ANADOLU MANDASI
Prof. Dr. M. İHSAN SOYSAL
Dr.Emel ÖZKAN
Dr.Özden ÇOBANOĞLU
Namık Kemal Üniversitesi
Tekirdağ Ziraat Fakültesi
Zootekni Bl.Biyometri ve Genetik ABD
Dombey,Gedek,Camış,Kömüş gibi adlarla da
bilinir.
GİRİŞ:
(Manda Yetiştiriciliğinin Avantajları)
‹ Manda et, süt ve çeki hayvanı olarak özellikle
Asya’nın tropik ve subtropik bölgelerinde
büyük bir ekonomik etkinleğe sahiptir.
‹ Yem seçmemesi ve diğer ruminantlara oranla
kaba yemlerden daha fazla yararlanılabilme
yeteneğinde olması nedeni ile özellikle mera
hayvancılığı için oldukça elverişlidir.
‹ Sığır ve koyunların yararlanamadığı alanlar
mandalar
tarafından
tehlikesizce
kullanılabilmektedirler.
FAO istatistiklerine göre dünya manda popülasyonu
1982’de 128 milyon iken 1992’de 148 milyon olmuştur.
Buna göre son 10 yılda % 1.2 artış olmuştur.
FAO, 1992 istatistiklerine göre dünya manda
popülasyonunun %95-96’sı Asya’da bulunur.
Güney Asya,Hindistan gibi büyük ülkelerde Dünya
manda popülasyonunun %53’ü bulunur. Hindistan’da
son 10 yılda manda sayısı 880.000 adet (yılda %1.1)
artmıştır. FAO1996 verilerine göre Hindistan’da
mandalar sütü alınan (keçi dışındaki) hayvanların
%35’ini oluşturur. Aynı istatistikler üretilen sütün %70’i
mandadan elde edildiğini göstermektedir. Hindistan’da
82 milyon manda varlığı bildirilmektedir.
Dünyanın ikinci büyük manda sayısına sahip ülkesi
Çin’dir. Bu ülkede 1982’de 18.8 milyon olan manda sayısı
yıllık %1,6’lık artışla 1992’de 22 milyona çıkmıştır.
Dünya manda popülasyonunun en çok sayısına
sahip üçüncü ülke Pakistan’dır. Bu ülkede yıllık artış oranı
%4.7’dir.Bangladeş ve Nepal ise sırasıyla yıllık %5.7 ve
%2.1’lik artışa sahiptir.Sri Lanka’da manda sayısı
azalmaktadır.
Tayland, Filipinler ve Malezya’da manda sayısı
sırasıyla%1,1 , %1.3 ve -%2.3 arasında azalmaktadır.
Endonezya, Laos, Vietnam, Myanmar (Birmanya) gibi
ülkelerde artış söz konusudur.
Türkiyede halen yüzbin manda bulunduğu tahmin
edilmektedir.
‹
‹
‹
‹
Mitokondrial Genlerin Açıklaması
Mitokondrialar eukaryotik hücrelerde bulunan alt
hücresel organellerdir. Bunlar gıda moleküllerinin
oksidasyonu ile açığa çıkan enerjinin hücre enerji
gereksinim reaksiyonlarında kullanılabilecek depolanmış
forma çevrilmesinden sorumludur.
Mitokondrial içinde yer alan proteinler ve kofektörler
ATP gibi nukleotıdlerde depolanmıştır. Oluşumunu
sağlayan karmaşık elektron tranfort sisteminin
kapsamın, oluştururlar.
1958’e kadar mitokondrial proteinlerin çoğunun
sitoplazmada üretilip oradan organele geçirildiği çok
azının ise mitokondriada mevcut ribozomlarda yapıldığı
düşünülüyordu. Neticede bu proteinlerin sadece
mitokondriada bulunan belirli DNA molekülleri aracılığı
ile taşınan genlerce kodlandığı anlaşıldı. Bu nedenle bu
organeller çekirdekten fenomen bağımsız genetik
sistemler içerir.
Şekil. 10.1. Mitokondriyal proteinlerin sentezi için iki yer
Şekil.10.2.Bira mayası mitokondriya genomunun genetik haritası
‹
‹
‹
‹
Mitokondrial Genler Standart Tekniklerle
Haritalanır
Mitokondrial genlerle çalışmak (1990) larda özellikle
bira mayası S.Cerevisae'nin klasik genetik analizlerle
incelenmesi sonucu ilerlemiştir. Bira mayası
mitokondrial genleri ile hangi proteinlerin kodladığı
mitokondrial genomun nisbi pozisyonlarına ilişkin
haritalar klasik standart tekniklerle tanımlanmıştır.
Bindokuzyüzseksende ayrıntılı genetik harita
yapılmıştır.
Bira mayası ile bu çalışmalar sürerken diğer araştırma
grupları diğer organizmaların mitokondria genlerini
araştırmışlardır. Neticede tüm mitokondriaların kendi
ribozomlarına sahip oldukları anlaşıldı. Ancak
mitokondrial DNA moleküllerinin büyüklüğü değişkenlik
gösterir. Birçok hayvansal mitokondrial DNA molekülleri
15 kilobazlığı bazı bitki genomları 1000 kilobazdır.
Biramayası genomu ise 80 kilabozdır. Biramayası
nükleaz kromozomu ise 600 kilobazdır.
Bu büyüklükteki varyasyonu tüm organizmaların
mitokondrial genomlarının yeni gen unsurlarının içerip
içermediği yada daha küçük hayvansal genomun bira
mayasından daha az genom içerip içermediği sorusuna
yol açmıştır.
Bu soruya klasik genetikte tam cevap verilemez.
Ancak mitokondrial genler ayrıntılı elde edildikten sonra
daha iyi cevap beklenebilir.
Çünkü birçok genetik teknikler incelenen gende
bir mutasyon oluşturmaya dayanır.
Organizmaların çoğunda mitokondrial genler için
gendeki mutasyonlar letaldir.
Çünkü bu şekilde enerji üretimi yok edilmektedir.
Ama maya olağan dışı durumlarda facultatif Anerob olan
organizma
gerektiğinde
mitokondrial
aktivite
olmaksızında
işlev
sürdürür.
‹
‹
‹
DNA Diziliş Sıra Analiz Yöntemleri Mitokondrial
Genoma Uygulanması
1975’lerde hızlı DNA diziliş sıra analiz teknikleri ilk
geliştirildiğinde mitokondrial genomlar bu konuma
uygulandığı ilk molekül tipi olmuştur. Bu olgu kısmen bu
moleküllerin gizeminden ve kısmen daha küçük genom
içeren (mesela hayvanlar ve ipliksi mantarlar) nitelikleri ile
uygulama alanı arayan diziliş sırası analiz projelerinin
kapsamına girmekteydiler.
Bu projeler birçok gen klonlama tekniklerini kullanmıştır.
Mesela 33 kilobazlık Aspergillus nidulans isimli mitokondria
genomu böyle bir örnektir. Bu 1979 da başlamış 5 yıl sonra
bitirilmiştir. İlk adım saf mitokondrial DNA hazırlığıdır. Bunun
için standart toplam hücre için DNA hazırlanmasına nazaran
bir modifikasyon yöntemle örnek hazırlanmıştır. Çünkü
mitokondrial DNA nükleaz DNA'dan tamamen arı olmak
zorundadır. Orijinal eldeğmemiş mitokondrialar hazırlanır,
yıkanır tüm hücresel materyal uzaklaştırır ve lisise edilerek
(DNA) saflaştırılır. Saf mitokondria DNA örneği bir seri (R.E)
enzimleri ile kesilir ve ayrıntılı restriksiyon haritaları yapılır.
Şekil. 10.3. Aspergillus nidilans mitokondrial genomunun tam DNA diziliş sırasını
elde etmek için kullanılan stretejinin özeti
‹
Klon Kütüphaneleri mitokontrial (DNA) nın
HındlII, EcoRI ve Bal II gibi nükleotid
endunükleazlar ile kesilerek ve parçaları pBR322
ye ekleyerek hazırlanır. Gendeki DNA parçaları
kendileride Sau3A, Alu. I ve Tagl gibi
tetranükleotid endonükleazlarla kesilmiştir. Elde
edilen parçalar ister Maxam Gilbert yöntemi ile
dizilim analizine sabit tutulur yada eğer Coulson
diziliş analizi için M13'e aşılanır. Neticede giderek
çakışmalar mitokondrial DNA dizilimi elde edilmiş
olur.
‹
‹
‹
‹
‹
Mitokondrial DNA Analizi Önemli Sürpriz Sonuçlar
Vermiştir.
A.Nidulans genomu mitokondrial (DNA) dizilim analizi
fenemlere mantar genomudur. Bunun ardından insan, böcek,
fare gibi memeli hayvanlarında mitokondrial DNA dizilimi
tamamlanmıştır.
Bu üç proje yanısıra bira mayası, diğer mantarlar böcekler
ve az sayıda bitkiden elde edilen bilgiler büyüklük söz
konusu olmaksızın mitokondrial (DNA) nın çok az varyasyon
olmakla beraber hemen hemen aynı genler uzunluğuna
sahiptir.
Büyüklük farkıda genler arasındaki aralık (boşluk)
DNA'lardan ileri gelmektedir. Daha küçük genomlar oldukça
sıkı ve genler arasında çok az aralık bulunurken bitkiler gibi
daha büyük genomların daha gevşek organize olduğu
anlaşılmaktadır.
Böyle DNA dizilimleri mitokondrial genom organizasyonunu
anlamakdan daha fazla bilgi sağlarlar. Diziliş sıraları analizi
aşağıda belirtilen beklenmeyen sonuçlar sağlamıştır. Bu
bulguların araştırmaları ateşlemesi beklenir. Elde edilen
sürpriz sonuçlar şunlardır.
Şekil. 10.4. İnsan mitokondrial genlerinde kullanılan genetik kodun universal koddan farklı
olduğuna dair kanıt. Nükleotid diziliş sırası gösterilen unsur sitokrom C ksidaz II alt
ünitesinin bir kısmıdır .Universal koda göre TGA kodonu durdur ancak saflaştırılmış
sitokrom C oksidaz II alt ünitesi protein bu noktada triptofan içerir. Sonuç olarak insan
mitokondrial genomunda TGA sonlandırmadan ziyade Triptofandır.
MİKROSATELLİTLER
Mikrosatellitler değişik sayıda kısa ard arda nükleotid dizilim
tekrarları içeren bölgelerdir (yukarıdaki şekilde (CA) tekrarları söz
konusudur). Her mikrosatellit lokusu bu lokusa özgü primer ile
tanınır. Primer bitişikteki tekrarlanan bölgeye özgü özgün dizilimi
ifade eder.
Mikrosatellitler iyi genetik işaretleyicidir. Çünkü her biri farklı
birçok allele sahiptir. Mesela birçok tekrar bölgesi uzunluğu olabilir.
Bu durumda birçok allel söz konusu ise bireylerin çoğu heterozigot
olur.
İŞARETLEYİCİ TİPLERİ
Minisatellit (Mini s) : Genellikle 10 baz çifti içeren değişken
sayı da tekrarlanan DNA baz çifti dizilimi
Tek Nukleotid Polimorfizmi (Single Nucleotid Polimorfizm = SNP):
Genom dizilişinde nokta mutasyonu olup esas itibariyle bi
allelik, fakat her biri aynı lokasyonda 4 nükleotid bazdan her
biri ile (4) allel oluşturan yapısal çok şekillilik.
Mikrosatellit : (Mıcro s): Aynı kısa dizilimi çok kere
tekrarlandığı yerler esasına göre oluşmuş dizilim.
EVCİLLEŞME ÇALIŞMALARINDA MOLEKÜLER İŞARETLEYİCİLER
Mitokondriyal DNA Polimorfizm
mtDNA daki değişkenlik genetik çeşitlilik için şu nedenlerle uygundur.
mtDNA ana yoluyla kalıtlanır. Rekombinasyon göstererek genomdaki
tüm işaretleyiciler bir haplotip gibi etkili bağlı haldedir. Bu nedenle
mitokondrial genomdaki nükleotid farklılığı genetik farklılığı direk
gösterir.
Her hücre mtDNA’nın binlerce kopyasını içerir.
mtDNA bölgelerinin çekirdek DNA dan 5-10 misli. daha çok mutasyon
gösterir.
Bu durum evcil ve yabani populasyonun farklılaşmasını çalışmak için
kısa zaman diliminde avantaj verir.
mtDNA analizinden uygun yol diğer mtDNA bölgelere göre daha çok
varyasyon gösteren. Sitokron B geni ve kontrol bölgesi dizilimini
belirlemektir.
(Y) Kromozomu : mtDNA’nın anasal kalıtımla ilgisinde olduğu gibi
populasyonda babadan geçen özellikler bakımından varyasyonu
incelemeye uygundur. Burada rekombinasyon kromozomun küçük bir
alanı ile sınırlıdır.
Microsatellites
Kısa tekrar sayılarındaki varyasyon (farklılık)
allel 1
allel 2
DNA İŞARETLEYİCİLERİN TİPLERİ, AVANTAJLARI, NİTELİKLERİ
İşaretleyici Nitelikler : Aşağıdaki işaretleyicilerde istenilen özellikler
tanımlanmıştır.
Yaygın Dağılım : Genom boyunca yaygın değişik haritalamaya elverişlilik
Yerel Yoğunluk : Küçük genomik bölge içinde de ince ayar haritalama
yapmaya uygun işaretleyiciler olma kabiliyeti
Genomda Bulunabilirliği : Genomda fiziksel bir lokalize olma yeri
bulunmak
Yüksek Polimorfik : Homolog kromozom segmentleri arasından ayırt
edilebilirlik, bu durum işaretleyici lokusda allel sayısı çok içerikde
heterozigotluk artışına bağlıdır.
Kodominant : Her iki allelin tanımlanabilirliği
Düşük Mutasyon : Generasyonlar boyunca uzun dönem stabilite niteliği
Yüksek Elverişlilik : PCR sürecine elverişlilik dahil ,aynı miktar DNA’dan
daha çok genotiplendirmeye olanak veren otomasyona uygun nitelik
Düşük Teknik Maliyet:
Tekrarlanabilirlik:
Farklı İşaretleyici Tiplerin Vasıfları
NitelikD
Mini S
Parmakizi
RFLD
RAPD
Mıcro s
AFLP
Yaygın
Dağılım
Orta
Orta
Çok iyi
Çok iyi
Çok iyi
Yerel
Yoğunluk
Zayıf
Zayıf
Orta
Orta
İyi
Orta
Çok iyi
Genomda
Bulunabili
rlik
Zayıf
Çok iyi
Çok iyi
Zayıf
Çok iyi
Orta
Çok iyi
Polimorfizm
Çok iyi
Çok iyi
Zayıf
Orta
Çok iyi
Zayıf
Zayıf
Kodominantlı
k
Evet
Hayır
Evet
Hayır
Evet
Hayır
Evet
Mutasyon
Hızı
Hızlı
Hızlı
Makul
Makul
Hızlı
Makul
Makul
Yüksek
elverişlilik
Çok
düş
ük
Çok düşük
Orta
Orta
Orta
Orta Çok
Yükse
k
Teknik
Maliyet
Çok
yük
sek
Çok
yükse
k
Çok
yükse
k
Çok
yükse
k
Orta
Orta
Çok düşük
Tekrarlanırlık
Zayıf
Zayıf
İyi
Çok zayıf
İyi
İyi
Çok iyi
Çok iyi
SNP
Çok iyi
Bu şekil farklı mikrosatellit DNA parçalarını
farklı eletroforez işlemi sonucu gözlenen allellerini
temsil eder. Daha küçük DNA parçaları daha hızlı
ilerler.
Bu örnekde dört allel vardır. Kuşkusuz her
birey sadece ikisini taşır. Dört hayvanın genotipleri
sırasıyla bd, ac, ad, bc, biçiminde olur.
Manda Yetiştiriciliği:
Dünya’da manda yetiştiriciliği :
‹ Asya, Kuzey Afrika, Kuzey ve Güney
Amerika, Akdeniz ülkeleri (Fransa
dışında), Balkanlar ile bazı Orta
Avrupa ülkelerinde ve
Avusturalya’da yetiştirilmektedir.
‹ Bir çok ülkede manda yetiştiriciliği
yapılmakla birlikte evcil manda
populasyonlarının çoğunun Asya’da
olduğu belirtilmektedir (~%95’i‹
Hindistan, Çin, Parkistan, Endonezya, Filipinler
vs...).
Türkiye’de Manda Yetiştiriciliği:
Anadolu Mandası’nın yogun olarak
bulunduğu bölgeler:
‹
‹
‹
‹
‹
Kuzey Anadolu Bölgesinin kıyı şeridi
(Sinop, Samsun),
Orta Anadolu’nun kıyılara yakın kuzey
kesimleri (Çorum, Amasya),
İç Batı Anadolu ( Afyon, Balıkesir),
Doğu Anadolu (Sivas, Muş)
Güney Doğu Anadolu ( Diyarbakır) ‘da
bulunmaktadır.
NİÇİN ANADOLU MANDASI :
‹
‹
‹
Türkiye’deki Anadolu Mandası
populasyonlarında genetik çeşitliliğin yüksek
olabileceği düşünülmektedir.
Anadolu Mandası’nın mtDNA ve mikrosatellit
polimorfimzi ilk kez çalışılacak,
populasyonların genetik yapısı incelenecektir.
Asya, Avrupa ve Afrika da yetiştirilen manda
ırkları karşılaştırılması yapılmamıştır.
Genetik Çeşitlililiğin yüksek olmasının nedenleri:
‹
‹
‹
Türkiye konum olarak geçiş bölgesinde (Asya,
Avrupa ve Afrika)
Türkiye’nin birçok çiftlik hayvanının ilk evrimleşme
merkezine yakın olması (Güney Anadolu ve civarı)
(koyun, sığır, keçi ve manda)*.
Türkiye’deki yerli ırklardaki genetik çeşitliliğin
yüksek olması başka ırklarda kaybolmuş genetik
enformasyonu da içerdiği için korunmada öncelikli
olabileceğini düşündürmektedir (Bruford ve ark.,
2003; Loftus, 1999).
*Clutton-Brock, 1981; Meadow, 1993; Loftus ve ark., 1994; Legge, 1996; Uerpmann, 1996; Bradley et al., 1996; Tanaka ve
ark., 1996; Loftus ve ark., 1999; Luikard ve ark., 1999; Troy ve ark., 2001; Luikard ve ark., 2001, Hiendleder ve ark., 2002;
Bruford ve ark., 2003; Bruford and Townsend, 2004.
AMAÇ:
‹
‹
‹
‹
Türkiye’de Anadolu Mandası populasyonlarının
genetik yapısının moleküler genetik teknikler
(mtDNA ve mikrosatellitler) ile incelenmesi
yapılabilecektir.
Mevcut literatür verilerinden yola çıkarak
Türkiye’de yetiştirilen Anadolu Mandası ile
Dünya’daki manda ırkları arasında
karşılaştırmalar yapılabilecektir.
Anadolu Mandası’nın kökeni hakkında bilgi
sahibi olunacaktır.
Anadolu Mandası populasyonlarının genetik
saflık düzeyi incelenebilecek,
MATERYAL VE METOD:
‹
‹
Türkiye’nin yerli gen kaynaklarından biri olan
ve sayısı her geçen gün azalmakta olan
Anadolu mandasının genetik yapısı
20
mikrosatellit lokusu ve mtDNA polimorfizm
tekniğine göre incelenecektir.
Anadolu Mandası’nın genetik yapısı ilk kez
moleküler teknikler kullanılarak
incelenecektir.
‹
‹
‹
Çalışmada farklı populasyonlarından seçilen
ortalama 50 bireyin genetik çeşitliliği ve
mevcut populasyonların genetik yapısının
incelenmesi planlanmaktadır.
Çalışılacak mikrosatellit lokusları ISAG ve FAO
çalışma grubunun belirlediği 30 mikrosatellit
lokusu arasından seçilmiştir (ISAG, 2004).
Anadolu mandasında mtDNA polimorfizminin
incelenmesinde kullanılacak primer
Çalışılacak Mikrosatellit Lokuslar ve
Kromozomları :
Mikrosatellit İsmi
Allel Sayısı
Kromoz
om No
Mikrosatellit
İsmi
Allel
Sayısı
Kromozom
No
CSSM061
12
-
CSSM033
11
17
DRB3
9
2p (23)
CSSM038
13
11
BMC1013
10
3p
CSSM043
12
1p(27)
CSSM062
8
-
CSSM047
20
3q(8
CSSME070
8
3p(19)
CSSM019
15
1q (1)
ETH121
7
2q
CSRM060
15
11 (10)
ILSTS030
5
2q
CSSM029
1
19 (7)
ILSTSO33
bb
13(12)
CSSM041
11
21 (20)
ILSTS005
5
11(10)
CSSM057
11
9 (7)
ILSTS008
4
15(14)
ETH003
19
3p (19)
Mandanın Sınıflandırılması ve
Kökeni
‹
‹
‹
‹
‹
Mandalar morfoloji ve davranış kriterlerine
göre iki tipe ayrılmaktadır.
Bataklık Mandaları : (2n= 48)
Filipinler ve Batı Hindistan’da bulunur.
Bataklık mandaları iş güçü yönünde
gelişmiş olup süt verimi oldukça azdır. Son
yıllarda et yönünde seleksiyon
yapılmaktadır.
• Nehir Mandaları : (2n=50)
Batı Hindistan, Mısır ve Avrupa’ya kadar
yayılan alanlarda bulunur. Süt ve et
verimleri oldukca iyidir.
• Amerikan Buffaloları (bizon),ile Zebu sığırları
(Indıcus ) karyotipleri bakımından
benzerdir(2n=60).
• Afrika buffaloları: Ya da Kongo buffaloları denilen(
syncerus caffer nannus ) kromozom sayısı
(2n=54)
• ve yine Latince adı syncerus caffer caffer olan
diğer Afrika mandalarının kromozom sayısı
(2n=52)’dir.
• Yabani Hindistan mandası uysal/evcil niteliğinde
olmayıp Madhya Pradesh ve Assam isimli bölge
ormanlarında yaşarlar. Yabani yaşayan bu
mandalar ise Arni mandası diye bilinir.
• Nehir ve Bataklık mandaları arasındaki coğrafi
sınırların Burma’daki “Arakan-Yoma ve Patkai,
Barail” dağ silsileleri olduğu var sayılmaktadır. Bu
dağların batısı Nehir mandaları doğusu ise
Bataklık mandası tipi olarak öngörülmektedir.
‹
‹
‹
Güney Hindistan mandalarının tümü dış (düşük süt verimi,
küçük cüsse bakımından) karakteristikler bakımından
bataklık mandalarına benzer. Orissa adı verilen mandalar
49 kromozom sayısı ile Bataklık mandalarına benzer.
Hindistan içinde de Bataklık ve Nehir mandaları için sınır
bölgelerinde sitotaksonomi bakımından karyotip esasına
göre yeterli çalışma yapılmamıştır.
Kuzey Hindistan mandaları üzerinde yapılan çalışmalar
(2n=50) kromozom sayısına sahip nehir mandaları tipinin
varlığını göstermiştir. Özellikle pestisitler bakımından çevre
kirliliği gösteren, fabrika atığı içeren sulardan içen, içinde
yüzen mandalarda kromozom sayısı değişmeleri
görülmüştür.
Bu olgu etkilenen mandalar arasında sterilitiye de yol açar.
Nehir mandalarının genomunun (2n=50) olduğu yönündeki
hipotez deneysel doğrulama gerektirir. Ancak Nehir
mandaları (2n=50) ve Bataklık mandaları (2n=48)
arasındaki melezlerin (F1) ve (F2) döllerinde kromozom
sayısı 49 olmasına karşın döl verimliliği gözlenmektedir.
‹
‹
‹
‹
‹
Mandalar orjinalde Asya hayvanı olup, Yakın Doğuya ve Kuzey
Afrika’ya buradan geçtiği düşünülmektedir (Soysal M.İ., 2006,
Şekerden, Ö., 2001; Kumar ve ark., 2006)
Mandanın M.Ö.5000 yıllarında önce Güney hindistanda Arni
Mandasından evcilleştirildiği düşünülmektedir. (Soysal M.İ., 2006)
Avrupa’ya bir rivayete göre Haçlı seferleri ile Ortaçağda getirildiği;
başka bir rivayete göre ise İtalya Kralı Arululava’ya (595-596
yılları)Avar Hanından hediye olarak verilerek getirildiğinden
bahsedilmektedir.(Soysal M.İ., 2006 , Kumar ve ark., 2006).
Türkiye’de yetiştirilen mandalar Anadolu mandası olarak
adlandırılmakta olup Akdeniz mandasının nehir mandası sınıfına
girmektedir .
Akdeniz mandalarının ise Hindistan mandasından köken aldığı
belirtilmektedir ( Dellal, 1994, Şekerden, 2001; Soysal M.İ., 2006;
Kumar ve ark., 2006).
Mandalarda Yapılan mtDNA Çalışmaların
Özetleri
‹
‹
‹
Asya mandalarında mtDNA polimorfizminin incelendiği
bir çalışmada (Lau ve ark., 1998);
303 bp uzunluğunda Cytochrome b gen bölgesi 14 farklı
populasyondan alınan 54 bireyde çalışılmıştır.
158 bp uzunluğundaki D-loop bölgesi, 11 farklı
populasyondan alınan 80 bireyde çalışılmıştır.
Şekil: İnsan mt DNA’sının gen haritası
‹
‹
‹
‹
‹
Bu çalışmada (Lau ve ark., 1998);;
Bir tane “cytochrome b” haplotipinin
sadece nehir mandalarında olduğu
belirlenmiştir.
4 tane “cytochrome b” haplotipinin ise
sadece bataklık mandalarında olduğu
belirlenmiştir.
Bir haplotipin ise hem nehir hemde bataklık
mandalarında olduğu belirlenmiştir.
D-loop gen bölgesinde 33 farklı haplotip
belirlenmiş olup bu haplotiplerden sadece
11 tanesinin bataklık mandalarında
görüldüğü beirlenmiştir.
‹
‹
‹
D-loop gen bölgesinin sonuçlarının analiz edilmesi
sonucunda, bataklık ve nehir mandalarının ortak bir
atadan geldiği tahmin edilmekte olup, bu ortak atanın
yabani Asya mandası (Bubalus arnee) olabileceği
belirtilmiştir.
D-loop bölgesi verilerinden, nehir ve bataklık manda
tiplerinin birbirlerinden
28 000 ila 87 000 yıl önce olmuş olabileceği belirlenmiştir.
Haplotip : Bir kromozom üzerinde bulunan çok yakın
bağlı genler veya işaretleyicilerle ilgili allelin
kombinasyonu. Haplotipler birbirine bağlı genler ünitesi
oluşu nedeniyle bir ünite olarak kalıtlanır ancak
generasyonlar boyunca rekombinasyonla değişir
‹
‹
‹
Bu çalışma sonucunda mandanın yayılışı
hakkında ortaya atılan hipotez:
Güney Doğu Asya’dan bir kol Çin’in kuzeyine
ve bir diğer kolunda Hindistan’ın
kuzeyindeki alt kısımlara gitmiş olabileceği
yönündedir.
Nehir mandalarının Hindistanda
evcilleştirildiği, bunu izleyen
evcilleştirmenin ise Çin’de bataklık
mandalarında olduğu belirtilmiştir. Çin’den
de Tayvan, Filipinler, Borneo, Sulawesi,
güneydoğu Asya ve Endonezya’nın
batısındaki adalara yayılmış olabileceği
tahmin edilmektedir.
Afrika manda ırklarında mtDNA
polimorfizminin incelendiği bir çalışmada
ise ( Simonsen ve ark., 1998);
‹
‹
‹
348 bç uzunluğundaki mtDNA kontrol bölgesi,
Afrika’nın doğusunda ve güneyinde
yetiştirilen 11 farklı populasyonda
çalışılmıştır.
Afrika manda populasyonlarında kıtasal
düzeyde yüksek düzeyde genetik varyasyon
olduğu belirlenmiş olmasına rağmen
populasyonlar arasındaki farklılıkların
bölgesel bazda düşük olduğu belirlenmiştir.
Cografik olarak birbirine yakın olan
populasyonlar arasındaki farklılıkların düşük
olduğu belirlenmiştir.
‹
‹
‹
Bu 2 çalışmanın incelenmesi
sonucunda mtDNA polimorfizminde;
D-loop bölgesi (158 bç), Cytochrome
b (303 bç) ve mtDNA kontrol
bölgelerinin (348 bç) çalışılması ile;
Türkiye’deki Anadolu mandasının
kökeni hakkında bilgi sahibi
olunabileceği gibi, cografi uzaklık ile
populasyonlar arası genetik
farklılıkların arasında bir bağlantının
olup olmadığı incelenebilecektir.
‹
Kierstein ve ark. 2003 yilindaki mandalarin
evcillestirilmesine yonelik yapilan Avrupa ve
Latin Amerika manda irklarini iceren bir
calismada,
• Butun mt DNA D-loop bolgesini 4 farkli
irkdan 80 mandada analiz ettiler.
• Analizlerinde 128 polimorfik bolgeyi iceren
36 haplotip belirlediler.
• Gerek nehir gereksede bataklik
mandalarinin Hindistan’da ayni sekilde
evcillestirildigi kanisina vardilar.
• Çindeki mandalarinda digerlerinden
bagimsiz olarak evcillestirildiklerine dair
dusunclerini ifade ettiler.
• Iki manda sinifinin bagimsiz olarak
evcillestirilip evcillestirilimedigine
yonelik yapilan calismada (Kumar ve
ark, 2007).
• Sekans analizi Mt dNA Dloop ve cyt b
gene sirasiyla 217 ve 80 manda yapildi
(8 farkli irkdan)
• Data sonuclari nehir ve bataklik
mandalarinin iki farkli sinif olduklarini
ve
• 2 sinifin birbirinden bagimsiz olarak
evcillestirildigini ortaya koydular.
‹
Faruque, MD nin Banglades
mandalariyla yaptigi diger bir
calismada;
• 6 farkli populasyondan 36
mandada,1140 bc uzunlugundaki mt
DNA tamamiyla sekans edilmis.
• 13 farkli haplotip tesbit edilmis.
‹
‹
Bunlarda 11 si nehir mandalariyla, 2 si
bataklik mandalariyla, 1’i de her iki sinifla
homoloji gostermistir.
Genetik olarak ulkenin bati ve orta
kesimlerinindeki mandalar Hindistan daki
nehir ve Nili-Ravi irkina benzerken, dogu
bolgesindekilerin ise hem nehir hemde
bataklik mandalarindan genler tasidigi tespit
edilmistir
Mandalarda Yapılan Mikrosatellit
Çalışmaların Özetleri
‹
‹
Hindistan’da yetiştiriciliği yapılan 8 nehir
mandası ırkından oluşan 383 bireyde 27
mikrosatellit lokusunun çalışıldığı bir
çalışmada ( Kumar ve ark., 2006); ırklar
arası genetik çeşitliliğin yüksek olduğu
belirlenmiştir.
Çalışmada bazı ırklarda Hardy-Weinberg
dengesinden sapma olduğu belirlenmiş olup
bu sapmanın nedeninin heterozigotluk
eksikliğinden olduğu belirlenmiştir. Bu
ırklarda görülen heterozigotluk eksikliğinin
nedenleri tahmin edilmeye çalışılmış ve bu
ırkların yetiştirilme sistemlerinde
düzenlemeye gidileceği belirtilmiştir.
‹
‹
Çalışmada populasyonların genetik yapısı
incelenmiş olup ırklar arası genetik
uzaklıklar, ırklar arası karışım oranları ve
ırklar arası genetik farklılıklar
incelenmiştir.
Çalışmada elde edilen sonuçların,
Hindistan manda populasyonlarının
koruma stratejilerinin oluşturulmasında ve
uygun yetiştirme programlarının
geliştirilmesinde yararlı olacağı
belirtilmiştir.
‹
Navani ve ark, (2002).
• Sigirda tanimlanan 108 sigir mikrosatelit
primer ciftinin sigira uygulanabilirligini
incelemistir.
• 81 marker (%75)basarili bir sekilde
cogaltilirken
• Bunlardan 61 marker (% 56) 25 manda
DNA panelinda polimorfik band sekli
gostermislerdir.
• Allel sayi ortalamasi 4.5 (SE 0.20)
• Ortalama heterozigotluk ise 0.66 (SE 0.02)
Kumar S. ve ark (2006) yaptiklari bir
calismaya gore 8 Hindistan nehir
mandasi irkinda genetik degiskenlik ve
aralarindaki iliskiler incelenmistir.
‹ 27 mikrosatelit lokusu kullanilan bu
calismada HW dengesidan onemli olcude
sapmalar gorulmustur. Fst indexi
bakimindan irk farkliliklari analiz
edildiginde % 0.75 – 6.değerleri
gözlenmiştir.
‹ Komsu birlestirme diyagramlari onemli
olcude farkliliklari ortaya koymustur.
‹
Trakya Üniv.Ziraat Fakültesi Zootekni Bölümünce Anadolu mandası
populasyonunda yapılan Micro sattalite DNA polimorfizmi çalışmadan
aşağıdaki sonuçlar çıkmıştır.
The table shows the name of the microsatellite loci used in the study, their
primer sequences, Polymorphism information contents (PIC), annealing
temperature, the chromosome number the belong to, and the references articles.
Primer Sequence
PIC
Locus Name
TGLA227
CGAATTCCAAATCTGTTAATTTGCT
ACAGACAGAAACTCAATGAAAGCA
Annealing
Temp. (0C)
Chromosome
Number
Reference
55
18
Steigleder et al,
(2004)
ILSTS005
GGAAGCAATGAAATCTATAGCC
TGTTCTGTGAGTTTGTAAGC
0.42
55
10
Arora et al, (2003)
CSSM66
ACACAAATCCTTTCTGCCAGCTGA
AATTTAATGCACTGAGGAGCTTGG
0.49
58
14
Arora et al, (2003)
BM1818
AGCTGGGAATATAACCAAAGG
AGTGCTTTCAAGGTCCATGC
0.40
58
23
Arora et al, (2003)
LOCUS
Number of
alleles
(nA)
Observed
Heterozygosity
(HO)
Expected
Heterozygosity
(He)
Hn.b.
FIS
TGLA227
7
0.600
0.743
0.753
0.20
5
ILSTS005
3
0.550
0.494
0.500
0.10
1
CSSM66
8
0.775
0.707
0.716
0.08
4
BM1818
9
0.750
0.815
0.825
0.09
2
Mean
6.75
0.668
0.689
0.698
0.04
3
Characteristics of Bovine Microsatellite Markers Tested on Anatolian Water Buffalo Population.
Bizleri korumak için gösterdiğiniz ilgiye teşekkür ederiz.
Türkiye Anadolu Manda Populasyonunun 20
mikrosatellit lokusu ile incelenmesi
sonucunda,
‹
‹
‹
Mevcut populasyonların genetik yapısı ve
populasyonlarının genetik saflık düzeyi
incelenebilecek,
Diğer manda populasyonları ile
karşılaştırması yapılacaktır.
Genetik yapısı saf olan bireylerin koruma
altına alınması sağlanacaktır.
Sucuk:
İçindekiler: Sığıt eti, manda eti, kuyruk yağı, sarımsak, tuz, kimyon,
kırmızıbiber, karabiber, antimikrobiyal madde (sodyum nitrat ) asitliği
düzenleyici madde ( gulukono delta lakton ).Muhafaza: Vakumlu
ambalajlarda +4 °C da 3 ay
Boynuzda Yaşa Göre Oluşan Kertik ve Halkalar.
Biyometri ve Genetik Anabilim dalının laboratuvar olanakları
MANDA DA İLK 6 AYLIK
PLAN
İlk 6 Aylık Süre içerisinde:
‹
‹
‹
Manda örneklerinin gelmesine bağlı olarak
mevcut DNA’ların Izolasyonu.
DNA izolasyonunda Fenol – Kloroform –
İsoamil alkol metodunun uygulanması
düşünülmektedir.
Yapılan literatür taramalarının çoğunda ve
FAO DAD-IS kapsamında yürütülmekte
olan çalışmalarda bu metod ile DNA
izolasyonunun yapıldığı belirtilmektedir.
‹
Uluslar Arası Standartlara göre
Mikrosatellit Sonuçlarını Düzenleme
Ortak bir çalışmada birlikte çalıştığımız
Prof. Dr. Alessio Valentini’nin
laboratuvarına (Department of Animal
Production, University of Tuscia, Via
de lellis, 01100 Viterbo, Italy)
5-10 örnek gönderilip 20 lokus
standardize edilecektir.
‹
‹
‹
Mikrosatellit primerlerinden ilk 10 tanesinin
siparişi verilecek ve PCR koşullarının
optimizasyonuna geçilecektir.
Allel uzunluklarına göre ve yükseltgenme
sıcaklıklarına göre multipleks PCR koşulları
optimize edilecektir.
PCR koşullarının ve optimizasyonların
yapılmasında elimizde şu anda bulunan
TÜBAP – 626 nolu projenin manda
örneklerinden yararlanılacaktır.
‹
‹
‹
mtDNA kontrol bölgesinin primerleri sipariş
verilecektir.
Elimizdeki örneklerden 3-5 tanesinde ön
çalışmalar yapılacaktır.
6. ayın sonunda elimizdeki örneklerden
yararlanılarak mtDNA-RFLP analizleri ön
çalışması yapılmış, RFLP sonucuna göre
seçilen 3-5 örneğin mtDNA dizi analizi
yapılacak, 10 mikrosatelit lokusunun PCR
koşulları optimize edilerek standart
örneklerin genotipi analiz edilecek. Ayrıca I.
Gelişme raporu yazılacak.
Filmi izlemek için aşağıdaki yazıya tıklayn
manda .FİLM.AVI
manda .FİLM.AVI
Download

anadolu mandası - İstanbul Manda