Универзитет “Св. Кирил и Методиј” Скопје
ФАРМАЦЕВТСКИ ФАКУЛТЕТ МОЛЕКУЛАРНА БИОЛОГИЈА
СО ГЕНЕТИКА - практична настава - Ас. Надица Матевска
Ас. Александра Грозданова
Скопје, 2010 година BLOK 1
НУКЛЕИНСКИ КИСЕЛИНИ
ВЕЖБА БР:1 Изолација на геномска ДНК
ВЕЖБА БР:2 Изолација на вкупна РНК
ВЕЖБА БР:3 Определување на концентрација и интактност на
нуклеински киселини
Nukleinskite kiselini se javuvaat vo dve formi, dezoksiribonukleinska
kiselina (DNK) i ribonukleinska kiselina (RNK). Primarno nivnata funkcija
opfa}a skladirawe i prenesuvawe na genetskite informacii, no mo`at da imaat i
drugi strukturni i kataliti~ki ulogi.
Nukleinskite kiselini pretstavuvaat linearni, nerazgraneti makromolekuli od
dolgi nizi (verigi) na monomeri nare~eni nukleotidi. Sekoj nukleotid e sostaven od
tri dela: (1) {e}er so pet jaglerodni atomi (pentoza), (2) heterocikli~na azotna baza i
(3) negativno naelektizirana fosfatna grupa, odgovorna za kiselite svojstva. [e}erot
i azotnata baza zaedno formiraat nukleozid, poradi {to nukleotidite se poznati i
kako nukleozidni monofosfati. Azotnata baza e povrzana so 1’, a fosfatot so 5’
jaglerodot od {e}erot. Za vreme na sostavuvaweto na veriga od nukleinska kiselina,
hidroksilnata grupa prika~ena za 3’ jaglerodot od {e}erot na eden nukleotid se
povrzuva so esterska vrska za fosfatnata grupa prika~ena za 5’ jaglerodot od
naredniot nukleotid vo verigata. Na toj na~in nukleotidite od edna veriga na DNK
(ili RNK) se povrzani so 3’-5’ fosfodiesterska vrski bidej}i fosfatniot atom e
esterificiran so dva kislorodni atomi, po eden od dvata soedineti {e}eri (слика 1).
Imeto na nukleinskite kiselini poteknuva od {e}erot koj vleguva vo nivnata
struktura, RNK sodr`i β-D-riboza, dodeka DNK sodr`i 2-dezoksi-β-D-riboza kojа se
razlikuva so otsustvo na kislorod na 2’jaglerodot. Veriga od DNK (ili RNK) sodr`i
~etiri razli~ni tipovi na nukleotidi koi se razlikuvaat po nivnata azotna baza. Vo
nukleinskite kiselini ima dva tipa na bazi: pirimidini i purini. Pirimidinite se
pomali molekuli sostaveni od eden prsten; purinite se pogolemi, sostaveni od dva
prsteni. RNK-ite imaat dva razli~ni purini, adenin i gvanin kako i dva razli~ni
pirimidini, citozin i uracil. Vo DNK, uracilot e zamenet so timin, pirimidin so
dopolnitelna metil grupa povrzana za prstenot za jaglerodot vo polo`ba 5.
Azotnite bazi formiraat vodorodni vrski na visokospecifi~en na~in. Azotnite
atomi vrzani za jaglerod 4 od citozin i jaglerod 6 od adenin se prete`no vo amino (NH2)
konfiguracija namesto vo imino (NH) forma. Na sli~en na~in, kislorodnite atomi
vrzani za jaglerod 6 od gvanin i jaglerod 4 od timin se prete`no vo keto (S = O)
konfiguracija namesto vo enol (S-ON) forma. Ovie strukturalni restrikcii na
konfiguraciite od bazite sugeriraat deka adeninot e edinstveniot purin koj e
2 strukturalno sposoben da se vrzuva so timin i deka gvaninot e edinstveniot purin koj e
sposoben da se vrzuva so citozin. Imeno purinite se komplementarni samo so
pirimidinite, pirimidin-pirimidin parovite se energetski nestabilni poradi toa
{to molekulite se mnogu oddale~eni edna od druga za da se formira stabilna
vodorodna vrska, dodeka pak purin-purin parovite se mnogu blisku poradi {to doa|a do
nivno odbivawe. Sparuvaweto pome|u A-C i G-T se slu~uva poradi postoeweto na
komplementarnost me|u vodorod donornite i akceptornite mesta. Zatoa, edinstveni
mo`ni parovi se A-T i A- U (povrzani so 2 vodorodni vrski) i G-C (povrzani so 3
vodorodni vrski), koi odli~no se sovpa|aat vo nivnata geometrija. Poretko, kaj RNK,
se slu~uva sparuvawe pome|u G i U, so dve vodorodni vrski.
Molekulata na DNK e sostavena od dve komplementarni verigi od nukleotidi,
spiralno izvitkani edna okolu druga za da formiraat par od heliksi koi se
orientirani kon desno. Molekulata na RNK e sostaven od samo edna veriga na
nukleotidi, me|utoa taa mo`e da se izvitka okolu sebe i da formira komlementarni
bazni parovi za da napravi unikatna sekundarna struktura. Dvete verigi od koi e
sostaven eden dvoen heliks se dvi`at vo sprotivni nasoki; t.e. tie se antiparalelni.
Na toj na~in, ako ednata veriga e naso~ena vo 5’ → 3’ pravec, nejziniot partner mora da
bide naso~en vo 3’ → 5’ pravec. [e}er-fosfat -‘rbetot od sekoja ni{ka e lociran na
nadvore{nata strana od molekulata. Fosfatnite grupi i davaat na molekulata golem
negativen polne`. Ova ja pravi molekulata na DNK polarna, a so toa i rastvorliva vo
voda. Azotnite bazi se protegaat kon centarot i se postaveni normalno na nadol`nata
oska na molekulata, poradi {to na molekulata i davaat izgled na spiralni skali (слика
2а). Osven vodorodni vrski, pome|u azotnite bazi postojat i Van der Valsovi sili i
hidrofobni interakcii so {to se obezbeduva stabilnost za celata DNK molekula.
Dvojniot heliks pravi edno celosno svrtuvawe na sekoi 10 rezidui (3.4
nm).
Prostorite me|u sosedni svrtuvawa na heliksot formiraat dva `leba so razli~na
{iro~ina – po{irok golem `leb i potesen mal `leb – koi se izvitkuvaat okolu
nadvore{nata povr{ina od dvojniot heliks. Proteinite koi se vrzuvaat za DNK
~estopati sodr`at domeni koi se smestuvaat vo ovie `lebovi.
Naru{uvaweto na sekundarnata struktura na DNK koe nastanuva poradi
raskinuvawe na vodorodnite vrski me|u komplementarnite bazi se narekuva
denaturacija. Spored toa denaturiranata DNK e ednoveri`na. Procesot e
reverzibilen, pri {to rekonstrukcijata na heliksot se narekuva renaturacija. Ovie
procesi se odvivaat i vo fiziolo{ki uslovi za vreme na replikacija i transkripcija (слика 2б,в,г). Vo laboratoriski uslovi, denaturacijata nastanuva na visoka
temperatura (>75°S), vo bazna sredina ili vo prisustvo na odredeni agensi, na pr. urea.
Temperaturata na koja polovina od heliksite na DNK se denaturirani se narekuva
to~ka na topewe (Tm). To~kata na topewe zavisi od dol`inata i specifi~nata
nukleotidna sekvenca na molekulata. Segmentite na DNK so pove}e G-C parovi
(odnosno so visoka GC sodr`ina) pote{ko se denaturiraat poradi toa {to pome|u niv
postojat 3 vodorodni vrski, pa poradi toa imaat povisoka to~ka na topewe. 3 слика 1
4 слика 2
5 ВЕЖБА БР: 1
ИЗОЛАЦИЈА НА ГЕНОМСКА ДНК
Postojat nekolku metodi koi mo`at da se koristat za izolacija na DNK od
razli~ni biolo{ki materijali, kakona pr. polna krv, razli~ni vidovi na tkiva,
plunka, urina, kulturi, formalin fiksirani parafinski oblo`eni tkiva.
Ekstrakcijata na DNK od kletkite se izveduva po nivno razoruvawe, a se bazira na
razli~nite karakteristiki koi gi imaat DNK, proteinite i ostanatite konstituensi.
Standardnata postapka se odviva preku digestija na kletkite so proteinaza K vo
prisustvo na metalen helator (EDTA) i detergent kako SDS (natrium dodecil sulfat),
po {to sledi te~no-te~na ekstrakcija na rastvorot na DNK so fenol i precipitacija
so alkohol. So ovaa postapka se dobiva golem prinos na DNK so golemina od 100-150kb
koja e adekvatna za ponatamo{ni analizi kako polimeraza veri`na reakcija,
sekvencionirawe itn.
Novite tehniki na izolacija na DNK se baziraat na cvrsto-fazna ekstrakcija
(SPE - solid phase extraction). Metodot upotrebuva koloni ispolneti so silika (ili nekoja
druga cvrsta faza) koja selektivno gi vrzuva (adsorbira) nukleinskite kiselini (DNK
ili RNK) vo zavisnost od pH sredinata i koncentracijata na soli vo puferot. Ovie
koloni kako i site puferi koi se potrebni za izveduvawe na postapkata doa|aat vo
oblik na komercijalni kitovi, a izolacijata na DNK se izveduva spored instukciite na
proizvoditelot. Prednosta na ovie kitovi se sostoi od toa {to, za razlika od
standardnata postapka, celiot proces na DNK izolacija da se odviva mnogu polesno i
pobrzo, no, osven visokata cena kako nedostatoci se i pomaliot prinos na DNK i
nepoznavawe na to~niot sostav na puferite koi se vklu~eni, {to go pravi pote{ko
spravuvaweto so problemite dokolku se javat. Generalno site kitovi za izolacija na
DNK vklu~uvaat nekolku ~ekori:
1. Liza: puferite za lizirawe mo`at da imaat razli~en sostav, no sekoga{
sodr`at a) visoka koncentracija na nekoj haotropen agens (na pr. gvanidin
hidrohlorid, gvanidin tiocijanat, urea, litium perhlorat) koi gi denaturiraat
proteinite preku destabilizirawe na vodorodnite vrski, Van der Valsovite sili i
hidrofobnite interakcii; b) detergenti koi pomagaat vo solubilizacijata na
proteinite; v) enzimi, na pr. proteinaza K.
2. Vrzuvawe: osven {to se zna~ajni za lizata, haotropnite soli poradi toa {to ja
namaluvaat asocijacijata na DNK so molekulite na vodata so {to se obezbeduvaat
uslovi za vrzuvawe na DNK za matriksot od silika. Naj~esto vo ovoj ~ekor se dodava
apsoluten etanol, koj isto taka go olesnuva vrzuvaweto.
3. Miewe na kolonata: naj~esto se izveduvaat dve posledovatelni miewa so dva
razli~ni puferi. Prviot obi~no sodr`i nekoj denaturira~ki agens, so cel da se
odstranat proteinite koi se adsorbirale na kolonata. Vtoriot pufer obi~no ima
visoka koncentracija na etanol, so cel da se odstranat solite.
4. Elucija na DNK: obi~no se koristat puferi so pH pome|u 8-9, so cel da se
zgolemi rastvorlivosta i stabilnosta na elurianata DNK. 6 ZADA^A 1: IZOLIRAJ GENOMSKA DNK OD POLNA KRV SO
STANDARDNA FENOL-HLOROFORMSKA POSTAPKA
1.1. Prigotvuvawe na potrebnite rastvori
Hemiskite supstancii isto kako i vodata potrebna za spremawe na rastvorite koi
se koristat za izolirawe na genomska DNK treba da bidat so najvisok kvalitet.
Rastvor 1:
1x RBLB (Lizira~ki rastvor)
Rastvorot se prigotvuva kako 10 pati pokoncentriran rastvor za ~uvawe (10x RBLB) koj
e stabilen podolgo vreme na +4°S. Ovoj rastvor pred upotreba se razreduva do
rabotnata koncentracija (1x RBLB) so voda so HPLC ~istota.
10x RBLB
NH4Cl
NH4HCO3
0.5 M EDTA pH 7.4
H2O (HPLC ~istota)
Rastvor 2:
finalna koncentracija
1.55 M
0.1 M
1 mM
potrebna masa za 1l rastvor
82.91 g
7.91 g
2 ml
do 1000 ml
finalna koncentracija
0.1 M
0.05 M
1 mM
potrebna masa za 1l rastvor
5,84 g
6,06 g
0,37 g
do 1000 ml
STE rastvor
STE rastvor
NaCl
Tris
EDTA
H2O (HPLC ~istota)
pH на растворот треба да биде 7.4, што се подесува со додавање на HCl. Готовиот раствор се
стерилизира со автоклавирање и се чува на 4°C.
Rastvor 3:
Fenol zasiten so Tris pH 8
Vo vodena bawa zagreana na 65°C se rastopuva 1kg fenol. Vo rastopeniot fenol se
dodava 1g 8-hidroksikvinolin so cel da se spre~i negovata oksidacija. Rastopeniot
fenol se prefrla vo ~a{a, se dodava ednakov volumen (1L) na 1M Tris i se me{a na
magnetna me{alka 30 minuti. Po prekin na me{aweto i izdvojuvawe na dvata sloja, se
aspirira gorniot voden sloj. Postapkata se povtoruva u{te edna{ so 1 M Tris i u{te
dva pati so 0,1 M Tris. Pri poslednoto aspirirawe, vodenata faza ne se odstranuva vo
celost (obi~no se ostava okolu 1cm). Se proveruva pH vrednosta (treba da e 7.5-8.0).
Zasiteniot fenol se ~uva na 4 °C, vo temno {i{e.
7 Rastvor 4:
TE pufer
TE pufer
Tris
EDTA
H2O (HPLC ~istota)
finalna koncentracija
10 mM
1 mM
potrebna masa za 0.1l
rastvor
0.12 g
0.037 g
do 100 ml
pH на растворот треба да биде 7.4, што се подесува со додавање на HCl. Готовиот раствор се
стерилизира со автоклавирање и се чува на 4°C.
1.2. Protokol za rabota
Primerokot na krv (3 ml) se dobiva so vnimatelna venepunkcija koristej}i
vakumizirana epruveta koja sodr`i antikoagulans (EDTA). So obrabotka na
primerokot se zapo~nuva u{te istiot den (vo slu~aj koga izolacijata na DNK mora da
se odlo`i, primerokot se ~uva na 4°S).
^ekor 1: Izdvojuvawe na leukociti od periferna krv so lizirawe na
eritrocitite
1. Primerokot se centrifugira (3000rpm, 5min, 4ºC) po
{to plazmata se oдstranuva, a kleto~nite komponenti se
prefrlaat vo plasti~na epruveta od 10 ml (слика 1). 2. Epruvetata se dopolnuva so fiziolo{ki rastvor (0.9%
NaCl), se me{a so inverzija nekolku pati i se
centrifugira (3000rpm, 5min, 4ºC) po {to supernatantot,
koj treba da e bistar, se odstranuva so pasterova pipeta (слика 2). Vo slu~aj da se pojavila spontana hemoliza
(naj~esto poradi podolgo ~uvawe na primerokot na 4°S),
promivaweto na kletkite so fiziolo{ki rastvor se
povtoruva u{te 1-2 pati. слика 1
слика 2
3. Epruvetata se dopolnuva so sve`o prigotven 1xRBLB rastvor i inkubira
(20min, 4ºC) so povremeno prome{uvawe. Za ova vreme eritrocitite se
liziraat, poradi {to rastvorot dobiva temno-crvena lakirana boja.
4. Po centrifugiraweto (3000rpm, 5min, 4ºC) vo sedimentot e vidliv bel
talog koj gi sodr`i leukocitite (слика 3). Supernatantot se odstranuva so
pasterova pipeta, vnimatelno da ne dojde do aspirirawe na leukocitite. Vo
slu~aj da liziraweto e necelosno (vidliv crven prsten vo talogot),
~ekorite 1.3 i 1.4 se povtoruvaat u{te edna{.
слика 3
8 ^ekor 2: Digestija na leukocitite so proteinaza K
1. Леукоцитите се ресуспендираат во 2,5 ml STE раствор со енергично мешање.
2. Се додава 125 μl 10% SDS (natrium dodecil sulfat) и 30 μl (20 mg/ml)
Proteinaza K и ne`no se me{a со инверзија на епруветата (слика 4).
3. Smesata se инкубира na 37 ºC preku no}. Следното утро растворот треба да
биде вискозен bez vidlivi ostatoci od kletki.
слика 4
^ekor 3: Fenol-hloroformska ekstrakcija
1. Vo epruvetata se dodava ednakov volumen (2.5 ml) na fenol zasiten so Tris
(pH 8). Epruvetata ne`no se me{a okolu 5 minuti. Bidej}i DNK e polarna
molekula, ne se rastvara vo fenolot i ostanuva vo vodenata faza. Nasproti
toa, fenolot gi denaturira proteinite pri {to nivnite hidrofobni delovi
(koi vo nativniot protein se orientirani kon vnatre) se izlo`uvaat na
nivnata povr{ina. Kako posledica na ova tie preminuvaat vo organskata
faza.
2. Primerokot se centrifugira (3000 rpm, 5 min, 4ºC) pri {to doa|a do
odvojuvawe na dvete fazi. Vodenata faza (gorna) vnimatelno se odvojuva so
pasterova pipeta i se prefrla vo ~ista epruveta. слика 5 3. Vo epruvetata se dodava ednakov volumen (2.5 ml) na smesa hloroform :
izoamilalkohol vo odnos 24:1 (izoamilalkoholot se dodava za stabilizacija
na hloroformot koj vo prisustvo na kislorod spontano se raspa|a do
fozgen) i ne`no se me{a okolu 5 minuti. I vo ovoj slu~aj DNK ostanuva vo
vodenata faza. Preostanatite proteini i lipidite se rastvaraat vo
hloroformot i preminuvaat vo organskata faza.
4. Primerokot se centrifugira (3000 rpm, 5 min, 4ºC) po {to vodenata faza
(gorna) vnimatelno se odvojuva so pasterova pipeta i se prefrla vo ~ist
erlenmaer.
slika 6
^ekor 4: Precipitacija na DNK so apsoluten etanol
1. Na vodenata faza od prethodniot ~ekor, vnimatelno po yid
ovite na erlenmaerot, se dodava laden apsoluten etanol, pri
{to DNK vedna{ po~nuva da precipitira vo oblik na konci.
Ova se slu~uva poradi toa {to etanolot ima pomala
dielektri~na konstanta od vodata, {to im ovozmo`uva na Na+
jonite koi se prisutni vo puferot da go neutraliziraat
negativniot polne` na DNK (koj poteknuva od PO3–) so {to se
gubi nejzinata hidrofilnost. So me{awe na erlenmaerot so
kru`ni dvi`ewa precipitiranata DNK se nasobira i izdignuva
kon povr{inata na te~nosta. Vnimatelno, so pasterova pipet,
izoliranata DNK se prefrla vo tubi~ka od 1.5 ml.
slika 7
9 2. Vo tubi~kata se dodava 1 ml 70% etanol, se prome{uva nekolku pati i se
centrifugira (12000 rpm, 2 min, sobna temperatura). Izoliranata DNK sega e vo oblik
na bel talog, etanolot se odvojuva so dekantacija. Ovoj ~ekor na promivawe
(odstranuvawe na rezidualnite soli) se povtoruva u{te edna{.
3. Poradi toa {to etanolot mo`e da gi inhibira ponatamo{nite analizi, po vtoroto
miewe tubi~kata se ostava otvorena na sobna temperatura so cel toj celosno da ispari.
Pri toa treba da se vnimava da ne dojde do presu{uvawe na talogot od DNA bidej}i toa
}e ja namali nejzinata rastvorlivost.
^ekor 5: Rastvorawe na izoliranata DNK
1. Dobienata DNK mo`e da se rastvori vo voda ili TE pufer. Volumenot na dodadeniot
rastvoruva~ zavisi od koli~inata na dobienata DNK, obi~no se dodava 350-500 μl. Za
potpolno rastvorawe na DNK tubi~kata se inkubira preku no} na 37°C. Zabele{ka: Pri nisko pH mo`e da dojde do depurinacija na DNK. Kiselosta na vodata
mo`e da varira vo pH interval od 5-8.5, a pokraj toa vodata mo`e da sodr`i i metali
koi ja zabrzuvaat ovaa reakcija. Poradi ova DNK koja e rastvorena vo voda se ~uva na 20°C i pokratko vreme. So rastvorawe vo TE pufer se obezbeduva neutralna sredina, a
prisutnata EDTA gi helira metalite vo tragovi. So ogled na toa {to se naogaat vo
mali koncentracii, nitu edna od komponentite na TE puferot ne pre~i vo
ponatamo{nite ispituvawa, a rastvorot na DNK e stabilen podolgo vreme i mo`e da se
~uva na temperatura od 4°C.
ZADA^A 2: IZOLIRAJ GENOMSKA DNK OD POLNA KRV SO
CVRSTO-TE^NA EKSTRAKCIJA
Izolacijata se izveduva so upotreba na GenEluteTM Mammalian Genomic DNA
Miniprep Kit, spored protokolot na proizvoditelot (Sigma-Aldrich).
data:
osvoeni bodovi:
asistent:
10 ВЕЖБА БР: 2
ИЗОЛАЦИЈА НА ВКУПНА РНК
Dobivaweto na kvalitetna, intaktna RNK e prviot, i naj~esto kriti~niot, ~ekor
pri izveduvaweto na mnogu razli~ni analizi vo humanata genetika. Od najgolem
interes e informacionata (mesinxer) RNK (mRNK) bidej}i taa pretstavuva prepis na
protein-kodira~kite sekvenci od DNK. Ovoj tip na RNK ~ini samo 1-3% od
primerocite na izolirana vkupna (totalna) RNK. Malata sodr`ina i golemata
nestabilnost na molekulata vo golema mera ja ote`nuvaat postapkata na izolacija.
Imeno, degradacijata na RNK se javuva poradi dve pri~ini:
1. Ribonukleazite (RNAzi) se mnogu aktivni i isklu~itelno stabilni enzimi koi
mnogu te{ko se inaktiviraat (vklu~itelno i so avtoklavirawe). Pokraj endogenite
RNAzi koi se osloboduvaat po razoruvaweto na kletkite od koi se izolira RNK,
nastanuva i kontaminacija so egzogeni RNAzi koja poteknuva od dlankite i bakteriite
od vozduhot.
2. RNK i samata e fragilna molekula. Za razlika od DNK, taa ima pomala
termodinami~ka stabilnost poradi prisustvoto na 2’– ON grupa na ribozata koja vr{i
hidrofilen napad na 5’-3’fosfodiesterskata vska pri {to se dobiva 2’-3’cikli~en
fostat. Hidrolizata se zabrzuva na povisoka temeratura i pH i prisustvo na Mg2+ joni
koi go stabiliziraat fosfatniot intermedier.
Poradi ova, izolacijata treba da se izveduva vo posebna prostorija ili
alternativno vo del od laboratorijata koj e namenet za taa cel, a vo tekot na
procedurata treba da se nosat rakavici i da se izbegnuva dopirawe na povr{ini koi
najverojatno se kontaminirani so RNAzi (kako na pr. ra~ki od fri`ider). Site
laboratoriski sadovi dokolku se za pove}ekratna upotreba treba da tretirani so 0.1 M
NaOH; 3% H2O2 ili apsoluten etanol i potoa obilno isprani so DEPC (dietil
pirokarbonat) tretirana voda.
Postapkite za izolacija na RNK opfa}aat nekolku ~ekori: razoruvawe na
kletkite i tkivata so efektivna denaturacija na nukleoproteinskite kompleksi i
purifikacija na RNK od proteinite i DNK, koe mo`e da se izvr{i so te~no-te~na ili
te~no-cvrsta ekstrakcija.
ZADA^A 1: IZOLIRAJ RNK OD PERIFERNA KRV SO UPOTREBA NA
RASTVOR D
1.1. Prigotvuvawe na potrebnite rastvori
Hemiskite supstancii isto kako i vodata potrebna za spremawe na rastvorite koi
se koristat za izolirawe na RNK treba da bidat so najvisok kvalitet i da ne sodr`at
RNAzi.
11 Rastvor 1:
Rastvor D
Sol. D
gvanidin tiocijanat
1M natrium citrat
10% sarkozil
2-merkaptoetanol
voda
finalna koncentracija
4M
25 mM
0.5 %
0.1 M
potrebna masa za 0.1l
rastvor
47.26 g
2.5 ml
5 ml
720 μl
do 100 ml
Rastvorot mo`e da se prigotvi i ~uva podolgo vreme na 4°C, me|utoa 2merkaptoetanolot se dodava ex tempore.
DEPC tretirana voda
Dietil pirokarbonatot reagira so amino, hidroksi i tiol grupite na proteinite i na
toj na~in gi inaktivira RNAzite. Voobi~aeno tretmanot vklu~uva dodavawe na DEPC
(do 0.1% v/v) vo vodata (koja se koristi ja izrabotka na rastvori ili pak za promivawe
na laboratoriskiot pribor) i inkubirawe na 37°C preku no}. Naredniot den DEPC se
inaktivira so avtoklavirawe (15 minuti).
1.2. Protokol za rabota
Primerokot na krv (3 ml) se dobiva so vnimatelna venepunkcija koristej}i
vakumizirana epruveta koja sodr`i antikoagulans (EDTA). So obrabotka na
primerokot se zapo~nuva u{te istiot den (~uvawe na primerokot na 4°S vo golema mera
go namaluva prinosot na RNK).
^ekor 1: Izdvojuvawe na leukociti od periferna krv
Ovoj ~ekor mo`e da se izvede so
lizirawe na eritrocitite na identi~en
na~in kako vo postapkata za izolacija na
DNK (od ve`ba br.1). Alternativno,
polimorfonuklearnite leukociti mo`at da
se izdvojat od ostanatite komponenti na
krvta preku centrifugirawe so gradient na
gustina. Vo ovoj slu~aj, 3 ml na krv
razredena vo odnos 1:1 so voda se nanesuvaat
vrz 1 ml na fikol (Histopaque-1077, SigmaAldrich). Pri toa, se vnimava da ne dojde do
me{awe na sloevite. Epruvetite se
centrifugiraat 30 minuti na 4°S, 1200rpm,
po {to polimorfonuklearnite leukociti
slika 1
12 se rasporeduvaat vo oblik na prsten nad slojot od fikol koj gi razdvojuva od ostanatite
kleto~ni komponenti (slika1). Leukocitite se aspiriraat vnimatelno so pasterova
pipeta, se prefrlaat vo plasti~na epruveta od 10ml, se promivaat so fiziolo{ki
rastvor i centrifugiraat 5 minuti na 4°S, 3000rpm.
^ekor 2: Liza na leukocitite so rastvor D
1. Fiziolo{kiot rastvor se odstranuva so dekantacija, se dodava 500 μl rastvor D i
rastvorot se homogenizira so energi~no pipetirawe. Dokolku rastvorot e premnogu
viskozen se dodava u{te od rastvor D (maksimum do 1ml) i se prodol`uva so
homogenizirawe.
Gvanidin tiocijanatot pretstavuva silen haotropen agens koj gi denaturira
proteinite preku destabilizirawe na vodorodnite vrski, Van der Valsovite sili i
hidrofobnite interakcii, dodeka β-merkapto etanolot (βME) gi reducira
disulfidnite vrski. Osven toa {to ovozmo`uvaat liza na kletkite, tie se zna~ajni i
poradi toa {to vr{at inaktivacija na prisutnite endogeni ribonukleazi.
2. Ratvorot se inkubira 5 minuti na sobna temperatura, so {to se ovozmo`uva celosna
disocijacija na nukleoproteinite.
^ekor 3: Kisela fenol-hloroformska ekstrakcija
1. Vo tubi~ka od 1.5 ml se prefrlaat 500 μl od primerokot. Ostatokot od primerokot se
zamrznuva na -70°S. Obrabotena na ovoj na~in, RNK e stabilna podolgo vreme.
2. Vo tubi~ka so primerokot, po sledniot redosled se dodavaat:
- 50 μl 2M natrium acetat (rN=4)
- 500 μl kisel fenol (zasiten so voda, rN=4.5)
- 100 μl hloroform:izoamil alkohol (24:1)
3. Smesata energi~no se prome{uva 10 sekundi i se inkubira na mraz 15 minuti.
4. Primerokot se centrifugira (12000 rpm, 5 min, 4ºC) pri {to doa|a do odvojuvawe na
dvete fazi. Vodenata faza (gorna) ja sodr`i RNK, dodeka DNK i proteinite se nao|aat
vo interfazata i organskata faza. Gorniot sloj vnimatelno se odvojuva so pasterova
pipeta i se prefrla vo ~ista tubi~ka od 1.5 ml.
^ekor 4: Precipitacija na RNK so izopropanol
1. Na vodenata faza od prethodniot ~ekor, se dodava 500 μl izopropanol i tubi~kata se
inkubira na -20°S najmalku 1 ~as.
2. Po centrifugiraweto (12000 rpm, 5 min, 4ºC) RNK e vidliva kako bel talog.
3. Izopropanolot se dekantira a talogot od RNK se promiva so 1 ml 70% etanol i se
centrifugira (12000 rpm, 2 min, 4ºC) so cel da se odstranat rezidualnite soli.
3. Etanolot se odstranuva so dekantirawe i tubi~kata se ostava otvorena na sobna
temperatura so cel istiot celosno da ispari od primerokot. Pri toa treba da se
vnimava da ne dojde do presu{uvawe na talogot od RNA bidej}i toa }e ja namali
nejzinata rastvorlivost.
13 ^ekor 5: Rastvorawe na izoliranata RNK
Dobienata RNK mo`e da se rastvori vo voda ili TE pufer. Volumenot na dodadeniot
rastvoruva~ zavisi od koli~inata na dobienata RNK, obi~no se dodava 20-50 μl.
Primerokot na RNK se ~uva na temperatura od -70°S. ZADA^A 2:
Dali e vozmo`no da se izolira DNK od primerok koj e
arhiviran vo rastvor D? Obrazlo`i go odgovorot.
Dokolku odgovorot e pozitiven, navedi koi modifikacii
na protokolot bi gi napravil.
data:
osvoeni bodovi:
asistent:
14 ВЕЖБА БР: 3
OPREDELUVAWE NA KONCENTRACIJA I
INTAKTNOST NA NUKLEINSKI KISELINI
Po ekstrakcijata na nukleinskite kiselini voobi~eno e da se proveri nivnata
koncentracija, ~istota i intaktnost bidej}i e mo`no vo izolatot da bidat prisutni i
drugi primesi (naj~esto proteini) ili da dojde do nivna degradacija, {to direktno
vlijaae vrz rezultatite od posledovatelnite analizi. Za ovaa cel, naj~esto se
upotrebuva kombinacija od dve metodi spektrofotometrisko merewe i elektroforeza
na agarozen gel.
Nukleinskite kiselini i pove}eto od naj~estite kontaminenti na gotovite
izolati absorbiraat vo regionot od 230nm do 320nm. Ova ovozmo`uva, so merewe na
apsorbancata vo ovoj region, da se odredi koncentracijata na nukleinskite kiselini i
da se dade uvid vo nivoto na kontaminacija na izolatot. Mereweto mo`e da se izvede na
konvencionalen spektrofotometar ili na posebni aparati koe se dizajnirani
specijalno za analiza na biomolekuli kako {to se BioPhotometer (Eppendorf) ili
NanoDrop (Thermo Scientific). Bez razlika koj aparat }e se koristi, najzna~ajnite branovi
dol`ini na koi treba da se obrne vnimanie se:
- 230nm: kade se nao|aat maksimumite na apsorpcija na gvanidin tiocijanat (i
drugi soli na gvanidin) i fenol. Visoki vrednosti na apsorpcija na ovaa branova
dol`ina se indikativni za prenos na ovie soedinenija vo primerokot.
- 260nm: prstenite na purinite i pirimidinite vo nukleiskite kiselini
apsorbiraat na 260nm, i ovaa vrednost (A260) mo`e da se iskoristi za presmetuvawe na
nivnata koncentracija.
- 280nm: blagodarej}i na silnata apsorpcija na tirozinskite i triptofanskite
rezidui na ovaa vrednost, apsorbancata na 280nm (A280) se koristi kako indikator za
kontaminacija so proteini.
- 320nm: vrednosta na apsorbancata na ovaa branova dol`ina (A320) pretstavuva
op{ta merka za turbiditetot (opalescencijata) na primerokot i obi~no se odzema od
A260 vrednosta pri presmetuvawe na koncentracijata na nukleinski kiselini. Visoki
vrednosti na A320 uka`uvaat na nespecifi~na kontaminacija.
Glaven problem so spektrofotometriskoto odreduvawe na koncentacijata na
nukleinskite kiselini e toa {to odredeni kontaminenti isto taka mo`at da
apsorbiraat na 260nm, {to bi dovelo do dobivawe na rezultati koi se pogolemi od
vistinskite. Isto taka ovoj metod ne mo`e da napravi razlika pome|u DNK i RNK,
odnosno nemo`e da otkrie kontaminiranost na primeroci na RNK so DNK i obratno.
Poradi toa, paralelno so spektrofotometriskoto odreduvawe se izveduva i
elektroforeza na agarozen gel. Pokraj toa, na gelot mo`e da se voo~i i stepenot na
degradacija na nukleinskite kiselini.
15 ZADA^A 1: Odredi ja spektrofotometriski koncentracijata i ~istotata na
primerocite na DNK dobieni vo ve`ba br.1
1. Vo tubi~ki od 2ml se pipetiraat po 20μl od primerocite na DNK, se
dopolnuvaat do 2ml so voda i dobro se prome{uvaat.
2. Se odreduva apsorbancata na 230nm, 260nm, 280nm i 320nm koristej}i voda kako
slepa proba.
3. Opredeluvaweto na koncentracijata na DNK se bazira na Lambert-Beroviot
zakon spored koj postoi linearna zavisnost pome|u koncentracijata i apsorbancata na
260nm (A260). Imaj}i predvid deka ~ist rastvor na DNK so apsorbanca A260 = 1 ima
koncentracija od 50μg/ml, presmetuvaweto se izveduva po slednata formula:
koncentracija (μg/ml) = (izmerena A260 – izmerena A320) h 50 h faktor na
razreduvawe (100)
4. Opredeluvaweto na relativnata ~istota na izolatot na DNK se odreduva so
presmetuvawe na odnosot A260/A280 i A260/A230 . Dokolku se raboti za ~ist primerok
prvata vrednost }e bide pome|u 1.8 i 2.0, a vtorata pogolema od 1.5.
Rezultati:
primerok
A230
A260
A280
A320
A260/ A280
A260/ A230
c (μg/ml)
16 ZADA^A 2: Odredi ja intaktnosta na primerocite na DNK dobieni vo ve`ba
br.1 na agarozen gel so koncentracija od 0.8%
Potrebni rastvori:
Rastvor 1:
1x TBE
Rastvorot se prigotvuva kako 10 pati pokoncentriran rastvor za ~uvawe (10x TBE) koj e
stabilen podolgo vreme na sobna temperatura. Ovoj rastvor pred upotreba se razreduva
do rabotnata koncentracija (1x TBE) so voda so HPLC ~istota.
10x TBE
NH4Cl
NH4HCO3
0.5 M EDTA pH 8
H2O (HPLC ~istota)
finalna koncentracija
890 mM
890 mM
20 mM
potrebna masa za 1l rastvor
108 g
55 g
40 ml
do 1000 ml
Protokol za rabota:
1. Vo erlenmaer od 100ml se odmeruva 0.4g agaroza i se dodavaat 50ml 1xTBE pufer
i 5μl etidium bromid.
2. Erlenmaerot se zagreva vo mikrobranova pe~ka se dodeka agarozata ne se
rastvori celosno (3-5min) i se ostava da se oladi do okolu 50°S.
3. Otkako }e se oladi, gelot se izleva vo UV-tranparentna kadi~ka i se postavuva
~e{elot so posakuvana golemina na bunar~iwa.
4. Koga gelot }e se stvrdne (15-30min) vnimatelno se vadi ~e{elot, kadi~kata se
smestuva vo sistemot za horizontalna elektroforeza i se potopuva so 1xTBE pufer.
5. Bunar~iwata na gelot se polnat so primerocite vo koi e dodadena boja (Oran`
G) vo odnos 5:1.
6. Po 2 ~asa (100V) gelot se vnesuva vo UV komora i se fotografira.
Rezultat:
Komentar:
17 ZADA^A 3: Odredi ja spektrofotometriski koncentracijata i ~istotata na
primerocite na RNK dobieni vo ve`ba br.2
Postapkata se izveduva na identi~en na~in kako {to e objasneto vo zada~a broj 1,
so toa {to vo ovoj slu~aj presmetuvaweto se izveduva po slednata ravenka:
koncentracija (μg/ml) = (izmerena A260 – izmerena A320) h 40 h faktor na
razreduvawe
Rezultati:
primerok
A230
A260
A280
A320
A260/ A280
A260/ A230
c (μg/ml)
ZADA^A 4: Odredi ja intaktnosta na primerocite na RNK dobieni vo ve`ba
br.2 na agarozen gel so koncentracija od 1%
Postapkata se izveduva na identi~en na~in kako {to e odjasneto vo zada~a broj 2,
so toa {to vo ovoj slu~aj se prigotvuva 1% agarozen gel.
Rezultat:
data:
Komentar:
osvoeni bodovi:
asistent:
18 BLOK 2
POLIMERAZA [email protected] REAKCIJA (PCR)
ВЕЖБА БР:4 Детекција на JAK2 c.1849G>T мутација со AS-PCR
ВЕЖБА БР:5 Релативна квантификација на BCR/ABL
транскрипт со qRT-PCR
Polimeraza veri`nata reakcija e edna od najzna~ajnite i naj~esto
upotrebuvanite tehniki vo molekularnata biologija bidej}i ovozmo`uva brza i
ednostavna in vitro amplifikacija (umno`uvawe) na DNK sekvenci (fragmenti) od
interes. Teoretski, vo rok od samo nekolku ~asa, od samo eden DNK molekul mo`at da
se dobijat milijarda identi~ni kopii na fragmentot od interes, ozna~eni kako
amplikoni. Dobienite amplikoni ponatamu mo`at da se vizueliziraat so standardni
elektroforetski tehniki (agarozna ili poliakrilamidna elekrtoforeza) ili pak da
bidat vklu~eni vo ponatamo{ni analizi, kako {to se restrikcija so endonukleazi,
sekvencionirawe itn.
Princip na polimeraza veri`na reakcija
Polimeraza veri`nata reakcija pretstavuva in vitro enzimska replikacija koja se
odviva vo serija na inkubaciski ~ekori na razli~ni temperaturi vo to~no opredeleni
vremenski intervali. Eden PCR ciklus naj~esto se sostoi od tri inkubaciski ~ekori.
1. denaturacija na dvoveri`nite DNK molekuli na temperatura od 95°S. Na ovaa
temperatura doa|a do raskinuvawe na vodorodnite vrski pome|u komplementarnite
bazi pri {to se dobivaat ednoveri`ni ni{ki.
2. anilirawe na prajmerite na temperatura od 50 do 65°S. Prajmerite
pretstavuvaat ednoveri`ni oligonukleotidi (sostaveni od okolu 20 nukleotidi) koi
komplementarno se vrzuvaat (hibridiziraat) na dvata kraja na fragmentot od interes.
Edniot, t.n. preden prajmer e komplementaren so 3’ krajot na gornata (+) veriga na DNK,
dodeka drugiot, reverzen prajmer, e komplementaren so 3’ krajot na dolnata (–) veriga od
regionot koj treba da se amplificira.
3. ekstenzija na prajmerite na temperatura od 72°S. Ekstenzijata na prajmerite ja
vr{i termostabilnata Taq polimeraza (originalno izolirana od Thermus aquaticus) so
dodavawe na slobodni deoksiribonukleozidni trifostati, dNTP (dATP, dGTP, dCTP i
dTTP) vo prodol`enie na prajmerite vo nasoka 5’→3'. Na toj na~in doa|a do sinteza na
nova veriga komplementarna na verigata za koja se vrzani prajmerite.
Produktite od PCR amplifikacijata se akumuliraat eksoponencijalno vo tek na
25-30 ciklusi, taka {to DNKta koja e sintetizirana vo eden ciklus i samata
pretstavuva matrica za sinteza na nova DNK vo naredniot ciklus. Na krajot od
reakcijata, teoretskiot prinos iznesuva 230, {to pretstavuva 109 identi~ni kopii na
fragmentot od interes. Po triesetiot ciklus amplifikacijata navleguva vo
19 neeksponencijalna (plato) faza, {to se dol`i na namalenata koli~ina na dNTP,
prajmeri i reduciranata aktivnost na enzimot.
slika 1
slika 2
20 slika 3
slika 4
Optimizacija na polimeraza veri`na reakcija
Ne postoi edinstven PCR protokol koj bi bil soodveten za site eksperimentalni
istra`uvawa. Uspehot na reakcijata, kako i nejzinata specifi~nost i senzitivnost,
zavisat od golem broj faktori.
1. Pravilen izbor na set od prajmeri. Ova pretstavuva klu~en ~ekor za uspehot na
edna PCR, i zatoa pri nivniot dizajn treba da se vnimava tie da bidat:
a) so {to pomala razlika vo nivnata dol`ina, koja treba da se dvi`i vo ramkite
od 18-22 nukleotidi. Vo ovoj slu~aj prajmerite brzo se povrzuvaat za vreme na ~ekorot
na anilacija, a sepak se dovolno dolgi za da obezbedat adekvatna specifi~nost.
b) so {to pomala razlika vo nivnata to~ka na topewe (Tm) koja zavisi
proporcionalno od nivnata GC sodr`ina. Generalno, najoptimalni rezultati davaat
prajmeri so GC sodr`ina od 40-60% i Tm od 54-60°S.
21 v) da ne bidat komplementarni pome|u sebe, nitu pak so drugiot prajmer, posebno
na 3'- krajot, so cel da ne obrazuvaat sekundarni strukturi, koi mo`at da bidat
intramolekularni (vo oblik na jamki) ili intermolekularni (dimeri od dve molekuli
na edniot ili dvata prajmeri). Sekundarnite strukturi se naj~esto kompetetivni so
formiraweto na fragmentot od interes.
2. Adekvatno podesuvawe na finalnata koncentracijata na komponentite vo
reakciskata smesa.
a) osobeno zna~ajna e koncentracijata na Mg2+ jonite. Tie se neophodni za
aktivnosta na Taq polimerazata, no od druga strana dokolku se prisutni vo vi{ok
mo`at da gi stabiliziraat nespecifi~nite vrzuvawa na prajmerite i so toa da dovedat
do namaluvawe na specifi~nosta na reakcijata. Naj~esto se koristat vo finalna
koncentracija od 2mM, no sepak se prepora~uva optimalnata koncentracija da se
odredi eksperimentalno so serii na razreduvawa.
b) koncentracijata na prajmerite mo`e da se dvi`i od 0.1-0.5μM, no naj~esto se
koristat vo koncentracija od 0.2μM. Vrednosti pod ovaa obi~no davaat slab prinos na
produktot, dodeka pak visokite koncentracii mo`at da bidat pri~ina za nespecifi~en
rezultat.
v) deoksiribonukleotidite obi~no se koristat vo finalna koncentracija od
200μM (sekoj od niv). Povisoki koncentracii mo`at da ja inhibiraat enzimskata
reakcija preku vrzuvawe so Mg2+ jonite, dodeka pak neizbalansiraniot soodnos mo`e da
bide pri~ina za pogre{no inkorporirawe vo novite kopii na DNK.
3. Prisustvo na kontaminenti koi mo`at da ja inhibiraat reakcijata, a
poteknuvaat glavno od postapkite na izolacija na DNK.
inhibitorna
koncentracija
SDS
>0.005% (w/v)
fenol
>0.2% (v/v)
etanol
>1% (v/v)
izopropanol
>1% (v/v)
natrium acetat
>5 mM
natrium hlorid
>25 mM
EDTA
>0.5 mM
tabela 1. Inhibitorni koncentracii na naj~estite kontaminenti vo DNK
izolatite
supstancija
4. Goleminata i strukturata na fragmentot koj e predmet na amplifikacija
vlijaat na uslovite (temperatura na anilacija, broj na ciklusi, dol`ina na sekoj ~ekor
od eden ciklus) vo koi najoptimalno bi se odvila reakcijata. So ogled na toa {to
prajmerite go ograni~uvaat amplikonot, tie indirektno vlijaat na samite uslovi na
rabota.
a) Izborot na temperaturata na anilacija zavisi od Tm na prajmerite i Tm na
amplikonot. Dokolku se izbere previsoka temperatura }e se dobie mal prinos od PCR
reakcijata poradi niskiot stepen na hibridizacija na prajmerite so primerokot, vo
sprotivno, dokolku se izbere preniska temperatura mo`no e da izgubi specifi~nosta
22 na reakcijata.
b) Generalno, sekoga{ koga e vozmo`no, treba da se izbegnuva dizajn na prajmeri
koi produciraat amlikon so visoka GC sodr`ina, bidej}i ovie fragmenti imaat visoka
Tm i mo`no e da ne bidat celosno denaturirani na temperaturata na anilacija. Isto
taka treba da se izbegnuvaat delovi od DNK za koi se znae (ili pretpostavuva) deka
obrazuvaat sekundarni strukturi. Vo slu~aj koga toa ne e mo`no, vo reakcionata smesa
se dodava DMSO (dimetil sulfoksid) ili glicerol, so cel da se minimizira nivnoto
obrazuvawe.
v) Brojot na ciklusite e pravopropocionalen so prinosot od reakcijata. So ogled
na toa {to posle 30-tiot ciklus ve}e se gubi eksponencijalnata zavisnost, naj~esto vo
praksa se izveduvaat 25-30 ciklusi.
g) Vremetraeweto na ~ekorot na ekstenzija zavisi od goleminata na amplikonot.
Kaj dolgi fragmenti, vo slu~aj koga ekstensijata e prekratka mo`e da dojde do
predvremena terminacija na amplifikacijata {to direktno vlijae na efikasnosta na
reakcijata.
Vizuelizacija na produktite od standardna PCR
Razdvojuvaweto i identifikacijata na DNK fragmentite so razli~na dol`ina se
vr{i so elektroforetski metodi. Konvencionalnite tehniki vklu~uvaat
elektroforeza na agarozen ili poliakrilamiden gel, i tie osven za kvalitativna i
semikvantitativna analiza mo`at da se koristat i kako preparativni tehniki za
pre~istuvawe na odredena frakcija na DNK fragmenti od smesa na fragmenti so
razli~na molekulska masa.
Vo neutralna ili slabo alkalna sredina, DNK fragmentite imaat negativen
polne`, pa spored toa vo elektri~no pole patuvaat kon pozitivnata elektroda (anoda).
Pri toa fragmentite se dvi`at so razli~na brzina, {to vo kontrolirani uslovi
ovozmo`uva nivno pravilno razdvojuvawe i vizuelizacija so etidium bromid. Etidium
bromid pretstavuva fluorescentna boja koja interhelira pome|u bazite na
dvoveri`nata DNK i na toj na~in ovozmo`uva vizuelizacija pod UV svetlo. Pri
elektroforezata, pokraj primerocite za analiza, sekoga{ se aplicira i DNK marker
(lader) koj pretstavuva smesa na DNK fragmenti so poznati dol`ini so {to se
ovozmo`uva, so sporeduvawe, da se ot~ita nepoznatata dol`ina na DNK fragmentite od
primerocite.
Podvi`nosta na DNK fragmentite pri elektroforeza e zavisna od pove}e
faktori:
1. dol`inata na fragmentite. Za linearnite molekuli, brzinata so koja se
dvi`at e obratnoproporcionalna so log10 od nivnata molekulska masa. Ova zna~i deka
podolgite molekuli (so pogolem broj na bazni parovi) patuvaat pobavno od pokusite
molekuli.
2. konformacijata na fragmentite. Molekulite so ista dol`ina no razli~na
konformacija (linearna, cirkularna, superspiralizirana DNK) patuvaat so razli~ni
brzini.
3. goleminata na porite na gelot, {to direktno zavisi od koncentracijata na
sredstva za gelirawe. Povisoki koncentracii (pomali pori) ja olesnuvaat separacijata
na pomalite fragmenti, i sprotivno, poviskoki koncentracii (pogolemi pori)
23 ovozmo`uvaat razdvojuvawe na pogolemite fragmenti (slika 5).
Slika 5. Migracija na set od DNK fragmenti vo isti uslovi na gelovi so tri
razli~ni koncentracii na agaroza. Obele`aniot fragment e so dol`ina od 1000bp.
4. intenzitetot na naponot na elektri~no pole. Generalno so zgolemuvawe na
naponot se zgolemuva brzinata na dvi`ewe, me|utoa podolgite DNK fragmenti
dobivaat pogolemo zabrzuvawe od pomalite, {to mo`e da dovede do “razma~kuvawe”
odnosno gubewe na rezolucijata vo regionot na fragmentite so pomala molekulska
masa. Osven toa visokiot napon doveduva do zagrevawe na mediumot, {to mo`e da
dovedo do topewe na gelot. Podadi ovie pri~ini ne se prepora~uva koristewe na napon
pogolem od 5-8 V/cm gel.
5. sostav na puferot za elektroforeza. Puferite osven toa {to ja odr`uvaat
optimalnata pH vrednost, obezbeduvaat i joni za odr`uvawe na sprovodlivosta.
Elektroforetskata podvi`nost na DNK fragmentite zavisi od sostavot i jonskata
ja~ina na puferot. Na pr. DNK fragmenti pobrzo se dvi`at vo TAE (Tris-acetaten)
pufer i zatoa ovoj pufer dava podobra razolucija pri razdvojuvawe na fragmenti
pogolemi od 2kb, dodeka pak pokusite fragmenti so dol`ina od 0.1-2kb podobro se
razdeluvaat vo so TBE (Tris-boraten) pufer.
6. prisustvo na interhalira~ki supstancii. Povrzuvaweto na etidium bromid za
DNK fragmentite ja menuva nivnata masa i rigidnost, a so toa i brzinata so koja tie se
dvi`at. Prisustvoto na etidium bromid vo gelot ja namaluva podvi`nosta za okolu
15%.
DNK elektroforezata mo`e da bide nativna, za analiza na dvoveri`ni DNK
fragmenti, i denaturira~ka, za analiza na ednoveri`ni DNK fragmenti. Pri
denaturira~kata elektroforeza, neposredno pred aplikacijata, primerokot se zagreva
na na 95°C vo prisustvo na formamid pri {to doa|a do negova denaturacija. Vo gelot i
puferot isto taka se dodavaat denaturiraki agensi (formamid ili urea) so cel da se
spre~i renaturacijata ili formiraweto na sekundarni strukturi za vreme na
elektroforezata.
Razdvojuvaweto na fragmentite na agarozni gelovi e so po{irok opseg (od 50bp do
60kb) no so zna~itelno poslaba razolucija od poliakrilamidnite gelovi.
Poliakrilamidnite gelovi (PAGE) se dobivaat so polimerizacija na akrilamid i
bisakrilamid vo prisustvo na amonium persulfat (APS) i tetrametil etilendiamin
(TEMED). Tie se poefikasni za razdvojuvawe na pomali DNK fragmenti (5-200bp) i
imaat visoka rezolucija, taka da mo`at da razdvojuvaat fragmenti koi se razlikuvaat
24 po dol`ina od samo nekolku bazni parovi.
agarozen
opseg (kb) PAGE (%) opseg (bp)
gel (%)
0.3
5-60
3.5
1000-2000
0.5
1-20
5.0
80-500
0.7
0.8-10
8.0
60-400
0.9
0.5-7
12.0
40-200
1.2
0.4-6
15.0
25-150
1.5
0.2-4
20.0
6-100
2.0
0.1-3
tabela 2. Efektiven opseg na elektroforetsko razdvojuvawe vo gelovi so
razli~ni koncentracii
Tipovi na polimeraza veri`na reakcija
1. Kvantitativen PCR - qPCR (poznat i kako Real-time PCR, RTQ-PCR, ne RT-PCR!)
e metod koj ovozmo`uva na istovremena amplifikacija i kvantifikacija na celnite
fragmenti. Kvantifikacijata se vr{i paralelno (simultano) so amplifikacijata,
odnosno po sekoj zavr{en ciklus. Voobi~aenite metodi za kvantifikacija vklu~uvaat
upotreba na a) nespecifi~ni fluorescentni boi (na pr. SYBR Green) koi se vmetnuvaat
vo dvoveri`nata DNK i b) modificirani oligonukleotidi t.n. probi koi sodr`at
fluorofori (na pr. TaqMan) koi ovozmo`uvaat detekcija i kvantifikacija po
komplementarno povrzuvawe za celniot fragment i razgraduvawe poradi 5’→3'
egzonukleaznata aktivnost na Taq polimerazata.
2. RT-PCR (Reverse Transcription PCR) pretstavuva PCR koja upotrebuva RNK kako
po~eten materijal i se koristi pri analiza na ekspresijata na genite. Pritoa,
reakcijata se odviva vo dve fazi. Vo prvata faza, se vr{i transkripcija na mRNK vo
komplementarna DNK so enzimot reverzna transkriptaza. Komplementarnata DNK se
razlikuva od genomskata po toa {to gi sodr`i samo protein-kodira~kite sekvenci
(nema introni). Vtorata faza pretstavuva amplifikacija na komplementarnata DNK i
mo`e da se odviva so klasi~na PCR ili qPCR.
3. Multipleks PCR pretstavuva varijacija na PCR so koja so upotreba na pove}e
para na prajmeri se ovozmo`uva istovremena amplifikacija na pove}e celni regioni
vo edna reakcija. Pri toa amplikonite koi se dobivaat so sekoj set na prajmeri treba
da imaat razli~na dol`ina so {to se ovozmo`uva nivna vizuelizacija so
konvencionalna ili kapilarna gel elektroforeza. So ispituvaweto na pove}e geni
istovremeno se dobivaat mnogu pove}e informacii odkolku od samo edna reakcija, a
pri toa se za{teduva na vreme i reagensi.
4. Vgnezdena PCR (Nested PCR) se koristi za zgolemuvawe na specifi~nosta na
amplifikacijata i osobeno e korisen pri amplifikacija na dolgi DNK fragmenti.
Metodot se sostoi od dve posledovatelni PCR reakcii so dva razli~ni setovi na
prajmeri. Prviot set na prajmeri se koristi za dobivawe na PCR produkt, koj osven
posakuvaniot fragment mo`e da sodr`i i drugi nespecifi~ni amplikoni. Produktot
od prvata reakcija potoa se koristi kako pojdoven materijal za vtora PCR so nov set na
“vgnezdeni” prajmeri ~ii mesta na vrzuvawe se delumno ili celosno razli~ni od prvite
i se lokalizirani vnatre{no od 3' krajot na prajmerite od prvata reakcija.
25 5. Ta~daun PCR (Touchdown PCR) e varijacija na PCR koja ovozmo`uva pogolema
spe~ifi~nost na reakcijata. Prvite ~ekori kaj ovaa PCR imaat visoki temperaturi na
anilacija, okolu 3-5°S povisoka od Tm na prajmerite (koga najmalku e mo`no
nespecifi~no vrzuvawe). Kako {to te~e reakcijata, temperaturata na anilacija
postepeno se namaluva so {to se zgolemuva efikasnosta na reakcijata i amplifikacija
na specifi~niot produkt koj se dobil vo prvite ~ekori.
6. Alel-specifi~en PCR pretstavuva tehnika koja se koristi za detekcija na
edno-nukleotidni polimorfizmi (SNP, single-nucleotide polymorphisms) i to~kini
mutacii, so koristewe na prajmeri ili probi ~ii 3’ kraevi se vrzuvaat za regionot vo
koj se nao|a promenata.
7. Metilacija-specifi~en PCR e tehnika koja se koristi za detekcija na
metilacija na CpG ostrovcata na genomska DNK. Na reakcijata i prethodi bisulfidna
modifikacija, pri {to doa|a do konverzija na site nemetilirani citozini vo uracil.
26 ВЕЖБА БР: 4
ДЕТЕКЦИЈА НА ЈАК2 c.1849G>T МУТАЦИЈА СО АЛЕЛСПЕЦИФИЧНА ПОЛИМЕРАЗА ВЕРИЖНА РЕАКЦИЈА
Јанус киназа 2 (ЈАК2), е цитоплазматскa тирозин киназа, важна за покренување на
интрацелуларна сигнализација преку рецепторите за еритропоетин, тромбопоетин,
интерлеукин-3, факторот кој стимулира гранулоцитни колонии (G-CSF) и факторот кој
стимулира гранулоцит-макрофагни колонии (GM-CSF).
JAK2 c.1849G>T е стекната точкina мутација во егзон 12 на ЈАК2 генот која доведува до
замена на аминокиселината Валин, која се наоѓа на позиција 617 во полипептидната секвенца,
со Фенилананин (V617F). Оваа мутација многу често се забележува кај пациентите со Phнегативна миелопролиферативна неоплазма. Поради ова, Светската здравствена организација
во 2008 година го вклучи испитувањето на JAK2 V617F мутацијата како дијагностички
критериум за полицитемија вера - ПВ, есенцијална тромбоцитемија - ЕТ и примарна
миелофиброза – ПМФ (СЗО Класификација на тумори од хематопоетски и лимфоидни ткива,
ревизија 2008). Детекцијата на оваа мутација е значајна за правилна дијагноза на овие болести
и нивно разликување од секундарните миелопролиферативни заболувања, а со тоа и правилен
избор на терапија.
Мутацијата е високо специфична за овие sostojbi (ПВ 95%; ЕТ 50-60%; ПМФ 50-60%)
меѓутоа и за мал процент на други миелопролиферативни или миелодиспластични болести (15%), што значи дека позитивен резултат е индикативен за клонална миелоидна неоплазма, но
негативен резултат не ја исклучува ниту една од овие болести.
Протокол за работа
Детекцијата на присуството на JAK2 V617F мутацијата се изведува со помош на алел
специфична полимераза верижна реакција со два различни предни прајмери и заеднички
реверзен прајмер. Првиот преден прајмер е специфичен за мутантниот алел и дава продукт од
203bp, додека вториот амплифицира продукт од 364bp од двата алели (мутантен и нормален) и
служи како интерна контрола на реакцијата.
преден прајмер (специфичен): 5’- AGCATTTGGTTTTAAATTATGGAGTATGT -3’
преден прајмер (контролен): 5’-TAGTCATGCTGAAAGTAGGAGAAAG-3’
реверзен прајмер:
5’-CTGAATAGTCCTACAGTGTTTTCAGTTTCA-3’
Поврзување на прајмерите за ДНК: (егзон 12 е претставен со големи букви)
atctatagtcatgctgaaagtaggagaaagtgcatctttattatggcagagagaattttctgaactatttatg
gacaacagtcaaacaacaattctttgtacttttttttttccttagTCTTTCTTTGAAGCAGCAAGTATGATGA
GCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGT(G/T)TCTGTGGAGACGAGAgtaagtaaa
actacaggctttctaatgcctttctcagagcatctgtttttgtttatatagaaaattcagtttcaggatcaca
gctaggtgtcagtgtaaactataatttaacaggagttaagtatttttgaaactgaaaacactgtaggactatt
cag
27 Изведување на реакцијата:
Реакцијата се изведува со употреба на 2μl ДНК во вкупен волумен од 25μl.
табела 1: реакциона смеса
компонента
1
2
3
4
5
6
7
8
10 x PCR пуфер
25mM MgCl2
2.5mM dNTP
100pmol/μl специфичен прајмер
100pmol/μl контролен прајмер
100pmol/μl реверзен прајмер
5U/μl Taq полимераза
ампуларна вода
табела 2: услови на течење на реакцијата
темп.
иницијална денатурација
95°C
денатурација
95°C
анилација
58°C
екстензија
72°C
финална екстензија
72°C
финална
концентрација
1x
2 mM
200μM
0.5μM
0.5μM
1μM
0.05U/μl
време
10 min
1 min
1 min
1,5 min
10 min
потребна количина
30 циклуси
ЗАДАЧИ:
1. Одреди ги потребните количини (волумен) на секоја компонента од реакционата смеса
(табела 1).
2. Врз основа на должината на фрагментите кои се добиваат со реакцијата, каков гел за
електрофореза и во која концентрација ќе употребиш?
28 3. Протолкувај ги добиените резултати.
Коментар:
data:
osvoeni bodovi:
asistent:
29 ВЕЖБА БР: 5
РЕЛАТИВНА КВАНТИФИКАЦИЈА НА
BCR/ABL ТРАНСКРИПТ СО qRT-PCR
Филаделфија хромозом (Ph) претставува специфична хромозомска абнормалност која се
наоѓа кај повеќе од 95% од пациентите со хронична миелоидна леукемија и 25-30% од
пациентите со акутна лимфобластна леукемија. На молекуларно ниво, Филаделфија
хромозомот се јавува поради транслокација помеѓу хромозомите 9 и 22 [означена како
t(9;22)(q34;q11)], која резултира со формирање на фузиран ген (BCR/ABL) поради спојување
на дел од BCR генот од хромозом 22 (регион q11) со дел од ABL1 генот од хромозом 9 (регион
q34). Овој ген кодира фузиран BCR/ABL протеин со тирозин-киназна активност, кој во
зависност од точната локализација на транслокацијата може да има молекуларна маса од 190
или 210 kDa (p190, p210). BCR/ABL протеинот е постојано активен и е одговорен за активација
на протеини вклучени во контролата на клеточниот циклус, поради што доаѓа до
неконтролирана пролиферација на миелоидните клетки.
Детекцијата на присуство на BCR/ABL p210 транскриптот претставува дијагностички
критериум за хронична миелоидна леукемија и започнување на терапија со инхибитори на
тирозин киназа (на пр. иматиниб). Во тек на терапијата, се препорачува мониторирање на
минималната резидуална болест преку одредување на нивото на транскриптот на секој 3
месеци. Ова овозможува рано воочување на субоптимален одговор или појава на
резистентност, и согласно со тоа, соодветно корегирање на третманот.
Протокол за работа
Детекцијата на присуство на BCR/ABL транскриптот, а со тоа и воспоставувањето на
дијагноза, може да се изведе и со конвенционална и со квантитативна RT-PCR. Од друга
страна, за мониторирање на терапијата, може да се користи само qRT-PCR. При тоа, се врши
определување на нивото на експресија на BCR/ABL генот преку споредување на количината на
присутните BCR/ABL транskрипти при две последователни контроли. Поради тоа што се
прави споредба, овој тип на анализа се нарекува релативна квантификација, а резултатите
кои се добиваат не претставуваат апсолутни вредности (на. пр.број на копии) туку степен на
промена (fold-change). Примерокот кој го користиме како референтен (со кој вршиме
споредување) се нарекува калибратор и тој е земен од истиот пациент, најчесто во времето на
дијагноза на болеста. Добиените вредности и од двата примероци секогаш се нормализираат со
помош на ендогена контрола, која се нарекува нормализатор. Ова, типично претставува ген за
кој се смета дека има константно ниво на експресија (кое не се менува поради фактори
поврзани со болеста). Неговата задача е да ги нормализира сите варијации во резултатите кои
би можеле да потекнуваат од ефикасноста на реверзната транскрипција, концентрацијата на
почетната РНК или степенот на нејзина чистота.
30 Изведување на реакцијата:
Чекор 1: Реверзна транскрипција
При овој чекор со помош на ензимот реверзна транскриптаза се врши синтеза на
комплементарна ДНК. Овој ензим исто така има потреба од прајмер за да ја започне синтезата.
При тоа, можат да се користат три типа на прајмери: а) олиго dT прајмери кои се поврзуваат за
3’ poly-A опашките и вршат транскрипција паралелно на сите мРНКи присутни во примерокот,
б) специфични прајмери кои се поврзуваат само за една мРНК и в) случајни прајмери кои ја
започнуваат транскрипцијата од различни места при што се добиваат продукти со варијабилна
големина, меѓутоа приносот на реакцијата е поголем, а поголема е и веројатноста дека ќе дојде
до транскрипција на 5’ краевите на мРНК (особено кога се работо за долги мРНКи).
табела 1: RT реакциона смеса
компонента
1
2
3
4
5
6
10 x RT пуфер
25mM MgCl2
2.5mM dNTP
50μM Random hexamers
20U/μl RNAse inhibitor
50U/μl Reverse transcriptase
финална
концентрација
1x
5 mM
1 mM
2.5 μM
1 U/μl
2.5 U/μl
потребна количина
Реакцијата се изведува со употреба на 3μl РНК во вкупен волумен од 20μl. Инкубацијата
се одвива во три чекори:
1. 15 минути на 21°С. Овој чекор е потребен само кога за започнување на
транскрипцијата се користат случајни прајмери. Овозможува нивна екстензија, со што тие ќе
останат хибридизирани кога во наредниот чекор ќе се зголеми температурата.
2. 40 минути на 42°С при што доаѓа до синтеза на комплементарна ДНК. Температурата
во овој чекор може да се движи од 37-60°С, во зависност од тоа кој вид на реверзна
транскриптаза се користи.
3. 5 минути на 99°С кога се врши инактивација на реверзната транскриптаза.
Чекор 2: Квантитативна полимераза верижна реакција
табела 2: qPCR реакциона смеса
компонента
1
2
3
4
5
6
7
8
10 x PCR пуфер
25mM MgCl2
2.5mM dNTP
100pmol/μl преден прајмер
100pmol/μl реверзен прајмер
10pmol/μl TaqMan проба
5U/μl Taq полимераза
ампуларна вода
финална
концентрација
1x
2 mM
200μM
1 μM
1 μM
0.1 μM
0.05U/μl
потребна количина
31 Реакцијата се изведува со употреба на 5μl од RT продуктот во вкупен волумен од 25μl.
Како ендогена контрола (нормализатор) се користи нормалниот ABL транскрипт.
BCR/ABL
преден прајмер
реверзен прајмер
TaqMan проба
ENF501
ENR561
ENP541
5'-TCCGCTGACCATCAAYAAGGA-3'
5'-CACTCAGACCCTGAGGCTCAA-3'
FAM 5'-CCCTTCAGCGGCCAGTAGCATCTGA-3' TAMRA
ABL
преден прајмер
реверзен прајмер
TaqMan проба
ENF1003
ENF1063
ENF1043
5'-TGGAGATAACACTCTAAGCATAACTAAAGGT-3'
5'-GATGTAGTTGCTTGGGACCCA-3'
VIC 5'-CCATTTTTGGTTTGGGCTTCACACCATT-3' TAMRA
слика 1: поврзување на прајмерите и пробите
За разлика од конвенционална PCR, во qPCR
е
вклучен
трет
освен
прајмерите
олигонуклеотид (т.н. проба). На неговиот
5’крај е прикачена флуоресцентна боја,
репортер (FAM, VIC), додека на 3’крајот е
прикачен пригушувач (TAMRA, BHQ). Се
додека пробата е интактна, флуоресценцијата
која ја емитира репортерот се пригушува и не
се детектира како сигнал. Пробата се поврзува
внатре во растојанието што го ограничуваат
двата прајмери и тоа само за едната верига
(слика 2). Кога ДНК полимеразата ќе почне да
со екстезијата (vo nasoka 5’→3') на прајмерот
кој е поврзан на таа верига, таа доаѓа до
пробата и започнува да ја разградува со што
репортерот се ослободува во растворот и се
детектира сигнал. Со секој нареден циклус
количината на проба која е деградирана се
зголемува,
поради
што
и
сигналот
експоненцијално се зголемува.
слика 2
32 Степенот на промена на експресија на BCR/ABL генот, односно степенот на промена на
нивото на BCR/ABL транскриптот се пресметува со ΔΔCt методот (слика 3). Според овој метод
нивото на транкриптот се изразува преку вредноста на циклусот во кој сигналот го преминува
лимитот на квантификација Ct (Cycle Treshhold). Оваа вредност прво се нормализира во однос
на ендогената контрола:
ΔCt анализа = ΔCt (BCR/ABL)а - ΔCt (ABL)а
ΔCt калибратор = ΔCt (BCR/ABL)к - ΔCt (ABL)к
слика 3
Релативната количината на BCR/ABL транскриптот во анализата во однос на калибраторот
потоа се пресметува според формулата:
fold change = 2-ΔΔCt
каде ΔΔCt = ΔCt анализа - ΔCt калибратор
33 РЕЗУЛТАТИ:
ΔCt (BCR/ABL)
ΔCt (ABL)
ΔCt
анализа
калибратор
Коментар:
data:
osvoeni bodovi:
asistent:
34 BLOK 3
POНАТАМОШНИ АНАЛИЗИ НА PCR ПРОДУКТИ
ВЕЖБА БР:6 Детекција на BRAF V600E мутација со RFLP-PCR
ВЕЖБА БР:7 Детекција на непознати мутации со
секвенционирање на гени
ВЕЖБА БР: 6
ДЕТЕКЦИЈА НА BRAF V600E МУТАЦИЈА СО RFLP-PCR
Restrikciski endonukleazi se enzimi koi prepoznavaat strogo specifi~en niz na
nukleotidi vo sekvencata na dvoveri`nata DNK i na toa mesto pravat po dve
zasekuvawa, po edno niz sekoj fosfaten skelet na dvoveri`niot DNK heliks bez притоа
da gi o{tetat bazite. Svoeto ime go dobile spored funkcijata koja ja imaat vo
bakteriite od kade za prvpat bile izolirani. Imeno, tie se vlku~eni vo odbranata od
infekcija so bakteriofagi na toj na~in {to ja uni{tuvaat virusnata DNK koja
navleguva vo kletkata i so toa restriktivno deluvaat na rastot na virusite.
Bakterijata ja {titi svojata sopstvena DNK so metilirawe na nukleotidite vo
restriktivnite mesta.
Dosega se otkrieni okolu 500 restriktivni endonukleazi, od koi stotici se i
komercijalno dostapni za laboratorski celi. Nivnata nomenklatura poteknuva od
imeto na bakterijata od koja se izolirani. Na primer:
EcoRI: E = Escherichia (rod)
co = coli (vid)
R = RY13 (soj)
I = Prv identificiran kaj bakterijata
Sekvencite prepoznaeni od ovie enzimi (restriktivni mesta) se dolgi ~etiri do osum
nukleotidi i se karakteriziraat so specijalen tip na vnatre{na simetrija nare~ena
palindrom (slika 1). Dvete verigi od DNK molekulata na ovie mesta imaat identi~en
redosled na bazi dokolku se ~itaat vo ist pravec (na pr. 5’→3’). Sekoj enzim prepoznava
razli~na nukleotidna sekvenca koja ja se~e sekoga{ na ist na~in. Pri toa mestata na
koi se prekinuvaat komplementarnite verigi na DNK mo`at da bidat postaveni edno
sproti drugo, pri {to se dobivaat fragmenti so tapi kraevi (blunt end) ili pak da se
razlikuvaat vo nekolku nukleotidi, pri {to dobivaat fragmenti so t.n. leplivi
kraevi (sticky ends) kaj koi ednata veriga e podolga od drugata.
35 slika 1. Restrikciski mesta i mesta na se~ewe na nekolku endonukleazi
Vo molekularnata biologija, terminot dol`inski polimorfizam na
restrikciski fragment (RFLP-restriction fragment length polymorphism) se odnesuva na
razlikite koi se javuvaat poradi razli~nata lokacija na restrikciskite mesta. Pri
RFLP-PCR analizite, produktot od odredena PCR reakcija posledovatelno se digestira
so opredelena restrikciska endonukleaza po {to dobienite restrikciski fragmenti
se separiraat vrz osnova na nivnata dol`ina so pomo{ na elektroforeza. Prisustvoto
ili otsustvoto na odredena mutacija vo restrikciskoto mesto na enzimot e prosledeno
so podlo`nost ili otpornost kon restrikciskata digestija, {to }e rezultira so pojava
na fragmenti so razli~na dol`ina. Pri toa, mutacijata mo`e da dovede go gubewe na
restrikciskoto mesto ili pak do kreirawe na novo restrikcisko mesto.
Детекција на BRAF V600E мутација со RFLP-PCR
Edna od naj~estite aktivira~ki mutacii vo BRAF genot pretstavuva nukleotidna
zamena na timin so adenin na pozicija 1799 vo egzon 15, poradi {to doa|a do zamena na
aminokiselinata Valin na pozicija 600 vo kodiraniot protein so Glutaminska
kiselina. Ovoj protein ima preku 10 pati pogolema aktivnost od normalniot protein i
ja promovira proliferacijata na tumornite kletki, poradi {to pacientite koi se
nositeli na ovaa mutacija voobi~aeno imaat polo{a prognoza vo odnos na brzinata na
progresija na bolesta i pre`ivuvaweto. Ispituvaweto na prisustvoto na BRAF V600E
mutacijata e zna~ajno i od aspekt na izborot na terapija. Imeno, odgovorot na
terapijata so mоноклоналните антитела цетуксимаб (Erbitux®) и панитумумаб (Vectibix®) e
zna~itelno namalen kaj pacientite koi se nositeli na ovaa mutacija.
Протокол за работа
Чекор 1: Polimeraza veri`na reakcija
So ovoj ~ekor se vr{i амплифиkacija na fragment од 224bp od BRAF genot koj ja
opfa}a ispituvanata mutacija. Реакцијата се изведува со употреба на 2μl ДНК во вкупен
волумен од 25μl.
36 преден прајмер:
реверзен прајмер:
5’-TCATAATGCTTGCTCTGATAGGA -3’
5’-GGCCAAAAATTTAATCAGTGGA -3’
Поврзување на прајмерите за ДНК:
tcataatgcttgctctgataggaaaatgagatctactgttttcctttacttactacacctcagata
tatttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacag(T/A)gaaatct
cgatggagtgggtcccatcagtttgaacagttgtctggatccattttgtggatggtaagaattgag
gctatttttccactgattaaatttttggcc
табела 1: реакциона смеса
компонента
1
2
3
4
5
6
7
10 x PCR пуфер
25mM MgCl2
2.5mM dNTP
100pmol/μl преден прајмер
100pmol/μl реверзен прајмер
5U/μl Taq полимераза
ампуларна вода
финална
концентрација
1x
2 mM
200μM
1μM
1μM
0.05U/μl
потребна количина
табела 2: услови на течење на реакцијата
темп.
време
иницијална денатурација
10 min
95°C
денатурација
45 sec
95°C
анилација
45 sec
30 циклуси
56°C
екстензија
1,5 min
72°C
финална екстензија
10 min
72°C
Чекор 2: Digestija на добиениот PCR продукт
Digestijata se izveduva so restriktivniot enzim TspRI со inkubacija на добиениот
PCR продукт на 65°S преку ноќ. slika 2. Restrikcisko mesto na TspRI
Реакцијата се изведува со употреба на 20μl PCR продукт во вкупен волумен од 30μl.
табела 2: реакциона смеса
компонента
финална
потребна количина
концентрација
1 10 x NEB buffer 4
1x
2 10 x BSA
1x
3 10 U/μl TspRI
0.4 U/μl
4 ампуларна вода
37 ЗАДАЧИ:
1. Обележи ги рестрикциските места и местата каде се сече секвенцата на PCR
продуктот.
tcataatgcttgctctgataggaaaatgagatctactgttttcctttacttactacacctcagatata
tttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacagtgaaatctcgatggag
tgggtcccatcagtttgaacagttgtctggatccattttgtggatggtaagaattgaggctatttttc
cactgattaaatttttggcc
tcataatgcttgctctgataggaaaatgagatctactgttttcctttacttactacacctcagatata
tttcttcatgaagacctcacagtaaaaataggtgattttggtctagctacagаgaaatctcgatggag
tgggtcccatcagtttgaacagttgtctggatccattttgtggatggtaagaattgaggctatttttc
cactgattaaatttttggcc
2. Колку фрагменти ќе се добијат и со која должина ќе бидат тие?
број на фрагменти
должина на фрагменти
хомозигот Т/Т
хетерозигот Т/А
хомозигот А/А
3. Каков гел за електрофореза и во која концентрација ќе употребиш за визуeлизација на
продуктите од дигестијата?
38 4. Протолкувај ги добиените резултати.
Коментар:
data:
osvoeni bodovi:
asistent:
39 ВЕЖБА БР: 7
ДЕТЕКЦИЈА НА НЕПОЗНАТИ МУТАЦИИ
СО СЕКВЕНЦИОНИРАЊЕ НА ГЕНИ
Секвенционирање на ДНК претставува метод со кој се одредува примарната структура
односно нуклеотидниот редослед на одреден ДНК фрагмент. Постојат две методи на
секвенционирање кои оригинално биле публицирани речиси во исто време:
• Метод со хемиска деградација (Maxam and Gilbert, 1977), во кој секвенцата на ДНК се
одредува преку третман со хемиски супстанции кои ја сечат молекулата на определени
нуклеотидни позиции при што се добиваат фрагменти со различна должина;
• Метод со прекинување на вериги (Sanger et al., 1977), во кој секвенцата на ДНК се
одредува преку ензимска синтеза на комплементарни полинуклеотидни ланци кои имаат
различна должина.
Во наредните години, особено со започнувањето на Human genome project, методот на
Sanger се здобил со поголема популарнот (се користат помалку токсични реагенси, полесно
може да се автоматизира), така да денес, за секвенционирање речиси исклучиво се користи
овој метод. Самата реакција на секвенционирање претставува синтеза на ДНК, меѓутоа за
разлика од полимераза верижната реакција каде се користат два прајмери и се добиваат голем
број на копии на целиот фрагмент кој е ограничен со прајмерите (бројот на копии се зголемува
експоненцијално), во овој случај се користи само еден прајмер (бројот на копии се зголемува
линеарно) при што синтезата се терминира на определени нуклеотидни позиции и на тој начин
се добиваат фрагменти кои се разликуваат во својата големина. Ова се постигнува со додавање
на мала количина на дидеоксинуклеотиди (ddNTPs) на стандардната реакциона смеса за ДНК
синтеза која содржи деоксинуклеотиди (dNTPs). Дидеоксинуклеотидите се хемиски
модифицирани на 3’ С-атомот од деоксиробозата (слика 1), така да можат да бидат
инкорпорирани во новосинтетизираниот ланец, меѓутоа по нив синтезата неможе да продолжи
поради недостатокот на 3’ –OH група која учествува во формирање на фосфодиестерската
врска.
слика 1. Дидеоксинуклеотид
40 Оригиналниот метод се состоел од изведување на четири посебни реакции кои се
разликуваат во деоксинуклеотидот кој е додаден (ddATP, ddTTP, ddCTP и ddGTP), така што по
завршувањето на реакција, продуктот на секоја од нив ќе биде смеса од фрагменти со различна
должина кои секогаш завршуваат со иста база. Продуктите од сите четири реакции потоа се
аплицирале на еден полиакриламиден гел со цел да се раздвојат според нивната должина.
Одредувањето на ДНК секвенцата (во насока 5’→3’) потоа се вршело со читање на лентите на
гелот почнувајќи од долната страна (најдалеку отпатуваните т.е. најмалите фрагменти). При
тоа треба да се има предвид дека добиената секвенца е всушност комплементарна на
оригиналната ДНК вегира која била секвенционирана.
Денес, секвенционирањето се изведува со користење на дидеоксинуклеотиди кои се
обележани со различни со флуоресцентни бои кои емитираат светлина на различна бранова
должина. Благодарејќи на ова секвенционирањето може да се изведува во само една реакција
во која се вклучени сите четири различно обележани дидеоксинуклеотиди, по што
сепарацијата и детекцијата се изведува со целосно автоматизирана капиларна гел
електрофореза. Фрагментите сепарирани по должина поминуваат низ детектор кој врши
идентификација на дидеоксинуклеотидот кој се наоѓа на крајот од секој фрагмент (слика 2).
Крајниот резултат е електроферограм кој е составен од серија на пикови кои ги означуваат
позициите на нуклеотидите (слика 3).
слика 2
41 слика 3
Протокол за работа
Чекор 1: Polimeraza veri`na reakcija
So ovoj ~ekor se vr{i амплифиkacija na fragmentот кој треба да се секвенционира.
Начинот на изведување на реакцијата, како и сите фактори од кои зависи успешната
амлификација, се детално објаснети во блок 2.
Чекор 2: Прочистување на PCR продуктот
Овој чекор се изведува со цел да се одстранат преостанатите (неупотребени) прајмери и
нуклеотиди (dNTP) од PCR реакцијата, со што би се овозможило контролирање на условите на
реакцијата на секвенционирање која следи. Прочистувањето може да се изведе на повеќе
начини, но генерално најчесто се користат два:
1. ензимски третман со комбинација од Егзонуклеаза I, која ги отстранува преостанатите
прајмери и Алкална фосфатаза, која ги отстранува преостанатите нуклеотиди.
2. сечење на лентите на PCR продуктот од агарозен гел и негова екстракција (најчесто со
употреба на колони за цврсто-течна екстракција).
Чекор 3: Реакција на секвенционирање
Реакцијата се изведува со употреба на 13μl прочистен PCR продукт во вкупен волумен од
20μl. Секвенционирањето секогаш се изведува во двата правци, што значи дека се
42 приготвуваат две реакциони смеси и при тоа едната го содржи предниот, а другата реверзниот
прајмер.
табела 2: реакциона смеса
компонента
1
2
3
5 x пуфер за секвенционирање
10 x BigDye terminator premix
10pm/μl прајмер
табела 2: услови на течење на реакцијата
темп.
иницијална денатурација
96°C
денатурација
96°C
анилација
50°C
екстензија
60°C
финална
концентрација
1x
1x
0.5 μМ
време
10 min
10 sec
5 sec
4 min
потребна количина
25 циклуси
Чекор 4: Прочистување на продуктот од реакцијата на секвенционирање
Овој чекор се изведува со цел да се одстранат преостанатите дидеоксинуклеотиди и
вишокот од соли , и со тоа да се добие почист сигнал при детекцијата. Постапката се состои во
преципитација на ДНК фрагментите со апсолутен етанол, EDTA и натриум ацетат. Талогот се
промива со 70% етанол и се раствара во 20μl формамид. Формамидот се користи за
денатурирање на двоверижните ДНК фрагменти пред електрокинетичкото инјектирање на
промероците во капиларниот електрофоретски систем.
ЗАДАЧИ:
Sekoj student treba da napravi pregled na rezultat od sekvencionirawe na
zadaden region od odreden gen so cel da izvr{i detekcija na prisutna mutacija.
Gen:
употребени прајмери:
sekvencioniran region:
43 Rezultat:
Komentar:
data:
osvoeni bodovi:
asistent:
44 45 
Download

молекуларна биологија со генетика