Mardin, Şırnak İlleri Zeytinlerinin (Olea europaea L.) Seleksiyon Yolu İle Islahı ve
Seçilen Tiplerin Moleküler Markörler Aracılığıyla Genetik Tanımlanması Üzerine
Araştırmalar*
M.T.ÖZKAYA1), E.ÇAKIR1), M.ULAŞ3), M.ÇELİK1), M.BAKIR2), ALİ ERGÜL2),
1)
Ankara üniversitesi Ziraat Fakültesi BahçeBitkileri Bölümü -Ankara
2)
Ankara Üniversitesi Biyoteknoloji Enstitüsü-Ankara
3)
Çukurova Üniversitesi Ziraat Fakültesi Bahçe Bitkileri Bölümü-Adana
ÖZET
Bu çalışmada Mardin ve Şırnak illeri gen kaynaklarından seçilen 47 zeytin tipi ve 4 adet yerli
standart ve 1 adet yabancı çeşit referans olmak üzere toplam 52 zeytin genotipi, DNA genetik
kimliklerinin araştırılması amacı ile SSR analizleri ile test edilmiştir. Her bir SSR lokusu için allel
büyüklükleri Beckman CEQ 8800 otomatik fragmant analiz sistemi ile belirlenirken, allel sayısı,
beklenen ve gözlenen heterozigotluk ve tanımlama olasılığı tespit edilmiştir, elde edilen sonuçlar
dendogram düzeyinde değerlendirilmiştir.
GİRİŞ
Akdeniz uygarlığının bir sembolü olan zeytin (Olea europaea L.), tarih boyunca bu bölgede kurulan
uygarlıkların temelini oluşturmuştur. Zeytinin anavatanının ve gen merkezinin Güneydoğu Anadolu
Bölgesi olduğu araştırıcılarca ifade edilmektedir.(Özkaya et al 2006). Son yıllarda yapılan çalışmalarla
Hatay, Kahramanmaraş ve Mardin şeridinde zeytin ağacının en alt türüne rastlanmış olması bu yargıyı
kesinleştirmektedir.
Türkiye‟de zeytin yetiştiriciliğinde büyük bir çeşit karmaşası yaşanmaktadır. Ekolojik faktörler ve
farklı kültürel uygulamalar nedeniyle ağaç ve meyve özelliklerinde görülen değişiklikler, bir çeşidin
farklı bölgelerde hatta aynı bölgede bile değişik isimlerle tanınmasına neden olmaktadır. Çeşitlerin
farklı bölgelerde veya aynı bölgede farklı isimlerle anılması ve sinonimlerinin farklı çeşitler olarak
kabul edilmesi de, çeşit karmaşasına neden olmaktadır (Dölek 2003).
Yapılan
çalışmaların
tümünde
karşılaşılan
ortak
sorun
elde
edilen
verilerin
çeşit/tip
tanımlandırılmasında yetersiz olmasıdır. Ekolojik koşullara bağlı olarak incelenen karakterlerin
değişkenlik göstermesi en önemli neden olarak ifade edilmektedr. Bu sorunun çözümüne yönelik
olarak biyokimyasal (izoenzim) ve RAPD gibi DNA tabanlı analizler çok çeşitli araştırıcı grupları
tarafından yapılmıştır (Pontikis et al.1980; Quazzani et al.1993; Trujillo and Rallo, 1995; Bagoni et
al.1994; Fabbri et al.1995, Claros et al. 2000, Özkaya et al 2004, Özkaya et al. 2006). İzoenzimlerin
transkripsiyon sonrası değişimler göstermesi nedeniyle güvenirliliğinin az olması ve RAPD tekniğinin
*
Bu çalışma DPT-2003K12019004-7 kod nolu projeden desteklenmiştir.
tekrarlanabilirliğinin düşük olması, araştırıcıları daha kesin ve güvenilir sonuçlar alabilecekleri
teknikler (SSR ve AFLP gibi) kullanmaya zorlamıştır
Zeytinin anavatanı olarak kabul edilen Güneydoğu Anadolu bölgesi illeri (Mardin, Şırnak), ilçeleri ve
köylerinde üstün nitelikli tiplerin ortaya çıkarılarak kaybolmasını önlemek amacıyla yürütülmesi
planlanan bu çalışma, bugüne kadar gerçekleştirilmiş olan seleksiyon çalışmaları zincirinin bir
halkasını oluşturacak ve ülkemiz genetik kaynaklarının korunmasında belli bir rol üstlenecektir.
Materyal ve Metot
Materyal: Bu çalışma 2005-2007 Mardin, Şırnak illeri ve ilçelerinde gerçekleştirildi. Çalışmanın
materyalini illerdeki mevcut zeytin üretim alanlarının yanı sıra mikroklima alanlarında kalmış olan
bazı zeytin genotipleri , farklı agronomik özelliklerine bağlı olarak seçildi. Bu genotiplerin
alınmasında yetiştiricilerin verdiği ön bilgilerden seleksiyon kriterleri göz önünde tutularak
yararlanıldı. GPS sistemi ile
örnek alınan yerler işaretlenerek kayıt altına alındı ve laboratuvar
çalışmaları için meyve ve yaprak örnekleri alındı.
Öncelikle illerdeki ve ilçelerdeki zeytin bahçelerinde (mikroklimalar dahil) belirlenen çeşit ve
tiplerden morfolojik, fenolojik ve pomolojik karakterler Barranco and Trujillo (2000) göre incelendi.
Mart- Aralık ayları arasında yürütülen çalışmalarda, seçilen fertlerde gelişme durumu, hasat zamanı
tespit edilerek ve her ağaçtan meyve örnekleri alındı.
DNA İzolasyonu:Genç yapraklardan izolasyon
Saghai- Maroof et al.(1984)‟e göre,
gerçekleştirilirken, DNA mikAtar ve saflık oranları ND-1000 Nanodrop spektofotometre ve %1‟lik
agaroz jelde belirlenmiştir.
Mikrosatellite(SSR) analizleri
PCR çoğaltımları; 15 ng DNA, 5 pmol her bir primer, 0.5 mM dNTP, 0.5 ünite GoTaq DNA
Polimeraz (1.5mM MgCl2 içeren) (Promega) olacak şekilde 10 µL hacimde gerçekleştirilmiştir. İleri
primerler D2 (siyah), D3 (yeşil), D4 (mavi) WellRED floresan boyaları ile işaretlenmiştir (Proligo,
Paris, France)(Tablo 1). PCR koşulları, 94°C‟de 3 dk, 94°C‟de 1 dk, 55-60°C‟de 1 dk 72°C‟de 2 dk 35
döngü olarak uygulanırken, son yazılım ise 72°C „de 10 dk olarak gerçekleştirilmiştir. PCR ürünleri
belirli oranlarda SLS (sample loading solution) ile seyreltildikten sonra, Genomelab DNA Standart
Kit-600 eklenerek, CEQ 8800XL capillary DNA analiz sisteminde (Beckman Coulter, Fullerton, CA,
USA) elektroferez yapılmıştır. Pik görüntüleri ve allel büyüklükleri ise Beckman CEQ fragment
analysis yazılım programı ile tespit edilmiştir. Reaksiyon koşulları gerektiği koşullarda birden fazla
olarak tekrar edilmiştir.
Genetik analizler
IDENTITY 1.0 yazılım programı kullanılarak her lokustaki allellerin sayısı (n), allel frekansı,
beklenen (He) ve gözlenen heterozigotluk, (Ho), null allellerin frekansı (r) ve tanımlama olasılığı(PI)
değerleri tespit edilmiştir. Benzer genotipler ve ebeveyn tayini için de Identity programı kullanılmıştır.
Paylaşılan allel (ps) (1-(ps)) obsiyonu (option‟ı) kullanılarak genetik uzaklık Microsat (versiyon 1.5)
programı ile hesaplanmış, daha sonra bu veriler Microsoft Excel‟de benzerlik değerlerine
dönüştürülmüştür. Dendogram
ise; Unweighted Pair-Group Method of the Arithmetic Average
(UPGMA) ‟e bağlı NTSYS-pc (Numerical Taxonomy System) yazılım programı 2.02g versiyonu
kullanılarak oluşturulmuştur.
Sonuçlar ve Tartışma
Her bir türde 5 SSR lokusuna ait primerlerle (Tablo 1) gerçekleştirilen SSR analizleri sonucu;
belirlenen allel sayısı (n), beklenen (He) ve gözlenen heterozigotluk, (Ho) ve tanımlama olasılığı (PI)
değerleri Tablo 2‟de, allel büyüklükleri ise Tablo 3 de sunulmuştur. Genotiplerde allel sayıları 6-10
arasında değişiklik gösterirken ortalama değerler 8.2 olarak tespit edilmiştir.
Tablo 1. SSR lokuslarını tespit etmede kullanılan primer çiftleri ise aşağıda sunulmuştur
Primer adı
Dizisi (5‟.......3‟)
i: GAT CTT GTC TGT ATA TCC ACAC
g: TAT ACC TTT TCC ATC TTG ACGC
i: TCACCATTCTTAACTTCACACCA
Udo12
g:TCAGCAATTCCACGCTATG
i: GGATTTAATTAAAAGCAAAACATACAAA
Udo24
g: CAATAACAAATGAGCATGATAAGACA
i: TTTGCCCTGGATTGGTACA
Udo4
g: AGCTTGAGCATCATCTGTGAG
i: TTGATTTCACATTGCTGACCA
Udo9
g: CATAGGGAAGAGCTGCAAGG
g: geri, i: ileri primer(florasan işaretlenmiştir)
Dca15
Genellikle yabancı tozlanan ve klonal olarak çoğaltılan çok yıllık bitkilerde yüksek heterozigotluk
(Sefc et al. 2000) görülmekte olup, her genotipte ulaşılan araştırma sonuçları bunla uyum göstermiş
ve gözlenen heterozigotluk, (Ho) yüksek bulunmuştur (Tablo 2).
Tanımlama olasılığı(PI) dikkate alındığında; zeytinde en fazla bilgi verici lokus 10 allel (PI: 0.101),
UDO 24 ve ( PI: 0.189) UDO 9 bulunurken, PI değerleri genel olarak Sefc et al. (2001)‟nın belirtiği
0.05 değerinden yüksek çıkmıştır.
Tablo 2. Zeytin genotiplerine ait lokuslardaki
allel sayısı (n), beklenen (He) ve gözlenen
heterozigotluk, (Ho) ve tanımlama olasılığı(PI) değerleri
Lokus
n
He
Ho
PI
Dca15
7
0.411428
0.326923
0.434763
Udo12
6
0.709874
0.634615
0.233890
Udo24
10
0.818047
0.461538
0.101476
Udo4
8
0.411797
0.192308
0.433026
Udo9
10
0.638683
0.615385
0.189117
Toplam
Ortalama
41
8.2
2.989829
0.5979658
2.330769
0.4461538
1.392272
0.2784544
Tablo 3 . Zeytin genotiplerine ait allel büyüklükleri (KİMLİK TANISI)
No
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
Bölge kodu
SSR lokusları
Dca15
Udo12
Udo24
Udo4
Udo9
gürmeşe 244 244 155 163 167 167 147 147
96 102
Mardin.kızıltepe
köyü-3
M.Kilise-1
Mardin.kızıltepe yurteri-5
Mardin.kızıltepe yurteri-8
Mardin.kızıltepe
yukarı
yurteri-2
Mardin paspanos-5
Mardin paspanos-4
Mardin paspanos-1
Mardin eski kale-1
Mardin bakırkıre-2
Mardin. derik Z.pınarı-1
Mardin.derik z.pınarı-2
Mardin. derik21
Mardin.derik24
Mardin.derik16
Mardin.derik17
Mardin derik22
Ş.Silopi besbin5
Ş.Silopi serkani-1
Ş.Cizre kurtuluş-1
Ş.Cizre kızılsu3
Ş.Cizre akdizgin-3
Ş.Cizre akdizgin-4
Ş.Cizre deran-1
Ş.Cizre deran-5
Ş.Cizrederan-3
Ş.Cizre zıron-5
Ş.Cizre zıron-6
Ş.Cizre zıron-3
Ş.Cizre zıron-9
Ş.Cizre yzıron2
Ş.Cizre zıron-2
Ş.Cizre zıron-4
244
244
244
244
244
244
244
264
155
163
155
155
163
163
163
155
167
167
167
167
183
181
181
183
147
147
147
147
147
147
147
147
96
120
96
96
102
120
102
96
244
244
244
244
244
244
244
244
264
244
244
244
244
244
244
240
244
244
244
244
244
244
244
244
244
244
244
244
244
244
266
264
244
264
244
244
264
244
244
244
244
244
264
240
244
264
264
244
244
244
244
244
244
264
264
264
155
165
163
163
167
155
155
165
155
155
165
155
155
155
155
155
155
163
165
155
157
155
155
155
163
157
155
155
163
165
165
165
167
163
163
165
165
163
165
165
163
163
157
163
165
165
165
155
157
163
163
163
163
163
163
163
169
169
181
167
181
183
167
185
167
165
183
185
187
183
185
165
185
165
185
191
187
165
165
183
165
181
183
183
181
181
185
181
181
183
167
185
166
185
183
185
186
183
185
183
185
183
185
191
187
185
183
183
165
187
183
183
147
147
143
147
147
143
147
147
143
147
147
147
159
147
147
147
147
147
143
143
143
147
147
147
147
147
159
147
147
147
143
147
147
143
147
147
143
147
147
147
159
147
147
147
147
147
147
143
143
151
147
146
150
147
139
147
96
96
88
88
96
86
88
86
86
96
84
86
86
96
96
96
96
96
86
86
84
78
86
100
96
96
96
96
102
102
96
96
102
96
96
96
96
96
88
96
96
96
96
96
96
96
96
110
84
96
110
100
114
96
114
110
No
Bölge kodu
34
35
36
37
38
Ş.Cizre nevalohasko-8
Ş.Cizre nevalohasko-6
Ş.Cizre nevalohasko-11
Ş.Cizre nevalohasko-1
Ş.Cizre akdizgin avena
deresi-1
Ş.Cizre akdizgin avena2
Ş.Cizre akdizgin avena3
Ş.Cizre akdizgin
razemazen-2
Ş.Cizre akdizgin mıla esik-1
Ş.Cizreakdizgin avena4
Mardin.zinnar-5
Mardin zinnar-4
Mardin zinnar-3
Mardin derik 23
Uslu
Gemlik
Manzanilla des harmanes
Silifke Yağlık
Adana Topağı
39
40
41
42
43
44
45
46
47
48
49
50
51
52
SSR lokusları
Dca15
Udo12
Udo24
Udo4
244 264 155 155 185 185 147
244 264 155 155 181 187 147
244 264 155 163 181 181 147
244 264 157 157 183 183 147
244 264 157 163 165 183 147
147
147
147
147
147
Udo9
96
78
96
78
96
96
96
96
86
96
244
244
244
264
264
264
155
155
157
163
163
163
167
165
183
183
183
183
143
149
147
147
149
147
96
84
102
102
96
102
244
244
244
244
244
244
244
244
244
244
244
264
264
264
264
264
264
264
264
264
264
264
163
155
155
165
155
115
155
155
155
165
155
163
155
155
165
163
115
163
165
155
155
165
183
185
181
183
167
183
187
185
165
167
181
183
185
181
183
183
183
181
185
186
185
181
147
143
147
147
147
147
147
143
143
147
143
147
149
147
147
147
147
147
147
147
147
147
84
96
96
96
96
96
96
96
96
96
96
96
102
96
114
96
102
114
96
96
96
102
Genetik benzerlikler
İncelenen genotiplerin iki ana grup altında toplandığı belirlenmiştir.Bunlardan 25-26 nolu (deran5,
deran3 ) şırnak cizre zeytin genotipleri 1. grubu temsil ederken ele alınan diğer tüm genotipler 2. grup
altında toplanmışlardır. Genotipler arasınada en yakın benzerlik 1-2-4 (gürmeşe3, darülzaferan
kilisesi1, yurteri8) nolu mardin genotipleri arasında % 90, yine mardin ilinden alınan 13-17 (derik 21,
derik22) genotipleri arasında % 90 lık benzerlik tespit edilmiştir. Yine Şırnak-cizre alınan (22-34)
akdizgin-3 ve navalo hasko8 genotipleri arasında da % 90 lık benzerlik gösterirken, manzanilla des
harmanes ile uzak bir dallanma göstermiştir.
Mardin ve Şırnak illeri zeytin gen kaynaklarının kimlik tanısını içeren bu çalışmanın sonuçları;
ülkemizin diğer bölgelerinde olduğu gibi gen kaynakları çeşit ve zenginliği açısından bölgenin
potansiyelinin yüksek olduğu göstermektedir. Araştırmanın devamı olarak analizlerde artırılcak SSR
lokusları ile gen kaynaklarının tanımlanması ve korunması tam anlamı ile sağlanmış olacaktır.
1
2
4
6
12
15
19
36
28
29
21
23
38
5
44
46
9
31
35
48
11
32
33
39
16
42
45
47
37
7
10
52
13
17
22
34
51
20
24
49
43
3
18
27
30
40
50
41
8
14
25
26
0.24
0.40
0.57
Coefficient
Şekil 1. Örneklerin SSR-Dendogramı
0.73
0.90
Morfolojik Tanımlamalar:
Tablo 4 Araştırmada kullanılan Mardin ve Şırnak illeri zeytin genotiplerinin Yaprak ve Meyvelerin Morfolojik özellikleri
No
Çeşitler
Yaprak yapısı ve
gövdeye eğimi
M.Ağırlık (gr) M.Biçim
(Boy/En)
1
Gürmeşe-3
Kilise-1
Yüksek (4.50
gr)
Yüksek (4.76
gr)
eliptik
2
eliptik
uzun,hiponatik
eliptik uzun,plana
3
Yurteri-5
eliptik,plana
çok yüksek
(8.99 gr)
eliptik
4
Yurteri-8
eliptik uzun,plana
yumurta
5
Y Yurteri-2
eliptik uzun,plana
çok yüksek
(9.62 gr)
Yüksek (4.61
gr)
6
Paspanos-5
eliptikuzun,plana
7
Paspanos-4
eliptik uzun,plana
8
Paspanos-1
9
Eski kale-1
Eliptik
uzun,hiponastik
eliptik uzun,plana
10
Bakırkıre-2
11
Derik zeytin
pınarı 1
Derik zeytin
pınarı2
Derik-21
12
13
yumurta
eliptik
çok yüksek
yumurta
(7.36 gr)
Yüksek (5.57 gr yumurta
)
Düşük (1.19 gr) eliptik
yüksek(5.31 gr)
yumurta
eliptik uzun,plana
yüksek(5.17 gr)
eliptik
Eliptik uzun,plana
Düşük(1.67 gr)
eliptik
eliptik uzun,plana
düşük(1.14 gr)
eliptik
Eliptik uzun,
hiponasik
Orta(3.67gr)
yumurta
M.Si M.Lent M.Lent
metri isel
isel
(A)
Görünü Dağılım
mi
ı
simetr belirsiz küçük
ik
yarı
belirgin küçük
simetr
ik
yarı
belirgin küçük
simetr
ik
simetr belirsiz küçük
ik
yarı
belirsiz küçük
simetr
ik
simetr belirgin küçük
ik
simetr belirgin küçük
ik
simetr belirsiz küçük
ik
simetr belirgin küçük
ik
simetr belirsiz küçük
ik
simetr belirsiz küçük
ik
simetr belirsiz küçük
ik
Yarı belirgin küçük
simetr
ik
M.Max Meyve
Çap
Tamamlanış
(Poz.B) Şekli
Meyve
Sap
Çukuru
Şekli
yuvarla
k
yuvarla
k
Olgunl
uk
Rengi
Meme
durum
u
diğer
yok
diğer
var
merkez
yuvarlak
merkez
yuvarlak
merkez
sivri
düz
diğer
var
merkez
yuvarlak
diğer
yok
merkez
yuvarlak
yuvarla
k
yuvarla
k
diğer
yok
merkez
yuvarlak
düz
diğer
var
merkez
yuvarlak
düz
diğer
yok
merkez
yuvarlak
diğer
yok
merkez
yuvarlak
diğer
yok
merkez
yuvarlak
diğe
yok
merkez
sivri
diğer
yok
merkez
yuvarlak
yuvarla
k
yuvarla
k
yuvarla
k
yuvarla
k
düz
diğer
yok
merkez
sivri
düz
diğer
Yok
No
Çeşitler
Yaprak yapısı ve
gövdeye eğimi
M.Ağırlık (gr) M.Biçim
(Boy/En)
14
Derik-24
eliptikuzun,plana
orta(2.32 gr)
eliptik
15
Derik-16
eliptik uzun,plana
orta(3.72gr)
sivri
16
Derik-20
eliptik uzun,plana
yüksek(4.67 gr)
eliptik
17
Derik-22
Eliptik uzun,
hiponastik
Yüksek(4.48 gr) eliptik
18
Besbin-5
eliptik uzun,plana
düşük(1.52 gr)
sivri
19
Serkani1
Eliptik uzun,plana
Düşük(1.13 gr)
eliptik
20
eliptik,plana
x
x
21
Kurtuluş1(çalı)
Kızılsu-3
eliptik uzun,plana
orta(3.51 gr)
eliptik
22
Akdizgin-3
Eliptik uzun,plana
Düşük(1.10 gr)
sivri
23
24
25
26
eliptik
Eliptik, hiponastik
eliptik
eliptik, hiponasyik
x
Düşük(1.15 gr)
x
-x
x
sivri
x
x-x
27
Hasanyıldız-4
Deran-1
Deran-5
Deran-3 (çalı
form)
Zıron-5
eliptik uzun
düşük(1.77 gr)
eliptik
28
Zıron-6
uzun,plan
düşük(1.98 gr)
eliptik
29
Zıron-3
Eliptik
Orta(3.02 gr)
sivri
M.Si M.Lent M.Lent
metri isel
isel
(A)
Görünü Dağılım
mi
ı
yarı
belirgin küçük
simetr
ik
yarı
belirgin küçük
simetr
ik
simetr belirgin küçük
ik
Yarı belirgin küçük
simetr
ik
yarı
belirsiz küçük
simetr
ik
Simet belirgin küçük
rik
x
x
M.Max Meyve
Çap
Tamamlanış
(Poz.B) Şekli
merkez
sivri
Meyve
Sap
Çukuru
Şekli
düz
yarı
simetr
ik
asimet
rik
x
Yarı
x
x-x
merkez
sivri
düz
diğer
Yok
merkez
yuvarlak
düz
diğer
Yok
merkez
yuvarlak
yuvarla
k
diğer
Var
merkez
sivri
yuvarla
k
diğer
Yok
mrkez
sivri
yok
x
x
Yuvarla diğer
k
x
x
belirgin küçük
merkez
sivri
yuvarla
diğer
Var
belirsiz
küçük
sivri
Yok
x
küçük
x
x-
yuvarla
k
x
yuvarl
x
-x
siyah
x
belirsiz
x
x-x
Meyve
burnu
x
merkez
x
x-
x
diğer
x
x-
X
Yok
X
x-
merkez
yuvarlak
yuvarla
k
diğer
Yok
merkez
sivri
diğer
Yok
merkez
sivri
yuvarla
k
düz
diğer
Var
yarı
belirsiz küçük
simetr
k
simetr belirgin küçük
ik
Yarı belirsiz küçük
x
sivri
x
x-x
Olgunl
uk
Rengi
Meme
durum
u
diğer
Var
x
No
Çeşitler
Yaprak yapısı ve
gövdeye eğimi
M.Ağırlık (gr) M.Biçim
(Boy/En)
uzun,hiponastik
eliptik heliodal
Zıron-9 (çalı
form)
Yukarı zıron-2 eliptik
uzun,hiponastik
x
x
düşük(0.85 gr)
sivri
32
Zıron-2
eliptik uzun,plana
orta(2.91 gr)
sivri
33
Zıron-4
uzun
orta 2.06 gr)
eliptik
34
Nevalohasko-8
eliptik uzun,plana
düşük(1.83 gr)
eliptik
35
Nevalohasko-6
eliptik
orta(2.52 gr)
eliptik
36
Nevalohasko11
eliptik
orta(2.27 gr)
sivri
37
Nevalohasko-1
orta(2.61 gr )
sivri
38
eliptik uzun,
hoponastik
Ş.Cizre avena-1 Eliptik uzun,plana
Düşük(1.09 gr)
sivri
39
40
Ş.Cizre avena-2 Eliptik, plana
Ş.Cizre avena-3 Eliptik, plana
Orta(2.61 gr)
Orta(2.52 gr)
eliptik
eliptik
41
Razemzaın-2
Eliptik,plana
Düşük(1.31 gr)
yumurta
42
Mıla esik1
Uzun,plana
Orta(2.51 gr)
sivri
43
Acelilsen2
Eliptik, hiponastik
Orta(2.98)
eliptik
30
31
M.Si M.Lent M.Lent
metri isel
isel
(A)
Görünü Dağılım
mi
ı
simetr
ik
x
x
x
M.Max Meyve
Çap
Tamamlanış
(Poz.B) Şekli
Meyve Olgunl
Sap
uk
Çukuru Rengi
Şekli
Meme
durum
u
x
x
x
x
X
yarı
simetr
ik
asimet
rik
simetr
ik
simetr
ik
yarı
simetr
ik
yarı
simetr
ik
asimet
rik
Yarı
simetr
ik
küçük
merkez
sivri
düz
diğer
Yok
belirgin küçük
merkez
sivri
diğer
Var
elirsiz
küçük
merkez
sivri
siyah
Yok
belirsiz
küçük
merkez
yuvarlak
yuvarla
k
yuvarla
k
düz
diğer
Yok
belirgin küçük
merkez
sivri
yuvarla
k
diğer
Yok
belirsiz
küçük
sap
bölgesi
sivri
yuvarla
k
diğer
Yok
belirsiz
küçük
merkez
sivri
diğer
Var
belirsiz
küçük
merkez
yuvarlak
yuvarla
k
düz
diğer
Yok
belirsiz küçük
belirgin küçük
merkez
merkez
yuvarlak
sivri
yuvarla
yuvarla
k
diğer
diğer
Var
Yok
merkez
yuvarlak
düz
diğer
Yok
merkez
sivri
diğer
Yok
Sap
bölgesi
sivri
yuvarla
k
yuvarla
k
diğer
Var
belirsiz
Yarı
simetr
ik
simetr belirsiz küçük
ik
simetr belirsiz küçük
ik
Yarı belirgin küçük
simetr
No
Çeşitler
Yaprak yapısı ve
gövdeye eğimi
M.Ağırlık (gr) M.Biçim
(Boy/En)
M.Max Meyve
Çap
Tamamlanış
(Poz.B) Şekli
Meyve Olgunl
Sap
uk
Çukuru Rengi
Şekli
Meme
durum
u
44
Zinnar-5
orta(2.73 gr)
merkez
yuvarlak
düz
diğer
Yok
45
Zinnar-4
eliptik uzun,
hpotastık
eliptik uzun,plana
merkez
yuvarlak
yuvarla
k
diğer
Yok
46
Zinnar-3
Eliptik uzun,plana
Düşük(1.21 gr)
merkez
sivri
yuvarla
k
diğer
Var
47
Derik- 23
eliptik uzun,plana
orta(3.58 gr)
meyve
burnu
sivri
yuvarla
k
diğer
Var
48
uslu
Orta (3.53 gr)
merkez
yuvarlak
yok
Gemlik
Meyve
burnu
yuvarlak
yuvarla
k
yuvarla
k
diğer
49
Uzun,orta geniş
eliptik.
Kısa-geniş eliptik
diğer
Yok
50
merkez
yuvarlak
Yok
merkez
yuvarlak
siyah
Yok
52
Adanatopağı
merkez
yuvarlak
yuvarla
k
yuvarla
k
yuvarla
diğer
51
Manzanilla des Orta uzun,geniş
eliptik.
harmanes
Orta normal
Silifke yağlık
diğer
Yok
Uzun- Dar eliptik.
orta(2.31gr
orta
Orta (3.73 gr)
İri (4,14gr)
iri
M.Si M.Lent M.Lent
metri isel
isel
(A)
Görünü Dağılım
mi
ı
ik
eliptik
simetr belirsiz küçük
ik
eliptik
yarı
belirsiz küçük
simetr
ik
eliptik
Yarı belirgin küçük
simetr
ik
sivri
yarı
belirsiz küçük
simetr
ik
oval
asimet belirsiz küçük
rik
Yuvarlağa simetr belirsiz küçük
yakın
ik
silindirik
yuvarlak simetr belirsiz küçük
ik
oval
simetr belirgin Küçük
ik
yuvarlak simetr belirgin küçük
Tablo 5. Araştırmada kullanılan Mardin ve Şırnak illeri Zeytin genotipleri çekirdeklerinin Morfolojik özellikleri
No
Çeşitler
Ç .Ağırlık
Ç.Biçim
(Boy/En)
Ç.Simetri
(A)
Max.Çap
(poz B)
1
2
3
4
Gürmeşe3
Darülzaferan
Yurteri5
Yurteri8
Orta(0.43)
Yüksek(0.48)
Çok yüksek(0.98)
Çok yüksek(1.18)
eliptik
eliptik
eliptik
sivri
asimetrik
simetrik
simetrik
asimtrik
5
Y.yurteri2
Yüksek(0.54)
eliptik
6
Paspanos5
Çok yüksek (0.77) eliptik
7
Paspanos4
Yüksek(0.66)
eliptik
8
Paspanos1
Düşük(0.18 gr)
eliptik
9
Eski kale1
Yüksek(0.55)
eliptik
Yarı
simetrik
Yarı
simetrik
Yarı
simetrik
Yarı
simetrik
simetrik
merkez
merkez
merkez
Meyve
burnu
merkez
10
Bakırkıre2
Yüksek(0.629
eliptik
11
Derik psrk1
Orta(0.39)
eliptik
12
13
Derikpark2
Derik21
Düşük(0.13)
Yüksek80.579
eliptik
eliptik
14
15
Derik-24
Derik-16
Düşük(0.29)
Yüksek(0.69)
eliptik
eliptik
16
Derik-20
Yüksek(0.65)
eliptik
17
Derik-22
Yüksek(0.64)
eliptik
18
19
20
Besbin-5
serkani1
Kurtuluş1(çalı form)
Yüksek(0.53)
Düşük(0.21)
x
eliptik
eliptik
x
Yarı
simetrik
Yarı
simetrik
simetrik
Yarı
simetrik
asimetrik
Yarı
simetrik
Yarı
simetrik
Yarı
simetrik
simetrik
simetrik
x
Ç.Tamamla Sap
nış şekli
çukuru
Şekil B)
yuvarlak
yuvarlak
yuvarlak
yuvarlak
sivri
düz
sivri
yuvarlak
Çekirdek uç
durumu
Çekirdek
yüzeyi
Lif durumu Lif dağılımı
düz
düz
iğneli
iğneli
dalgalı
pürüzlü
pürüzlü
pürüzlü
var
var
var
var
düzenli
düzenli
düzensiz
düzenli
sivri
yuvarlak
iğneli
pürüzlü
var
düzenli
merkez
yuvarlak
yuvarlak
düz
dalgalı
var
düzenli
merkez
yuvarlak
yuvarlak
düz
pürüzlü
var
düzenli
Meyve
burnu
Meyve
burnu
Meyve
burnu
merkez
yuvarlak
yuvarlak
düz
pürüzlü
var
düzenli
yuvarlak
yuvarlak
düz
dalgalı
var
Düzensi<z
yuvarlak
yuvarlak
düz
dalgalı
var
düzenli
sivri
yuvarlak
iğneli
pürüzlü
var
düzenli
merkez
merkez
yuvarlak
yuvarlak
yuvarlak düz
yuvarlAK düz
pürüzlü
pürüzlü
var
Var
düzenli
üzenli
merkez
Meyve
burnu
merkez
yuvarlak
sivri
yuvarlak
sivri
düz
iğneli
pürüzlü
pürüzlü
var
var
düzenli
düzenli
sivri
yuvarlak
iğneli
dalgalı
var
düzenli
merkez
yuvarlak
yuvarlak
düz
pürüzlü
var
düzenli
merkez
merkez
x
sivri
yuvarlak
x
yuvarlak
yuvarlak
x
düz
düz
x
pürüzlü
pürüzlü
x
var
var
x
düzenli
düzenli
x
No
Çeşitler
Ç .Ağırlık
Ç.Biçim
(Boy/En)
Ç.Simetri
(A)
Max.Çap
(poz B)
21
Kızılsu-3
Çok yüksek(0.73)
eliptik
22
23
24
Akdizgin-3
Akdizgin-4
Deran-1
Orta(0.38)
x
Orta(0.35)
eliptik
x
eliptik
25
26
x
x
x
x
düşük(0.37 gr)
Orta(0.42)
Çok Yüksek(0.72)
x
Yüksek(0.61)
eliptik
eliptik
eliptik
x
eliptik
Çok yüksek(0.73)
Yüksek(0.60)
Orta(0.34)
41
Deran-5(çalı)
Deran-3(çalı
formI)
Zıron-5
Zıron-6
Zıron-3
Zıron-9
Yukarı zıron2
Zıron-2
Zıron-4
Nevalohasko8
Nevalohasko6
Nevalohasko11
Nevalohasko1
Avena deresi1
Avena dersi2
Avena
dersesi-3
Razemazin-2
Yarı
simetrik
asimetrik
x
Yarı
simetrik
x
x
42
43
mıla esik-1
Acelilsen-2
27
28
29
30
31
32
33
34
35
36
37
38
39
40
Çekirdek uç
durumu
Çekirdek
yüzeyi
Lif durumu Lif dağılımı
merkez
Ç.Tamamla Sap
nış şekli
çukuru
Şekil B)
sivri
yuvarlak
iğneli
pürüzlü
var
Düzenli
merkez
x
merkez
yuvarlak
x
yuvarlak
sivri
x
sivri
iğneli
x
düz
pürüzlü
x
pürüzlü
var
x
var
düzenli
x
Düzenli
x
x
x
x
x
x
x
x
x
x
x
x
x
X
yarı simetrk
simetrik
simetrik
x
asimetrik
merkez
merkez
merkez
x
merkez
küçük
yuvarlak
sivri
x
yuvarlak
yuvarlak
yuvarlak
sivri
x
yuvarlak
yuvarlak
düz
düz
x
düz
pürüzlü
pürüzlü
pürüzlü
x
pürüzlü
var
var
var
x
var
düzenli
Düzenli
düzenli
x
düzenli
eliptik
eliptik
eliptik
simetrik
simetrik
simetrik
merkez
merkez
merkez
sivri
yuvarlak
yuvarlak
sivri
yuvarlak
yuvarlak
düz
düz
düz
pürüzlü
pürüzlü
pürüzlü
var
var
var
düzenli
düzenli
düzenli
Yüksek(0.64)
eliptik
asimetrik
sivri
yuvarlak
iğneli
pürüzlü
var
düzenli
Yüksek(0.54)
eliptik
Meyve
burnu
merkez
sivri
sivri
iğneli
pürüzlü
var
düzenli
Yüksek(0.61)
eliptik
sivri
yuvarlak
düz
pürüzlü
var
düzenli
Orta(0.41 gr)
eliptik
Yarı
simetrik
Yarı
merkez
simetrik
yarısimetrik merkez
yuvarlak
yuvarlak
düz
pürüzlü
var
düzenli
Yüksek(0.70 gr)
eliptik
Sap bölgesi
yuvarlak
düz
düz
pürüzlü
yok
yok
Yüksek(0.64 gr)
eliptik
Yarı
simetrik
asimetrik
sivri
yuvarlak
iğneli
pürüzlü
var
düzenli
Orta (0.38 gr)
yumurta
Meyve
burnu
merkez
yuvarlak
yuvarlak
düz
pürüzlü
var
düzenli
Orta(0.42 gr)
Ço yüksek80.769
eliptik
eliptik
merkez
Sap bölgesi
sivri
sivri
yuvarlak
düz
iğneli
iğneli
pürüzlü
pürüzlü
var
Var
düzensiz
düzenli
Yarı
simetrik
simetrik
simetrik
No
Çeşitler
Ç .Ağırlık
44
45
46
Zinnar-5
Zinnar-4
Zinnar-3
47
Ç.Biçim
(Boy/En)
Ç.Simetri
(A)
Max.Çap
(poz B)
Çekirdek uç
durumu
Çekirdek
yüzeyi
Lif durumu Lif dağılımı
Çok yüksek(0.739 eliptik
Çok yüksek(0.819 eliptik
Düşük(0.27)
eliptik
Ç.Tamamla Sap
nış şekli
çukuru
Şekil B)
yuvarlak
yuvarlak
yuvarlak
yuvarlak
sivri
sivri
düz
düz
iğneli
pürüzlü
pürüzlü
pürüzlü
var
var
var
düzenli
düzenli
düzenli
Derik- 23
Çok yüksek(0.70)
sivri
sivri
iğneli
pürüzlü
var
düzenli
48
Uslu
orta
yuvarlak
iğneli
pürüzlü
var
düzenli
49
50
oval
oval
simetrik
asimetrik
merkez
Sap bölgesi
sivri
sivri
iğneli
iğneli
pürüzlü
pürüzlü
var
var
düzenli
düzensiz
51
Orta (0.52 gr)
Gemlik
küçük
Manzanilla
des harmanes
Silifke yağlık orta (0,55 gr)
Dar
yuvarlak
sivri
sivri
eliptik
asimetrik
yuvarlak
yuvarlak
iğneli
Pürüzsüz
var
düzensiz
52
Adana topağı İri (0.63 gr)
yuvarlak
simetrik
Meyve
burnu
merkez
Dar
yuvarlak
yuvarlak
iğneli
pürüzlü
var
düzenli
Yaı simetrik merkez
simetrik
merkez
simetrik
Meyve
burnu
Sivri
asimetrik
Meyve
burnu
Uzun oval asimetrik
merkez
Kaynaklar
Barranco, D., Trujillo I., Rallo, P. 2000. Are „Oblanga‟ and „Frantoio‟ Olives The Same Cultivar.
Hortscience. Vol. 35 (7).
Bogani, P., Cavalieri,D., Petrucelli, R., Polsinelli,R., Roselli,G. 1994. Identification of olive
cultivars by random amplified polymorphic DNA.Acta HORT.356,98-101.
Claros, G. M., Crespillo, R., Aquilar, M. L. 2000. DNA Fingerprinting and Classification of
Geographically Related Genotypes of Olive Tree Euphytica 116. 131-142p.
Dölek, B. 2003. Erdemli, Silifke ve Mut ilçelerinde Yetiştiriciliği Yapılan Sofralık ve Yağlık Zeytin
Çeşit ve Tiplerinin Morfolojik, Fenolojik ve Pomolojik Özelliklerinin Belirlenmesi . Ç.Ü. Fen
Bilimleri Enstitüsü Bahçe Bitkileri Ana Bilim Dalı Yüksek Lisans Tezi, Adana
Fabbri, A., Hormoza, J. J., Polito, V. S. 1995. Random Amplified Polymorphic DNA Analysis of
Olive Cultivars. J. Amer. Soc. Hort. Sci. 120(3) : 528-542.
Özkaya, M.T., Cakir, E., Gokbayrak, Z., Ercan, H. and Taskin, N.2006. “Morphological and
molecular characterization of Derik Halhali olive (Olea europaea L.) accessions grown in Derik–
Mardin province of Turkey” Scientia Horticulturae, 108(2) 205-209.2006.
Özkaya,M.T., Ergülen,E., Ülger,S. and Özilbey,N., 2004. “Genetic and Biologic Characterization
of Some Olive (Olea europaea L.) Cultivars Grown in Turkey” Tarım Bilimleri Dergisi, 10(2)
231-236, 2004.
Pontikis, C. A., Loukas, M., Kousounis, G. 1980. The Use of Biochemical Markers to Distinguish
Olive Cultivars. Journal of Horticultural Science. 55:333-343.
Quazzani, N., Lumaret, N. R., Villemur, P., di Giusto, F. 1993. Leaf allozyme variation in
cultivated and wild oive tree. J.Hered.84,34-42.
Rallo, L., Dorado, G., Martin, A. 2000. Development of Simple Sequence Repeats (SSRs) in Olive
Tree (olea europaea L.) Theor. Appl.Genet., 101.984-989 p.
Saghai Maroof,M.A., Soliman,K.M., Jorgensen,R.A., Allard, R.W., 1984. Ribosomal DNA spacer
length polymorphisms in barley: Mendelian inhertance, chromosomal location and population
dynamics. Proc. Natl. Acad. Sci. USA 81, 8014-8018.
Trujillo, I., Rallo, L., Arus, P. 1995. Identifying Olive Cultivars by İsozyme Analysis. J.
Amer.Soc.Hort.Sci., 120(2): 318-324.
Download

Dosyayı İndir