpŕchli do svojich úkrytov, a vtom sa zjavilo bohatstvo, ktoré
skrývali selektívne priepustné dvere. Naľavo i napravo stáli veľké akvária plné vody
a v nej sa nadnášalo množstvo veľkých žiab. Ale nie len takých obyčajných, šlo totiž
o akvatický druh pazúrnatka vodná (Xenopus laevis), viac ako 50 rokov populárny
modelový organizmus výskumu ranného embryonálneho vývinu stavovcov. Tu,
v tomto kumbáli, žijú budúce hviezdy časopisov Nature a Science.
Xénia je zatiaľ len na začiatku svojho výskumu, už si však chystá
experimentálne embryá. Aby získala čo najrýchlejšie dostatok oplodnených vajíčok,
injikuje do niekoľkých jedincov tekutinu T zo zásobnej mikroskúmavky. To, že možno
pomocou tekutiny T hockedy behom roka indukovať rýchle rozmnoženie pazúrnatiek,
je jeden z dôvodov, prečo sa stali tak obľúbené vo výskume a zároveň sa stali
súčasťou ešte v nedávnej minulosti najbežnejšej spoľahlivej metódy na stanovenie
tehotenstva žien.
Okrem toho, pazúrnatka má enormne obrovské oocyty dosahujúce až 1 cm.
Pred časom, keď Xénia upratovala v mrazákoch, „omylom“ (aby našla kúsok
miesta aj pre seba) zmiešala zmrazené embryá rozdelené podľa stupňa vývinu do
jednej Petriho misky. Keď na to prišiel postarší doktorand, ktorému embryá patrili
a ktorý skúmal embryonálny pôvod larválnych dýchacích orgánov obojživelníkov,
prikázal Xénii túto galibu napraviť. Našťastie, veľké ranné embryá stačí prezrieť pod
svetelným mikroskopom a hneď je vám jasné, či pozeráte na morulu, a či na gastrulu.
Xénia plánuje pracovať s trochu neskoršími štádiami. Zaujíma sa totiž
o metamorfózu žiab. Vie sa, že metamorfóza je iniciovaná a sprevádzaná zvýšenou
hladinou trijódtyronínu (T3) a tyroxínu (T4) v krvnom obehu a dochádza pri nej ku
radikálnej telesnej prestavbe spojenej so vznikom nových štruktúr, remodeláciou už
stávajúcich štruktúr, smrťou niektorých embryonálnych orgánov, či zmenou ich
biochemickej špecifity. Čo sa však stane vo vývine pazúrnatky, keď je jej produkcia
T3 a T4 narušená (predčasná, oneskorená, či znížená)? Tak na to si budeme musieť
počkať nejaký ten rok.
1. a) Poznáte slovenské žaby? Napíšte slovenský, aj latinský rodový a druhový
názov štyroch vyobrazených žiab.
b) Pripíšte latinské názvy čeľadí, do ktorých patria vyobrazené druhy.
c) Ktorá čeľaď žiab vyskytujúca sa niekoľkými druhmi na Slovensku nemá svojho
zástupcu na obrázkoch?
2. Napíšte latinský názov čeľade, do ktorej je pazúrnatka zaradená. Z ktorého
kontinentu tento druh pochádza?
3. Čo presne je tekutina T, ktorú Xénia injikovala žabám a mala tak vyvolať
rozmnoženie žiab? Vysvetlite princíp fungovania tehotenského testu za využitia
pazúrnatiek.
4. a) Pomôžte Xénii usporiadať pomiešané, rôzne staré embryá. Na obrázku je
znázornené vajíčko pazúrnatky ako počiatočný bod vývinu a čerstvo vyliahnutá
žubrienka ako koncový bod vývinu. Medzi týmito dvoma bodmi sa nachádza viacero
štádií. Zoraďte osem zobrazených štádií (A až H) tak, ako sa postupne objavujú
v embryonálnom vývine
Koncentrácia T3 v krvi
b) Označte vývinové štádiá z obrázkov A-H, na ktorých je znázornené štádium:
moruly, blastuly, gastruly a neuruly.
c) Výlučne v ktorej skupine organizmov sa stretneme so štádiom neuruly a teda
i s neuruláciou a je teda pre ňu neurulácia apomorfným znakom?
5. a)Ako sa nazýva dýchací orgán larválnych štádií mlokotvarých a žiab? U ktorej
skupiny je tento orgán viditeľný zvonka, u ktorej skupiny je umiestnený vnútorne?
b) Akými dvoma spôsobmi dýchajú dospelé obojživelníky?
6. Na základe popisu v úvode, ktorá z troch kriviek (A-C) by mala popisovať
koncentráciu trijódtyronínu v obehovom systéme vyvíjajúcej sa žaby?
A
B
C
Vek (počet dní)
7. Priraďte, čo sa deje s orgánmi počas metamorfózy na žabu:
Chvost, larválne dýchacie orgány
Nová štruktúra
Remodelácia
Zadné končatiny
Typ vylučovania (ammonotelia vs. ureotelia)
Smrť
Lebka
Zmena špecifity
4. Úloha
J4. Juniori: História biológie
Keď bola na začiatku 20. storočia v súčasnom Petrohrade vytvorená najväčšia
semenná banka na svete, určite v nej nechýbali semená jablone. Vavilov, zakladateľ
tejto zbierky, sa pravdepodobne neuspokojil len s jednou reprezentačnou vzorkou,
pretože on a jeho spolupracovníci si uvedomovali, aký hodnotný je každý rastlinný
druh, každá jeho forma, divorastúci ekotyp, ako aj každý kultivar.
Existujú tisíce doteraz vyšľachtených kultivarov jablone domácej Malus
domestica. Na území Slovenska sa vyskytuje jej blízky príbuzný, voľne rastúci druh
jabloň planá Malus sylvestris.
1. Kto bol autorom prvého botanického opisu jablone planej? (Pomôcka: Veľmi ľahko
to zistíte pohľadom na správne uvedený vedecký názov.)
2. Aký botanický názov (v latinskom jazyku) dal jabloni Linné? V čom spočíva
kuriozita tohto názvu?
3. Ak by vám niekto podal konár jablone bez plodov, na základe akého znaku by ste
určili, či ide o jabloň planú alebo jabloň domácu?
Medzi najznámejších nadšencov pre jablone vo svete patril pán John
Chapman, prezývaný Appleseed. Žil v Amerike v 18. storočí, v období veľkých
prisťahovaleckých vĺn, počas ktorých do bájneho nového sveta prichádzali mnohí
Európania. Veľa z nich si do „zasľúbenej zeme“ prinieslo semená rôznych odrôd
ovocia. John Chapman miloval jablká a ich rozširovanie považoval za svoje poslanie
a vnímal ako zdroj svojej radosti. Všade, kde sa zdalo, že by boli vhodné podmienky
pre rast jabloní, sadil jabloňové semienka. Vysial ich tisíce. Vysádzal jabloňové sady
a prisťahovalcom darovával jablká na rozširovanie jabloní.
Nadšenci pre jablone neboli raritou ani na Slovensku, ktoré je pre pestovanie
tohto ovocného stromu ako stvorené. Jedným z nich bol Juraj Fándly, ktorý vo
svojom literárnom diele opisuje výnimočnú jabloň. Táto ho prežila a dodnes rastie
v jeho pôsobisku.
4. Čím je tzv. Fándlyho jabloň typická?
5. Vysvetlite, ako Fándlyho jabloň súvisí s ABC modelom vývinu kvetu.
Šľachtením rastlín sa zaoberajú zástupy vedcov. Väčina kultivarov zeleniny,
ovocia alebo okrasných kvetov je výsledkom priam krvopotnej námahy. Zaujímavé je,
že mnohé z kultivarov jabĺk, ktoré považujeme za najlepšie, vznikli bez ľudského
pričinenia. Človek tu zohral iba rolu objaviteľa.
Takto vznikol kultivar Jonathan, ktorý na dedinách nájdeme rásť v každej
druhej záhrade. Ako prvá ho „našla“ Ester Ricková, na prechádzke so svojim
snúbencom v zabudnutej časti rodinného hospodárstva.
V našich obchodoch sa veľmi často predávajú kultivary Golden Delicious
a Red Delicious. Prvý uvedený objavila neter Andersona Mullinsa na okraji
vyrúbaného sadu, druhý spomenutý padol do oka Jessemu Hiathovi, ktorý ho našiel
jednoducho pri ceste. Narástol tam ako hybridný semenáč z nejakého odhodeného
okryzka jablka.
Vďaka objavu Franza Baumanna dnes poznáme kultivar Bernské ružové.
Franz našiel „starú mamu“ tohto pekného jabĺčka počas poľovačky v lese. No
a babička Anna Smithová objavila podobný poklad vo svojej záhrade, za domom,
v ktorom žila od svojho príchodu do Austrálie. Ešte ako mladá vysadila záhradu
semenáčmi jabĺk a jeden z nich dal vznik kultivaru Granny Smith. Všetkým vyššie
uvedeným priniesli nové kultivary ekonomický zisk.
Čo z týchto historických faktov vyplýva pre nás?
6. Predstavte si, že by ste VY náhodne našli hybridnú jabloň výnimočnej kvality. Aký
typ rozmnožovania by ste zvolili na jej namnoženie - generatívny alebo vegetatívny?
Vysvetlite prečo.
7. Uveďte aspoň jednu podmienku, ktorá platí pri registácii nového kultivaru na
Slovensku.
8. Vymyslite si jablko, ktoré by zodpovedalo vašej predstave dokonalosti. Uveďte
opis tejto odrody. (Nezabudnite uviesť veľkosť a tvar plodu, farbu pokožky, farbu
dužiny, chuť a samozrejme názov ☺ Môžete si pomôcť klasifikátorom pre jablko.)
A na záver, na odľahčenie, úryvok z filmu pre pamätníkov, ktorý pozerávali naše
babičky až prababičky :) http://www.youtube.com/watch?v=b0fNV6oyoVA
S4. Seniori: Biochémia
ÚŠKĽAB SAV, niekedy ku koncu roka 2011
„Čo sa tu teda vlastne stalo?“ predniesol hlas so silným prízvukom. „No, veď vidíte,
vypáčené sklo, tu hento na zemi porozlievané etídium, ešte keď nám kvôli tomu
skape kocúr, tak nech si ma dotyčný nepraje!“ „A to je všetko? Kvôli tomuto nás
volali?!...“ „Nie, zobral aj kultúry králičieho tkaniva...“ Chlapík s prízvukom sa
pousmial a so slovami „No, zdá sa, že náš zlodej má toho celkom dosť za ušami“ si
takmer vypichol oko slnečnými okuliarmi...
John odchádzal od raditeľa ústavu šúchajúc si pravé oko a usmievajúc sa nad
vlastným „vtipom“, ale vedľa neho kráčajúci Peter si myslel, že to bol jeho najhorší
vôbec, a to už ich počul dosť. Obaja boli agenti prísne tajnej pobočky CSI
v Bratislave1 a po tom, ako sa obyčajná polícia rozhodla prípad nechať profesionálom
(„Kašlem vám ja na vedecké ústavy, dneska hrá Slovan!“) boli privolaní na miesto
činu. John bol rodený Američan, ale na slovenské pomery si rýchlo zvykol
a slovenčine sa priučil pri častých návštevách krčiem s miestnym rodákom Petrom.
1. Najprv mal John s množstvom alkoholu problémy, ale po čase zistil, že môže
vypiť viac a vytriezvie rýchlejšie. To znamená zvýšenú hladinu enzýmov, ktoré v tele
spracúvajú etanol (prevažne slávna alkohol dehydrogenáza, tiež jej aldehydová
sesternica). Ako môže zvýšená expresia génu súvisieť s DNA? Mohla sa zmeniť jej
sekvencia, alebo štruktúra? Expresia génu sa dá regulovať aj po transkripcii,
napríklad existujú malé úseky RNA, ktoré regulujú expresiu určitých mRNA. Aká asi
je ich sekvencia v porovnaní s mRNA? Tieto úseky tvoria komplexy s istou skupinou
proteínov. Čo je úlohou proteínu?
Nakoniec naši dvaja agenti prešli bludiskom zle osvetlených chodieb ústavu až na
miesto vlámania. Našli rozbité sklo, tekutinu na zemi, ale inak nič, čo by sa vymykalo
bežnému laboratórnemu neporiadku. „Je to na nič, vošiel dnu cez okno, ale nič z
toho nám nepomôže...“ predniesol John, ale Peter už kľačal na zemi a ukazoval na
švajčiarsky nožík. Kým si ho pozorne prezeral, znudený John sa oprel o UV lampu
a na zemi sa rozsvietili oranžové stopy...
2. Čo spôsobilo farbu týchto stôp? John a Peter to síce nevedeli, ale získali číslo
topánok. Vďaka úsiliu vedcov v labáku sa im tiež z nožíka podarilo zistiť, že dotyčný
je muž, fajčiar a žije vo vysokých nadmorských výškach. Čo presne mohlo byť na
nožíku a čo mohlo prezradiť tieto informácie? Prečo je ťažké získať z DNA viac
informácií bež možnosti porovnania (alebo nakoľko sa líši DNA medzi dvoma ľuďmi)?
1
Američania dostávajú rovnaké peniaze na každého agenta, a tak sa rozhodli, že pomôžu Slovensku a rozdiel
v platoch nezištne venujú výrobcovi luxusných jácht (aspoň tak vraví John)
Vďaka týmto informáciám a očitým svedkom, ktorí videli prichádzať taxík, sa našim
agentom podarilo cez taxislužbu vystopovať neznámu osobu až na letisko. Tu našli
len jeden let prichádzajúci vo vhodný čas z vhodného miesta – a ten bol zo
Švajčiarska! „Počúvaj, John, tu niečo nehraje... prečo by sa niekto trepal až sem,
pokiaľ chce kradnúť nejaké králičie kultúry, králikov musia mať aj tam...“ „Králikov
tam možno považujú za škodcov, veď vieš, zaberajú trávu tým ich fialovým kravám...“
Tento argument Petra nepresvedčil a už onedlho stáli pred riaditeľom ústavu
druhýkrát – akurát tentokrát na pôde kriminálky a do očí mu svietilo svetlo. „Je toto
naozaj nutné, páni?“ „Očividne si nám nepovedal všetko čo vieš, tak vyklop, čo je
také zvláštne na tých vzorkách?“ „Aha hej, produkujú ZloRII, na to som zabudol...
Tak či onak, bolo to v istej tlačovej správe, to nie je ako tajomstvo...“ Po chvíli,
v rámci ktorej ukecali riaditeľa aby ich nežaloval, stáli John a Peter pred dátami
o ZloRII a uvedomovali si, že toto je ich najväčší prípad vôbec.
3. Veľké prípady si vyžadujú veľkú opatrnosť a Peter sa teda rozhodol, že kľúčové
úseky DNA pre identifikáciu vraha si nielen namnoží, ale ešte aj uloží do vektoru. Na
to ale potrebuje špeciálny primér, ktorý bude tvoriť: 5’-dva ľubovoľné nukleotidy-šesť
špecifických nukleotidov na štiepenie (v tomto prípade GAATTC)-15 nukleotidov
komplementárnych k 3’ koncu DNA-3’. Najprv uvažoval len jedno vlákno, ktorého
posledná kľúčová sekvencia bola 5’-AAGAATTCTGAGTCA-3’. Pretože o dva prvé
nukleotidy priméru mu vôbec nešlo, rozhodol sa, že budú oba A. Je takýto primér
dobrou voľbou? Ak nie, prečo? Ako by sa dal v takom prípade vylepšiť?
Po tomto opatrení sa naši agenti vybrali na veľký výlet do Švajčiarska, kde nie
príliš vedecky založený John ustavične bľabotal čosi o tom, že za každým rohom
môže číhať čierna diera z urýchľovača. Peter bol už ale zvyknutý. Samozrejme si
vopred preklepli každého pasažiera letu, ale nepredpokladali, že by niekoho našli –
určite by necestoval pod pravým menom. Podarilo sa im ale zúžiť výber na pár ľudí
a postupne ich navštevovať, až kým im raz vo dverách neotvoril prisťahovalec, ktorý
im lámanou nemčinou oznámil, že nevie čo je to lietadlo – to bolo ono! Našťastie
platba na dané meno bola z bankového účtu a agenti si našli nadáciu, ktorej patrí.
4. Keď teda poznali miesto, potrebovali zistiť či je tam ich človek! Pod rúškom noci
sa vlámali dnu (cez nezamknuté zadné dvere) a odobrali náhodné vzorky DNA.
Nakoniec sa im ale nechcelo robiť poriadny porovnávací test, tak sa rozhodli vyriešiť
to po svojom. Vybrali si istý úsek DNA zo vzoriek a použili na neho postupne tri
endonukleázy – EcoRI, BamHI a PstI. Ďalej vedeli, že daný úsek vo vzorke zlodeja
obsahuje (ale nie je limitovaný na):
5’-CTAGCATCGACTAGCATCGGCATCGATCGACCTGCAGTGGCATCTAGCTACGC
GATCGACTGCAGATCGCTATACGATCGCTATGCTATCGGAATTCGCACTATCGT-3’
Následne si zistili počet rôznych fragmentov DNA vo vzorke. Takéto boli výsledky:
EcoRI
BamHI
PstI
Vzorka A
1
1
3
Vzorka B
2
2
3
Vzorka C
3
1
2
Vzorka D
2
2
1
Predpokladáme, že všetky sekvencie boli úplne rozštiepené. Dá sa z týchto vzoriek
vybrať nejaká, ktorá zodpovedá zlodejovi? Alebo ich je viac? Zdôvodnite.
Aj tieto výsledky našim agentom pomohli k zisteniu, že páchateľom by mal byť
človek s menovkou Šmidt na dverách. Na ďalšiu noc sa do nadácie vrátili (niekto tam
bol očividne veľmi lenivý zamykať tie dvere) a nasadili na neho plošticu. Do pár dní
mali dosť informácií na to, aby ho mohli zatknúť, aj keď väčšinou len nepriamych
(nadávky na bratislavských taxikárov a podobne), ale prokurátorovi to spolu s ich
ďalšími dôkazmi stačilo. John bol ako vždy teatrálny, ale kým dorecitoval svoje „You
have the right to remain silent...“ Peter už Šmidta odviedol z kancelárie.
5. Teraz mali k dispozícii normálnu vzorku Šmidtovej DNA, čerstvo odobratú. Hoci
sa zhodovala so vzorkou na nožíku v mnohých sledovaných faktoroch, v niektorých
sa líšila. DNA sa môže meniť a kvalita vzorky sa časom znižuje, ale chyby môžu
nastať aj pri delení buniek. Čo presne znamená pojem tautomér? Čo by mohlo stať,
ak by sa pri tvorení komplementárneho reťazca DNA nachádzala nejaká báza ako
svoj tautomér? (ovplyvnilo by to jej párovanie?) V skutočnosti sa takto vnesené
mutácie prenesú oveľa zriedkavejšie ako sa stávajú. Ako bunka kontroluje takéto
chyby?
Nakoniec sa im aj pomocou DNA podarilo Šmidta usvedčiť. Spolu so sebou stiahol
aj mnohých členov vedenia „nadácie“, ktorá bola odhalená ako tajná agentúra a v jej
podzemí nájdené rozsiahle biochemické laboratóriá. Bohužiaľ, kultúry sa už nenašli
(vraj ich omylom zjedol veľmi ospalý hladný doktorand), ale to už nebola ich chyba.
A tak, keď sa Johna na tlačovke spýtali, čo sa chystá robiť teraz, odpovedal: „Teraz
máme obaja pocit dobre vykonanej práce, ale nesmieme si dovoliť zaspať na
vavrínoch. Čochvíľa sa vrátime domov, kde už máme anonymné podanie na
prítomnosť gorilej DNA v parlamente.“
Korešpondenčný seminár z biológie 2011/2012
Úlohy tretieho kola, 7. ročník
Vydala Prírodovedecká fakulta UK, Mlynská dolina, 842 15 Bratislava 4
Autori:Jaroslav Ferenc, Silvia Hnátová, Ladislav Hovan, Zuzana Kochanová,
Zuzana Varadínová
Táto práca bola podporovaná Agentúrou na podporu výskumu a vývoja
na základe zmluvy č. LPP-0277-09.
http://bio.korsem.sk
Download

3.kolo - Korešpondenčný seminár z biológie