Univerzita Karlova v Praze
1. lékařská fakulta
Studium genetické predispozice ke vzniku
karcinomu prsu
Petra Kleiblová
Ústav biochemie a experimentální onkologie, 1. LF UK
- skupina molekulární biologie (doc. Pohlreich)
Ústav biologie a lékařské genetiky, 1. LF UK
Odd. biologie nádorové buňky, ÚMG AVČR
Karcinom prsu
 Nejčastější zhoubný nádor u žen
 Incidence > 120 / 100 000 žen / rok
 ~ 5-10% - dědičná forma C50
http://www.svod.cz/
Genetika dědičného karcinomu prsu
Analýza 963 rodin z Prahy a okolí (2000-2012)
„Bez mutace“
Vysoko-penetrantní
Geny se střední geny (BRCA1, BRCA2, p53,
PTEN, STK11)
penetrancí
(CHEK2, PALB2, ATM,
RAD51C, NBN,…)
Pohlreich P
Genetika dědičného karcinomu prsu
Analýza 963 rodin z Prahy a okolí (2000-2012)
„Bez mutace“
Vysoko-penetrantní
Geny se střední geny (BRCA1, BRCA2, p53,
PTEN, STK11)
penetrancí
(CHEK2, PALB2, ATM,
RAD51C, NBN,…)
Pohlreich P
Genetika dědičného karcinomu prsu
Analýza 963 rodin z Prahy a okolí (2000-2012)
Negativní
Vysoko-penetrantní
Geny se střední geny (BRCA1, BRCA2, p53,
PTEN, STK11)
penetrancí
(CHEK2, PALB2, ATM,
RAD51C, NBN,…)
Genetika dědičného karcinomu prsu
Necharakterizované predispoziční varianty
Privátní mutace v genech s vysokou
penetrancí („BRCAX“)
Doposud necharakterizované variace v
genech se střední penetrancí (kandidátní geny)
Doposud necharakterizované kombinace
variant v genech s nízkou penetrancí
Genetika dědičného karcinomu prsu
Necharakterizované predispoziční varianty
Privátní mutace v genech s vysokou
penetrancí („BRCAX“)
Doposud necharakterizované variace v
genech se střední penetrancí (kandidátní geny)
Doposud necharakterizované kombinace
variant v genech s nízkou penetrancí
Genetika dědičného karcinomu prsu
Analýza predispozičních variant
 GWAS (celogenomové asociační studie)
 HTS (high throughput sequencing)
 Mutační analýza genů kódujících proteiny v
společných cestách
Genetika dědičného karcinomu prsu
Analýza predispozičních variant
 GWAS (celogenomové asociační studie)
 HTS (high throughput sequencing)
 Mutační analýza genů kódujících proteiny v
společných cestách
Genetika dědičného karcinomu prsu
Geny pro DNA-reparační proteiny v predispozici ke vzniku
karcinomu prsu
-H2AX P
P 53BP1 BRIP1 MRE11
ATM
RAD50
BRCA1
P
Nbs1
P
P
P
Chk2
P BRCA2
PALB2 RAD51
P P
P
p53 CDC25A CDC25C
Regulace buněčného cyklu
Apoptóza
Reparace DNA
(reparace DDSB)
DNA
Genetika dědičného karcinomu prsu
Geny pro DNA-reparační proteiny v predispozici ke vzniku
karcinomu prsu
-H2AX P
P 53BP1 BRIP1 MRE11
ATM
RAD50
BRCA1
P
Nbs1
P
P
WIP1
P
Chk2
P BRCA2
PALB2 RAD51
P P
P
p53 CDC25A CDC25C
Regulace buněčného cyklu
Apoptóza
Reparace DNA
(reparace DDSB)
DNA
Mutační analýza genu PPM1D (WIP1)
WIP1
 Gen PPM1D lokalizován na 17q23.2
 Monomerní serin-threoninová fosfatáza
 Defosforylace proteinů zapojených do reparace DNA
(včetně ATM, CHEK1/2, -H2AX a p53)
 Amplifikace lokusu 17q23 v p53 wt nádorech
Mutační analýza genu PPM1D (WIP1)
Populace pacientů
 330 BRCA1/2 wt HBC/HBOC – primární soubor
 398 BRCA1/2 wt HBC/HBOC – konfirmační soubor
 450 kontrol bez onkologického onemocnění
 panel p53 wt buněčných linií
 304 pacientů s neselektovaným C18 – C20
Mutační analýza genu PPM1D (WIP1)
Mutační analýza
 gen PPM1D (6 exonů; amplifikace v 8 fragmentech)
 e2-6 – HRM analýza
 e1 + susp. HRM vzorky – PCR + přímé sekvenování
Mutační analýza genu PPM1D (WIP1)
Mutační analýza PPM1D v buněčných liniích
U2OS: c.1372C>T (p.R458X)
WT-GAGATAGCTCGAGAGAAT
Mut-......... T........
WT/p.E
Mut/p.E
I
I
A
A
R E
X458 -
N
-
HCT116: c.1349delT (p.L450X)
WT-AGAATTTTTTAGAGGTTT
Mut-.........AGAGGTTTC
WT/p.N
Mut/p.N
F
F
L E
X450 -
V
-
S
-
Mutační analýza genu PPM1D (WIP1)
Výsledky pacienti
Kleiblova et al. J Cell Biol 2013
Mutační analýza genu PPM1D (WIP1)
Výsledky pacienti
Kleiblova et al. J Cell Biol 2013
Mutační analýza genu PPM1D (WIP1)
Výsledky pacienti
#BRCA380: c.1601_1615del (p.F534X)
WT-AACTTTAAAAGGACATTAGAAGAG
Mut-.... AAGAGTCCAATTCTGGCCCC
#CRC32: c.1372C>T (p.R458X)
WT-GAGATAGCTCGAGAGAAT
Mut- .........T ........
WT/p.N
Mut/p.N
WT/p.E
Mut/p.E
F K
X534 -
R
-
T
-
L
-
E
-
E
-
#BRCA1855: c.1451T>G (p.L484X)
WT-AGCCCTGACTTTAAGGAT
Mut-...........G......
WT/p. A
Mut/p. A
L
L
T
T
L R
X484 -
I
-
I
I
A
A
R E
X458 -
N
-
#CRC145: c.1602dupT (p.K535X)
WT-AACTTTAAAAGGACATTA
Mut-...... TAAAAGGACATT
WT/p.N
Mut/p.N
F
F
K R
X 535 -
T
-
L
-
Mutační analýza genu PPM1D (WIP1)
Výsledky pacienti
#BRCA1855: c.1451T>G (p.L484X)
WT-AGCCCTGACTTTAAGGAT
Mut-...........G......
WT/p. A
Mut/p. A
L
L
T
T
L R
X484 -
I
-
Mutační analýza genu PPM1D (WIP1)
Výsledky pacienti
0%
10%
20%
30%
40%
WT
50%
Het
Mozaicismus?
#BRCA1855: c.1451T>G (p.L484X)
WT-AGCCCTGACTTTAAGGAT
Mut-...........G......
WT/p. A
Mut/p. A
L
L
T
T
L R
X484 -
I
-
60%
70%
80%
90%
100%
Mut
Mutační analýza genu PPM1D (WIP1)
Výsledky pacienti
0%
10%
20%
30%
40%
WT
50%
60%
70%
80%
90%
Het
Mozaicismus!
#BRCA1855: c.1451T>G (p.L484X)
WT-AGCCCTGACTTTAAGGAT
Mut-...........G......
100%
Mut
nenádorová mamární tkáň
WT-AGCCCTGACTTTAAGGATACATGA
Mut- ...........G ............
karcinom prsu
WT-AGCCCTGACTTTAAGGATACATGA
Mut- ...........G ............
WT/p. A
Mut/p. A
L
L
T
T
L R
X484 -
I
-
Význam mutací genu PPM1D (WIP1)
 Trunkační mutace postihují výlučně oblast exonu 6
1
2
3
4
5
Ruark et al. Nature 2013
6
1
2
3
4
5
6
Kleiblova et al. J Cell Biol 2013
Význam mutací genu PPM1D (WIP1)
 Trunkační mutace postihují výlučně oblast exonu 6
1
2
3
4
5
6
Ruark et al. Nature 2013
1
2
3
4
5
6
Kleiblova et al. J Cell Biol 2013
 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116)
U2OS:
WT-GAGATAGCTCGAGAGAAT
WT-GAGATAGCTCGAGAGAAT
#CRC32:
Mut-......... T ........
Mut- .........T ........
c.1372C>T
(p.R458X)
Kleiblova et al. J Cell Biol 2013
Zajkowicz et al. Mol Biol Rep 2013
Význam mutací genu PPM1D (WIP1)
 Trunkační mutace postihují výlučně oblast exonu 6
 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116)
 Trunkační mutace: „gain-of-function“ alterace
-
> biologický poločas WIP1 (in vitro)
- funkční inaktivace p53 (ztráta G1-S kontrolního bodu)
- zvýšená tolerance poškození DNA (?)
- kancerogeneze (?)
Kleiblova et al. J Cell Biol 2013
Význam mutací genu PPM1D (WIP1)
 Trunkační mutace postihují výlučně oblast exonu 6
 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116)
 Trunkační mutace: „gain-of-function“ alterace
-
> biologický poločas WIP1 (in vitro)
- funkční inaktivace p53 (ztráta G1-S kontrolního bodu)
- zvýšená tolerance poškození DNA (?)
- kancerogeneze (?)
 U pacientů se tyto mutace vyskytují jako mozaiky
Ruark et al. Nature 2013; Kleiblova et al. J Cell Biol 2013
Význam mutací genu PPM1D (WIP1)
 Trunkační mutace postihují výlučně oblast exonu 6
 U pacientů (C18 & C50) i ve stabilních liniích (U2OS, HCT116)
 Trunkační mutace: „gain-of-function“ alterace
-
> biologický poločas WIP1 (in vitro)
- funkční inaktivace p53 (ztráta G1-S kontrolního bodu)
- zvýšená tolerance poškození DNA (?)
- kancerogeneze (?)
 U pacientů se tyto mutace vyskytují jako mozaiky
-
Způsob vzniku?
Přenos na další generace?
Klinický význam ?
Ruark et al. Nature 2013; Kleiblova et al. J Cell Biol 2013
Význam mutací genu PPM1D (WIP1)
Nejasný mechanizmus a penetrance
Negativní
Geny se střední
penetrancí
Geny s vysokou
penetrancí
Poděkování
Ústav biochemie a exp.
onkologie, 1. LF UK
Odd. biologie nádorové
buňky, ÚMG AVČR
- Jan Ševčík
- Libor Macůrek
- Petr Pohlreich
- Jan Benada
- Zdeněk Kleibl
- Soňa Pecháčková
Ústav patologie, 1. LF UK
- Jiří Bártek
- Pavel Dundr
The Netherlands Cancer Institute
- Indra A. Shaltiel
- Emile E. Voest
- René H. Medema
Grant IGA MZ ČR: NT13343-4
Download

Studium genetické predispozice ke vzniku karcinomu prsu