Bakanlık Yayın No: 339
Müdürlük Yayın No: 32
TÜRKİYE’DEKİ SIĞLA (Liquidambar orientalis Miller)
POPULASYONLARININ GENETİK YAPISININ MOLEKÜLER
BELİRTEÇLERLE BELİRLENMESİ VE KORUMA STRATEJİLERİ
GELİŞTİRİLMESİ
ODC: 165.3
Determination of Genetic Diversity and Gene Conservation Strategies for
Oriental Sweetgum (Liquidambar orientalis Miller) Populations in Turkey
by Molecular Markers
Ercan VELİOĞLU
Dr. Burcu ÇENGEL
Dr. Gaye KANDEMİR
Dr. Yasemin TAYANÇ
Dr. Murat ALAN
Prof. Dr. Zeki KAYA
TEKNİK BÜLTEN NO: 20
T.C.
ÇEVRE ve ORMAN BAKANLIĞI
ORMAN AĞAÇLARI VE TOHUMLARI ISLAH ARAŞTIRMA
MÜDÜRLÜĞÜ
FOREST TREE SEEDS AND TREE BREEDING RESEARCH
DIRECTORATE
ANKARA-TÜRKİYE
ISBN: 978-605-393-019-8
ÖNSÖZ
Biyolojik zenginliklerimizden biri olan endemik sığla ağacının önemi
günümüzde diğer ülkeler tarafından da anlaşılmış ve Avrupa Gen Kaynakları
Programı (EUFORGEN) tarafından değerli yapraklı ağaçlar grubuna dahil
edilmiştir. Bu tür sınırlı yayılış göstermesinden dolayı, korunması ve
işletilmesine daha çok özen gösterilmesi yerinde olacaktır. Doğal
populasyonların genetik yapılarının anlaşılması gen koruma çalışmalarını
kolaylaştıracaktır, çünkü genetik çeşitlilik orman ağaçları populasyonları
için önemli bir niteliktir. Populasyonlar arası ve populasyon içi genetik
çeşitlilik genetik kaynakların korunma ve yönetimi açısından önemli olduğu
kadar, ıslah ve silvikültür uygulamalarına temel teşkil ettiği için de önem
taşımaktadır.
Bu çalışma, TUBİTAK, Tarım Ormancılık ve Veterinerlik Araştırma
Grubu tarafından desteklendiği için (TOVAG -1040 O 154) TUBİTAK’a
teşekkür ederiz.
Araştırma kapsamında, 18 populasyondan örnek toplanması
aşamasında yardımlarını esirgemeyen Süleyman Işık DERİLGEN, Belkıs
KORKMAZ, Rumi SABUNCU, Osman EŞE ve aramızdan zamansız ayrılan
Murat NUR’a teşekkür ederiz. Ayrıca, bu zahmetli ve masraflı çalışmada
sorunların üstesinden gelmemize yardımcı olan başta Müdürümüz Sadi
ŞIKLAR ve Müdür Yardımcımız Dr. Hikmet ÖZTÜRK’e, Bakanlığımız
taşra teşkilatına ve laboratuvar çalışmalarına katkıda bulunan Aslı
ÖZDİLEK ve Özlem SARIGİL’e teşekkürü bir borç biliriz.
Ankara, 2008
Ercan VELİOĞLU
Dr. Gaye KANDEMİR
Dr. Yasemin TAYANÇ
Dr. Burcu ÇENGEL
Dr. Murat ALAN
Prof. Dr. Zeki KAYA
i
İÇİNDEKİLER
ÖNSÖZ ………………………………………………………………………
İÇİNDEKİLER……………………………………………………………….
ÖZ…………………………………………………………………………….
ABSTRACT………………………………………………………………….
ŞEKİLLER ve ÇİZELGELER DİZİNİ …………………………………….
1. GİRİŞ........................................................................................……….......
2. LİTERATÜR ÖZETİ.........................................................……………......
3. MATERYAL ve YÖNTEM.............................................………………....
3.1. Populasyonların Tanıtımı ve Örneklenmesi .....................................
3.2. RAPD Analizi.......................................................................….....
3.2.1. DNA İzolasyonu....................................... ..............................
3.2.2. DNA Konsantrasyonunun Belirlenmesi..................................
3.2.3. RAPD Primerleri.....................................................................
3.2.4. RAPD-PCR Koşulları .............................................................
3.2.5. Jellerin Yorumlanması............................................................
3.2.6. Veri Analizi ............................................................................
3.2.6.1. Allel Frekansları............................................................
3.2.6.2. Allel Sayısı....................................................................
3.2.6.3. Etkili Allel Sayısı..........................................................
3.2.6.4. Heterozigotluk...............................................................
3.2.6.5. Polimorfik Lokus Oranı.................................................
3.2.6.6. Shannon Sabiti...............................................................
3.2.6.7. Genetik Çeşitliliğin Yapılanması..................................
3.2.6.8. Populasyonlar Arası Genetik Mesafe…………………
3.3. Kloroplast Genomu rps16 Bölgesi....................................................
3.3.1. Kloroplast rps16 Primerleri.....................................................
3.3.2. Kloroplast rps16 Bölgesi PCR Koşulları................................
3.3.3. Jellerin Yorumlanması............................................................
3.3.4. Veri Analizi………………………………………………….
3.4. Çekirdek Ribozomal DNA ITS Bölgesi………..…………… ……
3.4.1. ITS Primerleri..........................................................................
3.4.2. ITS Bölgesi PCR Koşulları.....................................................
3.4.3. Jellerin Yorumlanması............................................................
3.4.4. Veri Analizi………………………………………………….
4. BULGULAR ve TARTIŞMA .....................................................................
4.1. Populasyonların Genetik Yapısı........................................................
4.2. Genetik Çeşitlilik...............................................................................
ii
i
ii
iv
v
vi
1
5
7
7
8
8
9
9
9
10
10
11
11
11
11
12
12
12
13
14
14
15
15
16
16
17
17
18
18
19
19
19
4.2.1. Allelik Zenginlik.....................................................................
4.2.2. Heterozigotluk.........................................................................
4.2.3. Polimorfik Lokus Oranı..........................................................
4.2.4. Shannon Sabiti.........................................................................
4.2.5. Genetik Çeşitliliğin Yapılanması..............…………...……...
4.2.6. Populasyonlar Arası Genetik Mesafe .....................................
4.3. Kloroplast rps16 Bölgesi...................................................................
4.3.1. Populasyon İçi Genetik Mesafe (p-distance)........................
4.3.2. Minimum Farklılaşma Ağacı................................................
4.4. Çekirdek Ribozomal DNA ITS Bölgesi …………………………..
5. SONUÇ ve ÖNERİLER ..............................................................................
ÖZET ...............................................................................................................
SUMMARY ....................................................................................................
KAYNAKÇA ..................................................................................................
iii
19
20
20
20
22
25
28
28
29
30
32
34
35
36
5
ÖZ
Bu çalışmada, ülkemizdeki sığla (Liquidambar orientalis Miller)
populasyonlarındaki genetik çeşitlilik RAPD, çekirdek ribozomal DNA
(ITS) ve kloroplast (rps16) belirteçleri kullanılarak belirlenmiştir. Bu
amaçla, sığlanın tüm doğal yayılış alanını kapsayacak şekilde 18 populasyon
belirlenmiştir. Bu meşcerelerden 25’er ağaçtan yaprak örnekleri toplanmıştır.
Yapraklardan elde edilen DNA’lar RAPD belirteçleriyle taranarak
populasyonların genetik çeşitlilik parametreleri belirlenmiştir. Ayrıca ITS ve
kloroplast rps16 bölgelerinin dizi analizleriyle minimum farklılaşma ve
yakın bağlantı ağaçları oluşturulmuştur.
Çalışılan 10 RAPD primeriyle 75 polimorfik lokus elde edilmiştir.
Ortalama polimorfik lokus oranı %45, ortalama heterozigotluk 0.17±.02 ve
etkili allel sayısı 1.30±.04 olarak hesaplanmıştır. Elde edilen sonuçlar diğer
yapraklı ağaç türleriyle karşılaştırıldığında, oldukça düşüktür. Ayrıca,
populasyonlar arası genetik farklılaşmayı gösteren GST değeri 0.54’dür, yani
toplam genetik çeşitliliğin % 54’ü populasyonlar arasında, kalan % 46’sı ise
populasyonlar içerisindedir. Populasyonlar arası gen akışını gösteren Nm
değeri 0.42 olup, kritik gen akışı değerinin (0.5) altındadır. Tahmin edilen
tüm bu parametreler sığla populasyonlarında genetik çeşitliliğin oldukça
düşük, populasyonlar arası farklılaşmanın ise oldukça yüksek olduğunu
göstermektedir.
Sonuç olarak; RAPD belirteçleriyle elde edilen genetik çeşitlilik
parametreleri ile, ITS ve kloroplast rps16 bölgesi dizi analiziyle elde edilen
veriler ışığında, koruma stratejileri önerilmiştir. Köyceğiz-Köyceğiz ve
Marmaris-Değirmenyanı populasyonlarının in-situ korunması önerilmiştir.
Ayrıca, yüksek genetik çeşitliliğe sahip olan populasyonlar ve minimum
farklılaşma ağacında en çok farklılık gösteren populasyonların (AcıpayamBozdağ, Muğla-Yılanlı, Marmaris-Günnücek, Köyceğiz-Köyceğiz, MuğlaKıyra, Marmaris-Değirmenyanı, Muğla-Yatağan, Fethiye-Günlükbaşı) exsitu koruma altına alınması önerilmiştir.
Anahtar kelimeler: Liquidambar orientalis, sığla, genetik çeşitlilik, RAPD
belirteçleri, ITS, kloroplast rps16 bölgesi, in-situ ve ex situ koruma
iv
ABSTRACT
In this study, genetic diversity of sweet gum (Liquidambar orientalis
Miller) populations was investigated by means of RAPD, nuclear ribosomal
DNA (ITS) and chloroplast (rps16) markers. For this purpose, 18
populations were selected to cover all distribution area of sweet gum. Leaf
samples were collected from 25 trees from each population. DNA’s isolated
from leaves were used to screen populations with RAPD markers so that
genetic diversity parameters to be determined. Moreover, ITS and
chloroplast rps16 region’s sequence analysis was used to construct minimum
spanning and neighbour joining trees.
Ten RAPD primers generated 75 polymorphic loci. Percentage of
polymorphic loci was 45 %; number of effective alleles was 1.30±.04; mean
heterozygosity value was 0.17±.02. These values are generally low when
compared to other broad-leaves. Fifty four percent of genetic diversity was
contained among populations meaning that 46% contained within
populations. Gene flow value was estimated as 0.42 which was below the
critical (0,5) value. All these parameters state that genetic diversity of the
sweet gum populations is low and populations are differentiated
considerably with each other.
Results obtained by RAPD markers, ITS and chloroplast rps16
sequence data were employed to propose conservation strategies for sweet
gum. Köyceğiz-Köyceğiz and Marmaris-Değirmenyanı populations were
recommended for in situ conservation. Eight populations were determined
for ex situ conservation (Acıpayam -Bozdağ, Marmaris-Değirmenyanı,
Muğla-Yılanlı, Marmaris-Günnücek, Muğla-Kıyra, Köyceğiz-Köyceğiz,
Fethiye-Günlükbaşı, Muğla-Yatağan) due to their high genetic diversity
values and differentiation in minimum spanning tree.
Key Words: Liquidambar orientalis, sweet gum, genetic diversity, RAPD
markers, ITS, chloroplast rps16 region, in-situ and ex situ conservation.
v
ŞEKİLLER ve ÇİZELGELER DİZİNİ
Şekiller
Şekil 1. Bu çalışma için örneklenen sığla populasyonları................................
Şekil 2. Çekirdek ribozomal DNA ITS bölgesi ...............................................
Şekil 3. Nei’nin genetik mesafe değerleriyle oluşturulan dendrogram............
Şekil 4. Bozdağ ve Pamucak populasyonlarında CpDNA rps16 bölgesi
bantları..............................................................................................................
Şekil 5. CpDNA rps16 bölgesi verileriyle oluşturulan minimum farklılaşma
ağacı.................................................................................................................
Şekil 6. Çekirdek ribozomal DNA ITS bölgesi verileriyle oluşturulan yakın
bağlantı ağacı....................................................................................................
Çizelgeler
Çizelge 1. Çalışılan sığla populasyonlarının tanıtımı.......................................
Çizelge 2. Sığla için kullanılan RAPD primerleri............................................
Çizelge 3. RAPD primerleri için kullanılan PCR tepkime karışımı................
Çizelge 4. RAPD primerleri için kullanılan PCR döngüsü..............................
Çizelge 5. CpDNA rps16 bölgesi için kullanılan primerler.............................
Çizelge 6. CpDNA rps16 bölgesi için kullanılan PCR tepkime karışımı........
Çizelge 7. CpDNA rps16 bölgesi için kullanılan PCR döngüsü.....................
Çizelge 8. ITS bölgesi için kullanılan primerler .............................................
Çizelge 9. ITS bölgesi için kullanılan PCR tepkime karışımı.........................
Çizelge 10. ITS bölgesi için kullanılan PCR döngüsü ...................................
Çizelge 11. RAPD primerlerinin ürettiği polimorfik bant sayısı.....................
Çizelge 12. Sığla için 10 RAPD primeriyle hesaplanan genetik çeşitlilik
değerleri………………................................................................................…
Çizelge 13. RAPD belirteçleriyle herbir lokus için hesaplanan gen
çeşitliliği ve genetik farklılaşma ve gen akışı değerleri...................................
Çizelge 14. RAPD belirteçleriyle hesaplanan gen çeşitliliği, genetik
farklılaşma ve gen akışı değerleri.....................................................................
Çizelge 15. Nei’nin genetik benzerlik (üst diyagonal) ve genetik mesafe
değerleri (alt diyagonal)...................................................................................
Çizelge 16. rps16 primerleriyle hesaplanan genetik mesafe değerleri............
vi
8
16
26
28
30
31
7
9
10
10
14
15
15
17
17
17
19
20
23
24
27
29
1. GİRİŞ
Ülkemiz ormanları verim güçleri bakımından fakir olmakla birlikte tür
sayısı bakımından oldukça zengindir. Ayrıca doğal türlerimizin önemli bir
bölümü endemik karakterde türlerdir. Endemik türler, ülkemiz florasına
kazandırdıkları önem yanında, ormancılık uygulamalarımız için de ayrı bir
sorumluluk getirmektedir. Zira bu türlere ait bilgilerin ortaya çıkarılması,
öncelikle Türk ormancısına düşen bir görev olduğu belirtilmektedir (ACAR
1988a, DİRİK 1986). Bu türlerimizden birisi de Anadolu sığlası
(Liquidambar orientalis Miller)’dır. Gerek Liquidambar cinsinin yeryüzünde
çok sınırlı alanda yayılış göstermesi (SAMARODOVA-BIANKI 1957),
gerekse tarih boyunca Anadolu ürünü sığla yağının (levant storax)
uluslararası pazarda talep görmesi (ACAR ve ark. 1992), bu ürünü ve
sağlandığı ormanların Türkiye ormancılığı açısından önem ve değerini
ortaya koymaktadır.
Ülkemizde, eskiden amberi sail denilen (ACATAY 1963), bugünse
günlük ağacı ya da sığla ağacı olarak bilinen Liquidambar orientalis,
Hamamelidaceae
familyasının
Bucklandioidae
alt
familyasının,
Liquidambar cinsinin ülkemizde yayılış gösteren türüdür (ÖRTEL 1988).
Liquidambar; Latince liquidus, Arapça amber sözcüklerinin birleşmesinden
meydana gelmiştir ve güzel kokulu sıvı demektir (ÖNAL ve ÖZER 1985).
Liquidambar cinsi 5 türe sahiptir (EFE 1987). Bu türlerden L. formosana ve
L. edentata Çin’de, L. styraciflua ve L. macrophylla Kuzey Amerika’da
yayılış göstermektedir. Bu türlerin hepsi aşağı yukarı aynı enlem
derecelerinde olmak üzere Kuzey Yarıküre’de ılıman kuşakta adacıklar
halinde, kesintili bir yayılış göstermektedir (GOOD 1974). Günümüzde
sadece Anadolu, Amerika ve Çin’de doğal olarak yayılış gösteren
Liqudambar cinsine ait taksonlar; Tebeşir, Tersiyer, Pleistosen, Eosen
jeolojik devirlerinde Kuzey Amerika ve Avrasya’nın geniş bir kesiminde
yayılış göstermekteydi, ancak Buzul çağından sonra bugünkü yayılış
sahalarına çekilmişlerdir (EFE 1987; ACAR ve ark. 1992; AKMAN ve ark.
1992; KETENOĞLU ve ark. 2003). Buzullaşmanın daha az hissedildiği
Anadolu’da bazı korunaklı ve nemli-sıcak iklim koşullarının hüküm sürdüğü
yerlerin bulunması, birçok tersiyer kökenli türü, bu arada Anadolu sığlasını
da günümüze kadar getirebilmiştir. Zaten sığla odunlarının iç morfolojik
özellikleri, türün Angiospermae taksonlarının görülmeğe başladığı jeolojik
dönemlerin sonuna doğru ortaya çıktığını kanıtlamaktadır (EFE 1987).
Ülkemiz için relikt-endemik tür oluşu ile bir dünya mirası olan
Anadolu sığlası, Anadolu’daki doğal yayılışının kuzey sınırını Çine Çayı
boyunca, güney sınırını Eşen Çayının denize yakın kısımlarında, doğu
sınırını Silifke ve batı sınırını da Bodrum dolaylarında yapar (ACAR ve ark.
1
1992; DİRİK 1986). Bu genel yayılış alanı içerisinde esas yayılışı Muğla
yöresindedir. Anadolu sığlası, Ülkemizde Dalaman ve Köyceğiz deltaları ile
denize yakın taban düzlüklerinin genel olarak kuzey rüzgarlarına kapalı,
sıcak ve nemli yerlerinde bulunmaktadır. Sözkonusu yörede çok yüksek yaz
sıcaklıkları, şiddetli buharlaşma, düşük bulutluluk oranı, çok seyrek don ve
kar yağışı karakteristikleri gösteren Akdeniz iklim tipi hüküm sürmektedir
(DİRİK 1986). Ayrıca denize dik uzanan akarsular boyunca iç kesimlere
kadar sokulmakta ve Denizli’nin Acıpayam ilçesi yakınlarında 1000
metrenin üstüne çıkmaktadır. Bu yöre, iklim özellikleri bakımından esas
yayılışını yaptığı Köyceğiz yöresine göre önemli farklılıklar göstermektedir.
Bazı Türk araştırmacıları Anadolu sığlasının Rodos ve Kıbrıs’ta
bulunması sebebiyle endemik olmadığını söylemektedirler, fakat bu türün
eski dönemlerde Rodos ve Kıbrıs’a götürülerek kültüre alındığı
bildirilmektedir (HUŞ 1949; AKMAN 1995).
Ekolojik isteklerinden dolayı sınırlı bir alanda yayılan sığlanın 1940’lı
yıllarda 6312 ha olarak bildirilen toplam alanı (HUŞ 1949), 1980’li yıllarda
1337 ha’a inmiştir (İKTÜEREN ve ACAR 1987). Bu nedenle, Anadolu
sığlası IUCN tehlike kategorilerine paralel olarak hazırlanan listede “doğada
orta vadeli gelecekte yüksek tehdit altında” kategorisinde gösterilmektedir
(EKİM ve ark. 2000). Sığla ormanlarının en büyük tahrip nedeni, toprağın
çok verimli olması nedeniyle yapılan açmalar ve sulama kanallarının taban
suyunu çekmesidir (ÖNAL ve ÖZER 1985; ACAR ve KIZILEL 1988;
KETENOĞLU ve ark. 2003). Ayrıca yakacak odun amacıyla kesilmesi ve
hayvan otlatılması da alan daralmasını etkileyen faktörlerdendir.
Alan daralmasına paralel olarak, sığla ormanlarından elde edilen sığla
yağı üretimi de azalmıştır. 1950 yılında yaklaşık 180 ton olan sığla yağı
üretimi, 1980 yılında 18 tona ve 1990 yılında 1 tona düşmüştür. 2006 yılında
sadece 127 kg yağ üretimi yapılmıştır. Ülkemiz 80’li yıllara kadar sığla yağı
üretimi açısından monopol ağaç olma niteliğinde iken, bugün bu niteliğini
yitirmiştir (ATAY 1985). 1918 yılına kadar pazarda sadece Türk Sığla Yağı
bulunmasına karşın, 1. Dünya Savaşı nedeniyle sığla yağının
pazarlanamamasından dolayı, Liquidambar styraciflua’dan balzam üretimi
(sweet-gum, red-gum) başlamıştır (ACAR 1988b; ÇETİNTAŞ 1990).
Amerikan storax üretimi, Honduras ve Guatemala’da yapılmaktadır. Pazar
payının dolayısıyla üretimin azalmasının bir nedeni de; sığla yağı doğal
yapısı korunarak, temiz şekilde üretilip, pazara sunulması gerekirken, güncel
yöntemle elde edilen sığla yağının bu nitelikleri taşımamasıdır (GÜL 1986).
Anadolu sığlasının kabuklarından elde edilen sığla balzamı (storax) ve
bu balzamın uçuculaşan kısmı yani eterik yağı (styrax) çok eski çağlardan
beri bilinen bir materyaldir (ACAR 1988b). Batık Fenike gemilerinde içi
2
sığla yağı ile dolu amforaların çıkması, Akdeniz ticaretinde sığla yağının
önemli bir yer tuttuğunu göstermektedir. Farmakolojik olarak geniş kullanım
alanına sahip olan bu balzam, Avrupa’da ilaç olarak kullanılmaya 17.
Yüzyılda başlamıştır (HUŞ 1949). Halk arasında sığla yağı diye bilinen bu
balzamın diğer bir kullanım alanı da, kozmetik sektörüdür. Mısır
piramitlerindeki mezarlarda sığla yağının kokusu günümüze kadar gelmiştir
(ACAR 1988b). Ayrıca iyi bir antiseptik ve parazitlere karşı etkilidir (HUŞ
1949). Ciltte yumuşatıcı, iltihap giderici ve yara iyi edici etkileri
bulunmaktadır. Halk tarafından özellikle mide rahatsızlıklarında
kullanılmaktadır. Sabun ve kimya sanayinin de hammaddesidir. Buhur
denilen, yağı alınmış kapçıklar ise cami ve kiliselerde hoş koku verdiği için
kullanılmaktadır. Amerikada yetişen L. styraciflua odunu kereste üretiminde
ikinci sırayı almasına karşın, Anadolu sığlası yakacak odunu yanında, sadece
saban ve bazı küçük el aletleri yapımında kullanılmaktadır.
AKMAN (1995)’e göre, sığla orman yapısının Akdeniz bölgesinde bir
eşdeğeri bulunmamaktadır. Liquidambar orientalis formasyonları Türkiye
için birinci derecede önemli biyolojik ve ekolojik çevre oluşturmaktadır
(ACAR ve ark. 1992; AKMAN 1995; KETENOĞLU ve ark. 2003). Ayrıca
Anadolu sığlası 2001 yılında EUFORGEN (European Forest Genetic
Resources Program) tarafından değerli yapraklılar (Noble Hardwoods)
grubuna alınarak, Avrupa çapında korunacak bir tür olarak kabul edilmiştir
(ALAN ve KAYA 2003).
Tarım bitkilerinin aksine, orman ağaçları çağlar boyu oluşmuş doğal
yapısı değiştirilmemiş, çok zengin genetik çeşitliliğe sahiptir (PERRY 1978;
NAMKOONG ve ark. 1980; IŞIK 1988). Tür içindeki genetik varyasyon;
evrimsel güçler, türün üreme şekli gibi çok farklı ve karmaşık faktörlerin ve
bunların etkileşimlerinin sonucu olarak ortaya çıkmaktadır. Bu nedenle bilgi
üretmeden karmaşık ve dinamik bir kaynağı yönetmek, biyolojik bir
kaynaktan optimum bir şekilde ve devamlılık prensipleri içinde yararlanmak
olanaksızdır (COSSALTER 1989). Tür içinde, populasyon düzeyinde ve
populasyon içinde ne kadar fazla genetik çeşitlilik varsa, türün veya
populasyonların değişen çevre şartlarına uyum olasılığı o kadar yüksektir.
Anadolu sığlası, yayılış alanlarını hızla kaybetmesi nedeniyle yok olma
tehlikesiyle karşı karşıyadır (ÖZKAHRAMAN 1984; ÖNAL ve ÖZER
1985; EFE 1987; ÖRTEL 1988; ACAR ve ark. 1992; GÜNER ve ark. 1993).
Türlerin genetik çeşitliliğinin ve yapısının belirlenmesi, gen kaynaklarının
etkili korunması açısından önem taşımaktadır (MILLAR ve MARSHALL
1991), çünkü genetik çeşitlilik çalışmaları, gerek ıslah, gerekse korumaya
alınacak populasyonların seçiminde yol göstericidir (CONKLE 1980;
LEDIG 1998).
3
RAPD (Random Amplified Polymorphic DNA) belirteçleri genetik
çeşitlilik belirlemesinde, ıslah ve koruma stratejilerinin oluşturulmasında
oldukça sık kullanılan moleküler belirteçlerdir (NEALE ve ark. 1992;
RUSSEL ve ark. 1993; KEIL ve GRIFFIN 1994; ROSETTO ve ark. 1995).
Kloroplast DNA’sı, izole edilmesinin kolaylığı, genlerin çoğunlukla
tek kopya olarak yer alması ve mutasyon hızının yüksek olması nedeniyle
bitki filogenetik çalışmalarında sıklıkla kullanılmaktadır (LIANG 1997).
Kloroplast DNA’sının farklı bölümleri farklı hızlarla evrimleştiğinden,
çeşitli taksanomik gurupların ayrımına olanak tanımaktadır.
Genetik çalışmaların eksikliği; gerek ıslah çalışmalarında, gerekse gen
kaynaklarını koruma çalışmalarında etkin yöntem ve program belirlemeyi
güçleştirmektedir. Anadolu sığlası ülkemizin relikt-endemik ağaç türlerinden
biri olmasına rağmen, genetik çeşitliliğine yönelik araştırma
bulunmamaktadır. Halbuki gelişmiş ülkelerde uzun yıllardan beri
ağaçlandırma, ıslah ve koruma çalışmalarına yön verebilmek amacıyla
genetik çeşitlilik çalışmaları yapılmaktadır (ANONİM 1995). Anadolu
sığlası için de bu yönde çalışmalar yapılması önerilmektedir (ÖNAL ve
ÖZER 1985; DİRİK 1986; ACAR 1988a).
Anadolu sığlası, arzu edilen niteliklere sahip kalıtsal varyasyonlar
bakımından ümit verici bir potansiyele sahip olması, sınırlı bir alanda yayılış
göstermesi, relikt-endemik bir tür olması, alanlarının her geçen gün azalarak
yok olma noktasına gelmesi, ekonomik önemi yanında, Ülkemiz için birinci
derecede önemli biyolojik ve ekolojik çevre oluşturması nedeniyle, etkili bir
koruma stratejisi geliştirmek gerekmektedir. Bu çalışma, Anadolu sığlasının
genetik çeşitliliğinin belirlenmesi ve sonuçlarına göre koruma stratejisi
geliştirmek amacıyla yapılmıştır.
4
2. LİTERATÜR ÖZETİ
Anadolu sığlası ile ilgili olarak ilk yayın BERKEL ve HUŞ (1944)
tarafından yapılmıştır. Yağının önemi dolayısıyla daha çok bu konudaki
araştırmalarda yoğunlaşılmıştır (HUŞ 1947; HUŞ 1949; TOPÇUOĞLU
1947; TOPÇUOĞLU 1950; TOPÇUOĞLU 1968; TANKER ve SAYRON
1974; HAFIZOĞLU 1982; ÖNAL ve ÖZER 1985; GÜL 1986; ACAR
1988b; DURU ve ark. 2002; İSTEK ve HAFIZOĞLU 2004; İSTEK ve
HAFIZOĞLU 2005). Türün morfolojisi, yayılış alanları, sitotaksonomisi,
anatomik yapısı, silvikültürü ve doku kültürü konularına yönelik çalışmalar
da bulunmaktadır (BERKEL 1955; PAMUKOĞLU 1964; PEŞMEN 1972;
KESERCİOĞLU 1973; GOOD 1974; AYKIN 1976; ANONİM 1984;
ATAY 1985; DİRİK 1986; EFE 1987; ACAR 1988a; İŞÇİ 1988; ÖRTEL
1988; BOZKURT ve ark. 1989; BOZKURT ve ark. 1990; AKMAN ve ark.
1992; GENÇ ve ark. 1993; GENÇ 1994; GENÇ 1999; ALAN ve KAYA
2003; FAKİR ve DOĞANOĞLU 2003; FAKİR 2005). Ayrıca Anadolu
sığlasını tanıtıcı ve yok olmasına dikkat çeken makaleler bulunmaktadır
(ANONİM 1984; ÖZKAHRAMAN 1984; ACAR ve KIZILEL 1988;
ÇETİNTAŞ 1990; YÜCEL 1991; ACAR ve ark. 1992; EFE ve DİRİK 1992;
GÜNER ve ark. 1993; TETİK ve ŞİRİN 2002; KETENOĞLU ve ark. 2003).
Fakat ülkemizdeki Anadolu sığlasının populasyon genetiğine yönelik
araştırma yoktur.
DAVIS (1972)’e göre Türkiye’de Anadolu sığlasının orientalis ve
integriloba olarak iki varyetesi bulunmaktadır. Birincisi; Aydın ili Emirdağ
ve Çine, Muğla ili Milas, Selimiye, Fethiye ve Göcek dolaylarında, ikincisi
ise; Muğla ili Datça, Marmaris, Fethiye ile Kaş ve Kalkan dolaylarında
yayılış göstermektedir (ÖNAL ve ÖZER 1985; İKTÜEREN ve ACAR
1987). PEŞMEN (1972), “Flora of Turkey” için yapmış olduğu revizyon
çalışmasında var. orientalis yapraklarının bazılarında kama şeklinde bir
terminal lop ile 2-4 adet birbirine karşılıklı, 3 köşeli lateral tohum
bulunduğunu; var. integriloba yapraklarının ise hepsinin bölünmediğini,
geniş yumurta şeklinde, sivri uçlu loblu olduğunu belirtmesine karşın, EFE
(1987) arazi çalışmaları sırasında söz konusu iki varyatenin varlığını
doğrulayıcı örneklere rastlamadığını bildirmiştir.
Anadolu sığlasının ovada yayılış gösteren tiplerine “taban günlüğü”,
yüksek rakımda bulunanlara ise “dağ günlüğü” denilmektedir (BERKEL
1955). EFE (1987) ise odun elementlerinin boyut ve sayılarında yükseklik
açısından fark bulunmadığını, fakat batıdan doğuya gidildikçe çatallı
perforasyon basamak sayılarının arttığını, kuraklık artıkça trahelerde çatalsız
perforasyon basamak sayılarının azaldığını belirtmektedir. Geleneksel
üretimde çalışan işçiler Anadolu sığlasını yağ verimine göre “veren günlük”
5
ve “sağır günlük” diye ayırmaktadırlar (ACAR 1988b). EFE (1987)
çalışmasında yağ vermeyen bireylerin daha derin çatlaklı, küçük pullu ve
koyu renkli olduğunu belirtmiştir.
HOEY ve PARKS (1991), 41 populasyonda izoenzim varyasyonunu
saptadığı çalışmada, Kuzey Amerika ve Anadolu türlerinin kıtalar arası
(intercontinental) yakın akraba türlerden olduğu sonucuna varmıştır. Yine
HOEY ve PARKS (1994)’ın Doğu Amerika ve Meksika’dan aldığı L.
styraciflua örnekleriyle, Çin’den aldığı L. acalycina ve L. formosana ile
yaptığı çalışmada; genetik çeşitliliğin herbir tür için benzer olduğunu tespit
etmiştir. Ayrıca LI ve BOGLE (1997) ve LI ve ark. (1999), kloroplast DNA
çalışmalarında, L. styraciflua ve L. orientalis’in birbirlerine yakın akraba
(kardeş tür) olduklarını ortaya koymuştur.
SHI ve ark. (1998) tarafından Hamamelidaceae familyasına ait 15
türde ITS belirteçleri kullanılarak yapılan çalışmada, bu ailenin filogenetik
yapılanması yeniden oluşturulmuştur. Bu araştırmada Liquidambar cinsine
ait iki tür (L. styraciflua, L. formosana) yer almıştır. Elde edilen veriler
ışığında Liquidambar cinsinin parafiletik olabileceği sonucuna varılmıştır.
SHI ve ark. (2001) tarafından Hamamelidaceae familyasında cpDNA,
matK, PY-IGS ve ITS belirteçleri kullanılarak 3 cinse ait 14 türle
çalışılmıştır. Araştırmaya Liquidambar cinsinden; acalycina, formosana,
styraciflua ve orientalis türlerine ait bireyler dahil edilmiştir. Elde edilen
verilere göre; L. styraciflua ve L. orientalis türleri ile L. acalycina ve L.
formosana tür çiftleri arasında daha yakın akrabalık olduğu sonucuna
varılmıştır. Bu türlerin birbirlerinden oldukça farklılaştığı, bu yüzden de aynı
cins altında toplanmaması gerektiği sonucuna da varılmıştır.
Bu çalışmada kullanılan populasyonlarla kloroplast DNA
kodlanmayan transfer ribonükleik asit (trn) bölgesi kullanılarak yapılan bir
başka araştırmada; moleküler çaşitlilik parametreleri belirlenerek minimum
farklılaşma ağacı oluşturularak, Marmaris-Günnücek, Fethiye-Günlükbaşı,
Muğla-Kıyra, Acıpayam-Alcı, Marmaris-Değirmenyanı ve Muğla-Yılanlı
populasyonları ex situ koruma için önerilmiştir (OR 2007). Yine aynı
populasyonlarla yapılan diğer bir çalışmada, kloroplast DNA matK
bölgesinin dizi analiziyle varyeteler arasındaki genetik farklılaşma
belirlenmeye çalışılmıştır (ÖZDİLEK 2007). Bu çalışma sonuçlarına göre,
en fazla sayıda polimorfik bölgeye sahip populasyon Fethiye-Günlükbaşı
olup, varyeteler arasında belirgin bir ayrışma gözlenmemiş ve tüm sonuçlar
gözönüne alınarak; Fethiye-Günlükbaşı, Marmaris-Çetibeli ve Muğla-Kıyra
populasyonları korunması gereken populasyonlar olarak önerilmiştir.
6
3. MATERYAL ve YÖNTEM
3.1. Populasyonların Tanıtımı ve Örneklenmesi
Sığlanın yayılış alanını kapsayacak 18 populasyon belirlenmiştir (Şekil
1, Çizelge 1). Her bir populasyondan 25’er ağaç olmak üzere toplam 450
ağaçtan, yaprak örnekleri toplanmıştır. Meşcerelerden yaprak örnekleri
toplarken, aileler arasında en az 100 m mesafe olmasına, 300 m’den fazla
yükselti farkı olmamasına ve ailelerin yaklaşık aynı yaşta olmasına dikkat
edilmiştir. Dere içi vejetasyonlarında bu kriterler uygulanamamıştır. Herbir
ağaçtan toplanan yapraklar ayrı ayrı torbalanarak, buzluklarla en kısa sürede
Müdürlüğümüzün soğuk hava deposuna ulaştırılmıştır.
Çizelge 1. Çalışılan sığla populasyonlarının tanıtımı
Table 1. Information about studied sweet gum populations
No
Kod
Populasyon
No.
Code
Population
1
BOZD
Acıpayam-Bozdağ
2
PAMC
Varyete
Meşcere Tipi
Rakım
Variety
Stand Type
Altitude
Meşcere
1100
Dere içi vejetasyon
250
?
(GKO1-199)
Bucak-Pamucak
?
(GKO1-109)
3
4
5
KOYC
GUNN
GUNL
Köyceğiz- Köyceğiz
Marmaris-Günnücek
Fethiye-Günlükbaşı
integriloba
integriloba
integriloba
Meşcere
Meşcere
Meşcere
10
5
5
6
DEGM
MarmarisDeğirmenyanı
integriloba
Meşcere
5
7
8
9
10
11
12
13
UMUR
YILN
KIZY
SERK
KIYR
GUNC
KOTB
Aydın-Umurlu
Muğla-Yılanlı
Muğla-Kızılyaka
Antalya-Serik
Muğla-Kıyra
Marmaris-Günnücek
Köyceğiz- Köyceğiz
orientalis
orientalis
integriloba
?
integriloba
integriloba
integriloba
Dere içi vejetasyon
Dere içi vejetasyon
250
250
50
30
50
5
10
?
Dağınık meşcere
Meşcere
Klonal tohum
bahçesi
Meşcere
1100
(TM3-321)
integriloba
Dere içi vejetasyon
30
Marmaris-Hisarönü
Burdur-Söğütdağ
integriloba
Dere içi vejetasyon
30
???
Meşcere
500
orientalis
Dere içi vejetasyon
250
(TB2-137)
14
15
16
17
ALCI
CETB
HISR
SOGT
Acıpayam-Alcı
Marmaris-Çetibeli
(Tabiatı Koruma Alanı)
18
YATN
Meşcere
Dere içi vejetasyon
Muğla-Yatağan
1
: (GKO) Gen Koruma Ormanı, 2: (TB) Tohum Bahçesi,
(ANONİM 2001)
7
3
: (TM) Tohum Meşceresi
Şekil 1. Bu çalışma için örneklenen sığla populasyonları (Populasyon
numaraları Çizelge 1’de verilmiştir.)
Figure 1. Sweet gum populations sampled for this study
3.2. RAPD Analizi
3.2.1. DNA İzolasyonu
Sığla yapraklarının yüksek yağ içeriği nedeniyle PCR analizlerine
uygun saflıkta DNA elde edebilmek için hazır DNA izolasyon kiti
kullanılması planlanmıştı. Ancak denenen farklı DNA izolasyon kitlerinden
hiçbiri istenilen verimlilikte sonuç vermemiştir. Bu yüzden, çeşitli DNA
izolasyon yöntemleri denenmiştir. Bunlar arasında en iyi sonuç DOYLE ve
DOYLE’nin (1990) CTAB protokolüyle elde edilmiştir. Sonuç olarak, sığla
yapraklarından DNA izolasyonunda bazı değişiklikler yapılarak aşağıdaki
protokol kullanılmıştır:
1. Yapraklar sıvı azotla beyazlayıncaya kadar ezilip 0.5 gram tartılarak
tüplere konulur.
2. Üzerine önceden ısıtılmış, 15 ml CTAB özütleme tamponu eklenip,
karıştırılır.
3. Tüpler su banyosunda (65°C) 1 saat bekletildikten sonra 14000
rpm’de 10 dakika santrifüjlenir.
4. Üst faz yeni tüplere alınır, üzerine 10 ml kloroform:oktanol (24:1)
solüsyonu eklenip, karıştırılırdıktan sonra 14000 rpm’de, 15 dakika
santrifüjlenir.
5. Üst faz alınarak, daha önceden 10 ml soğuk isopropanol konulmuş
tüplere aktarılır.
8
6.
7.
8.
9.
10.
11.
Ultra soğuk (-80°C) dolapta 1 saat bekletilir.
Yeniden 14000 rpm’de 10 dakika santrifüjlenir.
Üst faz dökülür. Pelet 5 ml, 70 % etil alkolle iki kere yıkanır.
Tüpler ters çevrilerek kurumaya bırakılır.
Pelet 200 ml TE tamponuyla çözülür.
Elde edilen DNA -20°C’de saklanır.
3.2.2. DNA Konsantrasyonunun Belirlenmesi
Elde edilen tüm DNA örneklerinin konsantrasyonları “UV Visible
spektrofotometre”yle (Amersham Gene Quant) ölçülmüştür. Elde edilen
DNA konsantrasyonları 60 mg/ml - 1000 mg/ml arasında değişmiştir. Sonuç
olarak, PCR uygulamaları için tüm DNA örnekleri 20 ng/ml olacak şekilde
seyreltilmiştir. Bu örnekler çalışma süresince +4°C’de saklanmıştır.
3.2.3. RAPD Primerleri
Daha önce farklı çalışmalarda kullanılan RAPD-PCR primerleri
denenerek en çok polimorfizm veren 10 primer seçilmiştir (Çizelge 2).
Kullanılan primerlerin dizileri G+C içeriği % 60-70 olup, sonları birbirlerini
tamamlamayacak şekilde sentezlenmiştir. Bu 10 primerle, 18 populasyondan
360 DNA örneği taranmıştır.
Çizelge 2. Sığla için kullanılan RAPD primerleri
Table 2. RAPD primers used to screen sweet gum populations
Primer No
Dizi Bilgisi (5'- 3')
Primer No.
UBC-514
UBC-694
UBC-692
UBC-652
UBC-121
UBC-138
UBC-162
UBC-165
UBC-187
UBC-190
Primer Sequence
CGG TTA GAC GGGT TTG GAG G
AAA CCA GGC G
CCC AAC ACA C
GTG ACG CCG C
CTG CGG GTC A
GGC CGA TGA T
GAG TGG TGA C
GGA AGG GAG T
GGC CGA TGA T
3.2.4. RAPD-PCR Koşulları
Daha önce farklı çalışmalarda kullanılan PCR şartları (tepkime
karışımı) ve döngüleri kullanılarak farklı kombinasyonlar denenmiştir.
PCR tepkime karışımının optimizasyonu için, farklı DNA ve primer
konsantrasyonları denenmiştir. Sonuç olarak; sığla için kullanılan tepkime
şartları Çizelge 3’de, PCR döngüsü Çizelge 4’de verilmiştir.
9
Çizelge 3. RAPD primerleri için kullanılan PCR tepkime karışımı
Table 3. Optimized PCR mixture conditions for RAPD primers
PCR tepkime içeriği
Kullanılan miktar
Son etkin miktar
PCR Contents
Volume used
Final concentration
Steril Su
dNTP (10 mM)
MgCl2 (25mM)
Tampon (10x)
Primer (100 µM)
TaqDNA Polimeraz (5 u/µl)
DNA (ng/µl)
Toplam Miktar
15.25 µl
4 µl
1.5 µl
2.5 µl
0.25µl
0.3 µl
1.2
25 µl
1.6 mM
1.5 mM
1x
1 µM
1u
Çizelge 4. RAPD primerleri için kullanılan PCR döngüsü
Table 4. Optimized PCR cycles for RAPD primers
Sıcaklık
Süre
Döngü Sayısı Tanım
Temperature
Duration
No. of cycles
95°C
94°C
36°C
72°C
72°C
1 dk.
1 dk.
2 dk.
2 dk.
15 dk.
1
45
1
Explanation
İlk sarmal bozulumu
Sarmal bozulumu
Birleşme
Uzama
Son Uzama
3.2.5. Jellerin Yorumlanması
Elde edilen PCR ürünleri 2 μl yükleme boyası eklenerek, % 1.7’lik
agaroz jelde, 1x TAE tamponuyla, 80 Voltta 3 saat yürütülmüştür. Ayrıca
jellerde 2-3 kuyucuğa, elde edilen bantların büyüklüklerini belirlemek
amacıyla DNA standardı (GeneRulerTM 100bp DNA Ladder Plus, MBI
Fermentas, Litvanya) eklenmiştir. Daha sonra jeller etidyum bromid
solüsyonuyla 30 dk boyanmış ve jel görüntüleme sistemiyle dijital ortama
aktarılmıştır.
PCR amplifikasyonu ürünleri görsel olarak değerlendirilmiştir. Her bir
ana ağacın genotipi her bir lokusta bulunan bantlardan çıkartılmıştır. Bir
örnekte RAPD bantının gözlenmesi durumunda ”1”, gözlenmemesi
durumunda ”0” olarak kodlanmıştır.
3.2.6. Veri Analizi
Veri toplama aşaması tamamlandıktan sonra veriler populasyon
genetiği analiz programlarında değerlendirilmek üzere elektronik ortama
10
aktarılmıştır. Etkili (Ne) ve gözlenen (Na) allel sayısı, beklenen
heterozigotluk (h), Shannon Sabiti (I) ve polimorfik lokus (P) oranları
POPGENE (Microsoft Window-based Freeware for Population Genetics
Analysis, Version 1.31) kullanılarak hesaplanmıştır (YEH ve ark. 1997).
POPULATIONS 1.0 programı (LANGELLA 2000) kullanılarak NEI
(1972)’nin genetik mesafe değerleriyle ”yakın bağlantı ağaçları” (Neighborjoining trees) oluşturulmuştur.
3.2.6.1. Allel Frekansları
Bant yapılarının belirlenmesinin ardından allel frekanslarının tahmini
aşağıdaki formülle yapılmıştır:
( 2 N ii +
^
f(A i ) = x i =
m
åN
j =1
ij
)
2N
Bu formüldeki
f(Ai) : herhangi bir allelin frekansı,
N : populasyondaki birey sayısı,
Nii ve Nij : sırasıyla Aii ve Aij genotiplerinin sayısı,
m : bir lokusdaki allel sayısını temsil etmektedir (NEI 1987).
3.2.6.2. Allel Sayısı
Genetik varyasyonun bir diğer göstergesi de lokus başına düşen allel
sayısıdır (A). Allelik zenginlik olarak da anılan bu ölçüt örnek sayısından
etkilenmektedir (NEI 1987).
Ortalama (na ) =
å n ai
i
r
nai : i lokusunun allel sayısı, r : lokus sayısıdır
3.2.6.3. Etkili Allel Sayısı
KIMURA ve CROW (1978) tarafından geliştirilen bu ölçüt
homozigotluğun tersidir (devriğidir).
Ne= 1 ∕ ∑ xi2
ne : etkili allel sayısı
xi : i allelinin frekansıdır.
3.2.6.4. Heterozigotluk
Bir populasyondaki genetik varyasyonun en yaygın kullanılan ölçütü
heterozigotluktur.
11
^
Bir lokusdaki beklenen heterozigotluğun ( h ) tahmininde aşağıdaki
formül kullanılmaktadır:
^ 2 ö
æ
2 N çç 1 - å x i ÷÷
^
è
ø
h=
2N -1
N : birey sayısı
X : allel frekansıdır (NEI 1987).
3.2.6.5. Polimorfik Lokus Oranı
En yaygın allelin (xi) frekansı 0.99 veya 0.95’e eşit veya az ise o
lokusa polimorfik denmektedir. Bu çalışmada 0.99 kriteri kullanılmıştır.
Polimorfik lokus oranı (P) aşağıdaki formülle hesaplanmıştır:
P=
np
np : polimorfik lokus sayısı,
r
r: lokus sayısıdır (NEI 1987).
3.2.6.6. Shannon Sabiti
Shannon sabiti her bir populasyondaki varyasyon düzeyini
göstermektedir. Allel frekanslarına dayanılarak aşağıdaki formülle
hesaplanmaktadır. Her bir lokus için hesaplanıp, ortalaması alınarak tüm
lokuslar için ortalama değeri bulunmaktadır.
H0 = pi lnpi
H0 : Shannon sabiti
pi : Allel frekansıdır (LEWONTIN 1972; YEH ve ark. 1995).
3.2.6.7. Genetik Çeşitliliğin Yapılanması
Heterozigotluk, genetik çeşitliliğin 3
kullanılmaktadır (NEI 1987). Bunlar:
seviyede
tespitinde
HI = Bir bireyin alt-populasyondaki gözlenen heterozigotluk değeri,
HS = Bir bireyin alt-populasyondaki beklenen heterozigotluk değeri,
HT = Bir bireyin tüm populasyonlardaki beklenen heterozigotluk
değeridir.
HI aşağıdaki formülle hesaplanmaktadır:
s
H
I
=
^
åh
oj
j =1
s
^
s: populasyon sayısı,
heterozigotluk.
12
h o j : j populasyonundaki gözlenen
HS aşağıdaki formülle hesaplanmaktadır(NEI 1987):
s
H
S
=
^
åh
j =1
j
^
s
h j : j populasyonundaki beklenen heterozigotluk değeridir
HT aşağıdaki formülle hesaplanmaktadır (NEI 1987):
H
T
= 1 - å xia2
i
xia : i allelinin tüm populasyonlar için ortalama frekansıdır
DST alt-populasyonlar arasındaki ortalama çeşitliliğin ölçütü olup altpopulasyonların birbirleriyle karşılaştırmasını da kapsamaktadır. DST ile bir
bireyin heterozigotluğu arasındaki ilişki aşağıdaki şekildedir:
DST = HT - HS
Ayrıca alt-populasyonlar arasındaki genetik farklılaşmanın boyutu GST
değeriyle ölçülmektedir:
GST = DST / HT
GST populasyonlar arası genetik farklılaşmayı gösteren en kapsamlı
ölçütlerden biridir. Daima 0 ile +1 arasında değişen pozitif değerler alır. GST
değeri 0.05 ve daha azsa populasyon içi genetik farklılaşma ihmal edilebilir
düzeydedir, ancak 0.25’den büyükse ciddi ölçüde genetik farklılaşmadan söz
edilebilir.
Ayrıca, bu parametreler kullanılarak populasyonlar arasındaki gen
akışı (Nm) hesaplanabilmektedir. Gen akışı, bir populasyon içinde veya
tozlaşma yapan populasyonlar arasında (polen saçılması veya tohum
göçüyle) genlerin yayılmasıdır. Her jenerasyonda 1 bireyin göçü genetik
sürüklenmeden kaynaklanan genetik varyasyon azalmasını önleyecektir. Bu
değer populasyon büyüklüğünden bağımsızdır. Eğer Nm değeri 1’den
küçükse, populasyonlar arasında genetik kayma yüzünden farklılaşma
gözlenir, bu değer 0.5 veya daha düşük olduğundaysa kritik bir değeri ifade
eder (WRIGHT 1969).
3.2.6.8. Populasyonlar Arası Genetik Mesafe
Genetik mesafe populasyon (ya da tür) çiftleri arasındaki gen
farklılıklarının büyüklüğüdür. Bu değerler genellikle geometrik uzaklıklarla
eştir, yani mesafe değerinin “0” olması farklılık olmadığına işarettir.
Benzerlik (I) ve mesafe (D) değerleri birbirine komplementerdir ( I+D = 1 ).
13
En sık kullanılan genetik mesafe değeri Nei’nin Genetik Mesafesidir
(NEI 1972).
I=
(J
J xy
m
m
xJy )
J
1/ 2
xy
= å xi
i
y
i
J
x
= å xi
2
i
m
J
y
=åy
i
2
i
I
: x ve y populasyonlarının genetik benzerliğidir.
xi ve y i , i allelinin x ve y populasyonlarındaki frekanslarıdır.
Çalışılan tüm lokuslar için J xy , J x ve J y toplanıp lokus sayısına
bölünerek tüm alleller için ortalaması alınmaktadır. Elde edilen ortalama
değerler ( J xy' , J x' ve J y' ) genetik mesafe ( D ' ) ve benzerliğin tahmininde
kullanılmaktadır.
I =
'
(J
J ' xy
'
x
J
'
D ' = - ln I '
)
1/ 2
y
3.3. Kloroplast rps16 İntron Bölgesi
Protein sentezini katalize eden ribozomlar 40S ve 80S olmak üzere iki
üniteden oluşur. rps16 geni, 40S ünitesinin bileşenlerinden olan S16 isimli
ribozomal proteini kodlamaktadır (NEUHAUS ve ark. 1989). Bu gen bir çok
bitkide grup II intronlarla bölünmüştür (DOWNIE VE PALMER 1992). Dizi
verisi bulunan türlerde bu intronun uzunluğu 707 ile 951 bazçifti arasında
değişmektedir.
Kloroplast (Cp) DNA rps16 intron bölgesinin bitki sistematiğinde
kullanılabilirliği filogenetik çalışmalarla gösterilmiştir (LIDEN ve ark. 1997;
OXELMAN ve ark. 1997; DOWNIE VE KATZ-DOWNIE 1999; MORTON
ve ark., 2003).
3.3.1. Kloroplast rps16 Primerleri
Bu çalışmada, daha önce Caryophyllaceae türlerinde yapılan
çalışmalardan seçilen iki primer kullanılmıştır (OXELMAN ve ark. 1997).
Çizelge 5. Cp DNA rps16 bölgesi için kullanılan primerler
Table 5. Primers used for chloroplast rps16 region
Primer Primer baz dizisi (5’-3’)
Primer
Primer sequence
rpsF1
GTGGTAGAAAGCAACGTGCGACTT
rpsR2
TCGGGATCGAACATCAATTGCAAC
14
3.3.2. Kloroplast Genomu rps16 Bölgesi PCR Koşulları
PCR tepkime karışımının optimizasyonu için, daha önce farklı
çalışmalarda kullanılan PCR şartları (tepkime karışımı) ve döngüleri
kullanılarak farklı kombinasyonlar denenmiştir. Sonuç olarak kloroplast
rps16 bölgesi için kullanılan tepkime şartları Çizelge 6’da, PCR döngüsü
Çizelge 7’de verilmiştir.
Çizelge 6. CpDNA rps16 bölgesi için kullanılan PCR tepkime karışımı
Table 6. Optimized PCR mixture conditions for chloroplast rps16 region
PCR tepkime içeriği
Kullanılan miktar
Son etkin miktar
PCR Contents
Volume used
Final concentration
Steril Su
dNTP (10 mM)
MgCl2 (25mM)
Tampon (10x)
Primer (100 µM)
TaqDNA Polimeraz (5 u/µl)
DNA (3 ng/µl)
Toplam Miktar
36 µl
0.5 µl
5 µl
5 µl
2 µl
0.5 µl
4
55 µl
0.1mM
2 mM
1x
3.6 µM
2.5 u
12 ng
Çizelge 7. CpDNA rps16 bölgesi için kullanılan PCR döngüsü
Table 7. Optimized PCR cycles for chloroplast rps16 region
Sıcaklık
Süre
Döngü Sayısı Tanım
Temperature
Duration
No. of cycles
94°C
94°C
56°C
72°C
72°C
5 dk.
30 sn.
30 sn.
45 sn.
5 dk.
1
30
1
Explanation
İlk sarmal bozulumu
Sarmal bozulumu
Birleşme
Uzama
Son Uzama
3.3.3. Jellerin Yorumlanması
Elde edilen PCR ürünleri 2 μl yükleme boyası eklenerek, % 1.7’lik
agaroz jelde, 1xTAE tamponuyla, 90-100 Voltta 1 saat yürütülmüştür.
Ayrıca jellerde 2-3 kuyucuğa, elde edilen bantların büyüklüklerini
belirlemek amacıyla DNA standardı (GeneRulerTM 100bp DNA Ladder Plus,
MBI Fermentas, Litvanya) eklenmiştir. Daha sonra jeller etidyum bromid
solüsyonuyla 30 dk boyanmış ve jel görüntüleme sistemiyle dijital ortama
aktarılmıştır. Elde edilen bantlar kesilerek jelden çıkartılmış ve dizi analizine
gönderilmiştir.
15
3.3.4. Veri Analizi
Elde edilen bantların dizi analizleri Refgen Biyoteknoloji firmasına
yaptırılmıştır. Bu dizilerin, hizalama (alignment) ve düzeltme (proofreading)
işlemleri elle yapılmıştır. DNA dizileri MEGA-Molecular Evolutionary
Genetics Analysis 3.1 Software (KUMAR ve ark. 2004) program formatına
uygun şekilde hazırlanmış ve bu programla analiz edilmiştir.
Çalışılan populasyonlar için populasyon içi genotipler arası genetik
mesafe değerleri MEGA-Molecular Evolutionary Genetics Analysis 3.1
Software (KUMAR ve ark. 2004) programı kullanılarak tahmin edilmiştir.
İki dizi bilgisi arasındaki evrimsel mesafenin tahmininde nükleotid
değişikliklerinin sayısı kullanılmaktadır. Evrimsel mesafe değerleri,
moleküler evrim çalışmalarında ve filogenetik yapılandırmalarda sıklıkla
kullanılmaktadır.
Bu
mesafelerin
tahmininde
pekçok
yöntem
kullanılmaktadır. Çalışmamızda “p-distance” modeli seçilmiştir (NEI ve
KUMAR 2000). Bu mesafe, karşılaştırılan iki dizi bilgisi arasındaki farklı
nükleotidlerin oranıdır. Nükleotid farklılıklarının, karşılaştırılan toplam
nükleotid sayısına bölünmesiyle elde edilir.
Minimum farklılaşma ağacı (Minimum Spanning Tree), Arlequin
Software Version 2000 (SCHNEIDER ve ark. 2000) kullanılarak
oluşturulmuştur. Bu ağacın oluşturulmasında, ”p-distance”lardan oluşturulan
tüm haplotip çiftleri kullanılan matrixten yararlanılmaktadır.
3.4. Çekirdek Ribozomal DNA ITS Bölgesi
Ribozomal DNA (rDNA), ribozomun RNA parçasını kodlar. rDNA
ökaryotlarda çekirdekte yeralan kopyaları peş peşe dizili çoklu bir gen
ailesidir (Şekil 2). Tekrarlanan her bir bölge 18S, 5.8S ve 28S rRNA
genlerini içermektedir. Bu genler ITS1 ve ITS2 (Internal Transcribed
Spacer), ETS (External Transcribed Spacer) ve IGS (Intergenic Spacer)
isimli bölgelerle birbirinden ayrılmıştır. Yüksek frekanslı mutasyonlar
gösteren ITS bölgesi cinsler içindeki türler arasında ya da populasyonlar
arasında farklılıklar göstermektedir (WHITE ve ark. 1990; MUIR ve
SCHLOTTERER 1999).
Şekil 2. Çekirdek ribozomal DNA ITS bölgesi
Figure 2. Nuclear ribosomal DNA ITS region
16
3.4.1. ITS Primerleri
Bu çalışmada, daha önce NICKRENT ve ark. (1994) tarafından
kullanılan primerler seçilmiştir.
Çizelge 8. ITS Bölgesi için kullanılan primerler
Table 8. Primers used for amplification of ITS region
Primer
Primer baz dizisi (5’-3’)
Primer
Primer sequence
18s 1830 F AACAAGGTTTCCGTAGGTGA
26s 25 R
TATGCTTAAAYTCAGCGGGT
3.4.2. ITS Bölgesi PCR Koşulları
Daha önce farklı çalışmalarda kullanılan tepkime karışımı ve
döngüleri kullanılarak farklı kombinasyonlar denenmiştir. Sonuç olarak
kullanılan tepkime şartları Çizelge 9’da, PCR döngüsü Çizelge 10’da
verilmiştir.
Çizelge 9. ITS bölgesi için kullanılan PCR tepkime karışımı
Table 9. Optimized PCR mixture conditions for ITS region
PCR Tepkime İçeriği
Kullanılan Miktar Son etkin miktar
PCR contents
Volume used
Steril Su
dNTP (10 mM)
MgCl2 (25mM)
Tampon (10x)
Primer (100 µM)
TaqDNA Polimeraz (5 u/µl)
DNA (3 ng/µl)
Toplam Miktar
Final concentration
25.4 µl
6.6 µl
4.4 µl
5.5 µl
4.4 µl
0.2 µl
4.4
55 µl
0.1mM
2 mM
1x
1.25 µM
1.25 u
13.2 ng
Çizelge 10. ITS bölgesi için kullanılan PCR döngüsü
Table 10. Optimized PCR cycles for ITS region
Sıcaklık
Süre
Döngü Sayısı Tanım
Temperature
Duration
No. of cycles
95°C
94°C
55°C
72°C
72°C
5 dk.
30 sn.
30 sn.
50 sn.
5 dk.
1
30
1
17
Explanation
İlk sarmal bozulumu
Sarmal bozulumu
Birleşme
Uzama
Son Uzama
3.4.3. Jellerin Yorumlanması
Elde edilen PCR ürünleri 2 μl yükleme boyası eklenerek, % 1.7’lik
agaroz jelde, 1xTAE tamponuyla, 90-100 Voltta 1 saat yürütülmüştür.
Ayrıca jellerde 2-3 kuyucuğa, elde edilen bantların büyüklüklerini
belirlemek amacıyla DNA standardı (GeneRulerTM 100bp DNA Ladder Plus,
MBI Fermentas, Litvanya) eklenmiştir. Daha sonra jeller etidyum bromid
solüsyonuyla 30 dk boyanmış ve jel görüntüleme sistemiyle dijital ortama
aktarılmıştır. Elde edilen bantlar jelden kesilerek çıkartılmış ve dizi analizine
gönderilmiştir.
3.4.4. Veri Analizi
Dizi analizleri Refgen Biyoteknoloji firmasına yaptırılmıştır. Elde
edilen dizilerin, hizalama (alignment) ve düzeltme (proofreading) işlemleri
elle yapılmıştır. DNA dizileri MEGA-Molecular Evolutionary Genetics
Analysis 3.1 Software (KUMAR ve ark. 2004) program formatına uygun
şekilde hazırlanmış ve bu programla analiz edilmiştir. Elde edilen sonuçlarla
Yakın Bağlantı Ağacı (Neighbor Joining Tree) çizilmiştir.
18
4. BULGULAR ve TARTIŞMA
4.1. Populasyonların Genetik Yapısı
Çalışılan 10 primerde 119 polimorfik RAPD bantı gözlenmiştir.
Ancak bazı bantlar her populasyonda gözlenmediği ve frekansları çok düşük
(<10 %) olduğu için değerlendirme dışı bırakılmıştır. Beş lokus tüm
populasyonlarda monomorfiktir; diğer lokuslar 18 populasyonun en az
birinde polimorfiktir. Sonuç olarak, analizler 75 polimorfik bantla
gerçekleştirilmiştir. Belirli bir populasyona özgü(n) bir allele
rastlanmamıştır. Primerler tarafından üretilen polimorfik bant sayısı Çizelge
11’de gösterilmiştir. Görülen bant sayısı 3 (UBC–652) ile 10 (UBC–514 ve
UBC–138) arasında değişmiştir (Çizelge 11).
Çizelge 11. RAPD primerlerinin ürettiği polimorfik bant sayısı
Table 11. RAPD primers’ polymorphic band numbers
Primer
Primer
Polimorfik Bant Sayısı
Number of polymorphic bands
UBC-514
UBC-694
UBC-692
UBC-652
UBC-121
UBC-138
UBC-162
UBC-165
UBC-187
UBC-190
10
5
6
3
7
10
8
9
8
9
Toplam
75
4.2. Genetik Çeşitlilik
Populasyonların genetik çeşitliliğini belirlemede; gözlenen allel sayısı,
etkili allel sayısı, beklenen ve gözlenen heterozigotluk, Shannon sabiti ve
polimorfik lokus oranı kullanılmıştır (Çizelge 12).
4.2.1. Allelik Zenginlik
Genetik çeşitliliğin bileşenlerinden biri olan ortalama allel sayısı (Na),
bütün populasyonlar ve lokuslar için 1.45±0.05, etkili allel sayısı (Ne) ise
1.30±0.04 arasında görülmüştür (Çizelge 12).
Buna göre, en yüksek allel sayıları Aydın-Umurlu (1.60±0.05), MuğlaKızılyaka (1.60±0.05) ve Köyceğiz-Köyceğiz (1.57±0.05) populasyonlarında
19
Çizelge 12. Sığla için 10 RAPD primeriyle hesaplanan genetik çeşitlilik
değerleri
Table 12. Genetic diversity parameters estimated for seet gum populations
by RAPD markers
Populasyon
Population
Acıpayam-Bozdağ
(BOZD)
Bucak-Pamucak
(PAMC)
Köyceğiz- Köyceğiz
(KOYC)
Marmaris-Günnücek
(GUNN)
Fethiye-Günlükbaşı
(GUNL)
Marmaris-Değirmenyanı
(DEGM)
Aydın-Umurlu
(UMUR)
Muğla-Yılanlı
(YILN)
Muğla-Kızılyaka
(KIZY)
Antalya-Serik
(SERK)
Muğla-Kıyra
(KIYR)
Marmaris-Günnücek
(GUNC)
Köyceğiz- Köyceğiz
(KOTB)
Acıpayam-Alcı
(ALCI)
Marmaris-Çetibeli
(CETB)
Marmaris-Hisarönü
(HISR)
Burdur-Söğütdağ
(SOGT)
Muğla-Yatağan
(YATN)
ORTALAMA
Na
Ne
h
I
P(%)
1.43±.05
1.28±.04
0.16±.02
0.22±.03
43
1.44±.05
1.28±.04
0.16±.02
0.23±.03
44
1.57±.05
1.39±.04
0.22±.02
0.3±.03
52
1.40±.05
1.25±.04
0.14±.02
0.20±.03
40
1.44±.05
1.30±.04
0.17±.02
0.23±.03
44
1.45±.05
1.34±.04
0.19±.02
0.25±.03
45
1.60±.04
1.36±.04
0.21±.02
0.29±.03
60
1.51±.05
1.31±.04
0.18±.02
0.25±.03
47
1.60±.05
1.39±.04
0.22±.02
0.30±.03
55
1.43±.05
1.31±.04
0.17±.02
0.23±.03
43
1.48±.05
1.32±.04
0.18±.02
0.25±.03
48
1.49±.05
1.33±.04
0.19±.02
0.26±.03
49
1.44±.05
1.28±.04
0.16±.02
0.22±.03
44
1.24±.05
1.16±.03
0.09±.02
0.12±.02
24
1.53±.05
1.36±.04
0.20±.02
0.28±.03
53
1.35±.05
1.22±.03
0.13±.02
0.18±.02
32
1.37±.05
1.26±.04
0.14±.02
0.19±.03
37
1.48±.05
1.29±.03
0.17±.02
0.24±.03
48
1.45±.05
1.30±.04
0.17±.02
0.24±.03
45
20
gözlenmiştir. En düşük allel sayısı ise 1.24±0.05 değeriyle Acıpayam-Alcı
populasyonunda gözlenmiştir.
En yüksek etkili allel sayısı 1.39±0.04 değeriyle Köyceğiz-Köyceğiz
ve Muğla-Kızılyaka populasyonlarında, en düşük etkili allel sayısı ise
1.16±0.03 değeriyle Acıpayam-Alcı populasyonunda gözlenmiştir.
Sığla için hesaplanan ortalama allel sayısı ve etkili allel sayısı
değerleri, diğer yapraklı türlere göre düşüktür. HUANG ve ark. (1998)
Amerikan kestanesinde RAPD belirteçleri kullanarak yaptıkları çalışmada
allel sayısını 1.8, etkili allel sayısını 1.57 olarak belirlemişlerdir.
4.2.2. Heterozigotluk
Genetik çeşitliliğin önemli bileşenlerinden biri olan heterozigotluk
değeri 0.09±0.05 (Acıpayam-Alcı) ile 0.22±0.02 (Köyceğiz-Köyceğiz ve
Muğla-Kızılyaka) değerleri arasındadır (Çizelge 12).
Sığla için hesaplanan heterozigotluk değeri, diğer yapraklı türlere göre
daha düşük bulunmuştur. HUANG ve ark. (1998) Amerikan kestanesinin
genetik çeşitliliğini RAPD belirteçleri kullanarak belirledikleri çalışmada,
beklenen heterozigotluğu 0.36 olarak tahmin etmişlerdir. Benzer şekilde,
YEH ve ark. (1995) titrek kavakta aynı değeri 0.65 olarak tahmin
etmişlerdir.
Anadolu Pleistosen döneminde pek çok ibreli tür için bir sığınak
olduğundan, ibreliler yüksek genetik çeşitlilik göstermektedir (LEDIG
1998). Yapraklı ağaç türleri son buzul döneminden sonra Anadolu üzerinden
batıya doğru göç etmesi nedeniyle, oldukça farklı bir seyir izlemişlerdir
(BRICE 1978). Bu nedenle de çeşitlilik kaybına uğradıkları belirtilmektedir
(LEDIG 1998). Ayrıca sığla populasyonları birbirinden kopuk, yani
parçalanmış ve dar alanda yayılış göstermektedir. Bir kaç generasyon
boyunca küçük kalan populasyonlarda genetik kayma, fiksasyona neden
olabilmektedir (LEDIG 1998). Bu durumda, bazı alleller kaybolurken, diğer
alleller hakim olur.
4.2.3. Polimorfik Lokus Oranı
Çalışılan 18 sığla populasyonunda polimorfik lokus oranları % 24–60
arasında değişmektedir (Çizelge 12). En yüksek oran % 60’la Aydın-Umurlu
populasyonunda, en düşük oransa % 24’le Acıpayam-Alcı populasyonunda
gözlenmiştir.
Bu çalışmada hesaplanan oranlar diğer yapraklı ağaç türlerine göre
oldukça düşüktür. HUANG ve ark. (1998) Amerikan kestanesinde RAPD
belirteçleri kullanarak yaptıkları çalışmada polimorfik lokus oranını % 79,2
olarak tespit etmişlerdir. YEH ve ark. (1995), titrek kavakta polimorfik lokus
oranını % 90 olarak tespit etmişlerdir.
21
4.2.4. Shannon Sabiti
Shannon sabiti, çalışılan sığla populasyonları için 0.12 (AcıpayamAlcı) ile 0.30 (Aydın-Umurlu ve Köyceğiz- Köyceğiz) arasında değerler
almıştır (Çizelge 12). Sığla için hesaplanan bu değerler de diğer yapraklı
türlere oranla düşüktür.
YEH ve ark. (1995), titrek kavakta yaptıkları RAPD çalışmasında
Shannon sabitini ortalama 0.65 olarak tahmin etmişlerdir. GILLIES ve ark.
(1999), mahonyada Shannon sabitini 0.27-0.41 arasında gözlemişlerdir.
4.2.5. Genetik Çeşitliliğin Yapılanması
RAPD belirteçleriyle heterozigotluk değerleri her bir lokus için olduğu
gibi ortalama olarak da hesaplanarak, genetik çeşitliliğin yapılanması
belirlenmiştir (Çizelge 13, 14). Bu sonuçlara göre, populasyon içi genetik
çeşitlilik % 16 olarak hesaplanmıştır. Toplam genetik çeşitlilik yani HT
değeri % 35 olarak tahmin edilmiştir.
Populasyonlar arası genetik farklılaşmayı gösteren GST değeri
0.54’dür. GST değeri 0-1 arasında değerler almakta olup, bu değerin 0.25’den
büyük olması populasyonlar arasında çok büyük oranda farklılaşma
olduğuna işarettir. Anadolu sığla populasyonları için hesaplanan GST değeri
de bu değerin oldukça üstündedir.
Bu değer diğer yapraklı türlerle karşılaştırıldığında oldukça farklıdır.
Pek çok türde RAPD belirteçleriyle yapılan çalışmalar sonucunda genetik
farklılaşmanın büyük kısmının populasyon içinde olduğu görülmüştür.
KANASHIRO ve ark. (1997) ’nın Bertholletia excelsa (Brezilya fındığı)
türünde yaptıkları çalışmada, genetik farklılaşmanın % 68,7’sinin
populasyon içinde, % 31,3’ününse populasyonlar arasında olduğu
bulunmuştur. Benzer sonuçlar, Eucalyptus globulus (NESBITT ve ark.
1995), Camelia sinensis (WACHIRA ve ark. 1995) ve Grevillia scapigero
(ROSETTO ve ark. 1995) türlerinde de gözlenmiştir. Ancak YEH ve ark.
(1995), titrek kavakta genetik çeşitliliğin % 97.4’ünü populasyon içinde
tesbit etmişlerdir.
22
Çizelge 13. RAPD belirteçleriyle herbir lokus için hesaplanan gen
çeşitliliği, genetik farklılaşma ve gen akışı değerleri
Table 13. Gene diversity, population differentiation and gene flow estimates
for each loci
Lokus
Loci
P514-1
P514-2
P514-3
P514-4
P514-5
P514-6
P514-7
P514-8
P514-9
P514-10
ORT.
P694-1
P694-2
P694-3
P694-4
P694-5
ORT.
P692-1
P692-2
P692-3
P692-4
P692-5
P692-6
ORT.
P162-1
P162-2
P162-3
P162-4
P162-5
P162-6
P162-7
P162-8
Ht
Hs
Gst
Nm
0.49
0.50
0.20
0.21
0.44
0.47
0.23
0.21
0.22
0.42
0.34
0.13
0.40
0.32
0.32
0.49
0.33
0.50
0.24
0.44
0.30
0.32
0.48
0.38
0.46
0.50
0.36
0.40
0.39
0.45
0.49
0.39
0.17
0.13
0.15
0.05
0.16
0.19
0.15
0.18
0.16
0.32
0.17
0.07
0.11
0.24
0.18
0.16
0.15
0.18
0.14
0.26
0.21
0.23
0.40
0.24
0.14
0.10
0.14
0.11
0.15
0.06
0.27
0.17
0.65
0.74
0.27
0.74
0.64
0.61
0.37
0.18
0.26
0.23
0.47
0.43
0.72
0.24
0.43
0.68
0.50
0.65
0.42
0.41
0.30
0.30
0.18
0.38
0.69
0.80
0.60
0.72
0.63
0.86
0.44
0.57
0.27
0.17
1.38
0.18
0.29
0.32
0.87
2.25
1.44
1.65
0.78
0.66
0.19
1.56
0.67
0.24
0.66
0.27
0.70
0.72
1.18
1.18
2.34
1.07
0.22
0.12
0.34
0.20
0.30
0.08
0.64
0.38
Lokus
Loci
P121-1
P121-2
P121-3
P121-4
P121-5
P121-6
P121-7
ORT.
P165-1
P165-2
P165-3
P165-4
P165-5
P165-6
P165-7
P165-8
P165-9
ORT.
P187-1
P187-2
P187-3
P187-4
P187-5
P187-6
P187-7
P187-8
ORT.
P652-1
P652-2
P652-3
ORT.
P190-1
23
Ht
Hs
Gst
Nm
0.26
0.30
0.43
0.01
0.28
0.16
0.37
0.26
0.39
0.40
0.43
0.29
0.33
0.10
0.46
0.46
0.46
0.36
0.24
0.44
0.24
0.46
0.32
0.05
0.34
0.46
0.26
0.32
0.29
0.44
0.35
0.42
0.02
0.05
0.03
0.01
0.03
0.02
0.04
0.03
0.02
0.05
0.02
0.07
0.02
0.00
0.32
0.16
0.07
0.08
0.03
0.11
0.03
0.27
0.16
0.04
0.24
0.24
0.14
0.16
0.07
0.11
0.11
0.24
0.93
0.84
0.92
0.05
0.88
0.85
0.90
0.77
0.94
0.87
0.95
0.75
0.95
1.00
0.30
0.65
0.85
0.81
0.88
0.75
0.88
0.40
0.50
0.32
0.29
0.48
0.56
0.50
0.75
0.75
0.67
0.43
0.04
0.10
0.04
10.23
0.07
0.09
0.05
1.51
0.03
0.08
0.03
0.17
0.03
0.00
1.15
0.26
0.09
0.20
0.07
0.16
0.07
0.74
0.50
1.06
1.22
0.53
0.42
0.50
0.17
0.16
0.28
0.68
Lokus
Loci
ORT.
P138-1
P138-2
P138-3
P138-4
P138-5
P138-6
P138-7
P138-8
P138-9
P138-10
ORT.
Ht
Hs
Gst
Nm
0.44
0.48
0.32
0.38
0.48
0.18
0.42
0.46
0.32
0.47
0.13
0.37
0.19
0.33
0.23
0.24
0.30
0.11
0.20
0.26
0.21
0.34
0.12
0.22
0.77
0.32
0.28
0.38
0.38
0.36
0.52
0.45
0.34
0.27
0.14
0.34
0.29
1.07
1.31
0.83
0.82
0.89
0.46
0.62
0.98
1.33
3.02
1.26
Lokus
Loci
P190-2
P190-3
P190-4
P190-5
P190-6
P190-7
P190-8
P190-9
ORT.
Ht
Hs
Gst
Nm
0.46
0.50
0.49
0.50
0.14
0.25
0.40
0.31
0.37
0.32
0.35
0.36
0.39
0.11
0.19
0.27
0.19
0.27
0.32
0.29
0.27
0.21
0.26
0.25
0.33
0.38
0.29
1.07
1.20
1.34
1.88
1.45
1.52
1.03
0.83
1.26
Bir populasyonu oluşturan alt-populasyonlarda genetik çeşitliliğin
miktarı farklı olabilir. Yani mikro habitat farklılıklarının yarattığı seleksiyon
basıncı genetik çeşitliliğin dağılımını etkileyebilir. Bu çalışmada hesaplanan
HT , HS ve GST değerleri tüm lokuslar için farklıdır (Çizelge 13). Bu durum,
tüm populasyondaki lokusların çevresel faktörlerdeki değişimlerden
bağımsız olarak etkilendiğini göstermektedir. Lokus başına düşen GST
değerinin büyüklüğü, o lokusun populasyonlar arasındaki farklılığa yaptığı
etkiyi göstermektedir. Çizelge 13 incelendiğinde, populasyonlar arasındaki
farklılaşmaya en büyük etkiyi P165–6 (1.0), P165–3 (0,95), P165–5 (0.95)
lokuslarının yaptığı görülmektedir.
Çizelge 14. RAPD belirteçleriyle hesaplanan gen çeşitliliği, genetik
farklılaşma ve gen akışı değerleri
Table 14. Gene diversity, population differentiation and gene flow estimates
for studied sweet gum populations by RAPD markers
HT
HS
GST
Nm
0.35±0.001
0.16±0.001
0.54
0.42
Bu çalışmada örneklenen populasyonlar için hesaplanan ortalama gen
akışı değeri (Nm) 0.42’dir (Çizelge 14). LEDİG (1998), değişik çalışmalara
atıfta bulunarak, Nm değerini kızılağaç için 4.8, pırnal meşesi için 5.3,
kestane için 3.5, Avrupa kayını için 3.9 olarak bildirmektedir. Sığla için
hesaplanan bu değer, kritik değerin de altındadır. Nm değeri 1’den küçükse,
populasyonlar arasında genetik kayma yüzünden farklılaşma başlar, bu değer
24
0.5 veya daha düşük olduğunda, kaymanın bir sonucu olarak farklılaşma
kritik bir durum alır (WRIGHT 1969). Parçalanmalar sonucunda gen
akışının azalması ve dolayısıyla önceleri birbirleriyle ilişkisi olan izole
gurupların etkili bir populasyon büyüklüğünü yitirmesi durumunda, orman
parçalarının varlığı tehlikeye girer (LEDIG 1998).
Populasyonların parçalanması veya birbirinden kopması, gen akışını
sınırlayarak akrabalar-arası döllenmeyi teşvik eder. Bitkiler içerisinde uzun
ömürlü ağaç türleri bu duruma en az adapte olabilen türlerdir (LEDİG 1998).
Akrabalar-arası döllenme yapan gruplar arasında, kendinden-başka bireylerle
döllenme yapan populasyonlar arasında olduğundan daha büyük farklılaşma
beklenir. Akrabalar-arası döllenmede, özelliklede kendi-kendine döllenmede
çekinik alleller hızla seleksiyona uğrayarak, heterozigotlar homozigot
duruma gelirler (SORENSON 1969; FRANKLIN 1972). Anadolu sığlası
populasyonlarının alan olarak küçük ve birbirinden kopuk olması, çoğu
populasyonun dere içi vejetasyon şeklinde kalması nedeniyle, Nm değeri
kritik eşiğin altında gözlenmiştir. Heterozigotluğun düşüklüğü, GST değerinin
0.54 olması ve populasyonların birbirinden kopukluğu, akrabalar-arası
döllenme olduğu varsayımını güçlendirmektedir. Bu sonuca göre, sığla
populasyonlarının genetik kayma yüzünden, birbirlerinden ciddi ölçüde
farklılaşması beklenmektedir.
4.2.6. Populasyonlar Arası Genetik Mesafe
Çizelge 15’de Nei’nin populasyonlar arasındaki genetik mesafe ve
genetik benzerlik değerleri verilmektedir. Populasyonlar arasındaki genetik
ilişki NEI (1972) standart genetik mesafeleriyle “Neighbor-joining” metodu
yardımıyla oluşturulan dendrogramda da gözlenmektedir (Şekil 3).
Dendrogramda her bir ayrım üzerinde bulunan sayı yüzde olarak güvenilirlik
değerlerini belirtmektedir.
Genetik benzerlik değerlerine bakıldığında, birbirine en yakın
populasyonlar Muğla-Yılanlı ve Muğla-Kızılyaka’dır (0.9312) (Çizelge 15,
Şekil 3). Yine 0.903 değeri ile Acıpayam-Bozdağ ve Köyceğiz-Köyceğiz
yüksek genetik benzerlik değerine sahip populasyonlardır (Çizelge 15, Şekil
3). En yüksek genetik mesafe değeri Muğla-Yılanlı ve Acıpayam-Alcı
populasyonları arasındadır.
Dendrograma (Şekil 3) bakıldığında, populasyonların üç ana kola
ayrıldığı görülmüştür. Fethiye-Günlükbaşı’nın diğer populasyonlardan
ayrıldığı gözlenmektedir. Üçüncü kolu ise Marmaris-Değirmenyanı ve
Marmaris-Çetibeli populasyonları oluşturmuştur. Diğer 15 populasyonun
oluşturduğu ikinci kol kendi içinde iki ana guruba ayrılmıştır.
25
Şekil 3. Nei’nin genetik mesafe değerleriyle oluşturulan dendrogram
Figure 3. Dendrogram constructed by Nei’s genetic distance values
26
Çizelge 15. Nei’nin genetik benzerlik (üst diyagonal) ve genetik mesafe değerleri (alt diyagonal)
Table 15. Nei’s genetic identity (upper diagonal) and genetic distance measures
pop
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
===========================================================================================================================
1
27
**** 0.7380
0.7838
0.7535
0.7529 0.7488
0.7021
0.7831 0.8136 0.7779
0.7991
0.7988 0.9030
0.6413
0.7118 0.6878
0.7174
**** 0.8054
0.8267
0.8098 0.7439
0.7463
0.7878 0.7745 0.7559
0.8755
0.8213 0.7450
0.7484
0.7841 0.6841
0.7097
0.7985
0.7880
0.8010 0.7995
0.8141
0.8743 0.9214 0.7706
0.7897
0.8308 0.7710
0.6632
0.7785 0.7995
0.7997
0.8074
**** 0.8988 0.8046
0.7768
0.7298 0.7830 0.7791
0.8016
0.8151 0.7492
0.8228
0.8432 0.7766
0.7685
0.7890
0.7592
0.7818 0.8191 0.7322
0.8240
0.7819 0.7923
0.7392
0.8415 0.7389
0.7529
0.7696
**** 0.7775
0.7717 0.7909 0.7064
0.8050
0.7666 0.7499
0.7082
0.9244 0.7117
0.7807
0.7895
**** 0.7348 0.7696 0.7193
0.8012
0.7404 0.6939
0.7761
0.7752 0.6834
0.8643
0.8750
0.8153
0.7516 0.7473
0.6039
0.7802 0.7277
0.7070
0.7557
0.7908
0.7798 0.7861
0.6146
0.7615 0.7724
0.7473
0.8065
2
0.3038
3
0.2436
4
0.2830
0.1903 0.2382
5
0.2838
0.2110 0.2218
6
0.2893
0.2959 0.2238
0.2174
0.2173
7
0.3537
0.2926 0.2056
0.2526
0.2754
0.2517
8
0.2445
0.2385 0.1343
0.3149
0.2462
0.2592
0.3082
9
0.2063
0.2555 0.0819
0.2446
0.1996
0.2346
0.2619 0.0713
**** 0.7553
10
0.2512 0.2798
0.2606
0.2496 0.3117
0.3476
0.3294
0.3179
0.2806
11
0.2242 0.1330
0.2361
0.2211 0.1935
0.2169
0.2217
0.2042
0.2347
0.3347
12
0.2247 0.1968
0.1853
0.2045 0.2460
0.2658
0.3006
0.2855
0.2487
0.1077 0.2564
13
0.1021 0.2943
0.2600
0.2887 0.2328
0.2878
0.3654
0.2912
0.2407
0.2283 0.2308
0.2045
14
0.4442 0.2898
0.4107
0.1951 0.3022
0.3450
0.2534
0.5044
0.4867
0.2380 0.3091
0.2817
0.4034
15
0.3400 0.2432
0.2504
0.1706 0.1726
0.0787
0.2546
0.2483
0.2725
0.3014 0.2178
0.2356
0.2893 0.2465
16
0.3743 0.3796
0.2238
0.2528 0.3025
0.3401
0.3806
0.3178
0.2583
0.1860 0.3875
0.2148
0.2927 0.3023
0.2690
17
0.3321 0.3429
0.2236
0.2633 0.2838
0.2475
0.1458
0.3467
0.2913
0.3412 0.2408
0.3021
0.3427 0.3501
0.2881
0.3940
18
0.3392 0.2250
0.2139
0.2370 0.2619
0.2363
0.1336
0.2802
0.2150
0.2810 0.1618
0.2662
0.3613 0.3108
0.2363
0.3469 0.1252
0.2164
****
0.1067
**** 0.8047
**** 0.9312 0.7277
**** 0.7156 0.8979
0.7123
0.7959
0.7882 0.7398
0.8302
0.7109 0.7551
0.7939
0.7341 0.8043
0.6788
0.7860 0.8506
**** 0.8151
0.7545 0.7901
0.8067
0.7393 0.7663
**** 0.6680 0.7488
0.7462
0.7099 0.6967
**** 0.7739
**** 0.7815
0.7391
0.7046 0.7328
**** 0.7641
0.7497 0.7896
**** 0.6744 0.7069
**** 0.8823
****
4.3. Kloroplast rps16 Bölgesi
Sığla kloroplast rps16 bölgesinin genetik yapılanması 18
populasyondan 4’er bireyin DNA dizi analizleriyle belirlenmiştir. Şekil 4’de
Pamucak ve Bozdağ populasyonlarında bu bölgenin bant yapıları
görülmektedir. Elde edilen verilerle populasyon içi genetik mesafe (pdistance) değerleri hesaplanmış, minimum farklılaşma ağacı çizilmiştir
(Çizelge 15, Şekil 5).
Şekil 4. Bozdağ ve Pamucak Populasyonlarında CpDNA rps16 Bölgesi
Bantları (L: DNA Standardı)
Figure 4. Bands obtained for Chloroplast rps16 region for Bozdağ and
Pamucak Populations (L:DNA Ladder)
4.3.1. Populasyon İçi Genetik Mesafe (p-distance)
Aynı populasyona ait bireyler (genotipler) arasındaki dizi
farklılıklarını ortaya koyan “p-distance” değerleri çalışılan 18 sığla
populasyonunda 0 ile 0.0065 arasında değişmektedir (Çizelge 16). Çalışılan
dokuz populasyonda genotipler arası genetik mesafe “0” olarak tesbit
edilmiştir. Muğla-Yatağan populasyonu 0.0065 değeriyle, bireyler arasında
en fazla farklılığa sahip populasyondur.
28
Çizelge 16. rps16 primerleriyle hesaplanan genetik mesafe değerleri
Table 16. Genetic distance values estimated by rps16 primers
Populasyon Adı
Population
Acıpayam-Alcı
Marmaris-Çetibeli
Marmaris-Değirmenyanı
Fethiye-Günlükbaşı
Muğla-Kızılkaya
Marmaris-Günnücek
Marmaris-Günnücek
Acıpayam-Bozdağ
Marmaris-Hisarönü
Muğla-Kıyra
Köyceğiz-Köyceğiz
Gölhisar-Pamucak
Antalya-Serik
Burdur-Söğütdağ
Köyceğiz-Köyceğiz
Aydın-Umurlu
Muğla-Yatağan
Muğla-Yılanlı
Genotipler Arası Genetik
Mesafe (±standart hata)
p-distance (±standard error)
0.0033 (±0.0019)
0.0008 (±0.0008)
0.0041 (±0.0017)
0.0000 (±0.0000)
0.0035 (±0.0017)
0.0000 (±0.0000)
0.0033 (±0.0015)
0.0000 (±0.0000)
0.0000 (±0.0000)
0.0000 (±0.0000)
0.0025 (±0.0014)
0.0000 (±0.0000)
0.0000 (±0.0000)
0.0008 (±0.0008)
0.0000 (±0.0000)
0.0008 (±0.0008)
0.0065 (±0.0023)
0.0000 (±0.0000)
4.3.2. Minimum Farklılaşma Ağacı
Minimum farklılaşma ağacı 18 populasyona ait dizi bilgisi kullanılarak
oluşturulmuştur (Şekil 5). Bu ağaç oluşturulurken, çalışılan 18 populasyon
dışında ayrıca NCBI’ın (National Center for Biotechnology Information)
GenBank web sitesinden (http://www.ncbi.nlm.nih.gov/genbank/index.html)
alınan bir L. orientalis örneğine ait dizi bilgisi de karşılaştırma yapmak
amacıyla kullanılmıştır.
Oluşturulan ağaçta GenBank’tan alınan populasyon, çalışmada
kullanılan 18 populasyonla birlikte yer almıştır. Yalnızca Muğla-Yatağan ve
Muğla-Kızılyaka populasyonları 1-2 baz farklılığa sahiptir.
29
Şekil 5. CpDNA rps16 bölgesi verileriyle oluşturulan minimum
farklılaşma ağacı (Çizgilerin üzerinde bulunan rakamlar, populasyonlar
arasındaki baz değişikliklerini; dairelerin içindeki rakamlar populasyon
numaralarını göstermektedir.)
Figure 5. Minimum Spanning Tree Constructed By Chloroplast rps16
Region Data (Numbers on the lines refer to number of base substitution, numbers
in the circles refer to population numbers)
4.4. Çekirdek Ribozomal DNA ITS Bölgesi
Elde edilen dizi bilgileriyle yakın bağlantı ağacı oluşturulmuştur (Şekil
6). Oluşturulan ağaçta 2 ana grup gözlenmiştir. Birinci grup, kendi içinde
tekrar kollara ayrılmış ve bu kollardan oluşan bir grup % 91 ve % 92
güvenirlilik payıyla 3 populasyonu (Köyceğiz-Köyceğiz, Muğla-Kızılyaka,
Marmaris-Günnücek) kapsamıştır. Bu gruba bağlı diğer bir grupta % 82
güvenirlilik payıyla 2 populasyonu (Acıpayam-Alcı, Antalya-Serik)
kapsamıştır. Diğer gruplaşmaların güvenirlilik payları daha azdır. İkinci ana
kol içinde oluşan bir gruplaşmada da % 100 güvenirlilik payıyla (KöyceğizKöyceğiz (TB), Fethiye-Günlükbaşı) ve Aydın-Umurlu populasyonu
görülmüştür.
30
Şekil 6. Çekirdek ribozomal DNA ITS bölgesi verileriyle oluşturulan
yakın bağlantı ağacı
Figure 6. Neighbor joining tree constructed by nuclear ribozomal DNA ITS
region data
31
5. SONUÇ VE ÖNERİLER
Bu çalışmada, ülkemizdeki Anadolu sığlası populasyonlarında
bulunan genetik çeşitliliğin miktar ve yapılanması araştırılmıştır. Elde edilen
sonuçlar değerlendirilerek, Anadolu sığlası için koruma stratejileri
önerilmiştir. DİRİK (1994), ormancılıkta kullanabilmenin temel
koşullarından biri olan korumanın; bir yandan yasal ve yönetsel önlemlerin
alınmasını, diğer yandan da teknik çalışmaların ekolojik ve biyolojik
ilkelerle uyumlu olmasını, bu ilkelerin temel dayanaklarından birinin de
ormanların genetik yapıları oldduğunu belirtmektedir.
Yapılan
analizler
ve
değerlendirmeler
sonucunda,
sığla
populasyonlarının genetik yapılarıyla ilgili önemli bilgiler elde edilmiştir.
Populasyonlar 10 RAPD primeriyle taranmış ve 75 lokustan ortalama %
45’inin polimorfik olduğu tespit edilmiştir. Etkili allel sayısı ortalaması 1.30,
heterozigotluk 0.17 ve Shannon sabiti 0.24 olarak bulunmuştur.
Populasyonların farklılaşmasını gösteren genetik çeşitliliğin yapılanması ve
gen akışı değerlerinin istatistik analizi sonuçlarına göre sığlada toplam
genetik çeşitliliğin % 54’ü populasyonlar arasında, kalan % 46’sı
populasyonlar içerisindedir. Populasyonlar arası gen akışını gösteren Nm
değeri ise 0.42 olup, kritik gen akışı değerinin (0.5) altındadır.
RAPD analizi sonucu elde edilen bulgulardan Anadolu sığlasında
genetik çeşitliliğin yüksek olmadığı ve çeşitliliğin daha çok populasyonlar
arasında yapılandığı anlaşılmaktadır. Populasyonlar içerisindeki genetik
çeşitliliğin düşük olması, Anadolu sığlasında düşük genetik çeşitliliğin
göstergesidir. Uzun dönemde, çeşitliliğin düşük olması populasyon ve
taksonların evrim yoluyla çevresel değişimlere cevap verebilme yeteneğini
tehdit edecektir (LANDE 1995). Elde edilen düşük gen akışı değeri sığla
populasyonlarının genetik kayma yüzünden birbirlerinden ciddi ölçüde
farklılaştığına ve türün neslinin tehlike altında olduğuna işarettir. Küresel
iklim değişikliğinin gündemde olduğu günümüzde, düşük genetik çeşitliliğe
sahip olan Anadolu sığlasının bu değişikliğe uyum göstermede zorlanacağını
söyleyebiliriz.
Anadolu sığlasında heterozigotluğun düşük olması, populasyonlar
arası genetik farklılaşmayı gösteren GST değerinin 0.25’den büyük olması,
Nm’nin kritik gen akışı değerinin altında olması, genetik kayma meydana
geldiğini yani populasyonlar arasında farklılaşma başladığına işaret
etmektedir. Populasyonların birbirinden kopuk olması, dar alanda yayılış
göstermesi nedeniyle akrabalar-arası döllenme başlamış, bu da farklılaşmaya
neden olmuştur. Örneğin çalıştığımız populasyonların içinde en büyük
meşcereyi oluşturan Burdur-Söğütdağı populasyonunun büyüklüğü sadece 8
hektar kadardır.
32
Parçalanmalar sonucunda gen akışının azalması ve dolayısıyla önceleri
birbirleriyle ilişkisi olan izole gurupların etkili bir populasyon büyüklüğünü
yitirmesi durumunda, orman parçalarının varlığı tehlikeye girmektedir.
Bütünlükleri yakın bir zamanda bozularak parçalı hale gelmiş olan türlerin
durumu, tehlikede olan türlere örnektir (LEDIG 1998). Bu tür durumlarda,
gen alışverişini teşvik eden yönetim teknikleri, akrabalar-arası döllenmenin
etkilerini dengelemek için önerilebilir.
Bu çalışmada ayrıca, sığlanın çekirdek ribozomal DNA ITS ve
kloroplast rps16 bölgelerinin dizi analizlerinden yararlanılmıştır. Rps16
belirteçleriyle oluşturulan minimum farklılaşma ağacı, Muğla-Yatağan ve
Muğla-Kıyra populasyonlarının diğerlerinden 1-2 baz çifti farklılaştığını
göstermektedir.
Tüm analiz sonuçları birlikte değerlendirildiğinde, çalışılan sığla
populasyonlarının bilinen varyete ayrımlarını doğrulayacak şekilde belirgin
bir gruplaşma ya da farklılaşma oluşturmadığı gözlenmiştir.
Çalışılan sığla populasyonlarında gözlenen düşük genetik çeşitlilik ve
düşük gen akışı değerleri, bütün populasyonların in-situ korumaya alınması
gerekliliğine işaret etmektedir. Acıpayam-Bozdağ ve Gölhisar-Pamucak Gen
Koruma Ormanı (ANONİM 2001), Burdur-Söğütdağ Tabiatı Koruma Alanı
(ANONİM 2000) olarak yerinde korunmaktadır. Diğer populasyonların da
yerinde korunması önerilmektedir. Ancak populasyonların yayılış alanları
göz önüne alındığında, çoğunun ülkemizin önemli turizm bölgelerinde
bulunduğu ve bu durumda yerinde korumanın problemler yaratabileceği
bilinmektedir. Ancak Marmaris-Değirmenyanı ve Köyceğiz-Köyceğiz
populasyonları meşçere oluşturduğundan, in situ korunmaya alınması
yerinde olacaktır.
Muğla-Yatağan populasyonu, baraj yapımı nedeniyle yok olmak
üzeredir. Dolayısıyla bazı populasyonların ex-situ korumaya alınması, daha
garantili olacaktır. Zaten in-situ koruma ile birlikte, ex-situ koruma
önerilmektedir (KAYA 1990; DİRİK 1994; LEDIG 1998). Ex-situ koruma
ile kendinden-başka bireylerle döllenme de teşvik edilerek, çeşitliliğin de
artması *sağlanacaktır. Anadolu sığlası için ex-situ koruma stratejisi
belirlemek amacıyla RAPD, ITS ve kloroplast rps16 bölgesi analizlerinin
sonuçları birlikte değerlendirilmiştir. RAPD analizi değerlendirmesi sonucu
yüksek genetik çeşitliliğe sahip olan populasyonlar ile, ITS ve rps16 bölgesi
dizi verileriyle oluşturulan ağaçlarda en çok farklılık gösteren populasyonlar
belirlenmiştir. Her üç analizde de ortak olan 8 populasyonun (AcıpayamBozdağ, Muğla-Yılanlı, Marmaris-Günnücek, Köyceğiz-Köyceğiz, FethiyeGünlükbaşı, Marmaris-Değirmenyanı, Muğla-Kıyra, Muğla-Yatağan) ex-situ
korumaya alınmasına karar verilmiştir.
33
ÖZET
Ülkemizin endemik orman ağacı türlerinden olan Anadolu sığlası için
koruma yöntemlerini belirlemek amacıyla RAPD çekirdek ribozomal DNA
(ITS) ve kloroplast DNA rps16 bölgesi analizleri yapılmıştır. Sığla’nın
Türkiye’deki yayılış alanından 18 populasyondan 20’şer birey
örneklenmiştir. Genetik çeşitlilik parametreleri ve populasyonlar arası
ilişkiler her populasyondan 20 bireyin 10 adet RAPD belirteciyle taranması
sonrasında yapılan istatistik analizlerle belirlenmiştir. Minimum farklılaşma
ağacı her populasyondan 4’er bireyin kloroplast DNA rps16 gen bölgesinin
DNA dizi analizi sonrasında oluşturulmuştur.
RAPD analizi sonuçları sığla populasyonlarının yüksek genetik
çeşitliliğe sahip olmadığını ve genetik kayma sonucu populasyonların
birbirinden farklılaştığını göstermektedir. Polimorfik lokus oranı % 45, etkili
allel sayısı ortalaması 1.30 ve heterozigotluk 0.17 olarak hesaplanmıştır.
Genetik çeşitliliğin önemli kısmı (% 54) populasyonlar arasında olup,
populasyonlar içi genetik çeşitlilik oldukça düşüktür (% 46). Populasyonlar
arası gen akışı katsayısı da (Nm=0.42) düşük bulunmuştur.
Kloroplast DNA rps16 gen bölgesi analizi sonuçlarına göre
oluşturulan minimum farklılaşma ağacı Muğla-Yatağan ve Muğla-Kıyra
populasyonlarının diğerlerinden 1-2 baz çifti farklılaştığını göstermektedir.
Çalışılan sığla populasyonları arasındaki farklılaşmalar ve düşük
genetik çeşitlilik değerleri göz önüne alınarak bütün populasyonların in-situ
korumaya alınması önerilmektedir. Ancak önemli turizm bölgelerinde
bulunan bu populasyonların yerinde korunması zor olacaktır. Ancak,
Köyceğiz-Köyceğiz ve Marmaris-Değirmenyanı populasyonlarının in-situ
koruması önerilmiştir. Dolayısıyla, her iki yöntemin sonuçları
değerlendirilerek ex-situ koruma planı yapılmıştır. Genetik çeşitliliği yüksek
olan populasyonlar arasından en çok farklılaşma gösteren 8 populasyonun
(Acıpayam-Bozdağ, Muğla-Yılanlı, Marmaris-Günnücek, KöyceğizKöyceğiz, Marmaris-Değirmenyanı, Fethiye-Günlükbaşı, Muğla-Kıyra,
Muğla-Yatağan) ex-situ koruma altına alınması önerilmiştir.
34
SUMMARY
RAPD nuclear ribosomal DNA (ITS) and chloroplast DNA rps16
region analysis have been done to determine conservation strategies for
sweet gum, one of the endemic species of Turkey. 20 families were sampled
from 18 populations within the natural distribution area of sweet gum.
Genetic diversity parameters and relationships between populations were
determined by statistical analyses after screening of 20 families from each
population by 10 RAPD markers. Minimum spanning tree were constructed
after DNA sequence analysis of chloroplast DNA rps16 region of 4
individuals from each population.
Results of RAPD analysis indicated that genetic diversity of
populations was not high and populations have been differentiated from each
other due to the genetic drift. Percentage of polymorphic loci, effective allele
number and heterozygosity were calculated as 45%, 1.30 and 0.17,
respectively.
Most of the genetic diversity resides between populations (54 %) and
genetic diversity within populations (46 %) were quite low. Gene flow
coefficient between populations (Nm=0.42) were also low.
Minimum spanning tree that have been constructed by using DNA
sequence data of chloroplast rps16 gene region indicated that Muğla-Kıyra,
Muğla-Yatağan populations were differentiated by 1-2 basepair from other
populations.
In-situ conservation of all populations was suggested when considered
differentiation of studied populations and low genetic diversity parameters.
However in-situ conservation of these populations, that are located in
important tourism regions of Turkey, is complicated. Köyceğiz-Köyceğiz
and Marmaris-Değirmenyanı populations were determined for in-situ
conservation. Therefore, ex-situ conservation strategy has been developed by
considering results of both methods studied. It was proposed to have ex-situ
conservation for the most differentiated 8 populations (Acıpayam-Bozdağ,
Muğla-Yılanlı, Marmaris-Günnücek, Muğla-Kıyra, Köyceğiz-Köyceğiz,
Muğla-Yatağan, Marmaris-Değirmenyanı, Fethiye-Günlükbaşı,) with higher
genetic diversity.
35
KAYNAKÇA
ACAR, M. İ. 1988a. Sığla (Liquidambar orientalis Mill.) Ağaçlandırmalarında Köklü Çelik Kullanımının Gerek ve Önemi. Ormancılık Araştırma
Enstitüsü Yayınları, Dergi Serisi, Cilt:34, Sayı:2, No:68.
ACAR, M. İ. 1988b. Sığla (Liquidambar orientalis Mill.) Balzamı (Sığla
Yağı) Eterik Yağının GC-MS-DS Sistemi İle Analiz Edilerek Bileşiminin
Belirlenmesi. Ormancılık Araştırma Enstitüsü Yayınları, Teknik Raporlar
Serisi, No:33.
ACAR, M. İ., KIZILEL, M. 1988. Sığla Ormanlarının Dünü, Bugünü ve
Geleceği. Ormancılık Araştırma Enstitüsü Yayınları, Dergi Serisi, Cilt:34,
Sayı:1, No:67.
ACAR, M. İ., GEMİCİ, Y., GENÇ, A., ÖZEL, N. 1992. Anadolu Sığla
(Liquidambar orientalis Mill.) Ormanlarının Geçmişteki ve Günümüzdeki
Durumu. 1. Uluslararası Ekoloji ve Çevre Sorunları Sempozyumu. 127-133.
ACATAY, A. 1963. Sığla Ağacı (Liquidambar orientalis Mill.)’nın
Türkiye’de Yayılışı, Yeni Tesbit Edilen Varyetesi ve Sığla Ağaçlarına
Musallat Olan Böcekler. İ. Ü. Orman Fakültesi Dergisi, Seri A, Cilt 8, Sayı
2, İstanbul.
AKMAN, Y. 1995. Türkiye Orman Vejetasyonu. A. Ü. Fen Fakültesi
Botanik Ana Bilim Dalı. Ankara.
AKMAN, Y., KETENOĞLU, O., KURT, L. 1992. Fethiye-Marmaris ve
Bucak Çevrelerinde Yetişen Liquidambar orientalis Mill. Topluluklarının
Floristik Yapısı. Doğa-Turkish Journal of Botany. Vol:16, 273-286.
ALAN, M., KAYA, Z. 2003. Oriental Swet Gum. (Liquidambar orientalis
Mill.). EUFORGEN Technical Guidelines.
ANONİM. 1984. Günlük Ormanlarımızı Kurtarabiliriz. Ormancılık
Araştırma Enstitüsü Yayınları, Araştırma Bülteni, Sıra No:32.
ANONİM. 1995. Pasific Northwest Tree Improvement Research
Cooperative Annual Report (4/1/1994-9/30/1995), Placerville, California,
USA.
ANONİM. 2000. Türkiye’nin Tabiatı Koruma Alanları. Kırsal Çevre ve
Ormancılık Sorunları Araştırma Derneği, Yayın no:9. Ankara.
ANONİM. 2001. Orman Ağaçları ve Tohumları Islah Araştırma Müdürlüğü,
2000 Yılı Çalışma Raporu, 2001 Yılı Çalışma Programı. Çeşitli Yayınlar
Serisi. Sayı:3, Ankara.
ATAY, İ. 1985. Sığla Ağacının (Liquidambar orientalis Mill.) Önemi ve
Silvikültürel Özellikleri. İ. Ü. Orman Fakültesi Dergisi, Seri:B, Cilt:35,
Sayı:1.
36
AYKIN, R. 1976. Isparta Orman Bölge Müdürlüğü Sütçüler İşletmesi
Ormanlarında Sığla (Liquidambar orientalis Mill.) Meşcereleri. Orman
Mühendisliği Dergisi, Kasım-Aralık, Sayı:5, 17-25.
BERKEL, A. 1955. Sığla Ağacı (Liquidambar orientalis Mill.) Odununun
Makroskopik Özellikleri ve Anatomik Strüktürü Hakkındaki Araştırmalar. İ.
Ü. Orman Fakültesi Dergisi, Seri A, Cilt 5, Sayı 1-2, İstanbul.
BERKEL, A., HUŞ, S. 1944. Sığla Ağacı Ormanları ve Sığla Yağı Üzerine
Araştırmalar. Ankara Yüksek Ziraat Enstitüsü Dergisi, Cilt:3, Yıl:2, Sayı:1
(5), 9-28.
BOZKURT, Y., GÖKER, Y., KURTOĞLU, A. 1989. Sığla ağacının bazı
özellikleri. İ. Ü. Or. Fak. Der. Seri B, Cilt:39, Sayı:1.
BOZKURT, Y., GÖKER, Y., KURTOĞLU, A. 1990. Sığla odununun
fiziksel ve mekaniksel özellikleri. İ. Ü. Or. Fak. Der. Seri A, Cilt:40, Sayı:2.
CONKLE, M. T. 1980. Amount and Distribution of Isozyme Variation in
Various Conifer Species. In: Proceedings of the 7th Meeting. Canadian For.
Ser. pp: 109-117.
COSSALTER, C. 1989. Genetic Conservation: A Cornerstone of Breeding
Strategies: Breeding Tropical Trees. Population Structure and Gene
Improvement Strategies in Clonal and Seedling Forestry. (Proc. IUFRO
Conference).
BRICE, W. C. 1978: The desiccation of Anatolia, p. 141-147. In W. C.
Brice (ed.), The environmental history of the Near and Middle East since the
last ice age. Academic Press, London.
ÇETİNTAŞ, G. 1990. Anadolu sığla ağacına ilgisizlik devam edecekmi?.
Çevre ve Ormancılık Dergisi, Cilt:6, Sayı:1.
DAVIS, P. H. 1972. Flora of Turkey & The East Aegeon Island.Cilt IV.
DİRİK, H. 1986. Anadolu Sığlası (Liquidambar orientalis Mill.)’nın
Gençleştirilmesi Üzerine Çalışmalar. İ. Ü. Orman Fakültesi Yüksek Lisans
Tezi, İstanbul.
DİRİK, H. 1986.Genetik çeşitlilik ve orman gen kaynaklarının korunması. İ.
Ü. Orman Fakültesi Dergisi, Seri B, Cilt 44, Sayı 3-4, İstanbul.
DOWNIE, S.R., J.D. PALMER. 1992. Use of chloroplast DNA
rearrangements in reconstructing and plant phylogeny. Pp. 14-35. In:
Molecular Systematics of Plants. P.S. SOLTIS, D.E. SOLTIS, J.J. DOYLE
(Eds). New York:Chapman and Hall.
DOWNIE, S. R., KATZ-DOWNIE, D. S. 1999. Phylogenetic analysis of
chloroplast rps16 intron sequences reveals relationships within the woody
southern African Apiaceae subfamily Apioideae. Can. J. Bot., 77: 11201135.
37
DOYLE, J. J., DOYLE, J. L. 1990. Isolation of plant DNA from fresh
tissue. Focus 12:13-15.
DURU, M .E., ÇAKIR, A., HARMANDAR, M. 2002. Composition of
Volatile Oils Isolated from The Leaves of Liquidambar orientalis Mill. var.
orientalis and L.orientalis var. integriloba from Turkey. Flovour and
Fragrance Journal. 17 (2), 95-98.
EFE, A. 1987. Liquidambar orientalis Mill. (Sığla Ağacı)’ın Morfolojik ve
Palinolojik Özellikleri Üzerine Araştırmalar. İ. Ü. Orman Fakültesi. Dergisi
Seri A. Cilt: 37, Sayı:2, 273-286, İstanbul.
EFE, A., DİRİK, H. 1992. Une Espece Peu Connue de la Foret
Mediterraneenne Liquidambar orientalis. Foret Mediterraneene Tome:
X111, Numero:2.
EKİM, T., KOYUNCU, M., VURAL, M., DUMAN, H., AYTAÇ, Z.,
ADIGÜZEL, N. 2000. Türkiye Bitkileri Kırmızı Kitabı (Eğrelti ve Tohumlu
Bitkiler). Türkiye Tabiatını Koruma Derneği ve Van 100. Yıl Üniversitesi
Yayını.
FAKİR, H., DOĞANOĞLU, Ö. 2003. Isparta sığla (Liquidambar
orientalis Mill.) ormanı tabiatı koruma alanı bitki taksonları. SDÜ Or. Fak.
Dergisi, Seri:A, Sayı:1.
FAKİR, H. 2005. Isparta sığla ormanı tabiatı koruma alanı anıt ağaçları.
SDÜ Or. Fak. Dergisi, Seri:A, Sayı:1.
FRANKLIN, E. C. 1972. Mutant forms found by self-pollination in loblolly
pine. Journal of Heredity 60: 315-320.
GENÇ, A. 1994. Sığla Ağacının (Liquidambar orientalis Mill.) Genetik
Varyasyonundan Aşı Yoluyla Yararlanma. Ormancılık Araştırma Enstitüsü
Yayınları, Teknik Raporlar Serisi, No:57.
GENÇ, A. 1999. Sığla Ağacı (Liquidambar orientalis Mill.)’nın Doku
Kültürü Tekniği İle Üretilmesi. Ege Ormancılık Araştırma Müdürlüğü,
Teknik Bülten No:14.
GENÇ, A., AKGÜL, E., ÖZEL, N., UMUT, B. 1993. Sığla (Liquidambar
orientalis Mill.) Ormanlarının Yetişme Ortamı Özellikleri İle
Gençleştirilmesi Üzerine Araştırmalar. Ege Ormancılık Araştırma
Müdürlüğü, Teknik Bülten No:14.
GILLIES, A. C. M., NAVARRO, C., LOWE, A. J., NEWTON, A. C.,
HERNANDEZ, M., WILSON, J., CORNELIUS, J. P. 1999. Genetic
diversity in Mesoamerican populations of Mahogany (Swietenia
macrophylla) assesed using RAPDs. Heredity 83:722-732.
GOOD, R. 1974. The Geography of flowering plants. 4th edition. Longman
Group Ltd., London.
38
GÜL, S. 1986. Sığla Ağacı (Liquidambar orientalis Mill.) Kabuk
Sıyrıntılarından Yağ Elde Etme Yöntemleri Üzerine Araştırmalar.
Ormancılık Araştırma Enstitüsü Yayınları, Teknik Bülten Serisi, No:178.
GÜNER, A., VURAL, M., DUMAN, H., DÖNMEZ, A. A., ŞAĞBAN, H.
1993. Günlük ağacı (L. orientalis)- Köyceğiz’deki Durum. The Karaca
Arboretum Magazine Vol II, Part 1.
HAFIZOĞLU, H. 1982. Analytical Studies on the Balsam of Liquidambar
orientalis Mill. by Gas Choramatography and Mass Spectrometry.
Holzforschung36, 311-313. Berlin- New-York.
HOEY, M. T., PARKS, C. R. 1991. Genetic divergence between eastern
Asian, North American and Turkish Species of Liquidambar
(Hamamelidaceae). Amer. J. Bot. 78: 938-947.
HOEY, M. T., PARKS, C. R. 1994. Genetic divergence in Liquidambar
styraciflua., L. formosana and L. acalycina (Hamamelidaceaea). Syst. Bot.
19:308-316.
HUANG, H., DANE, F., KUBISIAK, T. L. 1998. Allozyme and RAPD
analysis of the genetic diversity and geographic variation in wild populations
of the American chestnut (Fagaceae). American Journal of Botany, 85:
1013-1021.
HUŞ, S. 1947. Reçine ve sığla yağı elde etme metotları. Tarım Bakanlığı,
OGM Yayınları, Özel Sayı:36.
HUŞ, S. 1949. Sığla Ağacının (Liquidambar orientalis Mill.) Ormancılık
Bakımından Önemi ve Sığla Yağının Kimyasal Araştırılması. Orman Genel
Müdürlüğü Yayını, Özel Sayı: 83. 7-61.
IŞIK, K. 1988. Orman Ağacı Türlerimizde Lokal Irkların Önemi ve Genetik
Kirlenme Sorunları. Orman Mühendisleri Dergisi, 25(11):25-30.
İKTÜEREN, Ş., ACAR, İ. 1987. Sığla Ağacının (Liquidambar orientalis
Mill.) Doğal Yayılışı, Sığla Yağı Üretimi ve Pazarlaması. Ormancılık
Araştırma Enstitüsü Yayınları, Dergi Serisi, Cilt:33, Sayı:2, No:66.
İSTEK, A., HAFIZOĞLU, H. 2004. Sığla ağacı (Liquidambar orientalis
Mill.) odununun anatomik özelliklerinin belirlenmesi. Bartın Or. Fak.
Dergisi, Sayı:1.
İSTEK, A., HAFIZOĞLU, H. 2005. Sığla ağacı (Liquidambar orientalis
Mill.) odunu kabuğunun kimyasal bileşenleri. G. Ü. Kastamonu Or. Fak.
Dergisi, Cilt:5, No:1.
İŞCİ, M. 1988. Sığla (Günlük) Ormanlarının Amenajman Esasları. K.T.Ü.
Orman Fakültesi Yüksek Lisans Tezi. Trabzon.
KANASHIRO, M., HARRIS, S. A., SIMONS, A. 1997. RAPD diversity in
Brazil nut. Silvae Genetica 46, 4: 219-223.
39
KAYA, Z.1990. Orman gen kaynaklarımız: Ulusal mirasımız. Fidan Dergisi,
Nisan, Sayı:28, Ankara.
KEIL, M., GRIFFIN, A. R. 1994. Use of Randomly Amplified
Polymorphic DNA (RAPD) Markers in The Discrimination And Verification
of Genotypes in Eucalyptus. Theor. Appl. Genet. 89: 442-450.
KESERCİOĞLU, T. 1973. Türkiye Bitkileri Üzerinde Sitotaksonomik
Anatomik ve Morfolojik Araştırmalar. E. Ü. Fen Fakültesi İlmi Raporlar
Serisi, No:173, 3-14.
KETENOĞLU, O., KURT, L., KURT, F. 2003. Sığla (Günlük) Ağacının
(Liquidambar orientalis Mill) Ekolojik Özellikleri. Çevre ve İnsan Dergisi
Sayı:56, Çevre Bakanlığı Yayını.
KIMURA, M , CROW, J. M. 1978. Effect of overall phenotypic selection
on genetic change at individual loci. Proc.Natl.Acad.Sci. 75:6168-6171.
KUMAR, S., TAMURA, K., NEI, M. 2004. MEGA 3: Integrated Software
for Molecular Evolutionary Genetics and Sequence Alignment. Briefings in
Bioinformatics 5:150-163.
LANGELLA, O. POPULATIONS: population genetics software
(Individuals or populations distances, phylogenetic trees). CNRS, France.
http://pge.cnrs-gif.fr/bio-info/populations. (2000).
LANDE, R. 1995. Mutation and conservation. Conservation Biology 9:
782-791.
LEDIG, F. T. 1998. Genetic diversity in tree species: with special reference to
conservation in Turkey and the eastern Mediterranean. In: Zencirci et al.
(Eds.) The Proceedings of International Symposium on in situ Conservation
of Plant Genetic Diversity. 249-256. CRIFC, Turkey.
LEWONTIN, R. C. 1972. The apportionment of human diversity. Evol Biol
6: 381–398.
LI, J., BOGLE, A. L. 1997. Interspecific relationships and Genetic
Divergence of the disjunct Genus Liquidambar (Hamamelidaceaea) inferred
from DNA sequences of plastid gene Matk. Rhodora. 99 (899): 229-240.
LI, J., BOGLE, A. L., KLEIN, A. S. 1999. Phylogenetic relationships in
the Hamamelidaceaea: Evidence from the nucleotide sequences of the plastid
gene matk. Plant. Syst. Evol. 218:205-219.
LIANG, H. 1997. The phylogenetic reconstuction of the grass family
(Poaceae) using matK gen sequences. PhD Thesis of the Faculty of the
Virginia Polytechnic Instıtute and State University. Blacksburg, Virginia,
USA.
LIDÉN, M., FUKUHARA, T., RYLANDER, J., OXELMAN, B. 1997.
Phylogeny and classification of Fumariaceae, with emphasis on Dicentra s.l.,
based on the plastid gene rps16 intron. Plant Syst.Evol. 206: 411–420.
40
MILLAR, C. I., MARSHALL, K. A. 1991. Allozyme Variation of PortOrford-Cedar (Chamaecyparis lawsoniana): Implications for Genetic
Conservation. Forest Sci. 37:1060-1075.
MORTON, C. M., GRANT M., BLACKMORE S. 2003. Phylogenic
relationships of the Aurantioideae inferred from chloroplast DNA sequence
data. American. J. Bot., 90: 1463-1469.
MUIR, D., SCHLOTTERER, C. 1999. Limitations to the phylogenetic use
of ITS sequences in closely related species and populations - a case study in
Quercus petraea (Matt.) Liebl. Chapter 11 in: Which DNA Marker for
Which Purpose? Final Compendium of the Research Project Development,
optimisation and validation of molecular tools for assessment of biodiversity
in forest trees in the European Union DGXII Biotechnology FW IV
Research Programme Molecular Tools for Biodiversity. Gillet, E.M. (ed.).
NAMKOONG, G., BARNES, R. D., BURLEY, J. 1980. A Philosophy of
Breeding Strategy for Tropical Forest Trees Commonwealth Foresty
Institute, Tropical Foresty Papers No:16. Oxford Unıversity Press, Oxford.
NEALE, D. B., DEVEY, M. E., JERMSTAD, K. D., AHUJA, M. R.,
ALOSI, M. C., MARSHALL, K. A. 1992. Use of DNA Markers in Forest
Tree Improvement Research. New Forests. 6: 391-407.
NEI, M. 1972. Genetic distance between populations. American Naturalist,
106: 283-292.
NEI, M. 1987. Molecular evolutionary genetics. Columbia University Press,
New York.
NEI, M., KUMAR, S. 2000. Molecular evolution and phylogenetics.
Oxford University Press, New York.
NESBITT, K. A., POTTS, B. M., VAILLANCOURT, R. E., WEST, A.
K., REID, J. B. 1995. Partitioning and distribution of RAPD variation in a
forest tree species, Eucalyptus globulus (Myrtaceae). Heredity, 74: (6) 628637.
NEUHAUS, H., SCHOLZ, A., LINK, G. 1989. Structure and expression of
a split chloroplast gene from mustard (Sinapis alba): ribosomal protein rpsl6
reveals unusual transcriptional features and complex RNA maturation. Curr.
Genet, 15: 63-70.
NICKRENT, D. L., SCHUETTE, K. P., STARR, E. M. 1994. A
molecular phylogeny of Arceuthobium (Viscaceae) based on nuclear
ribosomal DNA ITS sequences.
OR, M. 2007. Kloroplast genomundaki kodlanmayan “trn” bölgelerinin
karşılaştırılması yapılarak Liquidambar orientalis varyetelerinin filogenetik
analizi. ODTÜ, Master Tezi.
41
OXELMAN, B., LIDÉN, M., BERGLUND, D. 1997. Chloroplast rps16
intron phylogeny of the tribe Sileneae (Caryophyllaceae). Plant Syst. Evol.
206: 393–410.
ÖNAL, S., ÖZER, S. 1985. Ülkemizdeki Sığla Yağı üretimi ve
Değerlendirilmesindeki Sorunlar. Orman Ürünleri Endüstri Kongresi
(ORENKO). Trabzon.
ÖRTEL, E. 1988. Sığla ormanlarımızın durumu. Ormancılık Araştırma
Enstitüsü Dergisi Cilt 17, sayı 194: 16-19.
ÖZDİLEK, A. 2007. Kloroplast genomundaki matK gen bölgesine göre
Liquidambar orientalis varyetelerinin genetik farklılaşması. ODTÜ, Master
Tezi.
ÖZKAHRAMAN, İ. 1984. Anadolu Sığla Ağacı Yok Oluyor. Bilim ve
Teknik Dergisi, Cilt:17, Sayı:194.
PAMUKCUOĞLU, A. 1964. Memleketimizin Liquidambar orientalis
Orman Sahası. Türk Biyoloji Dergisi, 14, 2.
PERRY, D. A. 1978. Variation Between and Within Species. IUFRO, Proc.
Ecology of Evenaged Forest Plantation. 71-98.
PEŞMEN, H. 1972. The Genus Liqudambar L. in Davis, Flora of Turkey.
Vol:4, 264-265, Edinburgh.
ROSETTO, M., WEAVER, P. K., DIXON, K. W. 1995. Use of RAPD
analysis in devising conservation strategies for the rare and endangered
Grevillea scapigera (Proteaceae). Mol. Ecol. 4: 321-329.
RUSSEL, J. R., HOSEIN, F., JOHNSON, E., WAUGH, R., POWELL,
W. 1993. Genetic differentiation cocoa (Theobroma cacao L.) populations
revealed by RAPD analysis. Molecular Ecology 2: 89-97.
SAMARODOVA -BIANKI, G. B. 1957. De Genere Liquidambar L. Notule
Systematiscae ex Herbario Academiae Scientarum URSS. a. B. K.
Scuischkiy Redactus. Leningrad (XVIII), 77-89.
SCHNEIDER, S., ROESSLI, D., EXCOEFFIER, L. 2000. Arlequin
Software Version 2.000. A Software for population genetics data analysis.
Department of Anthropology and Ecology. University of Geneva,
Switzerland.
SHI, S., CHANG, H. T., YUEQING, C., LIANGHU, Q., WEN, J. 1998.
Phylogeny of the Hamamelidaceaea based on the ITS sequences of nuclear
ribosomal DNA. Biochemical Systematics and Ecology. 26:55-69.
SHI, S., HUANG, Y., ZHONG, Y., ZHANG, Q., CHANG, H.,
BOUFFORD, D. E. 2001. Phylogeny of the Altingiaceae based on cpDNA
matk, PY-IGS and nrDNA ITS sequences. Plant. Syst. Evol. 230: 13-24.
SORENSEN, F. C. 1969. Embryonic genetic load in coastal douglas-fir,
Pseudotsuga menziesii var. menziesii. American Naturalist 103: 389-398.
42
TANKER, M., SAYRON, E. 1974. Strax Liquidus Üzerine Farmokognozik
Araştırmalar. A. Ü. Eczacılık Fakültesi Mecmuası, Vol:4, No:1.
TETİK, M., ŞİRİN, G. 2002. Karacaören I. ve II. Barajlarının, Karacaören
Tabiat Ormanındaki Doğal Sığla (Liquidambar orientalis Mill.) Meşceresi
Üzerine Etkileri. Batı Akdeniz Ormancılık Araştırma Müdürlüğü Yayınları,
Dergi Serisi, Sayı:4.
TOPÇUOĞLU, A. 1947. Sığla yağı istihsali. Orman ve Av, Yıl:19, Sayı:9.
TOPÇUOĞLU, A. 1950. Sığla yağının ekonomik değeri. Orman ve Av,
Yıl:22, Sayı:1.
TOPÇUOĞLU, A. 1968. Siğla Ormanlarının Islahı, Bakımı, Sığla Yağı
İstihsali ve Kıymetlendirilmesi. Orman Genel Müdürlüğü, Teknik Haberler
Bülteni, Yıl:7, Sayı:28, 3-23.
WACHIRA, F. N., WAUGH, R., HACKETT, C. A., POWELL, W.
1995. Detection of genetic diversity in tea (Camellia sinensis) using RAPD
markers. Genome. 38:201-210.
WHITE, T. J., BRUNS, T., LEE, J. TAYLOR, W. 1990. Amplification
and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp.
315-322 In: PCR Protocols: A Guide to Methods and Applications, eds.
Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press,
Inc., New York.
WRIGHT, S. 1969. Evolution and genetics of populations: The theory of
gene frequencies. Chicago University Press.
YEH, F. C., YANG, R., BOYLE, T. 1997. POPGENE Version 1.20.
Windows-Based
Software
for
Population
Genetics
Analysis.
(http://www.ualberta.ca/~fyeh/)
YEH, F. C., CHONG, D. K. X., YANG, R.-C. 1995. RAPD variation
within and among natural populations of trembling aspen (Populus
tremuloides Michx.) from Alberta. Journal of Heredity 86: 454-460.
YÜCEL, M. 1991. Orman Ağaçlarımızdan Sığla Ağacı ve Kazdağı Göknarı.
Fen ve Tıp Bilimlerinde Araştırma. Cilt:3, Sayı:35.
43
Download

Liquidambar orientalis Miller - Batı Karadeniz Ormancılık Araştırma