Univerzita Komenského
Lekárska fakulta v Bratislave
ZBORNÍK KONFERENCIE
49. fakultná konferencia študentskej vedeckej
odbornej činnosti
a
V. vedecká konferencia doktorandov LF UK
2
Univerzita Komenského
Lekárska fakulta v Bratislave
49. fakultná konferencia
študentskej vedeckej odbornej činnosti
V. vedecká konferencia
doktorandov LF UK
Zborník prác
Bratislava
14. apríla 2010
3
Editor: Pavol Janega
Recenzenti: doc. MUDr. D. Ostatníková, PhD., doc. MUDr. B. Mladosievičová, CSc.
Za obsahovú a jazykovú správnosť príspevkov zodpovedajú autori.
Výroba CD Tribun EU s.r.o., Gorkého 41, 602 00 Brno
© Univerzita Komenského v Bratislave
ISBN 978-80-223-2897-5
2010
4
Sponzori vedeckej konferencie
Hlavný partner
Partneri
Občianske združenie PROBIOLMED
5
6
Program konferencie
Bloky prednášok predklinickej a molekulárnej časti
Prednášky vedeckej konferencie doktorandov
1. DNA analýza karcinómu endometria
MUDr. Edward Radzo
Školiteľ: doc. RNDr. Vanda Repiská, PhD.
2. Determination of the progression of prostate cancer using RT-PCR method
MUDr. Bc. Anežka Zummerová
Školitelia: doc. RNDr. Vanda Repiská, PhD. , prof. MUDr. Peter Labaš, CSc.
3. NFkB mediované ovplyvnenie bunkového cyklu v nádoroch štítnej žľazy
Mgr. Lucia Feketeová
Školitelia: prof. MUDr. Pavel Babál, CSc., MUDr. Pavol Janega, PhD.
4. Imunohistochemická štúdia úlohy NO vo vzniku a progresii plazmocytómu
MUDr. Andrea Urbánová
Školitelia: prof. MUDr. Pavel Babál, CSc., MUDr. Pavol Janega, PhD.
5. Probiotic therapy of colitis in mice
Mgr. Roland Pálffy
Školitelia: MUDr. Ing. Mgr. Peter Celec, PhD. MPH., doc. MUDr. Marián Bernadič, CSc.
6. Podávanie omega-3 polynenasýtených mastných kyselín spontánne diabetickým
potkanom potláča kardiovaskulárne riziko, moduluje myokardiálny konexín-43 a
zasahuje do signálnych dráh.
MUDr. Jana Radošinská
Školitelia: RNDr. Peter Weismann, PhD., RNDr. Narcis Tribulová, DrSc.
7. Different contribution of alpha-1- and alpha-2-adrenergic vasoconstriction to
pressor effects of exogenous norepinephrine in WKY and SHR rats: the influence of
nifedipine
Mgr. Michal Behuliak
Školitelia: MUDr. Jozef Zicha, DrSc., RNDr. Jaroslav Kuneš, DrSc.
8. Elektrokardiografické parametre u pacientov s hypertrofickou kardiomyopatiou
MUDr. Kristína Hudecová
Školitelia: doc. MUDr. Marián Bernadič, CSc, mim.prof., doc. MUDr. Iveta Šimková, CSc,
FESC
9. Farmakologické ovplyvnenie remodelácie ľavej komory pri spontánnej hypertenzii
potkanov.
MUDr. Kristína Bednárová
Školitelia: Prof. MUDr. Šimko F., CSc., MUDr. Mgr. Paulis Ľ.
7
10. Vplyv veku na hladiny degradačných produktov purínových nukleotidov adenozínu, inozínu hypoxantínu, xantínu a kyseliny močovej v cerebrospinálnom likvore
u pacientov so sklerózou multiplex
Mgr. Ľubomír Kuračka
Školiteľ: Prof. MUDr. Peter Turčáni, PhD.
11. Vplyv stravy bohatej na Maillardove produkty a aromatické látky na správanie
potkanov a na hormóny regulujúce metabolizmus
MUDr. Kristína Klenovicsová
Školitelia: MUDr. Katarína Šebeková, DrSc., prof. MUDr. László Kovács, DrSc., MPH
12. Imunogenetická determinácia vývoja astma bronchiale v slovenskej populácii
(nesúťažná práca)
MUDr. Martin Dzurilla
Školiteľ: prof. MUDr. Milan Buc, DrSc.
Prednášky konferencie študentskej vedeckej odbornej činnosti
13. The activity of BP6 cells depending on organ compartmentation
El-Hassoun Olia
Školitelia: prof. MUDr. Ivan Hulín DrSc, Mgr. Zuzana Valašková.
14. Esenciálne mastné kyseliny vo výžive pacientov s cystickou fibrózou
Marcela Doktorová
Školiteľ: Ing. Igor Vozár CSc
15. Expresia karbonickej anhydrázy IX v nádoroch štítnej žľazy
Martina Ondríková
Školiteľ: prof. MUDr. Pavel Babál, CSc.
16. Ukladanie železa v bazálnych gangliách
Iveta Gašparová
Školiteľ: RNDr. Martin Kopáni, PhD.
17. Mismatch repair enzyme expression in thyroid gland disorders
Ioannis Giannopoulos, Linda Mizun
Školitelia: prof. MUDr. Pavel Babál, CSc., MUDr. Pavol Janega, PhD.
18. Vplyv oxytocínu a antagonistu oxytocínového receptora na sociálne správanie u
potkana
Ján Haršány
Školitelia: doc. MUDr. Daniela Ostatníková, PhD., prof. RNDr. Silvia Kelemenová, DrSc.,
RNDr. Ján Bakoš, PhD.
19. Vplyv korenín na oxidačné poškodenie pečene
Mojmír Ducár
Školitelia: prof. MUDr. Pavel Babál, CSc., MUDr. Pavol Janega, PhD.
8
20. Účinok ubichinolu na mitochondrie mozgu Alzheimerovej choroby
Martin Tkačov
Školiteľ: Doc. RNDr. Anna Gvozdjáková, DrSc.
21. Inervácia ľudského apendixu
Katarína Galliková
Školitelia: prof. MUDr. Ján Jakubovský, DrSc., doc. MUDr. Eliška Kubíková, PhD.
Bloky prednášok klinickej časti
Prednášky vedeckej konferencie doktorandov
22. Závraty po kochleárnej implantácii
MUDr. Zuzana Pospíšilová
Školiteľ: doc. MUDr. Zuzana Kabátová, CSc.
23. Výskyt diabetes mellitus v gravidite na Slovensku v r. 1997 - 2008
MUDr. Lucia Féderová
Školiteľ: doc. MUDr. Miroslav Korbeľ, CSc.
24. Koagulačné a fibrinolytické zmeny v gravidite
MUDr. Ľubica Hammerová
Školiteľ: doc. MUDr. Ján Chabada, CSc.
25. Vplyv liečby rastovým hormónom na kostnú denzitu a kostné markery u pacientov s
deficitom rastového hormónu
MUDr.Martin Kužma
Školiteľ: prof. MUDr. Juraj Payer, CSc.
26. Kultivované alogénne keratinocyty v terapii rán vzniknutých po odbere
dermoepidermálnych autotransplantátov II. časť
MUDr. Dominika Kevická
Školiteľ: doc. MUDr. Ján Koller, PhD.
27. Prognostické faktory zápalových komplikácií v šestonedelí.
MUDr. Maľová Andrea
Školiteľ: doc. MUDr. Martin Redecha, PhD.
28. Význam jednotlivých parametrov rizikového profilu pacienta s nízkou kostnou
denzitou FRAX z hľadiska predikcie fraktúr a vývoja kostnej denzity
MUDr. Eva Lalciková
Školiteľ: doc. MUDr. Zdenko Killinger, PhD.
29. Porovnanie efektu mydriázy dvoma rôznymi spôsobmi pred operáciou sivého zákalu.
MUDr. Branislav Trnavec
Školiteľ: prof. MUDr. Andrej Černák, DrSc.
9
30. Diagnostika patológie endometria u žien v postmenopauze
MUDr. Ing. Horst Urban
Školiteľ: prof. MUDr. Miroslav Borovský, CSc.
31. Stanovenie kalcifikácií abdominálnej aorty využitím denzitometrického vyšetrenia
MUDr. Kristína Brázdilová
Školiteľ: prof. MUDr. Juraj Payer, CSc.
32. Gynekomastie z pohľadu plastickej chirurgie a onkológie
MUDr. Darina Potocká
Školiteľ: Doc. MUDr. Ján Koller, PhD
33. Úspech 3-ročnej kampane „MOST“ ako silného nástroja na implementáciu
Európskej charty zdravia srdca
MUDr. Anton Dlesk
Školitelia: prof. MUDr. Gabriel Kamenský, CSc., prof. MUDr. Ján Murín, CSc.
Prednášky konferencie študentskej vedeckej odbornej činnosti
34. Malé denzné LDL-lipoproteíny u novodiagnostikovaných pacientov s artériovou
hypertenziou.
Jozef Mikovčák, Martin Stančík, Peter Sabaka, Matej Kaško
Školiteľ: prof. MUDr. Andrej Dukát, CSc
35. Selected parameters of insulin sensitivity in hypertensive patients after the change in
therapy from angiotensin converting enzyme inhibitors to angiotensin II type I receptor
blockers.
Branislav Zagrapan
Školiteľ: MUDr. Richard Imrich, PhD., Ing. Štefan Zórad, PhD.
36. Kontaminácia zubných kefiek bakteriálnou flórou
Zuzana Borecká, Roman Andil, Miroslav Novotný
Školitelia: MUDr. B. Novák, PhD., prof. MUDr. Daniela Kotulová, PhD.
37. Epidemiologické aspekty reprodukčných strát v Slovenskej republike II. (veková
analýza)
Zuzana Kosibová
Školiteľ: doc. MUDr. Miroslav Korbeľ, CSc.
38. Využitie konfokálnej endomikroskopie pri in vivo diagnostike dysplastických zmien
u pacientov s ulceróznou kolitídou a Crohnovou chorobou
Peter Zita
Školiteľ: MUDr. Tibor Hlavatý, PhD.
39. Defekty prednej brušnej steny
Marián Janík
Školitelia: doc. MUDr. Eliška Kubíková, PhD.; MUDr. M. Čiešková
10
40. Normálny apendix a apendix v zápale - morfologická štúdia
Ján Dzuracký
Školitelia: prof. MUDr. Ján Jakubovský, DrSc., doc. MUDr. Eliška Kubíková, PhD.
41. Diagnostika intrauterinného ohrozenia plodu
Mária Vojtaššáková
Školiteľ: MUDr. Lenka Linhartová, PhD.
42. Interaktívny anatomický atlas topografických régií
Kollárik Boris , Michal Lapides
Školiteľ: Doc. MUDr. Eliška Kubíková, PhD.
11
12
Predklinická a molekulárna sekcia
V. konferencia doktorandov LF UK
1.miesto
Probiotic therapy of colitis in mice
Mgr. Roland Pálffy
2.miesto
Vplyv stravy bohatej na Maillardove produkty a aromatické látky
na správanie potkanov a na hormóny regulujúce metabolizmus
MUDr. Kristína Klenovicsová
3.miesto
Podávanie omega-3 polynenasýtených mastných kyselín spontánne
diabetickým potkanom potláča kardiovaskulárne riziko, moduluje
myokardiálny konexín-43 a zasahuje do signálnych dráh.
MUDr. Jana Radošinská
Farmakologické ovplyvnenie remodelácie ľavej komory pri
spontánnej hypertenzii potkanov.
MUDr. Kristína Bednárová
13
1. DNA analýza karcinómu endometria
MUDr. Edward Radzo
Školiteľ: Doc. RNDr. Vanda Repiská, PhD.
Univerzita Komenského v Bratislave, Lekárska fakulta, Ústav lekárskej biológie, genetiky a
klinickej genetiky, Sasinkova 4, 811 08 Bratislava, Slovenská republika,
Úvod
CaE je štvrtý najčastejší malígny nádor a zároveň, najbežnejšia gynekologická malignita u
žien (1).
Endometrioidný histologický podtyp CaE sa vyskytuje u žien väčšinou v
období perimenopauzy. Má nižší malígny potenciál, invázia do myometria je často minimálna
a prienik do lymfatických priestorov je zriedkavejší. Vo všeobecnosti má dobrú prognózu,
ako aj liečbu (2).
Serózny histologický podtyp CaE sa vyskytuje väčšinou u starších žien. Má vyšší malígny
potenciál, infiltrácia myometria je rýchlejšia a hlbšia a nádor má vyšší sklon k lymfogénnej
propagácii. Vo všeobecnosti má horšiu prognózu a diagnostikuje sa v neskorších štádiách
ochorenia (3).
Mutácie v géne TP53 a nadmerná expresia proteínu p53 v endometriálnej glandulárnej
dysplázii (EmGD) podporuje názor, že EmGD súvisí so seróznym CaE a môže byť jeho
prekancerózou. Pri porovnaní EmGD a serózneho CaE, v obidvoch prípadoch je prítomné
progresívne zvýšenie genetických porúch (4).
Substitúcia alebo delécia tumorsupresorového génu TP53 je najčastejšia genetická mutácia
v ľudských karcinómoch. Mutácia už jednej alely naruší pôsobenie takto kódovaného p53.
Zníži sa jeho schopnosť viazať sa na DNA a predĺži sa jeho životnosť. Zároveň stráca
schopnosť navodiť apoptózu bunky (3, 5). Vznik serózneho CaE môže nastať aj ďalšími
mechanizmami, vrátane rozvoja z endometrioidného podtypu CaE (6).
Vzhľadom na prognózu serózneho CaE je potrené a užitočné identifikovať tento podtyp
karcinómov aj v zmiešaných typoch CaE. DNA analýza génu TP53 môže pomôcť
identifikovať prítomnosť serózneho CaE, vzhľadom k tomu, že mutácie TP53 sa vyskytujú
hlavne v seróznom CaE a v karcinómoch endometria s vysokým stupňom histologickej
diferenciácie (G III).
Materiál a metódy
Na úrovni DNA sme analyzovali tkanivo z karcinómu endometria. Skupinu tvorilo 20
pacientok, vo veku od 44 do 77 rokov. Histologický diagnostický nález skúmaných vzoriek
bol od jednoduchej hyperplázie bez atypie buniek po endometrioidný CaE s výrazným
prenikaním do myometria (Tab. 1).
DNA sme izolovali z 25 mg tkaniva endometria odobratého do sterilnej skúmavky, izolačným
kitom (Qiagen, QIAamp DNA Mini Kit).
14
Sledovaný úsek génu TP53 sme namnožili pomocou polymerázovej reťazovej reakcie (PCR).
Amplifikácia prebehla na termálnom cyklery Eppendorf Mastercycler epgradient v 30
cykloch (denaturácia 96oC, 2 min., denaturácia 94oC, 15 sek., hybridizácia 20 sek., gradient
50-65oC, syntéza 72oC, 30 sek., záverečná syntéza 72oC, 10 min.)
Vzorky sme sekvenovali na genetickom analyzátore ABI PRISMTM 310 Genetic Analyzer,
ktorý využíva kapilárnu elektroforézu s použitím ABI TM DNA sequencing kitu (Applied
Biosystems). Priamym sekvenovaním sme analyzovali exóny 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 génu
TP53 (Tab. 2).
PCR produkty exónu 4 sme následne otestovali restrikčnou analýzou s použitím
restrikčnej endonukleázy BtgI. Štiepna reakcia prebiehala 16 hod. pri 37°C a inaktivácia
enzýmu 20 min. pri 80°C. Produkty sme vizualizovali po elektroforéze v 2% agarózovom géli
farbenom EtBr. Na porovnanie veľkosti fragmentov sme použili 100 bp dĺžkový marker.
Tab. 1: Údaje o pacientkách (EECa-Endometrioidný karcinóm endometria, GlCHglandulárna cystická hyperplázia endometria, KoH-komplexná hyperplázia endometria,
JeH-jednoduchá hyperplázia endometria)
1
2
3
Vek
44
47
50
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
55
57
58
59
60
60
63
64
65
66
67
70
70
74
75
77
77
Typ
EECa
EECa
EECa
GlCH bez
atypie
EECa
EECa
EECa
EECa
JeH
KoH s atypiou
EECa
EECa
EECa
EECa
EECa
EECa
EECa
EECa
EECa
EECa
Invázia do myometria
žiadna
žiadna
žiadna
žiadna
minimum
minimum
minimum
minimum
žiadna
žiadna
minimum
minimum
minimum
minimum
vysoká
minimum
minimum
minimum
minimum
minimum
15
Tab. 2: Primery použité pre amplifikáciu génu TP53
Sekvencia primerov ( 5´ → 3´)
Exon
E2-3
E4
E5-6
E7/1
E7/2
E8-9
E10
E11
Forward
TCTCATGCTGGATCCCCACT
TGCTCTTTTCACCCATCTAC
TGTTCACTTGTGCCCTGACT
CTTGCCACAGGTCTCCCCAA
AGGCGCACTGGCCTCATCTT
TTGGGAGTAGATGGAGCCT
CAATTGTAACTTGAACCATC
AGACCCTCTCACTCATGTGA
Reverse
AGTCAGAGGACCAGGTCCTC
ATACGGCCAGGCATTGAAGT
TTAACCCCTCCTCCCAGAGA
AGGGGTCAGAGGCAAGCAGA
TGTGCAGGGTGGCAAGTGGC
AGTGTTAGACTGGAAACTTT
GGATGAGAATGGAATCCTAT
TGACGCACACCTATTGCAAG
Výsledky a diskusia
Gén TP53 bol analyzovaný priamym sekvenovaním vo všetkých vzorkách. V exóne 4 sme
identifikovali polymorfizmus CCC/CGC, so zámenou aminokyselín Pro72Arg. Pomer
homozygotných ku heterozygotným polymorfizmom bol 11:9.
Vzhľadom na to, že sme identifikovali DNA polymorfizmus iba v exóne 4, podrobili sme
tento exón následne restrikčnej analýze. PCR produkty z tohto exónu od pacientok s
karcinómom endometria alebo prekanceróznou léziou sme štiepili pomocou restrikčného
enzýmu BtgI. Enzým BtgI rozpoznáva palindróm ccrygg. Pri zdravom jedincovi vzniknú
fragmenty s dĺžkou 141 bp a 212 bp, pri homozygotnej mutácii vznikne jeden fragment
s dĺžkou 353 bp a pri heterozygotnej mutácii vzniknú tri fragmenty s dĺžkou 353 bp, 212 bp
a 141 bp. Výsledky z restrikčnej analýzy boli totožné s výsledkami, ktoré sme získali
priamym sekvenovaním. Výsledky naznačujú, že môže ísť o zmiešané typy CaE so zložkou
glandulárnej dysplázie endometria, alebo zložkou serózneho CaE v skúmaných vzorkách
karcinómu endometria.
Pacientky s mutáciou v géne TP53 v tkanive karcinómu prsníka, a zároveň aj v lymfatických
uzlinách mali skrátené obdobie prežívania v porovnaní s pacientkami bez mutácie (7).
Výsledky štúdie môžu naznačovať, že prítomnosť mutácie v géne TP53 v nádorovom tkanive
môže viesť k výraznejším klinicko-patologickým príznakom príslušného nádorového tkaniva.
Mutácie v géne TP53 sa javia ako dôležité pri konverzii relatívne pokojného atrofického
endometria na intraepiteliálnu formu serózneho karcinómu. Tieto mutácie dávajú základ pre
akumuláciu ďalších genetických zmien v súvislosti s karcinogenéznym procesom (8).
Gén TP53 sa vyskytuje často mutovaný aj v endometriálnej glandulárnej dysplázii. Tieto
mutácie naznačujú, že EmGD je prekancerózou serózneho CaE. Mutácia v géne TP53 je
pravdepodobne jeden z najdôležitejších faktorov na začiatku karcinogenézy pri seróznom CaE
(9).
Endometriálna glandulárna dysplázia, ktorá sa môže vyskytovať aj v našich vzorkách, je
pravdepodobný kandidát na prekanceróznu léziu, ktorá nie je maligná, ale znamená
potencionálne riziko pre vznik serózneho intraepiteliálneho karcinómu endometria (10).
Naďalej bude potrebné sledovať genetické zmeny v CaE, pričom výsledky DNA analýzy
môžu pomôcť porozumieť procesu karcinogenézy z hľadiska molekulárno-biologickej
podstaty, a zároveň môžu spresniť diferenciálnu diagnostiku karcinómov endometria.
16
Poďakovanie
Táto práca bola podporená Ministerstvom zdravotníctva Slovenskej republiky v rámci
projektu Immunohistochemická a molekulovo-genetická analýza karcinómu endometria
2007/28-UK-05.
Literatúra
1. Zaino RJ. Endometrial hyperplasia and carcinoma. In:Haines M, Taylor CW, Fox H,
Wells M, eds. Haines & Taylor Obstetrical and Gynaecological Pathology.Edinburgh:
Churchill Livingstone, 5th ed; 2003:445 – 446.
2. Lax SF. Molecular genetic pathways in various types of endometrial carcinoma: from a
phenotypical to a molecular-based classification. Virchows Arch 2004; 444 (3): 213-223)
3. Lax SF, Kendall B, Tashiro H, Slebos RJ, Hedrick L. The frequency of p53, K-ras
mutations, and microsatellite instability differs in uterine endometrioid and serous
carcinoma: evidence of distinct molecular genetic pathway. Cancer 2000; 88: 814-24.
4. Oluwole Fadare 1, 2 and Wenxin Zheng, Insights into Endometrial Serous Carcinogenesis
and Progression, Int J Clin Exp Pathol 2009 2, 411-432.
5. Tashiro H, Isacson C, Levine R, Kurman RJ, Cho KR, Hedrick L. p53 gene mutations are
common in uterine serous carcinoma and occur early in their pathogenesis. Am J Pathol
1997; 150: 177-85.
6. Lomo L, Nucci MR, Lee KR, Lin MC, Hirsch MS, Crum CP, Mutter GL. Histologic and
immunohistochemical decision-making in endometrial adenocarcinoma. Mod Pathol
2008;21:937-42.
7. Bonafe M, Ceccarelli C, Farabegoli F, Santini D, Taffurelli M, Barbi C,Marzi E, Trapassi
C, Storci G, Olivieri F, Franceschi C: Retention of the p53 codon 72 arginine allele is
associated with a reduction of disease-free and overall survival in arginine/proline
heterozygous breast cancer patients. Clin Cancer Res 2003, 9(13):4860-4864.
8. Vogelstein B, Kinzler KW. p53 function and dysfunction. Cell 1992; 70: 523-6.
9. Jia L, Liu Y, Yi X, Miron A, Crum CP, Kong B, Zheng W. Endometrial glandular
dysplasia with frequent p53 gene mutation: a genetic evidence supporting its precancer
nature for endometrial serous carcinoma. Clin Cancer Res 2008;14:2263–9.
10. Fadare O, Zheng W. Endometrial Glandular Dysplasia: morphologically and biologically
distinctive putative precursor lesions of Type II endometrial cancers. Diagn Pathol 2008;
8: 3–6.
17
2. Determination of the progression of prostate cancer using RT-PCR method
MUDr. Bc. Anežka Zummerová
Consultant: doc. RNDr. Vanda Repiská, PhD.2
Consultant - specialist: prof. MUDr. Peter Labaš, CSc.3
1
Department of Pathology and Forensic Medicine, Health Care Surveillance Authority,
Bratislava, Slovak republic 2Institute of Medical Biology, Genetics and Clinical Genetics,
Faculty of Medicine, Comenius University, Bratislava, Slovak republic 3I. Clinic of Surgery,
Faculty of Medicine, Comenius University, Bratislava, Slovak republic
Introduction
Carcinoma of the prostate is one of the commonest forms of malignant disease in males in
Europe, with a peak incidence after the age 50 (1). This disease is characterized by a wide
range of clinical, pathological, histological, genetic and molecular features, regarding specific
treatment and monitoring. Standardly used prognostic parameters of the carcinoma of the
prostate, as the determination of the extent of the disease (staging), the degree of glandular
differentiation (grading, Gleason score), prostatic specific antigen (PSA) and its dynamics
seem to be insufficient in the prediction of the behavior of the disease (2, 3). The tendentions
to impose molecular-genetic methods to assess the degree of the progression of the disease
grow stronger. We introduced nested Reverse Transcriptase - Polymerase Chain Reaction
(RT-PCR) to detect circulating tumor cells, so called micrometastases, in the peripheral blood
of patients with prostate cancer in Slovak republic. During our 5 year-study we used a group
of 28 patients with verified diagnosis of in situ prostate carcinoma who underwent radical
prostatectomy, and our ambition was to check the correlation between the presence of the
circulating tumor cells in peripheral blood of the patients and the clinical stage of the disease.
Material and methods
In our project we studied a group of twenty-eight patients with localized prostate cancer who
underwent radical prostatectomy. Metastases were not diagnosed in these men by standard
examination methods. Peripheral blood of healthy young women in age between 18 and 24
was used as a negative control, and malignant tissue obtained from prostate gland was used as
a positive control.
Methods we used were following. The first step of our work was the isolation of cell elements
from the peripheral blood. The second step was the isolation of RNA. Then the RT-PCR
method was used to transcript the RNA to the complementary DNA (cDNA) and its
subsequent multiplication (4, 5). We applied nested PCR, using primers complementary to
sequences that were nowhere else in the genome.
Results
Patient with in situ carcinoma were examined directly before the operation and then two years
after radical prostatectomy. Eight out of twenty-eight patients showed positive result both for
18
PSA and PSM before the operation and six of them showed positive RT-PCR result for PSA
and PSM also two years after the operation. The health status of these patients worsened,
metastases occurred in a short time and 4 of them already died up to this date. The seventh
patient had negative results of RT-PCR reaction both for PSA and for PSM two years after the
operation, and his health status shows no progression of the disease. The last one of eight
patients had negative result for PSA and positive result for PSM using RT-PCR method two
years after operation. He shows the progression of the disease in means of metastases in
bones.
Seven out of twenty-eight patients had negative result for PSA and positive result for PSM
using RT-PCR reaction before radical prostatectomy. The results of RT-PCR reaction two
years after radical prostatectomy varied; however, we observed that independently to PSA
results of RT-PCR, positive RT-PCR reaction for PSM predominantly predicted the
progression of the disease.
Finally, thirteen out of twenty-eight patients had negative result of RT-PCR for PSA and also
for PSM before operation, and nine of them stayed negative also two years after the operation.
Two of these patients had positive result for PSA, staying negative for PSM, after the
operation. The health conditions of all of these eleven patients are very good, they show no
progression of the disease. The last two of the thirteen patients had negative result for PSA
and positive result for PSM two yeas after the operation. Their health status is getting worse,
the disease is progressing, and in some metastases in bones appeared.
Discussion
From the results of our study we can assume that RT-PCR reaction for PSA and PSM
correlates well with the health status of the patients. When we compared it with standard
prognostic factors, such as Gleason score, TNM classification and preoperative PSA serum
level, we could see a good correlation, and so we can observe that this approach seems to
have relevant prognostic value. In many cases, the detection of micrometastases in peripheral
blood of the patients using RT-PCR method even seems to be better predicting factor of the
progression of the disease than monitoring the serum level of PSA. Positive RT-PCR reaction
for both PSA and PSM in most of the cases meant the progression of the disease and the
formation of metastases. The patients with negative PSA and positive PSM, in majority of the
cases, also showed worsening of their health status. We noticed that patients with positive
RT-PCR reaction for PSA and negative RT-PCR for PSM showed no progression of the
disease, their health conditions were optimal. From these results we can imply higher
relevance or sensitivity of RT-PCR for PSM than for PSA. Patients with negative RT-PCR
reaction for PSA and also for PSM did not show any progression of the disease.
Many researches have been done up to this time that have proved high sensitivity of RT-PCR
reaction. Almost all of them have showed that RT-CR positive patients were at higher risk for
recurrence of prostate cancer after radical prostatectomy (6 - 8). We can assume that RT-PCR
reaction could be considered early staging modality for radical prostatectomy candidates.
References
1. Fletcher, Ch.: Histology of tumors. Volume 1, Churchill Livingstone Elsevier, 2007, p.
755-778.
19
2. Zhang, L., Wang, C.Y., Yang, R., Shi, J., Fu, R., Chen, L. et al.: Real time quantitative
RT-PCR assay of prostate-specific antigen and prostate-specific membrane antigen in
peripheral blood for detection of prostate cancer micrometastasis. Urol Oncol. 2008 NovDec; 26(6):634-40. MEDLINE.
3. Haas, C.J., Wagner, T., Wawroschek, F., Arnholdt, H.: Combined application of RT-PCR
and immunohostichemistry on paraffin embedded sentinel lymph nodes of prostate cancer
patients. Pathol. Res. Pract. 2005; 200(11-12):763-70.
4. Baffa, R., Moreno, J.G., Monne, M., Veronese, L., Gomella, L.G.: A comparative analysis
of prostate-spcific antigen gene sequence in benign and malignant prostate tissue. 2000.
Urology 47:795.
5. Vessella, R.L., Riley, D.E., Blouke, K.A., Arfman, E.W., Lange, P.H.: A sensitive method
for detection of a prostate tumor cell marker using the polymerase chain reaction. 1992 J.
Urol. 2:147-148.
6. Ghossein, R.A., Scher, H.I., Gerald, W.L., Kelly, W.K., Curley, T., Amsterdam, A. et al.:
Detecting of circulating tumor cells in patients with localized and metastatic prostatic
carcinoma: clinical implications. 1995 J. Clin. Oncol. 13: 1195-1200.
7. Katz, A.E., Olsson, C.A., Raffo, A.J., Cama, C., Perlam, H., Seaman, E. et al.: Molecular
staging of prostate cancer with the use of an enhanced reverse transcriptase-PCR assay.
1994 Urology 43: 765-775.
8. Altimari, A., Grigioni, A., Benedettini, E., Gabusi, E., Schiavina, R., Martinelli, A. et al.:
Diagnostic role of circulating free plasma DNA detection in patients with localized
prostate cancer. Am J Clin Pathol. 2008; 129(5), p.756-62.
20
3. NFкB mediované ovplyvnenie bunkového cyklu v nádoroch štítnej žľazy
Mgr. Lucia Feketeová
Spoluautor: MUDr. Andrea Urbánová
Školiteľ: Prof. MUDr. Pavel Babál, CSc., MUDr. Pavol Janega, PhD.
Ústav patologickej anatómie, Lekárska fakulta, Univerzity Komenského v Bratislave
Úvod:
Nádory štítnej žľazy patria medzi časté a závažné endokrinné choroby postihujúce významnú
časť populácie (1). Najčastejšie je diagnostikovaný benígny folikulárny adenóm (FA), menej
často sa stretávame s malígnym folikulárnym (FCa), papilárnym (PapCa) a medulárnym
karcinómom (MCa). MCa ako jediný typ pochádza z parafolikulárnych, kalcitonín
produkujúcich C-buniek, ostatné typy vychádzajú z folikulárnych buniek štítnej žľazy.
Hranica medzi benígnymi a malígnymi procesmi, najmä tých s folikulárnou diferenciáciou je
často nepresná a ťažko stanoviteľná. Rozhodujúcim rozlišovacím kritériom je prítomná
invázia do puzdra, prípadne ciev (1).
Nádorové bunky sú známe svojim nekontrolovaným rastom a delením sa. Bunkový cyklus
a vstup buniek do aktívnej S fázy je kontrolovaný mnohými molekulami. Jednou z nich je
cyklín D1, ktorý sa nachádza v cytoplazme buniek v neaktívnej forme. Po aktivácii vstupuje
do jadra, kde sa viaže na cyklín-dependentné kinázy, vytvára komplex a umožňuje prechod
buniek z G1 do S , resp. z G2 do M fázy bunkového cyklu. Pri mnohých nádoroch je
pozorovaná zvýšená expresia cyklínu D1, čo môže spôsobovať skrátenie G1 fázy a častejší
prechod nádorových buniek do S fázy (2). Zvýšená expresia cyklín D1 koreluje so skorým
nástupom nádorovej choroby a tiež s rizikom nádorovej progresie a metastázovania.
Nadbytok cyklínu D1 reguluje aj dynamiku celulárnej adhézie a bunkových interakcií. Aj
z toho dôvodu môže prispievať k invazivite a metastatickému fenotypu nádorov, nezávisle na
jeho účinkoch na progresiu bunkového cyklu (5). Expresia cyklínu D1 je ovplyvňovaná aj
prostredníctvom dráhy mediovanej nukleárnym faktorom- кB (NFкB). Neaktívny NFкB je
uskladnený v cytosole bunky vo väzbe s proteínom IкBα. Aktiváciou kináz (IKK) dochádza k
fosforylácii IкBα. Tá umožní uvoľnenie NFкB z väzby a jeho presun do jadra, kde sa viaže
na DNA a podieľa sa na aktivácii proteosyntézy. Cieľom prezentovanej štúdie bolo overiť
expresiu cyklínu D1 a aktiváciu dráhy NFкB v rôznych nádoroch štítnej žľazy.
Metodika:
Použitý bol súbor 69 archívnych bioptických vzoriek tkaniva štítnych žliaz, ktoré obsahovali
prípady folikulárneho adenómu (11), folikulárneho karcinómu (20), medulárneho karcinómu
(18), papilárneho karcinómu (10) a folikulárnej varianty papilárneho karcinómu (7). Prípady
parenchymatóznej strumy (3) boli hodnotené ako kontroly. Hodnotili sme pozitivitu cyklínu
D1 a NFкB, aktivácia dráhy NFкB bola sledovaná na základe pozitivity aktivovanej formy
IкB kinázy (p-IKK). Expresia proteínov bola detegovaná imunohistochemicky použitím
komerčne dostupných protilátok proti NFкB, p-IKK (Santa Cruz, USA) a cyclin D1
(Novocastra, USA). Reakcia bola vizualizovaná prostredníctvom sekundárnej protilátky
Histofine s použitím diaminobenzidínu (DAKO, Dánsko) ako substrátu pre reakciu
a vyhodnotená semikvantitatívne vo svetelnom mikroskope (Motic, Japan) nasledovne:
21
v prípade viac ako 30% pozitívnych buniek - pravidelná pozitivita, v prípade menej ako 30%
pozitívnych buniek - ložisková pozitivita, menej ako 10% pozitívnych buniek nepravidelná
pozitivita. Samostatne bola hodnotená cytoplazmová a jadrová pozitivita jednotlivých
proteínov. Intenzita pozitivity bola hodnotená ako: ++ silná pozitivita, + jemne zrnitá slabá
pozitivita, - negativita.
Výsledky:
V kontrolných vzorkách parenchymatóznej strumy bola prítomná len slabá cytoplazmová
poztivita NFкB, aktivovaná IKK kináza, ani cyklín D1 nevykazovali pozitivitu. NFкB bol
pravidelne exprimovaný vo všetkých nádoroch štítnej žľazy bez ohľadu na dignitu (tab.1). V
5 z 20 prípadov folikulárneho karcinómu (25%), 6 z 10 prípadov klasického variantu
papilárneho karcinómu (60%), 3 zo 7 prípadov folikulárneho variantu papilárneho karcinómu
(43%) a 3 z 18 prípadov medulárneho karcinómu (17%) sme zaznamenali pravidelnú
pozitivitu fosforylovanej formy IKK. Cyklín D1 vykazoval slabú pozitivitu v 5 prípadoch
(42%) benígneho folikulárneho adenómu, v 7 prípadoch (35%) folikulárneho karcinómu, v 16
prípadoch (89%) medulárneho karcinómu, v 5 prípadoch (50%) klasického variantu
papilárneho karcinómu a v 1 prípade folikulánrho variantu papilárneho karcinómu. Pravidelne
silne pozitívny bol v 4 prípadoch folikulárneho karcinómu (20%), 3 prípadoch medulárneho
karcinómu (17%), 3 prípadoch klasického variantu papilárneho karcinómu (30%).V
prípadoch folikulárneho variantu papilárneho karcinómu silnú pozitivitu cyklín D1
nepozorujeme (obr.1).
K
FA
FCa
MCa
PapCa- PapCaklasický folikulárny
variant variant
celkový
počet
3
11
20
18
10
7
prípadov
0
7c
5c
8c
3c
NFkB ++ 0
3c
8c
9c
13c
1c
4c
NFkB +
0
0
5
3
6
3
p-IkKB
cyklín D1
0
0
4
3
3
0
++
cyklín
0
5
7
16
5
1
D1+
p-IkKB 5
9
16
3
0
cyklín D1 0
+
p-IkKB +
0
4
3
5
1
cyklín D1 0
+
Tabuľka 1. Zhrnutie pozitívnych prípadov jednotlivých markerov v študovaných tkanivách
štítnej žľazy: K- kontrola, FA- folikulárny adenóm, FCa- folikulárny karcinóm, MCamedulárny karcinóm, PapCa- papilárny karcinóm klasický a folikulárny variant.
Pri všetkých karcinómoch sme pozorovali pomerné zastúpenie prípadov s pravidelnou
expresiou cyklínu D1 a s resp. bez pozitivity fosforylovanej formy IKK, okrem FA
a folikulárneho variantu PapCa (tab.1).
22
K
K
K
FA
FA
FA
FCa
FCa
MCa
MCa
PapC
a
PapCa
FCa
MCa
PapCa
Cyklin D1- jadrová pozitivita
NFкB - cytoplazmová pozitivita
p-IкKB – cytoplazmová pozitivita
Obrázok 1.: znázornenie cytoplazmovej (NFкB) a jadrovej pozitivity (cyklín D1, p-IкKB)hnedá farba, pri 400 x zväčšení.
23
Diskusia:
Kým v prípade iných nádorov (nádory pľúc, ezofagu) bol význam hodnotenia expresie
cyklínu D1 už v minulosti podporený početnými štúdiami (7), výsledky v tkanive štítnej žľazy
sú nejasné. Niektoré štúdie poukázali na zvýšenú expresiu v prípadoch papilárneho karcinómu
štítnej žľazy (6), výsledky iných štúdií ale neboli preukázne a neodporučili využitie
v diagnostike (8). Naše výsledky poukazujú na pravidelnú silnú expresiu cyklínu D1 najmä
v prípadoch malígnych nádorov štítnej žľazy. Kontrolné strumy cyklín D1 neexprimovali, len
v 4 prípadoch benígneho adenómu sme pozorovali jemne zrnitú pozitivitu. Nález nízkej
expresie cyklínu D1 v benígnych tumoroch bol opísaný aj v iných štúdiách (3, 5). Viaceré
štúdie poukázali na prognostický význam hodnotenia tohto markera. Zvýšená expresia sa
spája s horšou prognózou papilárnych mikrokarcinómov (3), ako aj s vyšším rizikom vzniku
metastáz (6). Pozorovali sme, že charakter expresie tohto markera umožňuje rozdeliť prípady
malígnych nádorov na tie s pravidelnou pozitivitou, resp. bez pozitivity. Bude preto
v budúcnosti zaujímavé korelovať výsledky imunohistochemického hodnotenia s klinickými
údajmi o prežívaní pacientov a ich reakcii na liečbu. Komplex cyklín D1/cdk4 môže byť aj
potenciálnym cieľom v liečbe nádorov (4). Cyklín D1 preukázal najvýraznejšiu pozitivitu
v prípadoch medulárneho karcinómu (100% prípadov). Takéto vysoké percento pozitívnych
prípadov nie je z literatúry známe, ale práve v prípade medulárneho karcinómu chýbajú štúdie
hodnotiace expresiu na väčšej skupine pacientov. V nádorových bunkách neoplázií štítnej
žľazy sme pozorovali popri zvýšenej expresii cyklínu D1 súčasne zvýšenú expresiu NFкB.
Táto bola len jemne zrnitá alebo negatívna v prípadoch benígnych adenómov. Expresia NFкB
bola vo všetkých prípadoch cytoplazmová, nález jadrovej expresie v prípadoch medulárneho
karcinómu s mutáciou v RET onkogéne ako opísal Gallel a spol. sme nepozorovali (9). Pri
všetkých malígnych nádoroch, pozitivita cyklínu D1 iba v malom počte prípadov korelovala
s pozitivitou p- IKK, pri folikulárnom variante papilárneho karcinómu túto koreláciu
nepozorujeme. Na základe týchto výsledkov možno predpokladať iný mechanizmus aktivácie
cyklín D1 v malígnych karcinómoch, nie vplyvom aktivovaného NFкB, o ktorého
neprítomnej aktivácii hovorí nízka expresia p-IkKB.
Výsledky prezentovanej štúdie ukazujú, že hodnotenie expresie cyklínu D1, ako jednej
z kľúčových molekúl regulujúcich bunkový cyklus počas nádorovej transformácie a dráh jej
regulácie sa ukazuje byť zaujímavé a perspektívne pre diagnostiku. Ak sa tieto výsledky
potvrdia aj v budúcnosti na rozšírenom súbore, môžu byť perspektívne aj s ohľadom na
terapiu nádorov štítnej žľazy.
Poďakovanie
Práca bola podporená vedeckým grantom Ministerstva zdravotníctva SR „Diagnostické
problémy chorôb štítnej žľazy – nové trendy v molekulárnej diagnostike“, 2006/23-UK-02 a
grantom Univerzity Komenského UK/118/2010 „Hodnotenie expresie génov zodpovedných
za sialyzáciu proteínov v diagnostike nádorov štítnej žľazy s folikulárnou štruktúrou.“.
Literatúra:
1. Muro-Cacho CA, Ku NN (2002) Tumors and tumor like lesions of the thyroid gland. In:
Pellitteri P, Mc CaVrey TV (eds) Endocrine surgery of the head and neck, 1st edn.
Thompson Delmar Learning, New York, pp 35–36
2. Tashiro E., Tsuchiya A., Imoto M.: Functions of cyclin D1 as an oncogene and regulation
of cyclin D1 expression, 2007, Cancer Sci, vol. 98, no. 5, 629- 635
24
3. Khoo M.L.C., Ezzat S., Freeman J.L., Asa S.L.: Cyclin D1 protein expression predicts
metabolic behavior in thyroid papillary microcarcinomas but is not associated with gene
amplification, 2002, J Clin Endocrinol Metab, 87(4): 1810- 1813
4. Thoms H.C., Dunlop M.G., Stark L.A.: CDK4 inhibitors and apoptosis: A novel
mechanism requiring nucleolar targeting of RelA, 2007, Cell Cycle, vol. 6, Issue 11:
1293- 1297
5. Fu M., Wang Ch., Li Z., Sakamaki T., Pestell R.G.: Minireview: Cyclin D1: Normal and
abnormal functions, 2004, Endocrinology, 145 (12): 5439- 5447
6. Pisac- Pešutić V., Punda A., Glunčić I., Bedeković V., Pranić- Kragić A., Kunac N.:
Cyclin D1 and p27 expression as prognostic factor in papillary carcinoma of the thyroid:
association with clinicopathological parameters, 2008, Croat Med J, 49: 643-9
7. Gautschi O, Ratschiller D, Gugger M, Betticher DC, Heighway J.: Cyclin D1 in non-small
cell lung cancer: a key driver of malignant transformation, 2007, Lung Cancer 55(1): 1-14
8. Temim L., Ebraheem A.K., Baker H., Sinowatz F.: Cyclin D1 protein expression in
human tyroid gland and thyroid cancer; 2006, Anat Histol Embryol, 35(2): 125-9
9. Gallel P., Pallares J., Dolcet X., Llobet D., Eritja N., Santacana M., Yeramian A.,
Palomar- Asenjo V., Lagarda H., Mauricio D., Encinas M., Matias- Guiu X.: Nuclear
factor- kappaB activation is associated with somatic and germ line RET mutations in
medullary thyroid carcinoma; 2008, Hum Pathol, 39(7): 994- 1001
25
4. Imunohistochemická štúdia úlohy NO vo vzniku a progresii plazmocytómu
MUDr. Andrea Urbánová
Spoluautori: Lucia Feketeová1
Školitelia: MUDr. Pavol Janega, PhD.1,2, prof. MUDr. Pavel Babál, CSc.1
1
Ústav patologickej anatómie, Lekárskej fakulty UK v Bratislave,
patologickej fyziológie, Slovenská akadémia vied, Bratislava
2
Ústav normálnej a
Úvod
Zvýšená tvorba oxidu dusnatého (NO) bola už v minulosti preukázaná v mnohých nádoroch,
vrátane hematologických malignít. Biologická funkcia NO v procese karcinogenézy je však
stále kontroverzná. NO môže mať ako prooxidačný účinok, ako aj protinádorový cytotoxický
efekt. Ovplyvnením apoptózy, kľúčového procesu prežívania nádorových buniek, môže ako
pro-apoptotický agens viesť k regresii nádorového ochorenia, alebo naopak svojim antiapoptotickým účinkom podporovať progresiu malignity. Ako modulátor angiogenézy, NO
ovplyvňuje rast, invazívne vlastnosti a metastatické šírenie malígnych buniek (1). Súčasné
štúdie naznačujú, že popri solídnych nádoroch je stupeň angiogenézy významným
prognostickým faktorom aj v hematologických malignitách. Nález je obzvlášť zaujímavý
v plazmocytóme, kde zvýšená vaskularizácia tumoru koreluje s kratším prežívaním pacientov
(2).
Cieľom prezentovanej štúdie bolo posúdenie expresie jednotlivých izoforiem NO-syntáz
v kostnej dreni pacientov s plazmocytómom v porovnaní s reaktívnymi kontrolami,
s nasledujúcou koreláciou so stupňom vaskularizácie v tkanive a pozitivitou apoptotických
markerov.
Metodika
Formalínom fixované a v parafíne zaliate vzorky boli spracované štandardnou
imunohistochemickou technikou s použitím polyklonálnych králičích protilátok proti všetkým
trom izoformám NO-syntáz: iNOS (Santa Cruz), eNOS (Santa Cruz) a nNOS (Bioscience).
Pozitivitu skúmaných markerov sme korelovali s fenotypovými znakmi charakteristickými
pre nádorový infiltrát (CD20, kappa, lambda), so špeciálnymi farbeniami znázorňujúcimi
jednotlivé vývojové rady hemopoetických buniek a s vaskularizáciou tkaniva znázornenou
cievnym markerom CD31 (Dako). Pri hodnotení sme sa sústredili na histologické
charakteristicky nálezu, lokalizáciu pozitivity vzhľadom na typ tkaniva a druh buniek, ako aj
intracelulárnu kompartmentáciu sledovaných proteínov a intenzitu pozitivity (0-negatívny
nález, +/- slabá, nepravidelná pozitivita, + jednoznačná pozitivita).
Expresia skúmaných markerov bola overená aj morfometricky. Obraz sme analyzovali
pomocou dvojrozmerného obrazového analyzátora (ImageJ 1.34n, National Institute of
Health, USA). Digitálnou farebnou subtrakciou sme z obrazu izolovali celkovú pozitivity
danej NO-syntázy (hnedá farba) a následnou farebnou analýzou sme určili jej podiel voči
celkovej ploche preparátu.
26
Výsledky
Histomorfologické a semikvantitatívne hodnotenie poukázalo na vyššiu expresiu eNOS, ale
nie iNOS a nNOS pri porovnaní plazmocytómov s reaktívnymi vzorkami. Kým v kontrolách
sa pozitivita eNOS viazala prevažne na granulocyty a megakaryocyty, v nádorových vzorkách
vykazovala eNOS intenzívnu pozitivitu najmä v endotelových bunkách ciev (Obr.1a,b.).
a
b
c
d
e
f
Obr.1. Expresia eNOS v plazmocytóme (a) viazaná prevažne na endotel ciev a sínusoidov
(šípky) a v reaktívnej kontrole (b) viazaná prevažne na megakaryocyty (kruh) a granulocytový
rad (šípky) 200x, 400x, DAB. Expresia CD31 (PECAM-1) v plazmocytóme (c) znázornená
ako membránová pozitivita nádorových plazmocytov a v kontrole (d) ako cytoplazmová
pozitivita megakaryocytov (šípky) 400x, 200x, DAB. Expresia anti-apoptotického proteínu
Bcl-2 v plazmocytóme (e) a v reaktívnej kontrole (f) 200x, DAB.
Výsledky morfometrickej analýzy potvrdili semikvantitatívne stanovenú zvýšenú expresiu
eNOS vo nádorových vzorkách, ktorá bola na hranici štatistickej signifikantnosti. Vzhľadom
na nie výlučnú pozitivitu eNOS v endotelových bunkách ciev, sme sa pokúsili z hodnotenia
vyňať ostatné bunky, ktoré taktiež vykazovali pozitivitu eNOS, a tým zvýšiť špecificitu
použitého markera so zameraním na cievnu pozitivitu. Analýzu plochy megakaryocytov a
27
granulocytov sme uskutočnili morfometrickou metódou s použitím pre tieto bunky
špecifických farbení (CHAE, PAS). Opätovné porovnanie cievnej expresie eNOS v
kontrolných a nádorových preparátoch s vylúčením ostatnej pozitivity, poukázala na
signifikantný vzostup cievnej pozitivity eNOS v plazmocytómoch (P<0,05) v porovnaní s
kontrolnou skupinou.
Zvýšená pozitivita eNOS v nádorových vzorkách korelovala so zvýšenou denzitou kapilár
v nádorovom tkanive, znázornenou pomocou vaskulárneho antigénu CD31 (PECAM-1).
Vaskulárna expresia eNOS kopírovala pozitivitu CD31 v cievach a sinusoidoch kostnej drene.
Proteín CD31 (PECAM-1) vykazoval membránovú pozitivitu aj na povrchu plazmocytov
v časti nádorových vzoriek (Obr.1c,d.). Pomedzi markerov apoptózy bola vo nádorových
vzorkách v porovnaní s reaktívnymi kontrolami najvýraznejšie zvýšená pozitivita antiapoptotického proteínu Bcl-2 (Obr.1e,f.).
Diskusia
V nádoroch krvotvorného tkaniva vykazujú jednotlivé typy NOS značnú rôznorodosť
expresie. Na základe výsledkov prezentovanej práce sa zdá, že v produkcii NO
v plazmocytómoch hrá poprednú úlohu endotelová izoforma NOS, čo sa zhoduje s nálezmi
ďalších autorov (3). Otázka prognostickej hodnoty expresie NOS v prípade hematologických
nádorov ostáva zatiaľ nezodpovedaná. Niektoré štúdie však naznačujú možnú koreláciu
zvýšenej expresie iNOS s horšou prognózou pacienta v prípade Hodgkinových aj nonHodgkinových lymfómov (4). Nami zistená zvýšená expresie eNOS v plazmocytómoch by
mohla taktiež predstavovať negatívny prognostický marker, najmä vzhľadom na
proangiogenénny vplyv eNOS. Novotvorba ciev je procesom potencujúcim rast a progresiu
nádorov. Paralela medzi nadmernou expresiou eNOS a nepriaznivou prognózou, respektíve
vyšším stupňom malignity bola predstavená už v minulosti u viacerých typov nádorov (5).
Odhalenie konkrétnych biologických procesov zapojených do mechanizmov vplyvu molekuly
NO si však vyžadujú ďalšie hodnotenie v budúcnosti.
Prekvapivým poznatkom bol nález pravdepodobne aberantnej expresie vaskulárneho markera
CD31 (PECAM-1) na povrchu nádorových plazmocytov. PECAM-1 (platelet/endothelial cell
adhesion molecule-1) je adhezívna molekula exprimovaná za fyziologických podmienok na
povrchu cirkulujúcich trombocytov, monocytov, neutrofilov, T lymfocytov a naivných, ale
nie zrelých, pamäťových B-buniek (6). Interakcia buniek s medzibunkovou hmotou (ECM),
zabezpečená adhezívnymi proteínmi, je esenciálna pre prežívanie a rast buniek. Uvoľnenie
buniek zo spojenia s ECM vedie k ich apoptotickému zániku, nazývanom aj anoikis (7).
Nadmerná alebo aberantná expresia adhezívnych molekúl, ako PECAM-1, nádorovými
bunkami by mohla tak predstavovať jeden z mechanizmov rezistencie maligných buniek proti
anoikis a podporovať nekontrolovaný rast a proliferáciu nádoru.
PECAM-1 zastupuje okrem funkcie adhezívnej molekuly aj funkciu signálneho receptora (8)
a sa zdá byť zapojený tak do procesu angiogenézy a tvorby NO ako aj do ovplyvnenia
pochodov apoptózy aktiváciou signalizačnej kaskády cez proteínkinázu Akt (9). Na
endotelových bunkách je transmembránový proteín PECAM-1 kolokalizovaný s eNOS
v mieste medzibunkových spojení (10), čo zodpovedá aj nášmu nálezu zhodnej expresia
eNOS a PECAM-1 v cievach a sinusoidoch kostnej drene. Signalizácia cez tento receptor sa
môže spájať so zmenou aktivity eNOS a vplývať na proces neovaskularizácie. Ovplyvnenie
signalizačnej kaskády cez PECAM-1, respektíve priama blokáda tohto proteínu by mohla
vzhľadom na tieto poznatky predstavovať perspektívne možnosti pre cielenú terapiu nádorov,
aj vo vzťahu k možnému ovplyvneniu apoptózy.
28
Poďakovanie
Projekt bol podporený grantom Univerzity Komenského UK/199/2010 „Angiogenéza a
apoptóza vo vzťahu k produkcii NO v plazmocytóme.“
Zoznam literatúry
1. Choi BM, Pae HO, Jang SI, Kim YM, Chung HT: Nitric oxide as a pro-apoptotic as well as
anti-apoptotic modulator. J Biochem Mol Biol. 2002; 35(1):116-26.
2. Zini JM, Tobelem G: Angiogenesis and hematologic malignancy. Bull Cancer. 2007; 94
Spec No:S241-6.
3. Mendes RV, Martins AR, de Nucci G, Murad F, Soares FA: Expression of nitric oxide
synthase isoforms and nitrotyrosine immunoreactivity by B-cell non-Hodgkin's lymphomas
and multiple myeloma. Histopathology. 2001; 39(2):172-8.
4. Wang SS, Davis S, Cerhan JR, Hartge P, Severson RK, Cozen W, Lan Q, Welch R,
Chanock SJ, Rothman N: Polymorphisms in oxidative stress genes and risk for non-Hodgkin
lymphoma. Carcinogenesis. 2006; 27(9):1828-34.
5. Erdamar S, Bagci P, Oz B, Dirican A: Correlation of endothelial nitric oxide synthase and
vascular endothelial growth factor expression with malignancy in patients with astrocytic
tumors. J BUON. 2006; 11(2):213-6.
6. Jackson DE, Gully LM, Henshall TL, Mardell CE, Macardle PJ: Platelet endothelial cell
adhesion molecule-1 (PECAM-1/CD31) is associated with a naïve B-cell phenotype in human
tonsils. Tissue Antigens. 2000; 56(2):105-16.
7. Zhang X, Xu LH, Yu Q: Cell aggregation induces phosphorylation of PECAM-1 and Pyk2
and promotes tumor cell anchorage-independent growth. Mol Cancer. 2010; 14;9:7.
8. Newton-Nash DK, Newman PJ: A new role for platelet-endothelial cell adhesion molecule1 (CD31): inhibition of TCR-mediated signal transduction. J Immunol. 1999; 163(2):682-8.
9. Evans PC, Taylor ER, Kilshaw PJ: Signaling through CD31 protects endothelial cells from
apoptosis. Transplantation. 2001; 71(3):457-60.
10. Govers R, Bevers L, de Bree P, Rabelink TJ: Endothelial nitric oxide synthase activity is
linked to its presence at cell-cell contacts. Biochem J. 2002; 361(Pt 2):193-201.
29
5. Probiotic therapy of colitis in mice
Mgr. Roland Pálffy
Co-authors: Eva Čomajova1, Michal Behuliak1
Tutors: MUDr. Ing. Mgr. Peter Celec, PhD. MPH.1, Doc. MUDr. Marián Bernadič, CSc.2
1
Institute of Molecular Biomedicine LF UK, 2Intstitute of Pathophysiology LF UK, Bratislava
Introduction
Crohn disease (CD) is a chronic inflammatory bowel disease (IBD), which most commonly
affects the terminal ileum. However, the inflammation might be found discontinuously on the
entire length of the gastrointestinal tract. CD causes serious mucous injuries. We do not know
the primary cause of this disease and the effective cure is also missing. For these reasons, we
decided to contribute on the research of this disorder.
The most frequently used chemical model for IBD is the dextran sulfate sodium (DSS) model.
This model is described as a simple, reproducible model with bloody diarrhea, ulcerations and
granulocyte infiltration. It is presumed that DSS is directly toxic for bowel epithelium, it
disintegrates intestinal mucosa and the innate immunity is involved more than the adaptive
immunity (1).
Genetically modified probiotics have been used mainly in animal experiments so far. Just a
few modified bacteria get into clinical trials. In animal experiments, we meet most commonly
probiotics producing anti-inflammatory agents or proteins modifying inflammatory status.
The largest number of works has been published about IL10 producing probiotic strains for
decreasing bowel inflammation in IBD models (2; 3). In IBD experiments on laboratory mice,
trefoil factors producing Lactococcus lactis bacteria were tested (4). Also bacteria
Escherichia coli Nissle 1917 are potent and safe instruments to produce anti-inflammatory
agents in a bowel (5).
Materials and methods
Male Balb/c mice (n=60, age 2 months, Charles River Laboratories) were divided into 6
groups: CTRL, DSS, DSS+ER2738, DSS+Nissle, DSS+Nissle/IL10 and DSS+L.lactis/IL10.
Mice in DSS treated groups received 2% DSS (MP Biomedicals, MW 36 000 - 50 000;
#160110) for 7 days ad libitum in drinking water. During DSS treatment mice in
DSS+ER2738, DSS+Nissle, DSS+Nissle/IL10 and DSS+L.lactis/IL10 groups received 1E9
attenuated bacteria SL7207 with or without the IL10 plasmid via gastric gavage in 0.25ml
PBS with 15% glycerol daily. Animals in CTRL and DSS groups received 0.25ml PBS with
15% glycerol. The body weight, water and food intake, stool consistency and rectal bleeding
(0-normal, 1-soft formed, 2-watery, 3-stool with blood) were monitored every day. On the
day 7 the animals were sacrificed and samples were taken.
Malondialdehyde (MDA) was measured in colon homogenates (10%) using a
spectrophotometric assay after derivatization with 0.67 % thiobarbituric acid in acidic
solution of acetic acid (95°C, 45 min). The colored product was extracted to n-butanol and
measured on a microplate spectrophotometer at 535nm. MDA concentration in colon
30
homogenates was expressed on the basis of the calibration curve using 1,1,3,3tetrametoxypropan as a standard in µmol/g of proteins.
Data was analyzed using One-way ANOVA or (Pearson) Chi-square Test (p-value in the
headline of figures). Bonferroni t-test was used to evaluate the differences between groups. Pvalues less than 0.05 were considered significant. The calculations were performed with
XLstatistics and Microsoft Excel 2007.
Results
We monitored the stool consistency during the whole experiment. The most important
changes were observed on the 7th day (Fig.1). At the end of the experiment we measured the
length of colon of each animal as a marker of inflammation caused injury. There was a
significant shortening of colon induced by DSS treatment. All groups with bacterial treatment
were significantly improved in comparison with the DSS group. The group with pure E. coli
Nissle 1917 showing the highest improvement (Fig.2). The concentration of MDA has not
increased in DSS group in comparison to CTRL group. However, all probiotic bacterial
therapies improved this parameter significantly in comparison with CTRL and DSS groups
(Fig.3).
Figure 1. Stool classification on day 7. Stool consistency was classified as follows: 0-normal
stool, 1-soft formed, 2- watery, 3- stool with blood. The DSS treatment worsened the score in
groups DSS and ER2738 equally. Significant differences have been found between these
groups and CTRL, Nissle, Nissle/IL10 and L.Lactis/IL10 groups (* - p < 0.05). Statistical
analysis was performed in XLStatistics using (Pearson) Chi-square test.
31
Figure 2. Colon length on beginning body weight. The colon was significantly shortened in all
DSS receiving groups in comparison with the CTRL group. Treatment with bacteria improved
the shortening of colon in comparison with DSS group (# - p < 0.05, ### - p < 0.001).
Figure 3. MDA levels in colon homogenates. The values are expressed in µmol/g of proteins.
Significant differences between the CTRL group and all probiotic treated groups have been
found in the MDA parameter (** - p < 0.01, *** - p < 0.001). Also significant differences
between DSS group and all probiotic treated groups have been found (### - p < 0.001).
Discussion
We prepared bacteria Nissle 1917/pMEC-IL10 able to produce IL10 cytokine. These bacteria
were never used before to produce cytokines, but the potential for delivering therapeutic
molecules was described (5). After 7 days of DSS administration and probiotic treatment we
observed significant changes in stool quality as a marker of bowel discomfort and injuries.
The all therapeutic probiotic bacteria had positive effect. The colon length, as the marker of
inflammation in colon, was changed by DSS treatment in all groups in comparison with
32
control group as have been described previously (6, 7). The DSS treatment did not increased
the oxidative stress parameters in comparison with control group. Bacteria administration
lowered the parameters of oxidative stress. Our therapy has positive effects on DSS induced
colitis, but follow up studies are needed.
Literature
1. Wirtz S, Neurath MF. Mouse models of inflammatory bowel disease. Adv Drug Deliv
Rev. 2007 30;59(11):1073-83.
2. Steidler L, Hans W, Schotte L, Neirynck S, Obermeier F, Falk W, Fiers W, Remaut E.
Treatment of murine colitis by Lactococcus lactis secreting interleukin-10. Science.
2000 25;289(5483):1352-5.
3. Steidler L. Genetically engineered probiotics. Best Pract Res Clin Gastroenterol.
2003;17(5):861-76.
4. Vandenbroucke K, Hans W, Van Huysse J, Neirynck S, Demetter P, Remaut E,
Rottiers P, Steidler L. Active delivery of trefoil factors by genetically modified
Lactococcus lactis prevents and heals acute colitis in mice. Gastroenterology. 2004
127(2):502-13.
5. Westendorf AM, Gunzer F, Deppenmeier S, Tapadar D, Hunger JK, Schmidt MA,
Buer J, Bruder D. Intestinal immunity of Escherichia coli NISSLE 1917: a safe carrier
for therapeutic molecules. FEMS Immunol Med Microbiol. 2005 1;43(3):373-84.
6. Rumi G, Tsubouchi R, Okayama M, Kato S, Mózsik G, Takeuchi K. Protective effect
of lactulose on dextran sulfate sodium-induced colonic inflammation in rats. Dig Dis
Sci. 2004 49(9):1466-72.
7. Geier MS, Butler RN, Giffard PM, Howarth GS. Lactobacillus fermentum BR11, a
potential new probiotic, alleviates symptoms of colitis induced by dextran sulfate
sodium (DSS) in rats. Int J Food Microbiol. 2007 20;114(3):267-74.
33
6. Podávanie omega-3 polynenasýtených mastných kyselín spontánne diabetickým
potkanom potláča kardiovaskulárne riziko, moduluje myokardiálny konexín-43 a
zasahuje do signálnych dráh
MUDr. Jana Radošinská
Školiteľ: RNDr. Peter Weismann, PhD.2 Školiteľ špecialista: RNDr. Narcisa Tribulová,
DrSc.3
1
Ústav lekárskej biológie, genetiky a klinickej genetiky LF UK a FNsP, 2Anatomický ústav
LF UK, 3Ústav pre výskum srdca SAV, Bratislava
Úvod.
Poruchy kontraktility srdca a poruchy srdcového rytmu sú časté komplikácie diabetes mellitus
u ľudí. Je tiež známe, že synchrónnu činnosť srdca zabezpečuje priama komunikácia medzi
kardiomyocytmi prostredníctvom medzibunkových konexínových kanálov. Tieto umožňujú
prenos elektrického impulzu a môžu nimi prechádzať aj ióny a hydrofilné molekuly s
hmotnosťou do 1kD. Najviac zastúpeným konexínom v pracovnej svalovine srdca je konexín
(Cx) 43. Z uvedeného vyplýva, že ochrana medzibunkovej komunikácie je dôležitá tak
v predchádzaní dysfunkcie srdca, ako aj pri liečení chorého srdca (1). Cieľom tejto štúdie bolo
preskúmať, či je ovplyvnená expresia Cx43 na úrovni mRNA a proteínu u spontánne
diabetických potkanov a aký vplyv bude mať suplementácia omega-3 polynenasýtenými
mastnými kyselinami (omega-3 PUFA). Ďalším cieľom bolo zistiť, či diabetes, a tiež liečenie
zasiahne do vnútrobunkovej signalizácie izoforiem proteinkinázy C (PKC) delta a epsilon.
Materiál a metódy
Ako experimentálny model boli použité spontánne diabetické Goto-Kakizaki potkany
charakterizované skorou inzulínovou rezistenciou, poruchami v inzulínovej sekrécii
a hyperglykémiou. Zdravé Wistar-Clea potkany tvorili kontrolnú skupinu. Zvieratá boli
rozdelené do skupiny neliečenej a liečenej 2 mesiace s omega-3 PUFA (Vesteralens, Nórsko,
200mg/kg/deň). Počas experimentu sa zaznamenávali vybrané biometrické a biochemické
ukazovatele. Tkanivo ľavej komory srdca sa použilo na stanovenie mRNA pre Cx43 použitím
kvantitatívnej RT-PCR a na stanovenie proteínovej expresie Cx43 a izoforiem PKC Western
blott analýzou. Imunobloty sa kvantitatívne analyzovali a výsledné hodnoty boli
normalizované k proteínu GAPDH. Všetky získané hodnoty sa vyhodnotili použitím
nepárového t-testu a sú prezentované ako priemer ± SD. Hodnoty s p<0,05 sú považované za
signifikantné.
Výsledky.
Hmotnosti tela, srdca ako aj ľavej komory srdca boli znížené u diabetických potkanov,
liečenie tento stav nemenilo. Hladiny glukózy, cholesterolu a triglyceridov boli zvýšené v krvi
diabetických potkanov, po liečení omega-3 PUFA sa hladiny glukózy a cholesterolu
signifikantne redukovali. Viď tabuľku.
34
Tab.: Prehľad vybraných biometrických a biochemických ukazovateľov. Potkany: W –
Wistar-Clea, G – Goto-Kakizaki. Signifikancia: ** p<0,01 verzus W, *** p<0,0001 verzus
W, # p<0,05 verzus G
Obr.1 Reprezentatívny western-blot a grafické znázornenie kvantitatívneho vyhodnotenia
pomeru fosforylovanej a nefosforylovanej formy Cx43. P2 – plne fosforylovaná forma Cx43,
P1 – čiastočne fosforylovaná forma Cx43, P0 – nefosforylovaná forma Cx43, * - p<0,5
Myokardiálna hladina mRNA pre Cx43 bola vyššia u diabetických v porovnaní
s nediabetickými potkanmi a podávanie omega-3 PUFA spôsobilo ďalšie zvýšenie v obidvoch
skupinách. Expresia celkového proteínu Cx43 korelovala s nárastom mRNA. Avšak pomer
fosforylovanej t.j. funkčnej formy Cx43 k nefosforylovanej (pomer P/P0) bol znížený
u diabetických potkanov v porovnaní so zdravou kontrolou. Po liečení omega-3 PUFA došlo
k zvýšeniu tohto pomeru v diabetickej skupine (viď obrázok). Zvýšenie fosforylácie Cx43
korelovalo so zvýšením expresie PKC-epsilon. Expresia PKC-delta bola v diabetických
srdciach zvýšená, liečenie normalizovalo hodnoty.
35
Diskusia
Originálne výsledky tejto štúdie poukazujú na viaceré skutočnosti:
Aplikácia omega-3 PUFA Goto-Kakizaki potkanom v období vyvíjajúcej sa inzulínovej
rezistencie a diabetu priaznivo zasiahla do priebehu ochorenia, čo dokumentuje zníženie
sérových hladín glukózy, cholesterolu a triglyceridov. Supresia rizikových faktorov pre vývoj
srdcovocievnych ochorení po aplikácii omega-3 PUFA bola zistená aj u hypertenzných
potkanov (2), a tiež v klinike u pacientov s ischemickou chorobou srdca (3) a dyslipidémiou
(4).
Za veľmi dôležitý poznatok považujeme zvýšenie expresie Cx43 na úrovni mRNA a proteínu
v ľavej komore srdca diabetických potkanov ako aj to, že omega-3 PUFA ešte potenciovali
toto zvýšenie. Vysvetľujeme si to tým, že v štádiu vyvíjajúceho sa diabetu by zvýšená
expresia mohla byť súčasťou adaptácie myokardu na daný patofyziologický stav pre
zachovanie funkcie srdca. V adaptačnom procese zdá sa, že omega-3 PUFA majú priaznivé
účinky, keďže mali za následok ďalšie zvýšenie expresie Cx43. Okrem toho je potrebné
zdôrazniť, že aplikácia omega-3 PUFA zvyšovala pomer P/P0 Cx43 v srdci diabetických
potkanov, ktoré ho mali bez liečenia znížený. Znížená expresia Cx43 a jeho fosforylovanej
formy vyskytujúca sa v srdciach hypertenzných a hypertyroidných potkanov zvyšovala
náchylnosť k malígnym arytmiám a srdcovému zlyhaniu (2, 5). V protiklade s tým, srdcia so
zvýšeným pomerom P/P0 u potkanov s diabetes mellitus 1. typu boli menej náchylné na
arytmie (5). Funkcia konexínového kanála závisí od fosforylovaného stavu Cx a že k
poruchám funkcie konexínových kanálov dochádza často pri rôznych ochoreniach srdca (6)
spojených so zmenami v expresii a aktivite vnútrobunkových proteínkináz (7). Pokles
fosforylácie, resp. defosforylácia Cx43 môže mať za následok vznik arytmogénneho substrátu
a počas akútnej ischémie aj šírenie ischemicko/reperfúzneho poškodenia medzi
kardiomyocytmi (8). Jednou z proteínkináz, ktoré priamo fosforylujú Cx43 je PKC epsilon.
V našej práci sme zistili jej zvýšenú expresiu v myokarde potkanov liečených omega-3
PUFA. To naznačuje možné zvýšenie jej aktivity, čo by zvýšenú fosforyláciu Cx43 mohlo
vysvetliť.
Molekulárne mechanizmy podieľajúce sa na vzniku diabetickej kardiomyopatie nie sú
v plnom rozsahu objasnené. Z literatúry sa však vie, že pri neliečenej hyperglykémii môže
byť úbytok kardiomyocytov až o 25% (9). Tento jav by sa mohol, prinajmenšom čiastočne,
podporiť náš nález zvýšenej expresie PKC delta v srdciach diabetických potkanov. Táto
izoforma PKC cestou aktivácie JNK a p38 MAPK (obidve zo skupiny mitogénmi
aktivovaných kináz) indukuje apoptózu kardiomyocytov a v konečnom dôsledku ich zánik
a fibrotizáciu myokardu.
Záverom je možné konštatovať, že potkany s diabetes mellitus 2. typu profitovali z podávania
omega-3 PUFA a to potlačením kardiovaskulárneho rizika, zvýšením expresie a fosforylácie
Cx43 ako aj pozitívnym ovplyvnením PKC signalizácie. Výsledky tejto štúdie podporujú
význam nefarmakologického prístupu v prevencii a liečbe diabetickej kardiomyopatie.
Podporené grantom VEGA č.2/0049/09 a v spolupráci s Ústavom experimentálnej
farmakológie a toxikológie SAV, Bogomoletz Institute of Physiology, Kyjev, Ukrajina a
Fukuoka Unversity, Fukuoka, Japonsko.
36
Zoznam použitej literatúry
1. Tribulová N, Knezl V, Okruhlicová L, Slezák J: Myocardial gap junctions: targets for
novel approaches in the prevention of life-threatening cardiac arrhythmias. Physiol
Res. 2008; 57 Suppl 2: s. 1-13.
2. Mitasikova M, Smidova S, Macsaliova A a spol.: Aged male and female
spontaneously hypertensive rats benefit from n-3 polyunsaturated fatty acids
supplementation. Physiol Res 2008; 57 Suppl 2: s. 39-48.
3. Marchioli R, Marfisi RM, Borrelli G a spol.: Efficacy of n-3 polyunsaturated fatty
acids according to clinical characteristics of patients with recent myocardial infarction:
insights from the GISSI-Prevenzione trial. J Cardiovasc Med (Hagerstown) 2007 Sep;
8 Suppl 1: s.34-7.
4. Zuliani G, Galvani M, Leitersdorf E, Volpato S, Cavalieri M, Fellin R: The role of
polyunsaturated fatty acids (PUFA) in the treatment of dyslipidemias. Curr Pharm Des
2009; 15(36): s. 4087-93.
5. Lin H, Mitasikova M, Dlugosova K a spol.: Thyroid hormones suppress epsilon-PKC
signalling, down-regulate connexin-43 and increase lethal arrhythmia susceptibility in
non-diabetic and diabetic rat hearts. J Physiol Pharmacol 2008 Jun; 59(2): s. 271-85.
6. Severs NJ, Coppen SR, Dupont E, Yeh HI, Ko YS, Matsushita T: Gap junction
alterations in human cardiac disease. Cardiovasc Res 2004 May 1; 62(2): s. 368-77
7. Dorn GW 2nd, Force T: Protein kinase cascades in the regulation of cardiac
hypertrophy. J Clin Invest 2005 Mar;115(3): s. 527-37.
8. Beardslee MA, Lerner DL, Tadros PN a spol.: Dephosphorylation and intracellular
redistribution of ventricular connexin43 during electrical uncoupling induced by
ischemia. Circ Res 2000 Oct 13; 87(8): s. 656-62.
9. Fiordaliso F, Bianchi R, Staszewsky L a spol.: Antioxidant treatment attenuates
hyperglycemia-induced cardiomyocyte death in rats. J Mol Cell Cardiol 37(5), 2004,
s. 959–968
37
7. Different contribution of alpha-1- and alpha-2-adrenergic vasoconstriction to pressor
effects of exogenous norepinephrine in WKY and SHR rats: the influence of nifedipine
Mgr. Michal Behuliak
Coauthors: Mgr.Mária Pintérová1,2
Tutors: MUDr. Josef Zicha, DrSc.1,2, RNDr. Jaroslav Kuneš, DrSc.1,2
1
Cardiovascular Research Center, Prague, Czech Republic, 2Institute of Physiology, Academy
of Sciences of the Czech Republic, Prague, Czech Republic, 3Institute of Pathophysiology,
Faculty of Medicine, Comenius University, Bratislava, Slovakia
Introduction
Hypertension represents a great risk factor for cardiovascular health. Blood pressure (BP)
level results from the balance between vasoconstrictor systems (mainly sympathetic nervous
system) ), which are modulated at both central and peripheral levels, and vasodilatator
systems (predominantly nitric oxide and endothelium-derived hyperpolarizing factor) (1). In
most of the forms of experimental hypertension high blood pressure results from the
dysbalance between sympathetic hyperactivity and vasodilatator deficiency (endothelial
dysfunction) (1, 2). It is well known that Ca2+ influx plays a key role on vascular contraction.
It is evident that nitric oxide and norepinephrine (NE) are antagonists in the control of
calcium influx through L-type voltage-dependent calcium channels (L-VDCC) (3). It is
generally believed that pressor effect of NE are enhanced in spontaneously hypertensive rats
(SHR), but NE dose-response curves recorded in conscious rats after the blockade of reninangiotensin system (RAS) and sympathetic nervous system (SNS) are almost identical in both
genotypes (4,5).
The aim of our study was to determine the contribution of alpha-1- and alpha-2-adrenergic
vasoconstriction to pressor effect of exogenous NE in Wistar-Kyoto (WKY) and SHR rats
and influence of L-VDCC blockade by nifedipine on these contributions.
Material and methods
The experiments were carried out in male WKY and SHR rats. One day before BP
determination, polyethylene catheters were inserted into the left carotid artery and jugular
vein and exteriorized in the interscapular region. BP was recorded in conscious rats after 24-h
recovery using PowerLab system (ADInstruments Ltd, Australia). To eliminate the influence
of circadian BP variation, the measurements were always done between 8:00 and 12:00 h a.m.
Baseline values of systolic, diastolic and mean arterial BP were monitored in conscious rats
for 20 min. Thereafter a consecutive blockade of RAS by captopril (10 mg/kg body weight
(b.w.), intravenous (iv)) and SNS by pentolinium (5 mg/kg b.w., iv) was performed. BP
response to increasing noncumulative NE dose (0.01 – 20 ug/kg b.w., iv) was determined in
the presence of alpha-1- or alpha-2-adrenoceptor antagonists (prazosin or yohimbine, 1 mg/kg
b.w., iv) before and after administration of calcium channel blocker, nifedipine (0.4 mg/kg
b.w., iv). Maximal BP responses reached after each NE dose were used to construct doseresponse curve (Fig. 1,2) and calculate ED50 (thin dotted lines).
38
Results
Fig.1 Particular components of NE vasoconstriction in both genotypes, Thin dotted lines
represent half-maximal BP response (mm Hg) and ED50 (log NE dose)
Fig.2 Influence of nifedipine on particular components of NE vasoconstriction. Thin dotted
lines represent half-maximal BP response (mm Hg) and ED50 (log NE dose)
39
Yohimbine pretreatment did not affect half-maximal BP response to NE in either genotype,
but it shifted NE dose-response curves to the right and this effect was greater in SHR than in
WKY (Fig. 1). In contrast, prazosin pretreatment lowered half-maximal BP response in both
strains, the effect being more pronounced in WKY (Fig. 1). As far as NE sensitivity was
concerned, ED50 for NE was increased in SHR only. In the presence of either antagonist
nifedipine shifted NE dose-response curves to the right (Fig. 2). Half-maximal pressor
response to NE was lowered by nifedipine only when prazosin was present, the effect being
more pronounced in SHR.
Conclusion
Prazosin but not yohimbine lowered half-maximal BP response to NE in SHR and WKY
suggesting a generally greater importance of alpha-1- than alpha-2- adrenergic
vasoconstriction for BP response to NE. This is especially true in WKY. Our data suggest that
the contribution of alpha-2-adrenergic mechanisms (studied as alpha-1-blockade) to NE
pressor response is enhanced in SHR, indicating that alpha-2-adrenergic vasoconstriction
might be enhanced in this model of hypertension. This is in agreement with lower halfmaximal BP response to NE seen in WKY pretreated with prazosin (Fig. 1). Acute
administration of nifedipine lowered the sensitivity to NE in both strains without changes in
maximal BP response to NE (Fig.2 upper panels). Similar effect was observed when alpha-1vasoconstriction was studied (in the presence of alpha-2-adrenoceptor antagonist yohimbine)
(Fig.2 lower panels). On the other hand, nifedipine lowered the sensitivity to NE and also
half-maximal BP response to NE when alpha-2-vasoconstriction was studied after the
blockade of alpha-1-adrenoceptor by prazosin (Fig.2 middle panels). Both types of alpha
adrenergic blockade lowered sensitivity (increased ED50) to NE in SHR but not in WKY
(Fig.1). These data confirm considerable importance of alpha-2-adrenergic vasoconstriction in
SHR as it was previously suggested (6,7).
Supported by grants: 305/08/0139 GACR, IAA 500110902 GAAVCR
Refferences
1.
KUNEŠ J, HOJNÁ S, KADLECOVÁ M, DOBEŠOVÁ Z, RAUCHOVÁ H, VOKURKOVÁ M,
LOUKOTOVÁ J, PECHÁŇOVÁ O, ZICHA J: Altered balance of vasoactive systems in experimental
hypertension: the role of relative NO deficiency. Physiol Res 53 (Suppl 1): S23-S34, 2004.
2. KUNEŠ J, DOBEŠOVÁ Z, MUSILOVÁ A, ZÍDEK V, VORLÍČEK J, PRAVENEC
M, KŘEN V, ZICHA J: Hemodynamic characterization of recombinant inbred strains:
20 years after. Hypertens Res 31: 1659-1668, 2008.
3. PAULIS L, LÍŠKOVÁ S, PINTÉROVÁ M, DOBEŠOVÁ Z, KUNEŠ J, ZICHA J:
Nifedipine-sensitive noradrenergic vasoconstriction is enhanced in spontaneously
hypertensive rats: the influence of chronic captopril treatment. Acta Physiol (Oxf)
191: 255-266, 2007.
4. PINTÉROVÁ M, KUNEŠ J, DOBEŠOVÁ Z, ZICHA J: Nifedipine-induced shift of
norepinephrine dose-response curve is similar in resistance vasculature of conscious
SHR and WKY rats. Hypertension 50: 812, 2007c.
5. PINTÉROVÁ M, KAREN P, KUNEŠ J, ZICHA J: Role of nifedipine-sensitive
sympathetic vasoconstriction in maintenance of high blood pressure in SHR: effect of
Gi-protein inactivation by pertussis toxin. J Hypertens 28: in press, 2010.
40
6. PETTINGER WA, SANCHEZ A, SAAVEDRA J, HAYWOOD JR, GANDLER T,
RODES T: Altered renal α2-adrenergic receptor regulation in genetically hypertensive
rats. Hypertension 4: 188-192, 1982.
7. SANCHEZ A, VIDAL MJ, MARTÍNEZ-SIERRA R, SÁIZ J: Ontogeny of renal α1
and α2 adrenoceptors in the spontaneously hypertensive rat. J Pharmacol Exp Ther
237: 972-979, 1986.
41
8. Elektrokardiografické parametre u pacientov s hypertrofickou kardiomyopatiou
MUDr. Kristína Hudecová
Školitelia: Doc. MUDr. Marián Bernadič, CSc., mim. prof.1, Doc. MUDr. Iveta Šimková,
CSc., FESC2
1
Ústav patologickej fyziológie, Lekárska fakulta Univerzity Komenského, Bratislava,
Kardiologická klinika, Slovenská zdravotnícka univerzita a Národný ústav srdcových
a cievnych chorôb, Bratislava
2
Úvod
Hypertrofická kardiomyopatia (HKMP) je autozomálne dominantné dedičné ochorenie
srdcového svalu, ktorého základnou charakteristikou je nevysvetliteľná hypertrofia stien
srdca. Toto geneticky podmienené ochorenie srdcového svalu sa manifestuje širokým
spektrom klinických príznakov - od asymptomatického nosiča mutácií až po pacientov, ktorí
sú ohrození náhlou kardiálnou smrťou. Základom stratégie správneho manažmentu pacientov
s HKMP je exaktná diagnostika a stratifikácia rizika z hľadiska prevencie náhlej kardiálnej
smrti. Aktuálna riziková stratifikácia sa opiera o súbor tzv. veľkých a malých rizikových
faktorov, ktoré sú nápomocné pri identifikácii podskupiny pacientov s vysokým rizikom
náhlej kardiálnej smrti.
V súčasnosti sa stále viac prác zaoberá posúdením jednotlivých ekg abnormalít z hľadiska ich
využitia ako prognostických markerov v rámci rizikovej stratifikácie [1,2,3,4,5].
Elektrokardiogram vykazuje u väčšiny pacientov s HKMP patologické odchýlky a preto
predstavuje nesmierne cennú skríningovú a diagnostickú vyšetrovaciu metódu. Abnormálny
záznam sa vyskytuje v 75% - 90% a predstavuje prvý záchytný bod pre podozrenie na HKMP
[4]. Za jeden z možných elektrokardiografických markerov prognózy sa u pacientov s HKMP
považuje depresia ST segmentu [2].
Predkladaná práca ma za cieľ zhodnotiť výsledky štandardnej 12-zvodovej
elektrokardiografie v súbore pacientov s diagnózou hypertrofickej kardiomyopatie.
Metódy
Do súboru bol zaradených 42 pacientov (17 mužov, 25 žien) s echokardiograficky
verifikovanou diagnózou hypertrofickej kardiomyopatie. Pacienti boli vyšetrení na
oddeleniach Kardiologickej a Kardiochirurgickej kliniky na Národnom ústave srdcových
a cievnych chorôb v Bratislave. Všetci pacienti sa podrobili kompletnej neinvazívnej
kardiologickej diagnostike, ktorá zahŕňala podrobnú anamnézu (so zameraním sa na výskyt
náhlej smrti v rodine a výskyt synkopy u pacienta), fyzikálne vyšetrenie, štandardnú pokojovú
elektrokardiografiu, vysokorozlišovaciu elektrokardiografiu a echokardiografické vyšetrenie.
Zo súboru boli vyradení dvaja pacienti, ktorých vyšetrenie prebehlo po predchádzajúcom
invazívnom terapeutickom zákroku (pacienti boli niekoľko rokov po chirurgickej myektómii
alebo prekutánnej transluminálnej septálnej myokardiálnej ablácii, PTSMA) z dôvodu
možného ovplyvnenia výsledkov elektrokardiografie. Prezentovaný súbor tvorí 16 mužov
42
a 24 žien, pričom podskupina pacientov, ktorí boli v čase vyšetrenia mladší ako 40 rokov
zahŕňa 8 pacientov.
V rámci analýzy pokojového 12-zvodového ekg záznamu boli hodnotené nasledovné znaky srdcová frekvencia, sklon srdcovej osi doľava, fibrilácia predsiení, Sokolow-Lyonov index,
PR interval, chýbanie R kmitu vo zvodoch V1-V3, nárast R kmitu vo zvodoch V1-V3, QRS
komplex, QTc interval a depresia ST segmentu. Sokolow-Lyonov index nebolo možné
vypočítať u dvoch pacientov z dôvodu úplnej amputácie R kmitov v prekordiálnych zvodoch.
PR interval nebol hodnotený u dvoch pacientov, ktorí mali v čase vyšetrenia implantovaný
kardiostimulátor. Po zhodnotení jednotlivých ekg parametrov sú výsledky prezentované ako
priemer +/- štandardná chyba priemeru (SEM).
Výsledky
Charakteristiku celého súboru pacientov opisujeme v tabuľke 1. Nepretrvávajúca komorová
tachykardia (nKT) bola opísaná u 9 pacientov ako minimálne tri po sebe idúce komorové
extrasystoly pri frekvencii najmenej 120 úderov za minútu a dobe trvania menej ako 30 s.
Synkopálna epizóda sa vyskytla u 17 pacientov, pričom 8 z nich mali dokumentovanú nKT.
U jedného pacienta, ktorý bol v čase vyšetrenia mladší ako 40 rokov, bola počas
elektrofyziologického vyšetrenia indukovateľná komorová tachykardia degenerujúca do
komorovej fibrilácie. Jeden pacient bol resuscitovaný pre kardiálne zlyhanie.
Supraventrikulárna tachykardia bola dokumentovaná u 4 pacientov. Familiárny výskyt HKMP
bol zaznamenaný u 4 pacientov.
Priemerná hodnota časového trvania PR intervalu bola 176,9 ± 5,9 ms, QRS komplexu 111,3
± 4,9 ms a QTc intervalu 455, 4 ± 6,6 ms, pričom 63,2% pacientov malo predĺžený QTc
interval (>440 ms). Depresiu ST segmentu sme zaznamenali v 60,5% pacientov. Jednotlivé
znaky hodnotené v rámci analýzy pokojového 12-zvodového ekg záznamu sú zhrnuté
v tabuľke 2.
Tabuľka 1. Charakteristika súboru pacientov
Sledovaný ukazovateľ
Počet pacientov (%)
Mužské pohlavie
40 (16/40)
Vek < 40 rokov
20 (8/40)
Náhla kardiálna smrť v rodine
17,5 (7/40)
Výskyt HKMP v rodine
10 (4/40)
Synkopa
42,5 (17/40)
nKT
22,5 (9/40)
KT/odvrátená náhla smrť
5 (2/40)
SVT
10 (4/40)
Fibrilácia predsiení
22,5 (9/40)
nKT - nepretrvávajúca komorová tachykardia, KT - komorová tachykardia, SVT supraventrikulárna tachykardia
43
Tabuľka 2. Hodnotené elektrokardiografické parametre
Parameter
Srdcová frekvencia (priemer ± SEM, počet úderov/min)
Sklon srdcovej osi doľava (%)
Sokolow-Lyonov index (priemer ± SEM, mm)
Sokolow-Lyonov index > 35 mm (%)
PR interval (priemer ± SEM, ms)
PR interval ≥ 200 ms (%)
Chýbanie R kmitu vo V1-V3 (%)
Nárast R kmitu vo V1-V3 (%)
QRS komplex (priemer ± SEM, ms)
QRS komplex ≥ 120 ms (%)
QTc interval (priemer ± SEM, ms)
QTc interval > 440 ms (%)
Depresia ST segmentu (%)
QTc - korigovaný QT interval
Pacienti
65,5 ± 1,5
65,8
38 ± 2,3
55,6
176,9 ± 5,9
25
34,2
52,6
111,3 ± 4,9
26,3
455,4 ± 6,6
63,2
60,5
Diskusia
Zmeny na elektrokardiograme u pacientov s HKMP predchádzajú rozvoju funkčných
a z veľkej časti aj morfologických (hypertrofie myokardu) znakov ochorenia. Hodnoty
konkrétnych elektrokardiografických ukazovateľov nie sú závislé iba na stupni
makroskopického zhrubnutia srdcovej svaloviny. Podieľa sa na nich predovšetkým
abnormálna mikroštruktúra myokardu a teda jeho odlišné elektrofyziologické vlastnosti.
U časti chorých môžu mikroskopické abnormality pretrvávať bez toho, aby došlo k vývoju
makroskopickej hypertrofie myokardu a k rozvoju samotného ochorenia.
U pacientov s HKMP s údajom o výskyte synkopy sa opisuje signifikantne predĺžený PR
interval, rozšírený QRS komplex a predĺžený QT interval v porovnaní s pacientmi bez
synkopy [1]. Najnovšie výskumy dokazujú, že depresia ST segmentu môže byť považovaná
za jeden z kľúčových rizikových faktorov [2]. Vyšší výskyt synkopy, nepretrvávajúcej
komorovej tachykardie, maximálnej hrúbky myokardu ≥ 30 mm a depresie ST segmentu
v bočných zvodoch bol zaznamenaný u pacientov, ktorí zomreli na náhlu smrť alebo bol u
nich zaznamenaný adekvátny výboj kardioverter-defibrilátora [2].
V našom súbore pacientov sa predĺžený QTc interval vyskytol v 63,2% a depresia ST
segmentu v 60,5%. Elektrokardiografia ako neinvazívne a dostupné vyšetrenie predstavuje u
pacientov s HKMP cennú diagnostikú metódu. Jednotlivé ekg abnormality môžu byť užitočné
v rizikovej stratifikácii pacientov s HKMP.
Práca bola podporená grantom MZ SR 2007/13-SZU-09.
Zoznam použitej literatúry
1. Haghjoo M, Faghfurian B, Taherpour M et al. Predictors of syncope in patients with
hypertrophic cardiomyopathy. Pacing Clin Electrophysiol 2009 May; 32(5): 642-647.
2. Haghjoo M, Mohammadzadeh S, Taherpour M et al. ST-segment depression as a risk
factor in hypertrophic cardiomyopathy. Europace 2009 May; 11(5): 643-649.
44
3. Erice B, Romero C, Andériz M et al. Diagnostic value of different
electrocardiographic voltage criteria for hypertrophic cardiomyopathy in young
people. Scand J Med Sci Sports 2009; 19: 356-363.
4. Dovgalyuk J. Holstege Ch, Mattu A, Brady JB. The electrocardiogram in the patient
with syncope. American Journal of Emergency Medicine 2007; 25: 688-701.
5. Dritsas A, Sbarouni E, Gilligan D et al. QT-interval abnormalities in hypertrophic
cardiomyopathy. Clin Cardiol 1992 Oct; 15(10): 739-742.
45
9. Farmakologické ovplyvnenie remodelácie ľavej komory pri spontánnej hypertenzii
potkanov
MUDr. Kristína Bednárová
Spoluautor: Martina Müllerová
Školitelia: Prof. MUDr. Fedor Šimko, CSc., MUDr. Mgr. Ľudovít Paulis
Ústav patologickej fyziológie, LFUK, Bratislava
Úvod
Hypertrofia ľavej komory (HĽK) je adaptačná odpoveď srdca na zvýšené hemodynamické
preťaženie. Na druhej strane však predstavuje HĽK nezávislý rizikový faktor zvýšenej
kardiovaskulárnej morbidity a mortality a neustále sa hľadajú cesty, ako tejto negatívnej
remodelácii srdca zabrániť (1). Hypertrofický rast preťaženej ľavej komory je okrem
samotnej hypertenzie spôsobený aktiváciou neurohumorálnych faktorov a zvýšenou
oxidačnou záťažou. Preto výskum vplyvu antioxidantov a neurohumorálnych modulátorov na
hypertenziu a remodeláciu ľavej komory predstavuje atraktívnu oblasť experimentálnej
kardiológie (2,3).
Melatonín, ako endogénna látka produkovaná epifýzou, zohráva dôležitú úlohu pri
synchronizácii cirkadiánnych rytmov. Okrem toho však melatonín prostredníctvom výrazného
antioxidačného a skevendžerového pôsobenia chráni endotel a zvyšuje tvorbu a biologickú
dostupnosť oxidu dusnatého (NO), ktorý má vazodilatačný a hypotenzívny účinok. Melatonín
okrem toho znižuje tonus sympatika, zvyšuje účinnosť parasympatika a na znižovaní krvného
tlaku sa môže podieľať aj priamym vplyvom na špecifické melatonínové receptory
lokalizované v periférnych cievach a v centrálnom nervovom systéme. Hypotenzívne,
antioxidatívne a humorálnu aktivitu tlmiace účinky melatonínu robia z tejto látky
potenciálneho kandidáta na terapeutickú modifikáciu hypertrofického rastu myokardu (4,5).
V našom experimente sme porovnali vplyv melatonínu, ACE-inhibítora kaptoprilu a
inhibítora aldosterónových receptorov spironolaktónu na regresiu hypertenzie a remodeláciu
ľavej komory u spontánne hypertenzných potkanov (SHR).
Metodiky
12 týždňov staré samce potkanov Wistar (WKY) a SHR sme rozdelili do piatich skupín:
kontroly (WKY), SHR, SHR+kaptopril (SHR+Cap) (100mg/kg/24h), SHR+spironolaktón
(SHR+Spi) (200mg/kg/24h) a SHR+melatonín (SHR+Mel) (10mg/kg/24h). Zvieratám sme
raz týždenne pletyzmograficky merali systolický krvný tlak (STK) na chvoste. Potkany sme
chovali v klietkach po jednom s neobmedzeným príjmom vody a potravy.
Po piatich týždňoch sme zvieratá usmrtili dekapitáciou. Srdce sme rozdelili na pravú komoru,
ľavú komoru a septum, stanovili hmotnosti jednotlivých oddielov a vypočítali ich relatívne
hmotnosti (v pomere k hmotnosti tela). Zároveň sme odobrali vzorky ľavej komory a obličky
na ďalšiu analýzu.
Kolagénové frakcie ľavej komory (ĽK)
46
Jednotlivé proteínové frakcie (vrátane solubilného a nesolubilného kolagénu) sa detekovali
diferenciálnou ultracentrifugáciou (Pelouch et al. 1995).
Aktivita NO-syntázy (NOS)
Celkovú aktivitu NOS sme stanovovali v homogenátoch ľavej komory a obličky na podklade
zmerania tvorby L-[3H]citrulínu (L-cit) z L-[3H]arginínu (Amersham, UK).
Stanovenie expresie nukleárneho faktora κB (NF-κB)
Expresiu NF-κB v ľavej komore a obličke, ako markera oxidačnej záťaže, sme vyhodnotili
metódou Western blot s použitím primárnych anti-NF-κB protilátok a sekundárnych
protilátok s peroxidázovou aktivitou (Santa Cruz Biotechnology, CA).
Štatistická analýza
Výsledky sme vyjadrili ako priemer ± štandardná chyba priemeru (SEM). Rozdiely sme
považovali za signifikantné, ak P<0,05. Na štatistické hodnotenie boli použité ANOVA
a Bonferroni test.
Výsledky
Spontánne hypertenzné potkany boli charakterizované zvýšením STK, hypertrofiou a fibrózou
ľavej komory. Tieto zmeny sprevádzalo zvýšenie aktivity NOS v ľavej komore a zvýšená
expresia NF-κB v ľavej komore a obličkách. Kaptopril, spironolaktón aj melatonín redukovali
STK, pričom najvýraznejšia redukcia STK nastala po kaptoprile. Všetky tri látky mierne
zvýšili aktivitu NOS v ĽK. Len melatonín redukoval expresiu NF-κB v ĽK a obličkách.
180
Sys
toli
cký
tlak160
krvi
(m
m
Hg)140
*
*
+
*
*
*
*
* SHR
*+
*+
*+
*+
*+
*+
*+
*+ SHR+Spi
*+
*+ SHR+Mel
*+ WKY
*+
120
*+ SHR+Cap
100
Expresia NF-κB v ĽK (A.U.)
Efekt na remodeláciu ľavej komory sa pozoroval len u kaptoprilu a melatonínu. Zatiaľ čo
kaptopril ako jediná látka redukoval hypertrofiu ľavej komory, iba melatonín znižoval obsah
kolagénu v ľavej komore.
120
*
100
*
*
*+
80
60
40
20
0
0
1
2
3
4
5
WKY
SHR
SHR+Cap SHR+Spi
SHR+Mel
týždeň liečby
SHR
SHR+Mel
SHR+Cap
SHR+Spi
WKY
Obr. 1 Efekt kaptoprilu, spironolaktónu a melatonínu na krvný tlak a expresiu NF-κB v ľavej
komore. Všetky tri látky redukovali krvný tlak, len melatonín znížil expresiu NF-κB. *P<0.05
vs. WKY, +P<0.05 vs. SHR.
47
2,5
0,6
Relatívna hm. ĽK (mg/g)
2,0
*
Obsah kolagénu v ĽK (mg)
*
*
*+
1,5
1,0
0,5
0,0
*
0,5
*
*
SHR+Cap
SHR+Spi
*+
0,4
0,3
0,2
0,1
0,0
WKY
SHR
SHR+Cap
SHR+Spi
SHR+Mel
WKY
SHR
SHR+Mel
Obr. 2 Efekt kaptoprilu, spironolaktónu a melatonínu na relatívnu hmotnosť a obsah kolagénu
v ľavej komore. Kaptopril redukoval hmotnosť ĽK, zatiaľ čo melatonín znížil obsah kolagénu
v ĽK. *P<0.05 vs. WKY, +P<0.05 vs. SHR.
Diskusia
ACE-inhibítory sú látky s najlepšie dokumentovaným antiremodelačným efektom. Ten je
sprostredkovaný nielen redukciou hypertrofického rastu, ale aj zabránením progresívnej
dilatácie ľavej komory a sprievodnou redukciou mortality u pacientov so srdcovým zlyhaním
(štúdia SAVE, AIRE, TRACE) (6,7). Podobne spironolaktón pridaný k ACE-inhibítorom
redukoval mortalitu u pacientov s ťažkým zlyhaním srdca hlavne redukciou fibrotickej
prestavby ľavej komory (štúdia RALES) (8,9). Doposiaľ je však veľmi málo
experimentálnych údajov o vplyve melatonínu na remodeláciu ľavej komory. Výrazný
antioxidačný účinok melatonínu, jeho schopnosť zlepšovať funkciu endotelu s následným
zvýšením produkcie NO s antiproliferatívnym účinkom, ako aj nepriamy sympatikolytický
efekt melatonínu robia z tejto látky potenciálneho kandidáta v prevencii alebo regresii
hypertrofie srdca. V našom experimente na spontánne hypertenzných potkanoch mal
najvýraznejší antihypertenzívny efekt kaptopril. Na druhej strane melatonín, ktorý jediný
znížil expresiu NF-κB v srdci a obličkách, redukoval obsah kolagénu v ľavej komore. NF-κB
sa považuje za ukazovateľa oxidačného stresu. Zníženie produkcie voľných radikálov môže
viesť k zlepšeniu biologickej dostupnosti oxidu dusnatého, ktorý má nielen vazodilatačný
a hypotenzívny účinok, ale aj výrazný antiproliferatívny efekt. Naše výsledky naznačujú, že
redukcia hmotnosti ľavej komory súvisí hlavne s intenzívnou redukciou krvného tlaku
(dosiahnutú kaptoprilom), zatiaľ čo zníženie fibrózy melatonínom by mohlo súvisieť s jeho
výrazným antioxidatívnym potenciálom.
Záver
1. Zdá sa, že hypertrofia ľavej komory a jej fibrotická prestavba sú odlišne regulované
patologické procesy. Vývoj hypertrofie ĽK závisí hlavne od stupňa hemodynamického
nákladu, fibrotická prestavba je zrejme determinovaná predovšetkým neurohumorálnymi
faktormi, vrátane oxidačného stresu.
2. Melatonín svojimi antioxidatívnymi a skevendžerovými účinkami pomáha redukovať
stupeň fibrózy ľavej komory. Aj keď podávanie melatonínu nenavodilo regresiu hypertrofie
ľavej komory, redukcia fibrózy by mohla navodiť takú hypertrofiu, ktorá nebude sprevádzaná
zvýšenou fibrózou a sprievodným zhoršením funkcie ĽK - tzv. „fyziologickú regresiu
hypertrofie“ (10).
48
3. Kombinácia ACE-inhibítora a melatonínu by mohla mať komplementárne pozitívny efekt.
Práca bola podporená VEGA 1/3429/06, VEGA 2/6148/69, GUK 143/2008.
Zoznam použitej literatúry
1. Šimko F. Left ventricular hypertrophy regression as a process with variable biological
implication. Can J Cardiol 1996; 12:507-551.
2. Klingbeil AU, Schneider M, Martus P, Messerli FH, Schmieder RE. A meta-analysis
of the effects of treatment on left ventricular mass in essential hypertension. Am J
Med 2003; 115:41-46.
3. Šimko F. Statins: a perspective for left ventricular hypertrophy treatment. Europ J Clin
Invest 2007; 37:681-691.
4. Paulis Ľ, Šimko F. Blood pressure modulation and cardiovascular protection by
melatonin: potential mechanisms behind. Physiol Res 2007; 56:671-684.
5. Šimko F, Paulis Ľ. Melatonin as a potential antihypertensive treatment (review). J
Pineal Res 2007; 42:319-22.
6. Pfeffer MA, Braunwald E, Moyé LA a spol. Effect of captopril on mortality and
morbidity in patients with left ventricular dysfunction after myocardial infarction:
results of the survival and ventricular enlargement trial. The SAVE Investigators. N
Engl J Med 1992; 327:669-677.
7. Šimko F, Šimko J, Fabryová M. ACE-inhibition and AT1 blockers in chronic heart
failure: pathological consideration of the unresolved battle. Cardiovasc Drugs Ther
2003; 17:287-290.
8. Pitt B, Zannad DF, Remme WJ a spol. for the Randomized Aldactone Evaluation
Study Investigators. The effect of spironolactone on morbidity and mortality in
patients with severe heart failure. N Engl J Med 1999; 341:709-717.
9. Lijnen P, Petrov V. Induction of cardiac fibrosis by aldosterone. L Moll Cell Cardiol
2000; 32:865-879.
10. Šimko F. Physiologic and pathologic myocardial hypertrophy: physiologic and
pathologic regression of hypertrophy. Med Hypotheses 2002; 58:11-14.
49
10. Vplyv veku na hladiny degradačných produktov purínových nukleotidov adenozínu, inozínu hypoxantínu, xantínu a kyseliny močovej v cerebrospinálnom likvore
u pacientov so sklerózou multiplex
Mgr. Ľubomír Kuračka
Spoluautori: RNDr. Terézia Kalnovičová, CSc.2
Školiteľ: prof. MUDr. Peter Turčáni, PhD.2
1
Ústav lekárskej chémie, biochémie a klinickej biochémie LF UK, Bratislava, 21.neurologická
klinika LF UK, Bratislava
Úvod
Skleróza multiplex (SM) je chronické autoimunitné ochorenie centrálneho nervového
systému, ktoré vedie k progresívnej dysfunkcii motorického, senzitívneho a vegetatívneho
nervového systému. Patoanatomicky je charakterizované opakovaným fokálnym poškodením
hematoencefalickej bariéry, perivaskulárnou infiltráciou lymfocytov a miestnou degradáciou
myelínu, čo vedie k tvorbe gliotických lézií a k axonálnej disrupcii. Priebeh ochorenia je
variabilný, benígny alebo malígny, prebiehajúci v atakoch (remitentne) s následným nárastom
neurologického deficitu (sekundárne chronicky progresívne), alebo pomaly progredujúco od
začiatku ochorenia (primárne chronicky progresívne).
Viaceré štúdie preukázali, že pacienti s SM majú v porovnaní so zdravými osobami nižšie
sérové hladiny kyseliny močovej (KM), čo sa interpretuje ako dôkaz prítomnosti
oxidačno/nitračného stresu v patogenéze tohoto ochorenia (1-3) Existujú štúdie, ktoré tento
fakt nepotvrdili (4-5), alebo poukazujú na zvýšené hladiny KM v sére SM pacientov (6). Tieto
kontraverzné alterácie v hladinách KM podnietili diskusiu, či KM má pri SM funkciu
antioxidanta alebo je parametrom, ktorý indikuje nastupujúci akcelerujúci katabolizmus
purínov ako sekundárny jav energetickej nerovnováhy. Čiastočnú odpoveď na túto otázku by
mohla umožniť analýza celého profilu purínových metabolitov v cerebrospinálnom likvore
(CSF) a v plazme, ich longitudinálne sledovanie a ich korelácia s progresiou ochorenia.
V tejto súvislosti sme sa v prvej fáze tohto projektu zamerali na analýzu likvorových hladín
KM a jej prekurzorov, xantínu, hypoxantínu, inozínu a adenozínu s cieľom zhodnotiť vplyv
veku SM pacientov a dysfunkcie hematolikvorovej bariéry (HLB) na metabolizmus
purínových nukleotidov.
Materiál a metódy
Analyzovaný súbor pozostával z 27 pacientov (žien), 11 pacientov s klinicky a laboratórne
potvrdenou diagnózou SM, 11 pacientov so suspektnou SM laboratórne nepotvrdenou a 5 SM
pacientov s poruchou hematolikvorovej bariéry.
Hladiny kyseliny močovej (KM), hypoxantínu (HYP), xantínu (XAN), inozínu (INO) a
adenozínu (ADO) v CSF sme stanovovali pomocou vysokoúčinnej kvapalinovej
chromatografie
(HPLC).
Mobilná
fáza
obsahovala
60
mmol.l-1
roztok
dihydrogénfosforečnanu draselného upraveného kyselinou trihydrogénfosforečnou na pH 2,91
a 2% metanolu (v/v). Separované látky sa detegovali spektrofotometricky pri vlnovej dĺžke
50
254 nm. Funkcia hematolikvorovej bariéry sa hodnotila pomocou indexu Qalb (Qalb = CSF
albumín/sérový albumín x 1000). Výsledky sú vyjadrené ako median s najnižšou a najvyššou
nameranou hodnotou.
Výsledky.
V tabuľke 1 sú uvedené výsledky likvorových hladín degradačných produktov purínových
nukleotidov u pacientov s klinicky a biochemicky potvrdenou diagnózou SM
(SM(+)), klinicky predpokladanou a laboratórne nepotvrdenou diagnózou SM (SM(-))
a u SM(+) pacientov s poruchou hematolikvorovej bariéry (SMQA). Pacienti s vyšším vekom
(nad 40 rokov) majú vyššie likvorové hladiny analyzovaných metabolitov a vyšší metabolický
obrat kyseliny močovej (KM/XAN) ako SM(+) pacienti nižšej vekovej kategórie. Tieto
vekové rozdiely sa u SM(-) pacientoch nepozorovali. Skupina SMQA sa líšila od vekovo
odpovedajúcej skupiny SM(+) zvýšenými hladinami KM a KM/XAN.
SM(+)
vek
KM
(µmol/L)
XAN
(µmol/L)
HYP
(µmol/L)
INO
(µmol/L)
ADO
(µmol/L)
KM/XAN
XAN/HYP
HYP/INO
INO/ADO
QA
IgG v CSF
(mg/L)
n = 11
n=7
28
(21-34)
10,18
(7,1-18,2)
3,09
(1,4-6,33)
3,01
(1,2-4,73)
1,08
(0,81-2,0)
2,82
(2,54-3,5)
4,5
(1,37-5,9)
1,16
(0,3-2,49)
2,37
(4,5-5,47)
0,38
(0,2-0,68)
3,9
(2,2-6,38)
0,046
(0,03-0,08)
SM(-)
n = 11
n=4
n=6
45,5
32
(44-46)
(24-36)
28,5
21,25
(19,5-46,7)
(12,5-32,4)
4,79
3,25
(2,7-5,88)
(1,66-4,5)
4,81
3,24
(2,44-6,75)
(1,3 – 4,69)
1,54
1,11
(1,46-1,64)
(0,89-3,45)
3,44
3,55
(3,3 – 3,64) (2,9-4,96)
6,87
7,2
(5,49- 7,94) (4,2-14,61)
1,01
1,04
(0,7-1,35)
(0,93-1,38)
3,24
2,39
(1,54-4,11)
(0,44-3,61)
0,44
0,32
(0,43-0,45)
(0,22-1,16)
4,3
3,5
(2,3-6,4)
(2,68-5,3)
0,038
0,018
(0,03-0,087) (0,01-0,034
SMQA
n=5
n=5
45
30
(40-48)
(22-40)
19,03
17,91
(12,21-36,1) (5,54-62,4)
2,86
3,51
(1,76-4,22)
(1,78-4,3)
2,49
2,76
(1,04-3,36)
(1,24-3,12)
1,12
0,96
(0,83-2,02)
(0,49-1,33)
3,59
2,91
(2,54-3,93)
(2,54-3,28)
6,46
5,13
(4,47-20,5)
(1,57-17,5)
1,18
1,43
(0,85-1,69)
(1,12-2,60)
1,68
2,41
(1,01-3,96)
(1,21-3,32)
0,38
0,305
(0,28-0,55)
(0,7-0,52)
4,6
9,06
(3,1-7,2)
(8,09-9,9)
0,024
0,076
(0,02-0,037) (0,034-0,1)
Tab.1: Hladiny degradačných produktov purínových nukleotidov v cerebrospinálnom likvore
u pacientov so sklerózou multiplex .
KM-kyselina močová, XAN-xantín, HYPO-hypoxantín, INO-inozín, ADO-adenozín.
SM (+) – laboratórne potvrdená skleróza multiplex, SM(-) laboratórne nepotvrdená SM,
SMQA – SM s dysfunkciou HLB.
51
Obr.1 Metabolizmus purínových nukleotidov..
AMP- adenozínmonofosfát, IMP- inozínmonofosfát, PNF- purínnukleozidfosforyláza,
XAO- xantínoxidáza, GD- guaníndeamináza
Diskusia
Skleróza multiplex (SM) je autoimunitné chronické zápalové demyelinizačné ochorenie
bielej hmoty CNS charakterizované masívnou fokálnou infiltráciou T-bunkami a makrofágmi,
poškodzovaním axónov a následnou stratou funkcie. V skorých štádiách rozvoja lézií
dochádza k poruche hematoencefalickej bariéry a k invázii hematogénnych monocytov a T
buniek do tkaniva mozgu, ktorých následná aktivita predstavuje základ pre začiatok a
progresiu ochorenia. SM ochorenie začína s typicky neurologickým deficitom s variabilnými
periódami remisie prerušovanej relapsom. Táto fáza ochorenia, ktorá sa nazýva relapsremitujúca SM, po 8 až 15 rokov u väčšiny pacientov vstupuje do štádia kontinuálneho
progresívneho neurologického deficitu (7). Kalnovičová a spol. (8) zistili, že pacienti
s chronicko-progredientnou formou SM majú v porovnaní s kontrolou a s RRSM pacientmi
signifikantne vyššie likvorové hladiny kyseliny močovej, hypoxantínu a xantínu, čo
interpretujú ako pravdepodobný odraz ireverzibilných deštrukčných zmien, ktoré prebiehajú
v nervovom tkanive v chronicky progresívnom štádiu SM. V tejto súvislosti nás zaujímalo, či
vekové rozdiely v našej skupine SM pacientov sa odrážajú v likvorových hladinách
degradačných produktoch purínových nukleotidov. Zistili sme, že skupina SM(+) nad 40
rokov mala v CSF zvýšené hodnoty analyzovaných metabolitov a vyšší metabolický obrat
kyseliny močovej (KM/XAN) ako SM(+) pacienti nižšej vekovej kategórie. Tento trend sa
nepozoroval v skupine pacientov so suspektnou SM, u ktorých sa diagnóza SM laboratórne
nepotvrdila (SM(-)). Zvýšené hladiny metabolitov v CSF pravdepodobne odrážajú
prebiehajúci chorobný proces, ktorý neskôr vedie k ireverzibilnej demyelinizácii, disrupcii
axónov a k neurodegenerácii. Analyzované zmeny v hladinách KM v CSF môžu pochádzať
z reakcie xantínoxidázy v endotelových bunkách a astrocytoch, z akcelerovaného katabolizmu
purínov a v prípade SMQA aj z cirkulácie. Vo všeobecnosti sa akceptuje, že energetické
zlyhanie mozgového tkaniva vedie k zvýšeniu hladín hypoxanínu, kým zvýšenie likvorových
hladín xantínu a KM nepriamo odráža tvorbu voľných radikálov, ktoré sa uvoľňujú pri
ireverzibilnej premene xantínu na KM pri aktivite xantínoxidázy (9).
52
Analyzovaný súbor je pomerne malý na vytvorenie korektných záverov. Predbežné výsledky
však potvrdzujú, že u SM pacientov v priebehu chorobného procesu dochádza k poruche
energetického stavu mozgového tkaniva a akcelerovanému katabolizmu purínových
nukleotidov. Súčasné poukazujú, že pri interpretácii týchto biochemických parametrov je
dôležité pri diagnóze SM vždy charakterizovať aj vekovú kategóriu a stupeň integrity HLB.
Zoznam použitej literatúry
1. Toncev G, Milicic B, Toncev S, Samardzic G: Serum uric aid levels in multiple
sclerosis patients correlate with activity of disease and blood brain barrier dysfunction.
Eur J Neurol 2002; 9(3):221-226.
2. Mattle HP, Lienert C, Greeve L: Uric acid and multiple sclerosis. Ther Umsch
2004;61(9):553-555.
3. Koch M, De Keyser J: Uric acid in multiple sclerosis . Neurol Res 2006;28: 316-319.
4. Mosert JP, Ramsaransing GS, Heersema DJ a spol.: Serum uric acid levels and
leucocyte nitric oxide production in multiple sclerosis patients outside relapses. J
Neurol Sci 2005; 231: 41-44.
5. Sotgiu S, Pugliatti M, Sanna A, Sotgiu A, Fois ML, Arru G, Rosati G: Serum uric acid
and multiple sclerosis. Neurol Sci 2002; 23(4):183-188.
6. Amorini AM, Petzold A, Tavazzi B a spol.: Increase of uric acid and purine
compounds in biological fluids of multiple sclerosis patients. Clin Biochem 2009; 41:
1001-1006
7. Steinman L: Multiple sclerosis: a two stage disease. Nature Immunol 2001; 2(9): 762764.
8. Kalnovičová T, Volaříková V, Ondrkalová M,Traubner P, Turčáni P: Degradačné
produkty purínových nukleotidov ako marker tkanivovej deštrukcie u pacientov so
sklerózou multiplex. Laboratórna diagnostika 2006; 11(1-2):26-30.
9. Stover JF, Lowitzsch K, Kempski OS: Cerebrospinal fluid hypoxanthine, xanthine
and uric acid levels may reflect glutamate-mediated excitoxicity in different
neurological diseases. Neurosci Lett 1997;238:25-28
.
53
11. Vplyv stravy bohatej na Maillardove produkty a aromatické látky na správanie
potkanov a na hormóny regulujúce metabolizmus
MUDr. Kristína Klenovicsová
Spoluautori: MUDr. Peter Boor, PhD.1, MUDr. Ing. Mgr. Peter Celec, PhD., MPH3, Mgr.
Michal Behuliak3, RNDr. Katarína Rácová4, Prof. Dr. Veronika Somoza5
Školiteľ: MUDr. Katarína Šebeková, DrSc.1, Prof. MUDr. László Kovács, DrSc.2
1
Oddelenie klinickej a experimentálnej farmakoterapie SZU, Bratislava, 2II. Detská klinika
DFNsP a LF UK, Bratislava, 3Ústav molekulárnej biomedicíny, Univerzita Komenského,
Bratislava, 4Ústav laboratórnych a vyšetrovacích metód LF UK a OUSA, Bratislava,
5
Nemecký inštitút potravinovej chémie, Garching, Nemecko
Úvod
Počas tepelného spracovania potravín vznikajú reakciou voľných amino-skupín bielkovín
s redukujúcimi sacharidmi produkty Maillardovej reakcie (Maillard reaction products, MRP).
MRP dávajú pokrmom vôňu, farbu, chuť a arómu. Najbohatším zdrojom MRP je strava typu
„fast food“ (vyprážané, grilované, fritované jedlá). Výsledky experimentálnych a klinických
štúdií dokladajú, že nadmerný príjem tepelne upravenej stravy bohatej na MRPs môže
spôsobovať prírastok hmotnosti, zvýšenie ukazovateľov zápalu a oxidačného stresu, má
diabetogénne a nefrotoxické účinky, prispieva k dysfunkcii endotelu a rozvoju predčasnej
aterosklerózy (1-5). Nie je však jasné, či aromatická zložka v strave ovplyvňuje aj
mechanizmy regulujúce pocit hladu a sýtosti, a či vyvoláva zmeny v správaní jedinca. V
predchádzajúcich pokusoch, zameraných na nefrotoxické účinky alimentárnych MRP (2), sme
pozorovali odlišné správanie sa potkanov kŕmených potravou bohatou alebo chudobnou na
MRP a arómy. Položili sme si otázku, ako pôsobí strava bohatá na chlebové kôrky (zdroj
aromatických MRP) na hormóny regulujúce príjem a metabolizmus potravy a na správanie sa
zdravých dospelých potkanov.
Materiál a metódy
Zdravé samce potkanov kmeňa Wistar sme rozdelili do troch skupín po 8 zvierat. Kontrolná
skupina (CTRL) dostávala štandardnú potravu pre hlodavce (SP1, Top Dovo), druhá skupina
(BC) konzumovala špeciálnu diétu, bohatú na MRP (25% štandardnej stravy nahradenej
chlebovými kôrkami). Tretia skupina (EX) konzumovala stravu bohatú na chlebové kôrky
(25% hmotnosti), z ktorých boli éterom vyextrahované aromatické zložky. Chlebové kôrky
vyrobili v spolupracujúcom nemeckom laboratóriu (Garching). Potkany mali voľný prístup
k vode a potrave. Počas 3 týždňov trvania experimentu sme u všetkých zvierat zaznamenávali
množstvo prijatej potravy a vypitej vody, a raz týždenne prírastok na hmotnosti a diurézu.
Správanie zvierat sme sledovali psychologickými testami. „Light-dark box“- a „Open field“ test sme realizovali za účelom hodnotenia miery anxiozity, test núteného plávania
a anhedonický test na testovanie sklonu k depresívnemu chovaniu.
Na konci pokusu sme zvieratám odobrali krv z brušnej aorty a moč z močového mechúra
v celkovej anestéze (ketamin/xylazin). V krvnej plazme sme stanovili koncentráciu AGEs
54
(advanced glycation end products, in vivo analógy potravinových MRP) a hormónov
regulujúcich pocit hladu a sýtosti (inzulín, adiponektín – RIA metóda, Linco Research, USA,
leptín – ELISA metóda, BioVendor, Nemecko). HPLC metódou sme stanovili koncentráciu
kyseliny 5-hydroxy-3-indolyloctovej (5HIAA, metabolit serotonínu) v moči.
Výsledky sme vyjadrili ako priemer ± SD. Na porovnanie skupín sme použili
ANOVA, Kolmogorov-Smirnov test, alebo Studentov t–test a Mann-Whitneyho U-test (pri
porovnaní 2 skupín). Za štatisticky významné sme považovali p<0,05.
Výsledky
Napriek tomu, že potkany v BC a EX skupinách konzumovali denne o 20-25 g viac stravy
v porovnaní s kontrolnou skupinou, priberali všetky 3 skupiny zvierat na hmotnosti
porovnateľne. Koncentrácie AGEs v plazme boli významne vyššie v skupinách kŕmených
stravou s vysokým obsahom MRP (p<0,001; u BC potkanov o 60% viac, u EX potkanov
o 73% viac ako v CTRL skupine).
Potkany konzumujúce potravu obohatenú o chlebové kôrky udržiavali porovnateľné glykémie
s kontrolnými potkanmi vyššou inzulinémiou (p<0,05), čo sa prejavilo zníženou inzulínovou
senzitivitou (HOMA: p<0,05), (obr.1).
20
IRI (µIU/ml)
7
6
16
5
12
4
3
8
2
4
1
0
0
Inz 0
p<0,05
Inz 1
HOMA 0
HOMA 1
p<0,05
Obr.1: Inzulinémia a index inzulínovej senzitivity (HOMA) nalačno (0) a postprandiálne (1)
u potkanov kŕmených štandardnou stravou (biele), stravou bohatou na MRP ale chudobnou na
arómy (kockované) a stravou bohatou na MRP aj arómy (prúžkované); výsledky sú
znázornené ako priemer + SD
EX a BC skupina mali významne vyššie koncentrácie leptínu a adiponektínu v plazme (obe:
p=0,001) v porovnaní s CTRL skupinou. Koncentrácia leptínu bola o 43% a adiponektínu
o 31% vyššia u BC potkanov ako v EX skupine (p=0,037, p=0,002). BC aj EX skupina
vylučovala močom významne viac 5-HIAA ako kontrolná skupina (p=0,000, p=0,020).
55
5
10
Leptín (ng/ml)
4
16
Adiponektín
3
(x10 ng/ml)
7,5
12
5
8
2,5
4
5-HIAA/kreat.
-3
(x10 umol/l)
3
2
1
0
0
CTRL
p<0,001
EX
BC
0
CTRL
EX
BC
p<0,001
CTRL
EX
BC
p<0,001
Obr.2: Priemerné koncentrácie leptínu a adiponektínu v plazme a renálne vylučovanie
kyseliny 5-hydroxy-3-indolyloctovej (5-HIAA) u zvierat na štandardnej strave (CTRL),
u potkanov kŕmených stravou bohatou na MRP ale chudobnou na arómy (EX) a potkanov
konzumujúcich stravu s vysokým obsahom MRP a aróm (BC); výsledky sú znázornené ako
priemer + SD
U zvierat v BC skupine sme pozorovali anxiózne a menej exploratívne správanie v Openfield
(p<0,05) a Light-dark box teste (p<0,05) v porovnaní s ostatnými dvoma skupinami. Testom
núteného plávania a anhedonickým testom sme nepotvrdili rozdiely medzi skupinami,
zvieratá nejavili známky depresívneho chovania.
Diskusia
Zdraviu škodlivé účinky nadmerného alimentárneho prívodu MRP dokladajú výsledky
experimentálnych a klinických štúdií (1-5). Nie je však jasné, ako vplýva strava s vysokým
obsahom MRP a aromatických zložiek na hormóny, regulujúce príjem potravy a na dietetické
chovanie zvierat. Predpokladali sme, že prítomnosť aromatickej zložky v potrave by mohla
ovplyvniť reguláciu normálnej kontroly príjmu potravy s následnou hyperfágiou a priberaním
na hmotnosti. Zároveň sme predpokladali, že aróma v potrave by mohla byť zodpovedná za
vznik návyku na konzumáciu tepelne upravenej stravy.
Zvieratá v BC a EX skupine konzumovali viac jedla ako kontrolná skupina, napriek tomu
počas 3 týždňov nepribrali viac. Túto skutočnosť možno pripísať buď dĺžke trvania pokusu,
ale aj jednoznačne nižšej biologickej dostupnosti alimentárnymi MRP modifikovaných
bielkovín pre energetický metabolizmus (6,7) v porovnaní s intaktnými bielkovinami.
Zvieratá konzumujúce potravu s vysokým obsahom MRP (BC a EX) mali vyššie koncentrácie
AGEs v plazme. Tento nález potvrdzuje, v súlade s literárnymi údajmi (4,8), že Maillardove
produkty z potravy sa vstrebávajú do krvného obehu.
Prítomnosť chlebových kôrok v strave výrazne ovplyvnila hormóny zapojené do kontroly
metabolizmu a príjmu potravy (inzulín, leptín, adiponektín, 5-HIAA-metabolit serotonínu).
Cirkulujúce koncentrácie leptínu pozitívne korelujú so stupňom obezity, inzulinémiou resp.
56
inzulínovou rezistenciou (9). Strava bohatá na aromatické chlebové kôrky v našom pokuse
indukovala najvyššiu leptinémiu a inzulinémiu a najnižšiu inzulínovú senzitivitu. Strava
s extrahovanými arómami (EX) taktiež vyvolala vzostup sledovaných hormónov v porovnaní
so štandardnou stravou. Tieto výsledky svedčia o tom, že alimentárne MRP, ako aj
aromatické zložky potravy, zasahujú do riadenia metabolických dejov a menia homonálny
profil zdravých potkanov.
Výsledky psychologických testov naznačili, že BC strava zvyšuje anxiozitu a znižuje
exploratívne chovanie potkanov. Domnievame sa však, že tento výsledok môže súvisieť aj
s väčšou spokojnosťou zvierat po nasýtení aromatickou stravou a menšou potrebou
vyhľadávať nové impulzy. Odpoveď na túto otázku očakávame aj od vyšetrenia mozgovej
signalizácie potkanov metódou c-fos (10).
Naša pilotná práca poskytuje nový pohľad na metabolické a behaviorálne zmeny podmienené
konzumáciou tepelne upravenej stravy, poukazuje na možnú dôležitú úlohu vznikajúcich
aromatických zložiek, a môže byť základom pre štúdie účinkov „fast food“ stravovania
u ľudí.
Podporené Vnútorným grantom Slovenskej zdravotníckej univerzity, č. 19-90-05 (KK)
a čiastočne grantom SAV CENDO II /2/2007 (KŠ).
Zoznam literatúry
1. Šebeková K, Somoza V: Dietary advanced glycation end products (AGEs) and their
health effects – PRO. Mol Nutr Food Res 2007; 51: 1079-1084.
2. Šebeková K, Hofmann T, Boor P, Šebeková K Jr, Uličná O, Erbersdobler HF, Baynes
JW, et al.: Renal effects of oral maillard reaction product load in the form of bread
crusts in healthy and subtotally nephrectomized rats. Ann N Y Acad Sci 2005; 1043:
482-491.
3. Wittmann I, Wagner Z, Mazák I, Pótó L, Schinzel R, Heidland A, Nagy J: Foods rich
in advanced glycation and products (AGEs) induce microalbuminuria in healthy
persons. Nephrol Dial Transplant 2001; 16: A106.
4. Uribarri J, Cai W, Sandu O, Peppa M, Goldberg T, Vlassara H: Diet-derived advanced
glycation end products are major contributors to the body's AGE pool and induce
inflammation in healthy subjects. Ann N Y Acad Sci 2005; 1043: 461-466.
5. Sandu O, Song K, Cai W, Zheng F, Uribarri J, Vlassara H: Insulin resistance and type
2 diabetes high fat-fed mice are linked to high glycotoxin intake. Diabetes 2005, 54:
2314-2319.
6. Seiquer I, Díaz-Alguacil J, Delgado-Andrade C, López-Frías M, Muñoz Hoyos A,
Galdó G, Navarro MP: Diets rich in Maillard reaction products affect protein
digestibility in adolescent males aged 11-14 y. Am J Clin Nutr 2006; 83: 1082-1088.
7. Rerat A, Calmes R, Vaissade P, Finot PA: Nutritional and metabolic consequences of
the early Maillard reaction of heat treated milk in the pig. Significance for man. Eur J
Nutr 2002; 41: 1-11
8. Somoza V, Wenzel E, Weiss C, Clawin-Rädecker I, Grübel N, Erbersdobler H: Dosedependent utilisation of casein-linked lysinoalanine, N(epsilon)-frustoselysine and
57
N(epsilon)-carboxymethyllysine in food samples. J Chromatogr 2006; A1140: 189 –
194.
9. Ganji V, Kafai MR, McCarthy E: Serum leptin concentrations are not related to dietary
patterns but are related to sex, age, body mass index, serum triacylglycerol, serum
insulin, and plasma glucose in the US population. Nutr Metab 2009; 14: 6-3.
10. Bratincsák A, McMullen D, Miyake S, Tóth ZE, Hallenbeck JM, Palkovits M: Spatial
and temporal activation of brain regions in hibernation: c-fos expression during the
hibernation bout in thirteen-lined ground squirrel. J Comp Neurol 2007; 505: 443-458.
58
12. Imunogenetická determinácia vývoja astma bronchiale v slovenskej populácii
MUDr. Martin Dzurilla
Spoluautori: MUDr. Monika Krivošíková PhD, MUDr. Juraj Javor PhD
Školiteľ: prof. MUDr. Milan Buc, DrSc.
Imunologický ústav Lekárskej fakulty UK Bratislava
Úvod
Atopická asthma bronchiale (AB) je geneticky determinovaná choroba; z početných
predispozičných génov medzi najvýznamnejšie patria gény hlavného histokompatibilného
komplexu (HLA), najmä druhej triedy a cytokínové gény. HLA-DQB1 a HLA-DRB1 alely
kódujú molekuly, ktoré sú potrebné pre prezentáciu exogénnych antigénov (teda aj alergénov)
T-lymfocytom. Tie po ich rozpoznaní svojimi špecifickými receptormi iniciujú rozvoj
imunitnej odpovede. Pri rozvoji a udržiavaní alergického zápalu a remodelácii steny
dýchacích ciest potom zohrávajú kľúčovú úlohu viaceré cytokíny (1). Štúdie, ktoré sa
zaoberajú asociáciou AB s HLA-alelami, resp. cytokínovým polymorfizmom sú aj vo svete,
nielen na Slovensku, nepočetné čo nás viedlo k urobeniu takejto štúdie.
Charakteristika súboru, materiál a metódy
Vyšetrovaný súbor pre polymorfizmy cytokínových génov tvorilo 129 pacientov s AB s
precitlivenosťou na trávové a iné aeroalergény, ktorá sa potvrdila kožnými testami a
vyšetrením špecifických IgE-protilátok. Diagnóza astmy bola stanovená podľa kritérií WHO
GINA (The Global Initiative for Asthma). Pre potreby vyšetrenia HLA-aliel sme tento súbor
zúžili na 109 subjektov – vynechali sme pacientov, ktorý neboli precitlivení na trávové
alergény. Viedla nás k tomu snaha docieliť homogénnejšiu kohortu pacientov. Kontrolný
súbor tvorilo 140 nepríbuzných zdravých jedincov bez prejavov astmy a alergických chorôb a
s negatívnou rodinnou anamnézou. Na typizáciu aliel HLA-DRB1 a -DQB1 na úrovni „low
resolution“ a určovanie 22 polymorfizmov cytokínových génov (IL-1α, IL-1β, IL-1R, IL1RA, IL-4Rα, IL-12, IFN-γ, TGF-β1, TNF, IL-2, IL-4, IL-6 a IL-10) sme použili
polymerázovú reťazovú reakciu so sekvenčne špecifickými primermi (PCR-SSP) a s využitím
komerčne dostupných kitov (Olerup SSPTM AB, GenoVision a Cytokine Genotyping Kit,
Dynal Biotech, Invitrogen Corp). Štatistické vyhodnotenie sme robili pomocou Fisherovho
exaktného testu.
Výsledky
Frekvencia DRB1-aliel v súbore astmatikov sa pohybovala od 0,5 % pre alelu DRB1*09 až
po 16,1 % pre alelu DRB1*11; pri DQB1 alelách najmenej častá bola alela DQB1*040 (2,3
%) a najčastejšia alela DQB1*03 (37,2 %). Keď sme porovnávali frekvenciu jednotlivých
aliel v súbore pacientov s frekvenciami aliel v zdravej populácii, nezistili sme nijakú
štatistickú signifikantnú odchýlku, ich frekvencie boli viac či menej rovnaké. Podobná
situácia bola pri vyšetrení SNP cytokínových génov, s výnimkou slabej asociácie s
59
polymorfizmami IL-10 -1082 G/A, -819 T/C, -592 A/C a TGF-β1 kodón 10 T/C.
U astmatikov sa však signifikantne častejšie vyskytoval haplotyp IL-10 -1082 A/-819 C/-592
C (38,76 % vs. 30,00 %; P = 0,0365; OR = 1,477).
Diskusia
HLA-molekuly sú principiálne molekuly, ktoré sa zúčastňujú na rozvoji imunopatologických
reakcií pri alergických i autoimunitných procesoch. V roku 2009 sme na konferencii
doktorandov prezentovali čiastkové výsledky od 51 subjektov, ktoré naznačovali, že pacienti
s AB majú vyšší výskyt alely DRB1*01 a naopak nižšiu frekvenciu alely DRB1*11. Súčasné
výsledky na väčšom súbore vyšetrených pacientov však túto asociáciu nepotvrdilo, pôvodne
išlo teda o chybu malého súboru.
Cytokíny sú dorozumievacím jazykom medzi bunkami imunitného systému a preto opäť
neprekvapuje, že niektoré z nich výrazne prispievajú k patogenetickým procesom, o.i. aj pri
astme. Naše výsledky naznačujú, že polymorfizmy v géne pre protizápalový a
imunosupresívny cytokín IL-10 môžu byť jedny z mnohých genetických faktorov
podieľajúcich sa na genetickej predispozícii k vzniku prieduškovej astmy. Nosičstvo
nízkosekrečného haplotypu ACC génu pre IL-10 by mohlo prispievať k rozvoju choroby, a to
práve cestou nižšej tvorby protizápalového IL-10. S rozvojom AB by sa tiež mohlo spájať aj
nosičstvo T-alely v 10. kodóne génu pre TGF-β1 T. Vzhľadom na nejasný vplyv tejto génovej
variácie na tvorbu tohto cytokínu, ako aj možné duálne pôsobenie TGF-β1
v imunopatogenéze astmy (protizápalové vs. profibrotické) si však na interpretáciu tohto
výsledku ešte budeme musieť počkať. Vo svetovej literatúre opakovane opisovaná asociácia
s polymorfizmami génov pre IL-4, IL-4Rα a TNF-α sa zatiaľ v našej štúdii nepotvrdila (2-6).
Zoznam použitej literatúry
1. Buc M. Základná a klinická imunológia. Bratislava: UK 2009, 608 s.
2. Hobbs K, Negri J, Klinnert M, Rosenwasser LJ, Borish L. Interleukin-10 and
transforming growth factor-beta promoter polymorphisms in allergies and asthma. Am
J Respir Crit Care Med 1998;158(6):1958-62.
3. Lyon H, Lange C, Lake S, Silverman EK, Randolph AG, Kwiatkowski D, et al. IL10
gene polymorphisms are associated with asthma phenotypes in children. Genet
Epidemiol 2004;26(2):155-65.
4. Movahedi M, Mahdaviani SA, Rezaei N, Moradi B, Dorkhosh S, Amirzargar AA. IL10, TGF-beta, IL-2, IL-12, and IFN-gamma cytokine gene polymorphisms in asthma.
J Asthma 2008;45(9):790-4.
5. Trajkov D, Mirkovska-Stojkovikj J, Arsov T, Petlichkovski A, Strezova A, EfinskaMladenovska O, et al. Association of cytokine gene polymorphisms with bronchial
asthma in Macedonians. Iran J Allergy Asthma Immunol 2008;7(3):143-56.
6. Buc M, Dzurilla M, Vrlik M, Bucova M. Immunopathogenesis of bronchial asthma.
Arch Immunol Ther Exp 2009, 57: 331-44
60
Predklinická a molekulárna sekcia
49. fakultná konferencia ŠVOČ
1.miesto
Expresia karbonickej anhydrázy IX v nádoroch štítnej žľazy
Martina Ondríková
2.miesto
The activity of BP6 cells depending on organ compartmentation
El-Hassoun Olia
3.miesto
Inervácia ľudského apendixu
Katarína Galliková
61
13. The activity of BP6 cells depending on organ compartmentation
Olia El-Hassoun
(General medicine, 5th year)
Supervisor: Prof. MUDr. Ivan Hulín DrSc, Mgr. Zuzana Valašková
Institute of Pathophysiology, LFUK Bratislava
Introduction
The process of cancerogenesis and growth of tumors is not solely a matter of autonomic
growth of a group of mutated cells. It is a highly complex systemic process (1). More
attention is nowadays drawn to studying the interactions between cancer cells and cells and
systems of the human body.
In human medicine, it is known that distant metastases occur during the progression of cancer,
it is not yet known, whether a group of tumor cells or isolated tumor cells can be found distant
from the tumor before the occurrence of metastases. The investigation of the presence of
isolated tumor cells is almost impossible without special detecting methods. It is like trying to
find a needle in a haystack. Such information is not surprisingly missing in the science
literature world. Till now, there is no experimental evidence concerning what happens in the
whole organism and in distant sites after the application of tumor cells to certain organs or
compartments.
In the past year, we were able to acquire BP6 cells with an incorporated gene for the green
fluorescent protein (GFP). We published the results of our experimental monitoring in an
international biomedical journal. Now, we attempted to monitor what happens in distant
organs, whether tumor cells remain in the site of application, or reach further to distant sites.
The answer to this question could principally change the concept of tumorigenesis, as it
would stop being considered as a disorder of a certain organ, in which a solid tumor develops.
If evidence is found that tumor cells are present in distant sites since the beginning of tumor
development, then the result of their presence does not have to be merely the production of
metastases. It could be a manifestation of the “engagement” of the whole organism in this
extremely complex process.
In our experiment we tried to demonstrate the role of the spleen as an important organ as well
as a blood filter in the (body– tumor) interactions, using BP6 sarcoma cells. The BP6 sarcoma
cell line if favorable as an experimental model because of its high tumor induction ability and
low metastatic potential. which in turn reduces the possibility of altered results by
paraneoplastic syndrome. The incorporated fluorescent protein (GFP) will help us locate these
cells, and observe their interactions in this environment.
Several studies confirmed that the immune system plays a principal role in the process of
tumorigenesis and growth of tumors (2). There are very few case reports of metastatic masses
in the spleen. A general view is that the spleen is a poor soil for metastasis given the large
amount of white blood cells (3).
62
Materials and methods
Wistar albino rats (ANALAB, Prague) were divided into 3 groups, each containing 4 rats; the
first group was an absolute negative control; the second was injected with 0.5 x 106 of GFP
incorporated BP6 dispersed in 2.0 ml of serum free RPMI 1640 medium into the peritoneal
cavity (IP); the third group was injected with the same amount of tumor cell s subcutaneously
(SC) in the area of the back. After 4 weeks rats were sacrificed, perfused with
paraformaldehyde, and dissected. Samples of the spleen were taken. Histological sections
from formol-paraffin blocks were prepared, both non stained and stained with hematoxylin
and eosin (HE). Samples were examined using the microscope Eclipse E50i (NIKON, Japan),
for both light microscopy and GFP fluorescent technique.
Results
Fig. 1a) Rat´s spleen. Tumor cells IP. Few large green fluorescent cells in PALS. 1b) Tumor
cells IP. Green fluorescence of pleomorphic small cells in the subcapsular area. 1c) Tumor
cells SC. Green fluorescence of few large cells in PALS. 1d) Tumor cells SC. Green
fluorescent small cells in the subcapsular area. x 400
63
In animals with IP injected tumor cells, multiple solid tumors were found in different sites
within the peritoneal cavity. The size of tumors ranged from 2 – 8 mm. the amount of solid
tumor masses ranged from 6 – 30. In animals with SC injected tumor, a solid tumor of
varying sizes, with blistered appearance developed in the place of injection.
We found no significant changes in the spleen morphology in HE stained histological sections
from all groups. In unstained sections we demonstrated the presence of fluorescent cells in
both IP and SC groups. These cells were pleomorphic and were present in the periarterial
lymphatic sheath (PALS) or the lymphatic follicles (fig. 1a,c) of the white pulp, and
occasionally in the subcapsular area (fig. 1b,d). Fluorescent cells in PALS were notably larger
than those in the subcapsulary area. Fluorescence was demonstrated in the cytoplasm either
diffuse or in granules, as well as in the nuclei of some cells.
Discussion
The fluorescent cells found in the spleen were scattered and did not show the typical cluster
formation of the sarcoma cells. Based on their fluorescent activity and pleomorphism we
believe that they are BP6 sarcoma cells that reached the spleen through the blood circulation.
Their presence in small amount could result from the minimal draining of the tumor sarcoma
cells to the blood. Fluorescent cells in the subcapsular space showed pleomorphism of
sarcoma cells but they were significantly smaller than those in the PALS, on the other hand,
fluorescent cells in PALS were large, and granulated. These morphological changes in tumor
cells resembling some sort of selection of tumor cells passing through the spleen parenchyma
could be a result of the unfavorable environment of the spleen for these cells to grow; as it
casts a long exposition to T lymphocytes in the PALP, and to dendritic cells and macrophages
alongside the acidic pH in the red pulp.
Sources describing metastatic cells in the spleen are scarce; they are mostly in the form of
case reports of solitary spleen metastasis of various tumors (3, 4). It is not clear though,
whether these case reports were associated with immunodeficiency in these patients, but it
was described that a spleen metastasis of an ovarian cancer confers a poor prognosis (5).
The incorporation of a fluorescent protein might alter the behavior of the tumor cells and their
intercellular interactions. It was observed that cells with GFP grow slower than a clean cell
line. No other significant changes were yet described (6).
Conclusion
We injected tumor cells in a different body environment with anticipation that they will
behave differently and the body will react differently to their presence based on our
observation in previous experiments (1). Our observation of a similar picture of the spleen in
both IP and SC injected tumors indicates on one hand a high level of regularity in the tumor
cell behavior disregarding the surrounding microenvironment, on the other hand suggests a
potential role of the spleen in actively attracting tumor cells, either to attack them, or to
process a form of information that will modulate further body–tumor interactions.
We confirmed the presence of solitary naturally fluorescent cells in the spleen, which we
believe to be BP6 sarcoma cells, even though they did not show the typical cluster formation
of a sarcoma metastasis. We suggest a potential role
b of the spleen in the signaling pathways of
cancer genesis and growth.
64
The body–tumor relations are complex and not restricted to a protective non specific immune
reaction. We are not yet fully aware of the extent nor the dimensions of the signaling systems
involved in the body tumor interactions. Putting together this piece of the puzzle will not only
help us understand why does grow “this way”, but will probably help us to know how and
where to intervene in cancer therapy.
References:
1. Valaskova Z, El-Hassoun O, Galfiova P, Jakubovsky J, Danihel L, Hulin I,
Perspective and complexity of experimental cancer study. The secrets of
tumorigenesis (To the Gupta’s, Chaffer’s and Weinberg’s “perspectives” and to the
Nurse’s “horizons”) Bratisl Lek Listy 2010; 111 (1) ) 9-12
2. Valaskova Z, Kinova S, Danihel L, Duris I, Markovicova D, Mravec B, Hulin I., The
complexity of interactions of the tumour growth process Vnitr Lek. 2009 Dec; 55(12)
:1145-58.
3. . Suleiman Massarweh, Hari Dhingra. Unusual Sites of Malignancy Case 3. Solitary
Splenic Metastasis in Lung Cancer With Spontaneous Rupture. Journal of Clinical
Oncology, Vol 19, Issue 5 (March), 2001: 1574-1575
4. F J Hoar, S-Y Chan, P S Stonelake, R W Wolverson, D Bareford Splenic rupture as a
consequence of dual malignant pathology: a case report J Clin Pathol 2003;56:709710 doi:10.1136/jcp.56.9.709
5. Cormio G, Loizzi V, Carriero C, Putignano G, Selvaggi L.Eur. Spleen involvement in
women with ovarian cancer. J Gynaecol Oncol. 2009;30 (4):384-6.
6. Valaskova Z, Lackovicova L, Vrabcova M, Bizik J, Perzelova A, Macikova I, Danihel
L, Kinova S, Buckingham T, Hulin I. Does incorporation of gene for green fluorescent
protein in BP6 fibrosarcoma tumor cells depress their intraperitoneal growth in rats?
Bratisl Lek Listy. 2009;110(3):127-32.
65
14. Esenciálne mastné kyseliny vo výžive pacientov s cystickou fibrózou
Marcela Doktorová
(všeobecné lekárstvo, 4.ročník)
Školiteľ: Ing. Igor Vozár, CSc.
Ústav lekárskej chémie, biochémie a klinickej biochémie LFUK
Úvod
Cystická fibróza (CF) je geneticky podmienené ochorenie, ktorého výskyt v európskej
populácii je 1 prípad na 2500-4500 novorodencov. [1] Ochorenie sa dedí autozomálne
recesívne a gén pre CF kóduje chloridový kanál CFTR (Cystic Fibrosis Transmembrane
Conductance Regulator). CFTR sa exprimuje v epiteliálnych bunkách dýchacích ciest,
pankreasu, pečene, čreva, potných žliaz a semenovodov. Následkom abnormálneho alebo
chýbajúceho CFTR proteínu v bunkovej membráne respiračného epitelu vzniká nadmerne
viskózny bronchiálny sekrét, ktorý zabraňuje správnej funkcii riasiniek a tým aj zhoršuje
samoočisťovaciu funkciu bronchopulmonálneho stromu. Tým sa vytvára prostredie
podporujúce prežívanie mikroorganizmov. Mutovaný CFTR je tiež príčinou nadmernej tvorby
prozápalových cytokínov a v pľúcach pacienta je prítomný chronický zápalový proces. Hustý
hlien vzniká aj v pankrease, spôsobuje jeho fibrózu a insuficienciu. CF sa prejavuje aj slaným
potom, sterilitou, poruchami glukózovej tolerancie a u novorodencov mekóniovým ileom.
Pacienti s CF majú špecifické nároky na stravovanie. U 78% pacientov s CF je
diagnostikovaná pankreatická insuficiencia. [2] Vtedy je nutné podávať pacientovi pri
každom jedle náhradu pankreatických enzýmov v tabletách. Ak by sa takto nepodporovalo
trávenie, pacient by trpel by malnutríciou. Z dôvodu pankreatickej insuficiencie, ale aj
zvýšených energetických požiadaviek organizmu pri chronickej infekcii musí byť kalorický
príjem u pacientov s CF vyšší o 30-50% oproti zdravým jedincom. To sa dosahuje najmä
pridávaním rastlinných olejov do stravy. [3]
Viaceré štúdie preukázali deficit esenciálnych mastných kyselín v sére pacientov s CF. Bolo
preukázané, že tieto abnormality nesúvisia s pankreatickou insuficienciou, či malnutríciou
a zmeny v percentuálnom zložení mastných kyselín boli zistené aj v tkanivách exprimujúcich
gén CFTR.[4] Zistilo sa, že CFTR ovplyvňuje metabolizmus mastých kyselín, cholesterolu a
sfingolipidov. [5]
Esenciálne sú pre človeka dve mastné kyseliny: k. linolová a k. linolénová. (tab.1)
Omega-6 rad mastných kyselín je nutný napr. na vytváranie eikozanoidov, zápalových
mediátorov. Omega-3 mastným kyselinám sa prisudzuje protizápalový a antiaterogénny
účinok. DHA kyselina sa výrazne uplatňuje v bunkovej funkcionalite a zníženie jej
dostupnosti má škodlivý efekt na pľúcne a pankreatické tkanivo. Preto je žiaduce prípadný
deficit, najmä omega 3 mastných kyselín, u pacientov s CF doplniť. Omega3 mastné kyseliny
sa nachádzajú okrem niektorých olejov aj v rybom tuku a doplnkoch výživy s obsahom
purifikovanej DHA a EPA. V našej práci sme sa zamerali na rastlinné oleje najmä z dôvodu
ich častej konzumácie pacientmi. V klinickej praxi je z dôvodu vyšších kalorických
požiadaviek pacientov štandardom obohacovať porciu hlavného jedla lyžicou rastlinného
66
oleja. Pri konzumácii vhodných olejov by sa mohol korigovať deficit esenciálnych mastných
kyselín v strave pacienta.
omega-9 rad
omega-6 rad
k. olejová (C18:1)
∆6-desaturáza ↓
omega-3 rad
k. α-linolénová (C 18:3, 9,12,15)
↓
k. linolová (C18:2, 9,12)
↓
k. oktadekadiénová (C18:2) k. γ-linolénová (C18:3, 6,9,12)
elongaza
↓
k. eikosadiénová (C20:2)
∆5-desaturáza ↓
k.eikosatriénová (C20:3)
k. oktadecéntriénová (C 18:4)
↓
↓
k. dihomo-γ- linolénová (C20:3) k. eikosatriénová (C 20:4)
↓
↓
k. arachidónová (C20:4)
k. eikosapentaénová (C20:5)
elongaza
↓
k. dokosapentaénová- EPA (C22:5)
elongaza
↓
∆6-desaturáza
↓
retrokonvertáza ↓
k. dokosahexaénová- DHA (C22:6)
Tab. 1: Metabolizmus esenciálnych mastných kyselín
Metodika
V práci sme stanovovali percentuálne zloženie voľných a viazaných mastných kyselín
v plazme pacientov s CF metódou plynovej chromatografie ako aj zloženie vybraných
rastlinných olejov z hľadiska obsahu esenciálnych mastných kyselín. Krv sme scentrifugovali
pri 1000ot/min 15min. Z plazmy sme pomocou zmesi izopropylalkoholu a n- hexánu (3:2)
izolovali lipidy. Po vysušení sme vzorky rozpustili v benzéne a pripravili metylestery
karboxylových kyselín. Metylestery voľných mastných kyselín sme pripravili esterifikáciou
BF3-metanolom (inkubácia 5min pri 92°C). Mastné kyseliny viazané v lipidoch plazmy sme
transesterifikovali pomocou BASE-reagentu (inkubácia 20min pri 80°C) .Vlastné stanovenie
a separáciu metylesterov sme robili na plynovom chromatografe Packard Backer, model 419
pri nasledovných podmienkach: kolóna s 10% DEGS-PS na Supelcoport, teplota kolóny
190°C, teplota injektora 275°C, teplota detektora 200°C.
Analyzovali sme vzorky plazmy šiestich detských pacientov s CF. Výsledky sme štatisticky
vyhodnotili a do výsledných tabuliek a grafov sme uviedli priemerné spektrum mastných
kyselín v sére pacienta s CF. Podobne sme postupovali pri analýze olejov- použili sme 6
olejov (slnečnicový, sójový, mandľový olej a panenský olej olivový, repkový a ľanový)
u ktorých sme predpokladali výskyt esenciálnych mastných kyselín.
67
Výsledky
Z výsledkov analýzy plazmy pacientov s CF vyplýva, že majoritné postavenie má kyselina
palmitová (28,7%), k. olejová (29,5%) a k. linolová (29,4%). V menšej miere je zasúpená
kyselina steárová (9%), k. dokosahexaénová-DHA (1%) a k. arachidónová (2,3%).
Zaznamenali sme výrazný deficit k. linolénovej, v plazme tvorila len 0,1 % z celkových
mastných kyselín.
2,306
1,037
k. palmitová
0,1
k. steárová
28,667
29,43
k. olejová
k. linolová
k. linolénová
9,027
k. DHA
29,523
k. arachidónová
Obr. 1: Percentuálne zastúpenie viazaných mastných kyselín v plazme pacienta s CF.
Stanovili sme zloženie rastlinných olejov z hľadiska mastných kyselín viazaných
v triacylglyceroloch. Slnečnicový, sójový a ľanový olej obsahoval najviac k. linolovej
(60,1%, 48,7% a 40,4%). Kyselina olejová tvorí hlavnú zložku olivového, repkového
a mandľového oleja (64,8%, 51,3% a 52,2%). Najviac kyseliny linolénovej obsahuje ľanový,
repkový a sójový olej. Preto by mali byť vhodné na doplnenie deficitu kyseliny linolénovej
u pacientov s CF.
Stanovili sme aj voľné mastné kyseliny v olejoch, ich spektrum bolo približne rovnaké ako
u viazaných. Voľnú k. linolénovú obsahoval sójový (14% zo všetkých voľných mastných
kyselín), repkový (17%) a ľanový (38%) olej. Voľná k. linolénová môže byť pre pacientov
s CF dostupnejšia, pretože ju nie je nutné enzymaticky spracovať (vzhľadom na ich
pankreatickú insuficienciu).
palmitová steárová
olejová
linolová
linolénová DHA
Slnečnicový
9,1
3,7
27,1
60,1
–––––––
0,5
Olivový panenský
15,7
2,1
64,8
15,5
1,8
0,1
Sójový
13,0
3,1
25,0
48,7
10,1
0,3
Repkový panenský 7,1
1,2
51,3
26,3
13,9
0,1
Ľanový panenský
7,8
2,4
22,7
40,4
26,7
0,1
Mandľový
7,7
2,0
52,2
38,2
0,5
0,7
Tab. 2: Percentuálne zloženie jednotlivých rastlinných olejov, viazané mastné kyseliny.
68
Diskusia
Doplnenie esenciálnych vyšších karboxylových kyselín, najmä omega 3, v strave zlepší
klinický stav pacientov, v tom sa zhodujú viaceré publikácie [1, 3]. Omega 3 mastné kyseliny
môžu mať priaznivý vplyv na chronický zápal pľuc u pacientov s CF. Preukázalo sa, že
omega 3 mastné kyseliny znižujú produkciu reaktívnych foriem kyslíka, pro-zápalových
cytokínov a podielajú sa na zmiernení zápalovej odpovede. [6]
Do výživy je preto vhodné zaradiť oleje s vysokým obsahom omega-3 mastných kyselínľanový, repkový a sójový olej. Vymenované oleje obsahujú najvyššie percento kyseliny
linolénovej vo viazanom aj vo voľnom stave.
Použitá literatúra
1. Vávrová V.: Cystická fibróza, 2006, s. 17-27,48
2. Coste TC, Deumer G, Reychler G, Lebecque P, Wallemacq P, Leal T.: Influence of
pancreatic status and sex in polyunsaturated fatty acid profiles in cystic fibrosis.
Clinical chemistry 2008, 54(2), s. 388-395
3. Sabolová G: Výživa detí a dospelých s cystickou fibrózou 2005, s. 2-10
4. Freedman SD, Blanco PG, Zaman MM a spol.: Association of cystic fibrosis with
abnormalities in fatty acid metabolism. N Engl J Med 2004, 350(6), 560-569
5. Worgall TS.: Lipid metabolism in cystic fibrosis. Curr Opin Clin Nutr Metab Care
2009, 12(2), 105-109
6. Thies F, Miles E.A., Nebe-von-Caron G, Powell J.R, Hurst T.L., Newsholme E.A.,
Calder P.C.: Influence of dietary supplementation with long-chain n-3 or n-6
polyunsaturated fatty acids on blood inflamatory cell populations and functions and on
plasma soluble adhesion molecules in healthy adults. Lipids 2001, 36(11), 1183-1193
69
15. Expresia karbonickej anhydrázy IX v nádoroch štítnej žľazy
Martina Ondríková
(všeobecné lekárstvo, 4. ročník)
Školiteľ: Prof. MUDr. Pavel Babál, CSc.
Ústav patologickej anatómie LF UK
Úvod
Malígne nádory štítnej žľazy patria k pomerne málo frekventovaným onkologickým
ochoreniam. Zo všetkých malignít predstavujú asi 1,1- 1,9 %. Medzi malígnymi chorobami
endokrinného systému sú však na prvom mieste a tvoria viac ako 90 % týchto nádorov.
Karcinómy štítnej žľazy tvoria heterogénnu skupinu malígnych nádorov, ktoré sa od seba
odlišujú anatomicky, funkčne aj svojim pôvodom. K nádorom vychádzajúcim z tyroxín
produkujúcich folikulárnych buniek radíme dobre diferencovaný folikulárny a papilárny
karcinóm, málo diferencovaný karcinóm vrátane inzulárneho karcinómu a veľmi malígny
nediferencovaný anaplastický karcinóm. Z parafolikulárnych kalcitonín tvoriacich C- buniek,
ktoré predstavujú len 0,1% tkaniva štítnej žľazy, vychádza medulárny karcinóm (1).
Medulárny karcinóm štítnej žľazy (MTC) je neuroendokrinný nádor s podielom do 5 %
všetkých karcinómov štítnej žľazy. Viac ako 25% týchto nádorov má dedičný základ
zapríčinený mutáciami v RET protoonkogéne (MEN 2A a 2B, familiárny MTC),
s autozomálne dominantným typom dedičnosti. V prípadoch sporadickej formy MTC zatiaľ
etiológia nebola úplne objasnená. Diagnostika sa opiera o imunohistochemickú detekciu
kalcitonínu, chromogranínu A, synaptofyzínu a tiež môže byť pozitívny karcinoembryonálny
antigén, TTF-1(thyroid transcription factor) a nízkomolekulové keratíny (2).
Karbonická anhydráza IX (anhydráza k. uhličitej IX, CA IX) je nedávno objavený,
membránovo- viazaný enzým, ktorý patrí do rodiny karboanhydráz, enzýmov katalyzujúcich
reverzibilnú konverziu oxidu uhličitého na bikarbonát a protón. V organizme plní niekoľko
funkcií. Podieľa sa na regulácii acidobázickej rovnováhy, zúčastňuje na medzibunkovej
komunikácii a bunkovej proliferácii. Prirodzene sa vo vysokej miere nachádza v sliznici
žalúdka, čreva a žlčových ciest. Jej abnormálna expresia sa zistila v rôznych bežne sa
vyskytujúcich nádoroch. Niekoľko štúdií poukazuje na možnú koreláciu medzi expresiou CA
IX a zvýšeným metastazovaním nádorov aj zlou prognózou. Tento enzým sa javí ako nová
potenciálna cieľová molekula pre diagnostiku aj terapiu niektorých nádorov (3,4,5,9).
Vzhľadom na absenciu podrobnejších údajov v dostupných informačných zdrojoch sme sa
sústredili na analýzu expresie tohto enzýmu v nádorových aj nenádorových procesoch štítnej
žľazy.
Materiál a metodika:
Použitý bol súbor 124 archívnych bioptických vzoriek štítnych žliaz, ktoré obsahovali 25
prípadov medulárneho karcinómu, 19 folikulárneho karcinómu, vrátane 5 vzoriek
folikulárneho karcinómu s onkocytárnou premenou, ďalej 28 prípadov papilárneho
70
karcinómu, z nich 8 prípadov folikulárneho variantu papilárneho karcinómu, 20 prípadov
folikulárneho adenómu,12 prípadov Hashimotovej choroby, 8 Graves-Basedowovej strumy a
12 vzoriek normálnej štítnej žľazy vrátane difúznej alebo uzlovej strumy. Tkanivové rezy
5µm hrubé sme odparafínovali a rehydratovali.
Pri imunohistochemickej detekcii expresie CA IX sme použili monoklonálnu protilátku proti
karboanhydráze IX (dar prof. Pastorekovej, Virologický ústav SAV) a detekčný systém En
Vision (DAKO) podľa inštrukcií výrobcu. Reakcia bola vizualizovaná diaminobenzidínom
(DAKO) a vyhodnotená vo svetelnom mikroskope AXIOSKOP 40 (ZEISS).
Výsledky:
V kontrolnej vzorke svetlobunkového karcinómu obličky sa ukázala silná cytoplazmová a
membránová pozitivita v nádorových bunkách. Zo všetkých nami vyšetrovaných vzoriek
štítnej žľazy sme pozorovali histochemickú pozitivitu CA IX v 22 prípadoch medulárnych
karcinómov (obr.1a). V tkanive normálnej štítnej žľazy ako aj v strumách, adenómoch
a v ostatných karcinómoch proteín karboanhydrázy IX nebol identifikovaný (obr.1 b,c).
Negatívne kontroly s vynechaním primárnej monoklonálnej protilátky nevykázali žiadnu
pozitivitu.
Obrázok 1. Expresia karbonickej anhydrázy IX v nádoroch štítnej žľazy. Medulárny karcinóm
(a) ukazuje membránovú expresiu proteínu enzýmu s maximom na vzdialených miestach od
strómy (šípky). Folikulárny karcinóm (b) aj papilárny karcinóm (c) nevykazujú detegovateľnú
prítomnosť proteínu karboanhydrázy IX. Anti-CA IX, avidin-biotin-peroxidáza,
diaminobenzidin, 200 x.
71
Diskusia:
V posledných rokoch sa častejšie začali objavovať práce predstavujúce anhydrázu kyseliny
uhličitej IX ako perspektívny nádorový marker a potenciálny terapeutický cieľ. V dostupných
zdrojoch sú údaje o relatívne vysokej expresii v tumoroch vychádzajúcich z tkanív, ktoré za
normálnych okolností tento proteín neobsahujú. Patria sem karcinómy prsníka, krčka
maternice, obličiek, pľúc, a ďalšie, pričom nápadne vysoká pozitivita bola zistená medzi
vzorkami karcinómov krčka maternice, renálnych a pľucnych karcinómov (4). V renálnych
karcinómoch je zvýšená expresia asociovaná so svetlobunkovým karcinómom obličky (9).
Rozsiahla štúdia karcinómov prsníka dokumentovala CA IX pozitivitu v 26% sledovaných
prípadov (6). Pri štúdiu karcinómov hrubého čreva sa tak isto potvrdila zvýšená expresia CA
IX. Z týchto nádorov vykazoval najmarkantnejší vzostup expresie hereditárny nonpolypózny
kolorektálny karcinóm (7). Je zaujímavé, že v karcinómoch tkanív, ktoré normálne exprimujú
karbonickú anhydrázu IX (žalúdok, žlčník), bola pozorovaná redukcia stupňa jej expresie
oproti zdravému tkanivu (4).
Nádory endokrinných žliaz neboli doteraz podrobnejšie preštudované. Z tohto pohľadu sú
naše výsledky vysokého stupňa expresie karboanhydrázy IX v medulárnom karcinóme štítnej
žľazy pozoruhodné, osobitne vzhľadom na vysoké percento nádorov s expresiou tohto
enzýmu. Z iných neuroendokrinných nádorov bola zvýšená expresia CA IX zatiaľ opísaná iba
v karcinoide čreva (8). Výsledky našej práce sú osobitné aj zistením, že karboanhydráza IX
nevykázala pozitivitu v ostatných nádorových a nenádorových ochoreniach toho istého
orgánu.
Expresia CA IX je stimulovaná hypoxiou, ktorá je typická pre nádorové mikroprostredie,
vzhľadom na nedokonalý cievny systém nádorov. Dá sa predpokladať, že cievne zásobenie
medulárnych karcinómov nebude odlišné od cievneho zásobenia ostatných karcinómov štítnej
žľazy, a aj napriek tomu je tu zásadný rozdiel v expresii karboanhydrázy IX v medulárnych
a nemedulárnych karcinómoch. Z uvedeného sa dá predpokladať, že v neuroendokrinných
nádoroch je regulácia expresie karbonickej anhydrázy IX odlišná od nádorov iného pôvodu.
Tento nález pozitivity preto môže byť nielen diagnostickým prostriedkom, ale aj špecifickým
cieľom pre terapiu medulárneho karcinómu štítnej žľazy.
V kontexte týchto konštatovaní sa otvárajú nové ciele do budúcnosti, porovnať hustotu
cievneho zásobenia rôznych nádorov štítnej žľazy a analyzovať transkripciu génov
kódujúcich anhydrázu kyseliny uhličitej IX v nádoroch štítnej žľazy.
Práca bola podporená projektom Ministerstva zdravotníctva Slovenskej Republiky
"Diagnostické problémy chobôb štítnej žľazy - nové trendy v molekulovej diagnostike", pod
číslom 2006/23-UK-02.
Literatúra:
1. Podoba J, Králik R, Borovičová F. et al.: Štandardné postupy v manažmente
karcinómu štítnej žľazy v Onkologickom ústave sv. Alžbety v Bratislave.Onkológia
2008;3(3):152-163.
2. World Health Organization Classification of Tumors. Pathology and Genetics of
Tumors of Endocrine Organs. Lyon, IARC Press. 2004, 86-91.
72
3. Saarnio J, Parkkila S, Parkkila AK, Haukipuro K, Pastoreková S, Pastorek J,
Kairaluoma MI, Karttunen TJ.:Immunohistochemical study of Colorectal Tumors for
Expression of a Novel Transmembrane Carbonic Anhydrase, MN/CA IX, with
Potencial Value as a Marker of cell Proliferation. American Journal of Pathology
1998;153:297-285.
4. Pastoreková S, Závada J:Carbonic anhydrase IX (CA IX) as a potencial target for
cancer therapy. Cancer Therapy 2004;2:245-262.
5. Robertson N, Potter Ch, Harris AL: Role of Carbonic Anhydrase IX In Human Tumor
Cell Growth, Survival, and Invasion. Cancer Research 2004;64:6160-6165.
6. Hussain SA, Ganesan R, Reynolds G: Hypoxia-regulated carbonic anhydrase IX
expression is associated with poor survival in patients with invasive breast cancer.
British Journal of Cancer 2007;96:104-109.
7. Niemelä AM, Hynninen P, Mecklin JP: Carbonic Anhydrase IX Is Highly Expressed
in Hereditary Nonpolyposis Colorectal Cancer. Cancer Epidemiology, Biomarkers &
Preventation 2007; 16(9):1760-1766.
8. Arvidsson Y, Bergström A, Arvidsson L, Kristiansson E, Ahlman H, Nilsson O:
Hypoxia stimulates CXCR4 signalling in ileal carcinoids. Endocrine-Related Cancer
2010;17(2):303-316.
9. Dorai T, Sawczuk IS, Pastorek J, Wiernik PH, Dutcher JP: The role of carbonic
anhydrase IX overexpression in kidney cancer. Eur J Cancer 2005; 41(18):2935-47.
73
16. Ukladanie železa v bazálnych gangliách
Autor: Iveta Gašparová
Spoluautori: Ján Gašparik , Anna Zahoranová
(všeobecné lekárstvo, 3. ročník; Biomedicínska fyzika, 3. ročník)
Školiteľ: RNDr. Martin Kopáni, PhD
Ústav patologickej anatómie LF UK, Bratislava
Úvod
Železo sa v ľudskom organizme zúčastňuje mnohých významných biologických procesov.
Tento prvok je potrebný pre normálnu erytropoézu a funkciu niektorých enzýmov. Voľné
železo je však pre človeka toxické a preto ľudský organizmus disponuje systémami
schopnými skladovať železo v netoxickej forme. S kumuláciou železa v mozgu sú spojené
niektoré neurodegeneračné choroby ako sú Alzheimerova (1), Parkinsonova (2),
Huntingtonova (3), sclerosis multiplex a amyotrofná laterálna skleróza (4,5). Železo
predstavuje najviac zastúpený kov v ľudskom mozgu. Predpokladá sa jeho účasť na syntéze
neurotransmiterov a na myelinizácií axónov. Tento prvok môžeme lokalizovať i v rámci
štruktúr mozgu, ktoré nazývame bazálne gangliá. Bazálne gangliá predstavujú zhluky sivej
hmoty vnútri hemisfér (6). Funkčne sa táto štruktúra podieľa na tlmení kôrových
i podkôrových motorických funkcií prostredníctvom inhibičného neurotransmitera kyseliny
gama-aminomaslovej.
Materiál a metódy
Vzorky
Na vyšetrenie vo svetelnom a elektrónovom mikroskope sme odobrali nekroptické vzorky
tkaniva globus pallidus z deviatich ľudských mozgov bez predchádzajúcej klinickej diagnózy
neurodegeneračnej choroby CNS.
Svetelná mikroskopia a elektrónová mikroskopia
Vzorky sme fixovali 10% formaldehydom počas 24 hodín, zaliali do parafínu a narezali
mikrotómom na 5 µm rezy. Vzorky sme farbili hematoxylínom a eozínom a Perlsovou
metódou na detekciu trojmocného železa. Vzorky sme vyšetrili svetelným mikroskopom
Eclipse E50i (Nikon, Japonsko) a rastrovacím elektrónovým mikroskopom JXA 840 A
(JEOL, Japan) s urýchľujúcim napätím 15 kV. Súčasne sme vykonali EDX analýza s
pomocou KEVEX 3205-1200 (Kevex, Valencia, Ca).
Výsledky
Pomocou svetelného mikroskopu sme vo vzorkách farbených na prítomnosť trojmocného
železa zistili veľké množstvo depozitov železa veľkosti do 5 µm okolo gliových buniek
(oligodendrocytov, obr. 1). Toto železo je prevažne lokalizované v cytoplazme, zriedkavejšie
v extracelulárnom priestore.
74
Depozity trojmocného železa sme pozorovali v lamina elastica externa v artériách aj vo
vénach (obr. 1). Ojedinele sa nachádzajú okolo ciev známky nedávneho drobného krvácania.
V lúmene ciev sme pozorovali erytrocyty, lymfocyty a niekde aj granulocyty.
Diskusia
Vzhľadom na veľkosť depozitov železa (~ 5µm) v okolí gliových buniek usudzujeme, že
železo sa nemohlo dostať do mozgu vo forme, v ktorej sme ho pozorovali vo vzorkách.
Hematoencefalická bariéra neumožňuje prestup železa vo forme konjugátov s bielkovinami
a vo forme iných väčších komplexov, ale len vo forme iónov. Predpokladáme dlhodobý
proces kumulácie iónov železa (7). Niektoré depozity železa disponujú magnetickými
vlasnosťami, čo prispieva ku kumulácii a vedie k otázke, či môže byť uložené železo
ovplyvňované vonkajším magnetickým poľom (8). Negatívnym vplyvom železa je jeho
schopnosť indukovať vznik voľných kyslíkových radikálov katalyzovaním Fentonovej
reakcie (9). Hydroxylové radikály môžu byť zodpovedné za poškodenie buniek a následne za
poruchu funkcie bazálnych ganglií (10).
Gliové bunky produkujú voľné kyslíkové radikály. Tie významnou mierou spôsobujú
uvoľňovanie železa z feritínu (11, 12). Connor a kol. (7) naznačujú, že s rastúcim vekom
môže dochádzať k zmene množstva železa v gliových bunkách, čo spolu s voľnými
kyslíkovými radikálmi môže viesť ku kumulácii železa v mozgu.
Obr. 1 Ľudsky mozog, globus pallidus. Modro zafarbené depozity odpovedajú prítomnosti
trojmocného Fe3+ okolo gliových buniek (vľavo). Niektoré gliové bunky obsahujú železo v
cytoplazme, zriedkavo v extracelulárnom priestore. Depozity trojmocného železa sme
pozorovali v lamina elastica externa v artériách aj vo vénach (vpravo). Svetelný mikroskop,
20x.
75
Zoznam použitej literatúry
1. Bishop G, Robinson SR, Liu Q, Perry G, Atwood CS, Smith MA. Iron: a pathological
mediator of Alzheimer disease, Dev Neurosci 24, 2002, 184–187.
2. Floor E. Iron as a vulnerability factor in nigrostriatal degeneration in aging and
Parkinson’s disease, Cell Molec Biol 46, 2000, 709–720.
3. Bartzokis G, Tishler TA. MRI evaluation of basal ganglia ferritin iron and
neurotoxicity in Alzheimer’s and Huntington’s disease, Cell Molec Biol 46, 2000,
821–834.
4. Ke Y, Qian Z. Iron misregulation in the brain: a primary cause of neurodegenerative
disorders, The Lancet
Neurol 2, 2003, 246–253.
5. Beard JL, Connor JR, Jones BC. Iron in the Brain, NutrRev 51, 1993, 157–170.
6. Čihák R.: Anatomie 3, Grada, 2002
7. Connor JR, Menzies SL, Martin SM, Mufson EJ. Cellular distribution of transferrin,
ferritin, and iron in normal and aged human brains. J Neurosci Res. 27(4), 1990, 595611.
8. Cranfield CG, Dawe A, Karloukovski V, Dunin-Borkowski RE, de Pomerai D,
Dobson J. Biogenic magnetite in the nematode caenorhabditis elegans. Proc Biol Sci.
271 Suppl 6, 2004, 436-439
9. Meguro R, Asano Y, Odagiri S, Li C, Shoumura K. Cellular and subcellular
localizations of nonheme ferric and ferrous iron in the rat brain: a light and electron
microscopic study by the perfusion-Perls and -Turnbull methods. Arch Histol Cytol.
71(4), 2008, 205-222.
10. Nakanishi H, Wu Z. Microglia-aging: roles of microglial lysosome- and mitochondriaderived reactive oxygen species in brain aging. Behav Brain Res. 201(1), 2009, 1-7.
11. Colton CA, Gilbert DL. Production of superoxide anions by a CNS macrophage, the
microglia. FEBS Lett. 223(2), 1987, 284-8,
12. Tanaka M, Sotomatsu A, Yoshida T, Hirai S, Nishida A.Detection of superoxide
production by activated microglia using a sensitive and specific chemiluminescence
assay and microglia-mediated PC12h cell death. J Neurochem. 63(1), 1994, 266-270
76
17. Mismatch repair enzyme expression in thyroid gland disorders
Ioannis Giannopoulos, Linda Mizun
(general Medicine, 6th year, general medicine, 3rd year)
Tutors: Prof. MUDr. Pavel Babal, PhD., MUDr. Pavol Janega
Department of Pathology, Faculty of Medicine, Comenius University in Bratislava
Introduction
Thyroid gland neoplasias are some of the most common endocrine diseases. Precise
distinction between malignant and benign lesions is difficult and is crucial for further
management of the patient and choosing the appropriate treatment. Since pure morphological
evaluation is in many cases ambiguous, there is a continuous search for detection of
additional markers that would help to make the precise diagnosis (1).
Many studies have shown the significance of DNA repair enzymes in the neoplastic
transformation of tissues. The main mismatch repair (MMR) enzymes carry the names
MSH2, MLH1, MSH6 and PMS2. Repair goes on with the interaction between two sets of
heterodimers, composed of MSH and MLH proteins. The MSH is mismatch dependent
heterodimer composed of MSH2/MSH6 and these pairs bind to base:base mismatches and
small insertion/deletion mismatches occuring during DNA synthesis. The MLH mismatch
independent heterodimers MLH1/PMS2 and MLH1/MLH3 communicate with MSH
heterodimers and they further signal for more enzymes to correct replication errors. Therefore
the absence of MMR or its incorrect function leads to increased mutation rate. In humans the
absence or mutations of either MLH1 or the MSH2 genes was found to cause a cancer
predisposition syndrome, hereditary nonpolyposis colorectal cancer. A significant proportion
of sporadic cancers are also MMR defective (2).
The aim of this study was to evaluate the possible associations between neoplastic changes in
the thyroid gland and the degree of expression of the four above named repair enzymes. To
our best knowledge this is the first study evaluating the action of mismatch repair enzymes in
the thyroid gland.
Materials and methods
A total of 24 archival biopsy specimens of thyroid gland tissue were analyzed. Samples
included the following types of lesions (n=3 of each): anaplastic carcinoma , follicular
adenoma, follicular carcinomas, follicular carcinomas with oncocytic transformation,
medullary carcinomas, papillary carcinomas, papillary carcinoma follicular variant,
Hashimoto thyroiditis, Graves disease. Samples of nodular goiter were chosen as controls.
The histological diagnosis was made by light microscopic evaluation of hematoxylin and
eosin-stained routine histopathological slides.
The 5 µm serial sections from paraffin blocks were deparaffinized and rehydrated. Antigen
retrieval was realized by heating in 10 mM citrate buffer (pH 6.0) in a pressure cooker at
120°C for 45 minutes, and 30 min cool-down. After 10 min incubation with blocking
77
solution (DAKO laboratories, Glostrup, Denmark) followed 24 hour incubation at 4°C with
anti-human MLH1, anti-MSH6 (Pharmingen, San Diego, CA); anti-Human MSH2 antibody
(Oncogene, Cambridge, MA, USA) anti-PMS2 (DAKO) antibodies in 1:100 dilution in
phosphate buffered saline (PBS, pH 7.4). The slides were washed and anti-mouse secondary
antibodies conjugated to peroxidase labeled polymer (DAKO EnVision+kit) were applied for
30 minutes and after washing the reaction was developed with DAB (DAKO). The enzyme
proteins expression was evaluated semiquantitatively in light microscope as strong, +++;
moderate, ++; weak, +; irregular weak, ±; and negative, -. Only nuclear staining was
considered specific. Slides incubated with plain buffer instead of specific primary antibodies
were considered as negative controls.
Results
Immunohistochemical positivity of all four tested enzymes was observed only in the nuclei of
cells. Localization and intensity of the reaction differed in relation to the enzyme type and the
histopathological findings. The results are summarized in table 1. A 100% moderate positivity
of MSH2 enzyme was observed in all specimens. MLH1 enzyme expression was weak and
irregular weak. There was only a mild or no reactivity detected with anti-MSH6 enzyme
antibodies. PMS2 expression was weak but consistent in Follicular, Follicular with Oncocytic
differentiation and papillary carcinoma and also in Hashimotos and Graves autoimmune
diseases. In general, follicular cells with signs of growth stimulation showed the strongest
expression. In nodular goiter, large follicles showed less positivity than the small follicles
with proliferation activity. Lymphocytes in germinal centers of lyphoid follicles showed
strong expression of all MMR enzyme proteins. Negative control slides incubated without
primary antibodies did not show any positivity.
Thyroid gland tissue
Normal thyroid gland
MLH1
+/-
MSH2
+
MSH6
-
PMS 2
-
Anaplastic carcinoma
Follicular adenoma
Follicular carcinoma
Follicular carcinoma w/oncocytic trans.
Medullary carcinoma
Papillary carcinoma
Papillary carcinoma follicular variant
++
+
+
++
++
+/-
++
+++
++
+++
+++
+++
+/+
+/+
+
++
++
++
-
++
-
+
Graves disease
+
+++
+
++
Hashimoto thyroiditis
++
+++
+
++
MMR positivity was evaluated semiquantitatively as follows: strong, +++; moderate, ++; weak, +;
irregular weak, ±; and negative, -. MSH2, MutS-homologue 2; MLH1, MutL-homologue 1; MSH6,
MutS-homologue6; PMS2, postmeiotic segregation increased 2
Table 1. Mismatch repair enzymes in various types of thyroid gland diseases
78
Discussion
The role of MMR has been extensively studied in hereditary nonpolyposis colorectal cancer
(HNPCC) (3) in head and neck squamous cell carcinoma (HNSCC) (4) and is responsible for
Turcot syndrome(5). These studies pointed at the key role of MMR in development of cancer.
The expression of four mismatch repair enzymes has been investigated on a variety of thyroid
gland lesions with tumor and non-tumor origin. Results show an over-expression of MSH2,
MLH1 and PMS2 enzymes in proliferating cells. This was seen in highly stimulated follicular
cells of all thyroid gland disorders. Studies on yeasts documented the over-expression of
MLH1 in connection to spontaneous mutagenesis (5). They suggested that MLH1 overexpression inactivates mismatch repair of replication errors. Similar over-expression of
MSH2 was found in non-small cell lung cancers(6). Abnormal functioning of p53 and MSH2
leads to deviated apoptosis and increases the chances for carcinogenesis (7). In our study the
over-expression of MMR enzymes was most pronounced in proliferating cells, in which p53
and MSH2 are highly active. This indicates that over-stimulation of follicular cells might lead
to damage in cell cycle regulation causing further deviation in cell repair, increasing the risk
for neoplastic development.
79
Opposing to the over-expressed MSH2, MLH1and PMS2 enzymes, the presence of MSH6
was low or absent. Similar findings were reported in HNPCC studies (8). To create MSH2MSH6 functional heterodimers there must be abundance of MSH6 and MSH2. Lower
expression of MSH6 may suggest decreased MSH2-MSH6 heterodimer formation resulting in
insufficient mismatch repair during proliferation. This is due to the missing prevention of
recombination between divergent DNA sequences caused by mutations (9).
Our findings of increased MMR enzyme expressions in nodular goiters, adenomas, cancers,
Graves and Hashimoto diseases support the fact that all these diseases may lead to neoplastic
development. Further studies must be done for confirmation of our preliminary results.
Clarification of the changes in MMR enzymes expression may contribute to a better
understanding of carcinogenesis in the thyroid gland.
This work was supported by Ministry of Health of the Slovak Republic under the project
„Diagnostic problems of thyroid gland diseases - new trends in molecular diagnostics“,
2006/23-UK-02
References
1. Babal P, Janega P, Cerna A., Kholova I, Brabenocova E: Neoplastic transformation of
the thyroid gland isaccompanied by changes in cellular sialylation. Acta histochem
2006; 108:133-140.
2. Shimodaira H., Yoshioka-Yamashita A., Kolodner K.R., Wang J.Y.J.: Interaction of
mismatch repair protein PMS2 and the p53-related transcription factor p73 in
apoptosis response to cisplatin. PNAS 100:2420-2425, 2003.
3. Wang XL, Yuan Y, Zhang SZ, Cai SR, Huang YQ, Jiang Q, Zheng S: Clinical and
genetic characteristics of Chinese hereditary nonpolyposis colorectal cancer families.
World J Gastroenterol 2006; 12(25): 4074-4077.
4. Sengupta S, Chakrabarti S, Roy A, Panda CK, Roychoudhury S: Inactivation of
human mutL homolog 1 and mutS homolog 2 genes in head and neck squamous cell
carcinoma tumors and leukoplakia samples by promoter hypermethylation and its
relation with microsatellite instability phenotype. Cancer 2007; 109(4): 703-712.
5. Itoh H, Ohsato K, Yao T, Iida M, Watanabe H: Turcot's syndrome and its mode of
inheritance, Gut. 1979; 20 (5): 414-419.
6. Shcherbakova VP, Hall CM,Lewis SM, Bennett ES, Martin JK, Bushel RP, Afshari C,
Kunkel AT:Inactivation of DNA Mismatch Repair by Increased Expression of Yeast
MLH1. Molecular and Cellular biology 2001;21(3):940-951.
7. Zink D, Mayr C, Janz Ch, Wiesmuller L:Association of p53 and MSH2 with
recombinative repair complexes during S phase. Oncogene 2002; 21(31): 4788-4800.
8. Xinarianos G, Liloglou T, Prime W, Sourvinos G, Karachristos A, Gosney JR,
Spandidos DA, Field JK: p53 status correlates with the differential expression of the
DNA mismatch repair protein MSH2 in non-small cell lung carcinoma. Int J Cancer
2002; 101(3): 248-252.
9. Klingler H, Hemmerle C, Bannwart F, Haidera R, Cattaruzzac M. S, Marra G:
Expression of the hMSH6 mismatch-repair protein in colon cancer and HeLa cells.
SWISS MED WKLY 2002; 132:57–63.
80
10. Kneitz B, Cohen EP, Avdiecich E, Zhu L, Kane FM, Hou H Jr, Kolodner DR,
Kucherlapati R, Pollard WJ, Edelmann W: MutS homolg 5 localization to meiotic
chromosomes is required for chromosome pairing during meiosis in male and female
mice. Genes 2000; 14(9): 1085-1097.
81
18. Vplyv oxytocínu a antagonistu oxytocínového receptora na sociálne správanie u
potkana
Ján Haršány
(všeobecné lekárstvo 3. ročník)
Školiteľ : Doc. MUDr. Daniela Ostatníková, PhD., RNDr. Silvia Kelemenová, RNDr. Ján
Bakoš, PhD.
Fyziologický ústav LFUK
Úvod
Oxytocín je hormón bielkovinovej povahy, ktorý sa tvorí v jadrách hypotalamu, konkrétne v
nc.supraopticus et paraventricularis. Cesta uvolňovania začína väzbou na neurofyzín.
Výbežkami neurónov sa dostane do neurohypofýzy a odtiaľ sa uvolní do krvného obehu.
Podnety k sekrécii sú napr. rozširovanie pôrodných ciest pri pôrode, dráždenie genitálu či
dráždenie bradaviek pri kojení. Funkcia oxytocínu je veľmi pestrá. Je zapojený do veľkého
množstva fyziologických, behaviorálnych a farmakologických účinkov. Z periférnych
účinkov sú známe najmä stimulácia ejekcie mlieka, stimulácia hladkých svalových buniek
maternice počas pôrodu, navodenie materského správania, rozličné kardiovaskulárne účinky
(3., 6.).
Nás však predovšetkým zaujímali centrálne účinky, teda vplyv na pamäť, učenie a sociálne
správanie (sociálne väzby, starostlivosť, agresivitu...) Bola vyslovená hypotéza, že sociálna
väzba vzniká ako dôsledok podmienenej asociácie medzi oxytocínom sprostredkovanou
aktivitou a vyvolávajúcim stimulom. Ako výsledok behaviorálnych skúseností bola popísaná
reorganizácia neurálnej siete, tzv. synaptická plasticita neurónov, teda schopnosť zmeny sily,
funkčnosti a efektívnosti synaptického spojenia (1.,3.)
Cieľom nášho výskumu bolo overiť vplyv neonatálne podaného oxytocínu a antagonistu
oxytocínového receptora (OXTR) na schopnosť sociálneho rozlišovania u potkanov a zistiť
vplyv oxytocínu na vybrané parametre mozgovej plasticity. Vychádzali sme z hypotézy, že
podanie oxytocínu zvýši záujem - dobu a počet sociálnych kontaktov a aj kvalitu ich
prejavov. Podanie antagonistu OXTR bude pôsobiť opačne. Podanie oxytocínu umožní
rýchlejšie/lepšie rozoznanie juvenilného potkana s dlhším trvaním pamäťovej stopy. Ďalej
stimuluje expresiu BDNF (Brain-derived neurotrophic factor), faktora podporujúceho rast
neurónov a synaptogenézu.
Materiál a metódy
Mláďatá potkana kmeňa WISTAR oboch pohlaví boli rodelené do 3 skupín.Všetkým
mláďatám bola podávaná látka 5 krát a to v dňoch 2,3,4,5,6 po narodení. Prvej skupine sme
podávali Oxytocín (50µl, 1mg/kg, i.p.), druhej skupine sme podávali antagonistu oxytocínu
Atosiban (Tractocile) (50 µl, 0,1mg/kg, i.p.) a tretej kontrolnej skupine sme podávali
fyziologický roztok (50 µl, i.p.). Vo veku 2,5 mesiaca boli potkany behaviorálne testované
testom sociálneho rozlišovania (social discrimination test) (upravený podľa prác Engelmann a
spol, 1995, 2.,4.,5.) Test prebiehal v open fielde (otvorenom poli), do ktorého boli vložené
82
dve malé klietky. Na ploche open fieldu v blízkosti a širšom okolí klietok rozoznávame
oblasti Cage1, Cage2, Okolie1, Okolie2 (Obr. 1). Ako sociálny stimulus sme použili
dvojtýždňového juvenilného potkana, ktorý bol vložený do klietok 1, 2. V 1. fáze, fáze učenia,
bol v klietke 1 umiestnený juvenilný potkan. Testovaný potkan bol do open fieldu vložený po
dobu 5 minút. Po 30 minutách nasledovala 2. fáza, testovacia fáza, v ktorej bol pôvodný
juvenilný potkan umiestnený v klietke 1 a nový juvenil v klietke 2. Testovaný potkan bol
opätovne vložený do open fieldu po dobu 5 minút.
Obr. 1. Schematické znázornenie open field-u použitého v teste sociálneho rozlišovania. V
open flielde so štvorcovou podstavou sú umiestnené dve klietky (1 a 2). Cage 1, 2 sú oblasti
zahŕňajúce klietku 1, 2 a ich bezprostredné okolie. Okolie 1, 2 sú oblasti širšieho okolia
klietok 1,2.
Na zaznamenávanie a získavanie údajov sme použili softvér ANYMAZE. Hodnotili sme
parametre kontaktu s juvenilným potkanom, teda čas strávený v oblastiach a počet vstupov do
týchto oblastí v oboch fázach pokusu. (Cage 1, 2, Okolie 1, 2). Sledovali sme vplyv
podávanej látky a/alebo pohlavia na charakter kontaktov testovaného zvieraťa s tým istým
juvenilným potkanom v prvej a druhej fáze za použitia testu RM ANOVA. Charakter
kontaktov bol kvantifikovaný ako čas strávený v oblastiach Cage 1 a Okolie 1 alebo ako počet
vstupov do týchto oblastí v jednotlivých fázach testu. V samotnom teste sociálneho
rozlišovania sme brali do úvahy len druhú fázu behaviorálneho testu. V nej sme porovnávali
charakter kontaktov testovaného zvieraťa s pôvodným juvenilom (v klietke 1) a s novým
juvenilom (v klietke 2) za použitia testu Two-way ANOVA. Charakter kontaktov bol teda
kvantifikovaný ako čas strávený v oblastiach Cage 1 vs. Cage 2 (príp. Okolie 1 vs. Okolie 2) a
počet vstupov do týchto oblastí. Počítali sme index čuchovej pamäte -diskriminačný index,
ktorý sme provonávali medzi skupinami.
Index čuchovej pamäte
83
Po skončení behaviorálneho testovania boli potkany usmrtené a bola uskutočnená analýza
expresie BDNF v ľavom hipokampe za použitia metódy ELISA. Výsledky boli štatisticky
spracované testom two-way ANOVA.
Výsledky
Vo výsledkoch sme najprv porovnávali fázu 1 verzus fázu 2, teda čas (s), počas ktorého bol
potkan v kontakte s juvenilom v danej fáze. Prehľadné výsledky uvádzame v tab č.1. Nezistili
sme štatisticky významný vplyv podávanej látky na charakter kontaktov testovaného zvieraťa
s tým istým juvenilom vo fáze učenia v porovnaní s testovacou fázou. Zistili sme však
významný vplyv pohlavia v prípade parametra počtu vstupov do oblasti Okolie 1.
Tabuľka č.1. – vyhodnotenie času kontaktov v oboch fázach
Vo fáze 2 sme hľadali rozdiel medzi pôvodným stimulom a stimulom spôsobeným novým
juvenilným potkanom.
Nezistili sme štatisticky významné rozdiely v charaktere kontaktov testovaného zvieraťa
s pôvodným vs. novým juvenilom. Ani porovnanie indexu čuchovej pamäte nebolo štatisticky
významné, vplyv podávanej látky ani pohlavia sa teda nepreukázal (Obr. 2).
Obr. 2 hodnoty indexu čuchovej pamäte
0,30
0,20
0,10
0,00
1
2
3
4
5
6
cčuIedvnohxjapmät
-0,10
-0,20
-0,30
Females Females
Ctrl
Oxytocin
Females
Tractocile
Males
Ctrl
84
Males
Males
Oxytocin Tractocile
Namerali sme, vyššiu expresiu BDNF v ľavom hipokampe u potkanov oboch pohlaví
ovplyvnených oxytocínom. P=0,003* (Two way ANOVA). Antagonista OXTR pôsobil
opačne (Obr. 3). Liečba teda signifikantne ovplyvnila hladiny BDNF.
BDNF in left hippocampus
BDNF pg/ml tissue homogenate
600
500
400
300
200
100
0
Fyziolog.
Tractocile
ma le s
Oxytocin 1 Fyziolog.
Tractocile Oxytocin
f e ma l e s
Obr.3. miera expresie BDNF v pg/ml homogenátu tkaniva ľavého hipokampu
Diskusia
Z našich výsledkov vyplýva viacero záverov. Nepodarilo dokázať vplyv podaného oxytocínu
na sociálne rozlišovanie – ako je vidieť na Obr. 2, nepozorovali sme žiadne rozdiely medzi
časovým kontaktom s novým a pôvodným juvenilným potkanom vyhodnoteným pomocou
indexu čuchovej pamäte vo fáze 2. Do budúcnosti by sme sa vyvarovali chybám, ktoré
pravdepodobne negatívne ovplyvnili očakávané výsledky. Napr. open field, teda pole v
ktorom prebiehal pokus, by malo byť a čosi menšie, ďalej by bolo vhodné pridať fázu
habituácie (potkan vložený do bludiska sa najprv oboznámi s novým prostredím a až po
určitom čase sa spustí samotný test).
Ďalší sledovaný fenomém sa nám potvrdil. Samičky strávili viac času kontaktom s
juvenilným potkanom vo fáze 1 ako samce. Tým sme ale len dokázali fakt, že samice majú vo
všeobecnosti zvýšenú mieru sociálnych interakcií v dôsledku spoluúčinkovania hormónov
oxytocínu a estradiolu.
V otázke vplyvu oxytocínu na mozgovú plasticitu -expresiu BDNF- sme zaznamenali taktiež
pozitívny výsledok. Na poslednom grafe sú signifikantné rozdiely v množstve BDNF u
potkanov, ktorým bol podaný oxytocín. Naproti tomu, jedincom s podaným antagonistom
oxytocínového receptora -Tractocile, je nižšia miera expresie v pg/ml homogenátu tkaniva
ľavého hipokampu. Tým sme dokázali jednoznačne pozitívny vplyv oxytocínu.
Podporené granami UK/430/2009, VEGA 1/0305/09.
Dakujeme prof. PharmDr. Daniele Ježovej DrSc.za možnosť uskutočniť merania BDNF na
Ustave experimentalnej endokrinologie SAV.
85
Zoznam použitej literatúry
1. Citri A, Malenka C R. Synaptic plasticity: Multiple forms, functions and mechanisms,
Neuropsychopharmacolog 2007; 8( 5): 2-9
2. Engelmann M, Wotjak CT, Landgraf R. Social discrimination procedure: an
alternative method to investigate juvenile recognition abilities in rats. Physiol Behav.
1995, 58(2):315-21.
3. Hynie S, Klenerova V. Centrální regulační úloha oxytocínu. Psychiatrie 2008;
12(Suppl. 2): 4-10.
4. Nadler JJ, Moy SS, Dold G, Trang D, Simmons N, Perez A, Young NB, Barbara RP,
Magnuson TR, Piven J, Crawley JN Automated apparatus for quantitation of social
approach behaviors in mice, Genes, Brain and Behavior . 2004, 3, 303-314.
5. Popik P, van Ree JM. Neurohypophyseal peptides and social recognition in rats. Prog
Brain Res. 1998;119:415-36. Review. PubMed PMID: 10074804.
6. V. Štrbák: Patofyziológia neurohypofýzových funkcií. In Hulín I, eds. Patofyziológia,
6.vydanie. Bratislava, SAP. 2002, 1027-1029
86
19. Vplyv korenín na oxidačné poškodenie pečene
Mojmír Ducár
(všeobecné lekárstvo, 3.ročník)
Školiteľ: prof. MUDr. Pavel Babál, CSc.1, MUDr. Pavol Janega, PhD. 1
1
Ústav patologickej anatómie LF UK
Úvod
Kurkuma, korenie získané z koreňa rastliny Cucruma longa z čeľade Zingiberacae a čierne
korenie – Piperum nigrum z čelade Piperacae sú známymi látkami v medicíne už od
staroveku, kedy sa používali v tradičnej Indickej a Čínskej medicíne. Hojne sa používajú
dodnes, najmä ako dochucovadlá potravín [2]. Kurkumín a piperín, aktívne látky izolované z
týchto korenín preukázali mnoho pozitívnych účinkov, kvôli ktorým sú predmetom
intenzívneho bádania v posledných rokoch. Boli dokázané ich antioxidačné a proti-zápalové
účinky [2, 4], redukujú krvnú hladinu cholesterolu, potláčajú trombózu, znižujú riziko
myokardiálnych infarktov. Pozitívny účinok preukázali pri mnohých chronických
chororobách v ktrorých hrá rozhodujúcu úlohu zápal , ako sú Alzheimerova choroba,
Parkinsonova choroba, epilepsia, sclerosis multiplex, reumatoidná artritída, ako aj v prevencii
nádorových chorôb [2, 3].
Už v minulosti bol opísaný hepatoprotektívny účinok týchto tátok [4, 6, 7]. V
predchádzajúcich experimentoch bolo preukázané, že dlhodobé podávanie prírodných látok
zabraňuje vzniku poškodenia pečene pri intoxikácii tetrachlórmetánom [9]. Tetrachlórmetán
a iné hepatotoxíny spôsobujú steatózu a fibrózu pečene v dôsledku nadmernej tvorby voľných
radikálov, ktoré následne vedú k lipoperoxidácii membrán, zvyšujú syntézu a esterifikáciu
tukov a spôsobujú nekrózu buniek [1, 5]. Cieľom predkladanej štúdie bolo overiť
hepatorpotektívny účinok kurkumínu a piperínu v modeli akútneho preťaženia pečene
voľnými radikálmi pri intoxikácii tetrachlórmetánom.
Materiál a metódy
Experimentálne potkany, samce kmeňa Wistar vo veku 3 mesiacov v počte 33 kusov sme
rozdelili do 6 skupín: 1. kontrolná skupina (5 zvierat), 2. kontrolná skupina s podávaním
kurkumínu (v počte 2 zvieratá), 3. kontrolná skupina s podávaním piperínu (v počte 2
zvieratá), 4. intoxikovaná skupina dostávala CCl4 subkutánne zmiešaný s kukuričným olejom
v pomere 1:1 v dávke 1ml/kg/deň počas 3 dní (v počte 8 zvierat), 5. intoxikovaná skupina so
súčasným podávaním kurkumínu (v počte 8 zvierat), a 6. intoxikovaná skupina so súčasným
podávaním piperínu (v počte 8 zvierat). Kurkumín bol podávaný v dávke 100mg/kg/deň,
piperín v dávke 20mg/kg/deň v suspenzii v kukuričnom oleji. Obe látky dostávali zvieratá raz
denne 4 dni pred intoxikáciou CCl4 a počas nej intragastrickou sondou. Po poslednej dávke
CCl4 boli zvieratá utratené predávkovaním anestetika tiopentalu.
Vzorky pečene boli fixované 24 hodín 10% formalínom, zaliate do parafínu a štandardné
histologické rezy boli ofarbené hematoxylínom a eozínom. Histologické zmeny boli
hodnotené vo svetelnom mikroskope Leica DM2000 (Wetzlar, Germany) s digitalizačným
87
zariadením (Canon S50, Japan). Miera steatózy pečene bola následne kvantifikovaná
morfometricky. Z každého preparátu bolo urobených 10 náhodných, neprekrývajúcich sa
fotografií parenchýmu pečene bez prítomnosti veľkých ciev, pri štandardnom osvetlení
a zväčšení 200x. Morfometrickým programom ImageJ bola určená plocha prázdnych
priestorov typických pre steatózu pečene. Následne sme vypočítali jej percento k celkovej
hodnotenej ploche u každého preparátu. Výsledok bol hodnotený štatisticky prostredníctvom
ANOVA testu a vyjadrený ako percento v porovnaní s kontrolnou skupinou zvierat (100%) ±
smerodajná odchýlka merania.
Výsledky.
Samotné podávanie kurkumínu alebo piperínu neviedlo k histologickým zmenám v tkanive. U
potkanov, ktorým bol podávaný tetrachlórmetán sa vyvinula drobnokvapôčková, ložiskovo
veľkovakuolárna steatóza (obr.1). Pozorovali sme prítomnosť apoptotických buniek, ale bez
prítomnosti tkanivovej nekrózy. Podávanie kurkumínu ako aj piperínu viedlo k poklesu
plochy veľkovakuolárnej steatózy (tab.1) a (obr.1).
Podávanie tetrachlórmetánu zvýšilo mieru steatózy na 125,16% ± 4,5 % v porovnaní s
kontrolnými zvieratami. Súčasné podávanie kurkumínu resp. piperínu viedlo k poklesu tohto
podielu na kontrolnú úroveň: 98,68 ± 4,04 % respektíve 88,82 ± 3,03 %.
Graf 1: Podávanie kurkumy (KK) a piprerínu (KP) neviedlo u kontrolných skupín zvierat
k signifikantným zmenám steatózy v porovaní s kontrolou bez podávania korenín (K).
Aplikácia tetrachlórmetánu signifikantne zvýšila steatózu k pečeni (I). Súčasné podávanie
kurkumy (IK) resp. piperínu (IP) zabránilo tomuto vzostupu.
88
Vzorka % Bielej plochy
K
100 ± 4,73
KK
88,04 ± 6,57
KP
109,47 ± 5,86
I
125,16 ± 4,5 *
IK
98,68 ± 4,04 #
IP
88,82 ± 3,03 #
Tab.1: Vzorka K – kontrola, KK – kontrola + kurkumín, KP – kontrola + piperín, I – CCl4, IK
– CCl4 + kurkumín, IP – CCl4 + piperín. * p<0,001 v porovnaní s K, # p<0,001 v porovnaní
sI
Obr.1: Kontrolné zvieratá (1) bez nálezu steatózy, len na niektorých miestach s mierne
rozšírenými sínusmi – 45,73%. U zvierat intoxikovaných CCl4 (2) nachádzame obraz
veľkovakulárnej steatózy pečene (elipsy) – 179,11%. Súčasné podávanie kurkumínu (3) –
89
71,2% resp. piperínu (4) – 49,3% viedlo k signifikantnému poklesu plochy steatózy v pečeni.
Farbené hematoxylínom a eozínom, zväčšenie 200x.
Diskusia
Výsledky našej štúdie podporili hepatoprotektívny účinok pôsobenia kurkumínu a piperínu na
pečeň poškodenú akútnym oxidačným stresom. Účinky korenín v prevencii poškodenia
pečene boli predmetom štúdia aj v minulosti. Samuhasaneeto a spol. [4] pozorovali pozitívny
účinok kurkumínu na prevenciu vzniku hepatopatie pri chronickej intoxikácii etanolom.
Podávanie kurkumínu vo vysokých dávkach (až 800mg/kg) zabránilo vzniku steatózy pečene
hodnotenej semikvantitatívne. Mechanizmus účinku etanolu je podobný ako tetrachlórmetánu,
pretože obe látky sú metabolizované v pečeni rovnakým izoenzýmom cytochrómu P450
CYP2E1 [10]. Náš experiment preukázal že kurkumín, pôsobí ako účinné hepatoprotektívum
už v nižších dávkach. Ako účinná sa ukázala už dávka 100mg/kg. Vychádzame z
predpokladu, že protektívny účinok kurkumínu súvisí s jeho antioxidačnými vlastnosťami.
Kurkumín má ako jeden z mála antioxidantov zároveň fenolovú a beta-diketónovú skupinu,
ktoré obe fungujú ako vychýtávače voľných radikálov [9]. Nižšie dávky kurkumínu (30mg/kg
) už v experimente nedosahujú dostatočnú účinnosť [6]. Je možné, že tento nález súvisí
s vysokou dávkou tetrachlórmetánu (1,25 ml/kg) použitou autormi, ktorá už po jednej dávke
vyvolala vznik pečeňových nekróz. Tieto sme v našom v experimente nepozorovali.
Antioxidačné vlastnosti piperínu potvrdili Singh a spol. [5]. Dokázali, že tieto účinky stúpajú
priamoúmerne s veľkosťou dávky, sú však slabšie v porovnaní s kurkumínom a inými
antioxidantmi. Keďže sme nepozorovali výraznejšie rozdiely medzi hepatoprotektívnym
účinkom piperínu a kurkumínu, predpokladáme, že tento účinok nesúvisí len
s antioxidačnými vlastnosťami, ale môžu byť ovplyvňované aj ďalšie regulačné dráhy
v bunke, vrátane apoptózy. Úloha týchto mechanizmov bude predmetom ďalšej štúdie
v budúcnosti.
Dôležitou otázkou zostáva minimálna dávka korenín potrebná na ich priaznivý účinok v
experimente [3]. Podarilo sa nám štandardizovať model akútneho hepatálneho poškodenia bez
vzniku tkanivových nekróz, ako aj overiť účinnosť nízkych dávok korenín. Ide o vhodný
model akútneho poškodenia pečene na štúdium účinku hepatoprotektívnych látok
v budúcnosti.
Podporené čiastočne grantom VEGA 1/0524/08.
Zoznam použitej literatúry
1. Emanuel Rubin, M.D., John L. Farber, M.D.: Pathology, Philadelphia, J. B. Lippincott
Company. 1988, 25-26, 754-760, 782-784.
2. Hideji Hideji Itokawa, Qian Shi, Toshiyuki Akiyama, Susan L Morris-Natschke and
Kuo-Hsiung Lee: Recent advances in the investigation of curcuminoids. Chinese
Medicine 2008; 3:11.
3. Bharat B. Aggarwal and Kuzhuvelil B. Harikumar: Potential Therapeutic Effects of
Curcumin, the Anti-inflammatory Agent, Against Neurodegenerative, Cardiovascular,
Pulmonary, Metabolic, Autoimmune and Neoplastic Diseases. Int J Biochem Cell
Biol. 2009; 41(1): 40-59.
4. Suchittra Samuhasaneeto, Duangporn Thong-Ngam, Onanong Kulaputana,
Doungsamon Suyasunanont, and Naruemon Klaikeaw: Curcumin Decreased
90
Oxidative Stress, Inhibited NF-κB Activation, and Improved Liver Pathology in
Ethanol-Induced Liver Injury in Rats. Journal of Biomedicine and Biotechnology
2009; 10:8.
5. Rasha S. A. Ismail, Ashraf A. A. El-Megeid, Aly R. Abdel-Moemin: Carbon
tetrachloride-induced liver disease in rats: the potential effect of supplement oils with
vitamins
E and C on the nutritional status. German Medical Science 2009; 7:10.
6. Ramnik Singh, Narinder Singh, B.S. Saini, and Harwinder Singh Rao: In vitro
antioxidant activity of pet ether extract of black pepper. Indian J Pharmacol. 2008
August; 40(4): 147–151.
7. Murat Bilgin H, Atmaca M, Deniz Obay B, Ozekinci S, Taşdemir E, Ketani A.:
Protective effects of coumarin and coumarin derivatives against carbon tetrachlorideinduced acute hepatotoxicity in rats. Exp. Toxicol Pathol. 2010.
8. P. Babál, V. Kristová, A. Černá, P. Janega, O. Pechánová, L. Danihel, R.
Aandriantsitohaina: Red wine polyphenols prevent endothelial damage induced by
CCl4 administration.
9. Janega P., Černá A., Pecháňová O., Zenebe W., Babál P.: Can red wine polyphenols
have protective effect on liver damage? Phys Res 2003; 52(6): 53P.
10. Osawa T, Sugiyama Y, Inayoshi M, Kawakishi S: Antioxidant activity of
tetrahydrocurcuminoids. Biosci Biotechnol Biochem 1995, 59:1609-1612.
91
20. Účinok ubichinolonu na mitochondrie mozgu Alzheimerovej choroby
Martin Tkačov
(Biomedicínska fyzika, 3.ročník)
Školiteľ: Doc. RNDr. Anna Gvozdjáková, DrSc.
Univerzita Komenského v Bratislave, Farmakobiochemické laboratórium III. Internej kliniky
Sasinkova 4, Bratislava
Úvod
Alzheimerova choroba (AD) je najčastejším typom stareckej demencie, ktorá postihuje ľudí
vo vyššom veku. AD je neliečiteľné, progresívne, neurodegeneratívne ochorenie, prvý krát
popísané Aloisom Alzheimerom v roku 1906. Klinické prejavy tejto choroby môžu byť
u jednotlivých ľudí individuálne, ale môžeme nájsť aj spoločné znaky. K prvým príznakom
patrí strata pamäte. AD pacienti si len ťažko pamätajú nedávno naučené veci a vypadáva im
krátkodobá pamäť. Postupom choroby sa pridávajú ďalšie príznaky ako zmätenie, nervozita,
agresia, náladové stavy a výpadky dlhodobej pamäte. V poslednom štádiu začínajú vypovedať
telesné funkcie, čo vedie k úmrtiu jedinca [1].
AD je charakteristická tvorbou proteínov – biomarkerov, ako sú amyloid-beta (Aβ) a tau
proteín, presenilín 1 a presenilín 2. Hromadenie Aβ spôsobuje nárast tvorby voľných
radikálov kyslíka a dusíka, ktoré prispievajú k poškodeniu mitochondriálneho respiračného
reťazca. Narastajúce poškodenie mitochondrií voľnými radikálmi a postupné znižovanie
tvorby koenzýmu Q10 (CoQ10) spôsobuje dysfunkciu mitochondrií, čo vedie k nedostatku
energie v bunkách mozgu AD. Energetický nedostatok je ďalším charakteristickým prejavom
tejto choroby. Zobrazovanie pozitrónovou emisnou tomografiou v kombinácií s 18F-2-deoxy2-fluoro-D-glukózou ukázalo pokles o 21-28% vychytávania a využitia okolitej glukózy
v mozgu AD pacientov oproti kontrole [2]. K hlavným zložkám respiračného reťazca
mitochondrií patrí CoQ10, u ktorého bol dokázaný pokles tvorby s narastajúcim vekom hlavne
vo veku nad 40 rokov [3]. CoQ10 má antioxidačné vlastnosti, v organizme sa vyskytuje v tzv.
Q-cykle, vo forme ubichinón (oxidovaný CoQ10), ubichinol (redukovaný CoQ10)
a semichinón (CoQ10 radikál) [4]. Doplnková terapia s CoQ10 spomaľuje starnutie, zlepšuje
pamäť, znižuje riziko srdcových chorôb a výskyt mozgového infarktu [5].
Cieľ:
Zistiť účinok ubichinolu na funkciu mitochondrií mozgu v experimentálnom modeli
mitochondriálnej Alzheimerovej choroby (MAD).
Materiál a metódy
Experimentálne zvieratá: potkany kmeňa Wistar (16 mesačné). Experimentálny model
Alzheimerovej choroby bol vyvolaný oklúziou troch ciev (3-VO), ktorý predstavuje akútne
ischemicko/reperfúzne poškodenie. Počet potkanov v každej skupine bol medzi 8 a 13.
Skupiny boli tri. 1. C – kontrolná skupina bez zákroku. 2. IR – ischemicko/reperfúzna skupina
92
(50 minutová ischémia). 3. IR + Q10-red (ubichinol) skupina. Potkany dostávali denne 200 mg
Q10-red / kg hmotnosti, počas 30 dní. V izolovaných mitochondriách mozgu sme stanovili
parametre oxidačnej fosforylácie použitím kyslíkovej Clarkovej elektródy (RCI – respiračný
kontrolný index, ADP:O – koeficient oxidačnej fosforylácie, stav S3 – rýchlosť spotreby
kyslíka mitochondriami pri stimulovanom dýchaní s ADP, stav S4 – rýchlosť spotreby kyslíka
mitochondriami pri pokojovom dýchaní bez ADP, OPR – rýchlosť tvorby ATP). HPLC
metóda bola použitá na stanovenie hladiny CoQ9-OX a CoQ10-OX. K štatistickému
vyhodnoteniu výsledkov sme použili Kruskal-Wallisov test.
Výsledky.
V experimentálnom modeli MAD bola signifikantne znížená kapacita respiračného reťazca
v mitochondriách mozgu a ATP tvorba v komplexe I a II, iba respiračný kontrolný index
(RCI) bol stimulovaný. Účinok ubichinolu signifikantne stimuloval funkciu mozgových
mitochondrií, ADP:O, stav S3, tvorbu ATP na úrovni I. a II. komplexu [tab. 1], ako aj
koncentráciu CoQ9-OX a CoQ10-OX v experimentálnom modeli MAD.
Complex I (glut/mal)
RCI (S3/S4)
ADP:O
(nmol
ADP:nAtO)
S3
(nmol
ADP/mg
prot/min)
S4
(nmol
ADP/mg
prot/min)
OPR (nmol ATP/mg
prot/min)
Kontrola
3,18 ± 0,22
IR
4,65 ± 0,23
IR+Q10-red
4,94 ± 0,30
%
6,24
2,80 ± 0,04
2,50 ± 0,06
2,68 ± 0,09
7,20
68,26 ± 4,37
45,67 ± 4,66
56,86 ± 7,47
24,50
Complex II (jantaran)
RCI (S3/S4)
ADP:O
(nmol
ADP:nAtO)
S3
(nmol
ADP/mg
prot/min)
S4
(nmol
ADP/mg
prot/min)
OPR (nmol ATP/mg
prot/min)
Kontrola
1,74 ± 0,08
IR
1,80 ± 0,05
IR+Q10-red
1,94 ± 0,07
%
7,78
1,50 ± 0,02
1,39 ± 0,03
1,30 ± 0,05
-6,47
90,58 ± 7,99
60,55 ± 4,99
77,05 ± 8,43
27,25
21,25 ± 1,79 10,22 ± 1,10 12,56 ± 2,30 22,90
185,26
± 115,24
± 158,84
±
16,48
12,52
24,35
37,83
51,82 ± 3,99 33,56 ± 2,72
132,28
±
11,09
84,59 ± 8,26
41,82 ± 5,37 24,61
105,72
±
13,84
24,98
Tabuľka 1: RCI – respiračný kontrolný index, ADP:O – koeficient oxidačnej fosforylácie,
stav S3 – rýchlosť spotreby kyslíka mitochondriami pri stimulovanom dýchaní s ADP, stav S4
– rýchlosť spotreby kyslíka mitochondriami pri pokojovom dýchaní bez ADP, OPR –
rýchlosť tvorby ATP, IR – ischemicko/reperfúzna skupina, IR+Q10-red – IR + ubichinol
skupina, % – percentuálny rozdiel IR+Q10-red ku IR.
93
Diskusia
Degenerácia neurónov môže byť zahrnutá v množstve neurodegeneratívnych chorôb, ku
ktorým patrí aj AD [6]. Dysfunkcia mitochondrií mozgu a poškodenie tvorby energie v nich,
patria k hlavným terčom Aβ proteínov v neurónoch. V súčasnom období sa hľadajú nové
terapeutické postupy, ktoré by zabránili vzniku a rozvoju AD. Jedným z nich je aj doplnková
terapia s koenzýmom Q10.
V tejto štúdii sme dokázali priaznivý účinok ubichinolu na oxidačnú fosforyláciu
mitochondrií mozgu v experimentálnom modeli MAD, čo sa prejavilo zvýšenou tvorbou
ATP, zlepšením funkcie mitochondrií a zvýšením koncentrácie CoQ10 v mitochondriách
mozgu. Predpokladáme, že dlhodobé užívanie CoQ10 v počiatočnom štádiu AD môže
spomaliť, prípadne zastaviť vývoj AD ochorenia u ľudí.
Poďakovanie: PharmDr. J. Kucharskej, PhD. za stanovenie CoQ, doc. MUDr J.
Horeckému, DrSc. za vyvolanie MAD, A.. Štetkovej za technickú pomoc, Doc. RNDr. I.
Waczulíkovej, PhD. a MSc. P. Slezákovi za pomoc pri štatistickom vyhodnocovaní výsledkov.
Štúdia bola podporená grantom Ministerstva školstva VEGA č. 1/0328/10 a Fy TISHCON
Corp., USA. (Li-QHR – lipozomálny ubichionol).
Zoznam použitej literatúry
1. http://en.wikipedia.org/wiki/Alzheimer%27s_disease
2. Atamna H, Frey H. V: Mechanisms of mitochondrial dysfunction and energy
deficiency in Alzheimer’s disease. Mitochondrion, 200 7, 7: 297–310
3. Rhen V, Baysang G, Rao S, Meier F, Bonert A, Mueller-Spahn F, Eckert A: Amyloidbeta leads to impaired cellular respiration, energy production and mitochondrial
electron chain complex activities in human neuroblastoma cells. Cell Mol Neurobiol,
2009, 29:1063-1071.
4. http://en.wikipedia.org/wiki/Coenzyme_Q10
5. Horecký J, Vančová O, Kuchárska J, Gvozdjáková A: Coenzyme Q10 supplementation
in an experimental model of Alzheimer`s disease. In: Mitochondrial Medicine, ed. A.
Gvozdjáková, Springer (Netherlands) 2008: 335-337.
6. Beal MF: Mitochondria take center stage in ageing and neurodegeneration. Ann
Neurol, 2005, 58(4): 495 – 505.
94
21. Inervácia ľudského apendixu
Katarína Galliková, Ján Dzuracký
(všeobecné lekárstvo, 3.ročník)
Školiteľ: prof. MUDr. Ján Jakubovský, DrSc.1, doc. MUDr. Eliška Kubíková, PhD. 2
1
Ústav patologickej anatómie LF UK, 2Anatomický ústav LF UK
Úvod
Nervové zásobenie ľudského apendixu je z anatomického hľadiska pomerne dobre známe
(Mráz et al. 2003, Moses et al. 2005). Štúdium jemnej inervácie sa stáva náročným hlavne
vtedy, keď chceme zistiť podrobnejšie informácie. V ostatných rokoch je stále viac
ventilované inervovanie lymfatického tkaniva. Zobrazenie inervácie bežne spočíva najmä v
striebriacich metódach. Sú veľmi citlivé na čistotu používaného skla, aj roztokov. Ďalšie
možnosti poskytuje formolom, alebo kyselinou glyoxylovou nabudená fluorescencia
katecholamínov (Danihel a Brozman 1983, Danihel et al 1985, Heusermann 1988).
Enzymohistochemický dôkaz aktivity 5'-nukleotidázy, ATPázy a acetylcholínesterázy sú
ďalšie možnosti znázornenia periférneho nervového systému (Heusermann 1988). Tieto
metódy sú pomerne nešpecifické. Súčasné metódy identifikácie zložiek centrálneho a
periférneho nervového systému spočívajú hlavne v imunohistochemických metódach.
Databáza PubMed.com v ostanej dobe eviduje nárast publikácií o identifikácii zložiek
nervového systému protilátkami proti enoláze špecifickej pre neuróny, S100 proteínu,
kyslému gliovému fibrilovému proteínu. Databáza údajov PubMed napodiv neeviduje
použitie týchto protilátok v štúdiu inervácie ľudského appendix vermiformis.
Enoláza špecifická pre neuróny je glykolýzový izoenzým známy v centrálnych, v periférnych
neurónoch aj v neuroendokrinných bunkách. S100 proteín reguluje rôznorodé funkcie bunky.
Nie je celkom špecifický pre nervový systém. Kyslý gliový proteín (GFAP) a neurofilamentá
sa podieľajú na cytoskelete.
Cieľ práce
Špecifickými protilátkami proti GFAP, S100, NSE a NF opísať inervovanie steny ľudského
apendixu.
Materiál a metódy
Histologické rezy z desiatich biopsií z ľudského appendix vermiformis s appendicitis simplex
až appendicitis flegmonosa, spracovaných zvyčajnou formolovo-parafínovou technikou sme
farbili s hematoxylínom a eozínom. Imunohistochemicky sme prítomnosť uvedených
protilátok dokazovali metódami podľa tab. 1
95
Primárna protilátka
Anti
NSE
monoklonov
á
myšia ab
Dodávateľ
DAKO
Klon
BBS/NC/VIH14
Izotyp
IgG1, κ
Katalógové číslo
Μ 0873
Používané riedenie s PBS, pH 7,4
1:50
Odparafínovanie
áno
Blokovanie 0,3% roztokom H2O2 v dest. áno
vode 10 min.
Revitalizácia
natrávením
Dako 5 minút
proteinase K
Opláchnutie s PBS, pH 7,4
1 min.
Revitalizácia: teplom
indukovaného Áno, pH 6,2
epitopu v DakoCytomation target
retrieval
solution
30min.
v
chladenom citrátovom tlmivom roztoku
Opláchnutie s PBS, pH 7,4
1minútu
Blokovanie
vo
vlhkej
komôrke áno
s DAKOCytomations peroxidase block,
5 min
Opláchnutie s PBS, pH 7,4
3 x 5 minút
Inkubácia primárnej protilátky, vo 1 h
vlhkej komôrke pri izbovej teplote
Opláchnutie s PBS, pH 7,4 3x5 minút
áno
TM
Inkubácia: En Vision + /HRP kit, 30 30 s. – 5
min vo vlhkej komôrke
min.
Oplach
s H20,
dofarbenie jadier áno
Mayerovým hematoxylínom 5 – 10 sec.
Opláchnutie vodou 1 min
áno
Vysušenie a montáž
Cez xylén
do entelanu
Anti S 100
polyklonov
á králičia
ab
DAKO
NF
monoklon
ová
myšia ab
DAKO
2F11
GAFP
polyklono
vá králičia
ab
DAKO
Z 0311
1:300
áno
áno
IgG1, κ
M 0762
1:50
áno
áno
Z 0334
1:500
áno
áno
5 minút
5 minút
5 minút
áno
Áno,
6,8
áno
pH Áno,
6,0
áno
pH Áno,
6,8
pH
áno
áno
áno
áno
áno
áno
áno
1h
áno
1h
áno
0,5 h
áno
áno
áno
áno
áno
áno
áno
áno
áno
áno
Cez xylén
do
entelanu
áno
Cez xylén
do
entelanu
áno
Cez xylén
do
entelanu
Tab. 1. Prehľad použitých imunohistochemických metód.
Výsledky
S-100 reakčný proteín (Haan et al. 1982)
S protilátkami proti S-100 proteínu reagujú jemné vlákna okolo gangliových buniek v oboch
vrstvách svaloviny. S protilátkou reaguje aj cytoplazma buniek glie. V stene appendix
vermiformis sú jemné S-100 pozitívne vlákna, a malé zhluky buniek s S-100 pozitívnou
cytoplazmou. Polymorfonukleárne granulocyty (PMNG) a stredne veľké lymfocyty
96
s protilátkou nereagujú. V seróze vidno široké lymfatické cievy, ktorých endotel je občas
slabo S-100 pozitívny. V svalovine s S-100 protilátkami gangliové bunky nereagujú. V ich
zhlukoch je však vidno iné bunky s pozitívnou cytoplazmou a prierezy vlákien v centre S-100
negat. Podsliznicové tkanivo obsahuje jednotlivé S-100 pozitívne nervové vlákna a bunky.
Lymfatické folikuly so zárodkovými centrami obsahujú S-100 pozitívne výbežky cytoplazmy.
Okrem nápadne pozitívnej cytoplazmy zhluknutých buniek vidno menšie bunky s rôznou
intenzitou reakcie. Časť z nich predstavujú retikulové bunky, časť z menších, slabšie
reagujúcich buniek tvoria PMN. V lamina propria mucosae klkov vidno hojné S-100
pozitívne bunky.
Kyslý gliový vláknový proteín (Glial fibrillar acid proteine, GFAP, Maunoury et al. 1977)
GFAP pozitívne nervové vlákna sú v celej stene apendixu. Gangliové bunky sú GFAP negat,
obkľúčené s GFAP pozitívnymi vláknami. V presiaknutej seróze vidno rôzne mononukleárne
bunky, aj PMNG, ktoré s anti-GFAP nereagujú. Nervové vlákna reagujú aj vo flegmónou
postihnutej stene apendixu. V okolí lymfatických folikulov v submukóze GFAP pozitívne
reagujúce vlákna nevidno. Mimo nich vidno krátke segmenty vlákien, reagujúcich s antiGFAP protilátkami. Okolo ciev submukózy a v lamina propria mucosae GFAP pozitívne
vlákna prítomné.
Neurofilamenty (NeuroFilaments, NF, Terenghi et al. 1984)
Protilátky proti neurofilamentám reagujú s nervovými vláknami vo vonkajšej, tiež vo
vnútornej vrstve hladkej svaloviny appendix vermiformis medzi bunkami hladkého svalu (obr.
2). Lymfoidné tkanivo v stene appendix vermiformis neobsahuje neurofilamenty.
Enoláza špecifická pre neuróny (NeuronSpecific Enolase, NSE, Carley a Polak 1984, Gu
et al. 1981)
Protilátky proti NSE nereagujú so štruktúrami v seróze appendix vermiformis. Vo vonkajšej
vrstve svaloviny pod serózou je vidno veľmi hrubé, intenzívne reagujúce pozdĺžne rezané
vlákna. V nich občas vidno jemnú tubulovú štruktúru. V lymfoidnom tkanive lamina propria
mucosae sú zhluky pozitívne reagujúcich hmôt, aj vretenové, či iné, menej pravidelné bunky
s dobre reagujúcou cytoplazmou. Pozitívne gangliové bunky sú aj v seróze. Medzi hladkou
svalovinou sú občas veľké zhluky gangliových buniek s intenzívne reagujúcou cytoplazmou.
V lamina propria mucosae sú občas malé lymfové folikuly aj so zárodkovými centrami. V ich
tesnej blízkosti sú pozitívne reagujúce vlákna. Tie sa často prepletajú aj medzi lymfoidným
infiltrátom lamina propria mucosae (obr. 1).
97
Obr. 1. NSE+. 400 x.
Obr. 2. NF+ vlákna. 100 x
98
Diskusia a záver
Ani metódy, ktoré sme použili na dôkaz nervového systému v stene apendixu nemožno
označiť za nástroj riešenia problému. Niektoré z nich demonštrujú aj iné štruktúry, ktoré
k nervovému systému nepatria. Iné sú veľmi citlivé, ale málo špecifické. Druhé sú veľmi
špecifické ale málo citlivé.
Zoznam použitej literatúry
1. Heusermann U: Morphology and function of the human spleen. Enzyme histochemical
and electron Microscopy studies of the splenic lymphatic vessels, nerves and
connective tissue structures. Veroff Pathol. 1988;129:1-165.
2. Moses KP, Banks JC, Nava PB, Petersen D: Atlas of Clinical Gross Anatomy.
Elsevier Mosby, 2005, 612s.
3. Mráz P (Ed): Anatómia III. Slovak Academic Press, Bratislava 2003, 1287s.
4. Danihel L, Brozman M, Bircák J, Viciánová K, Jurco R.: The detection of
catecholamines in autopsy material using fluorescence. Bratisl Lek Listy, 84, 1985, 6,
664-671.
5. Danihel L, Brozman M.: Fluorescence microscopy detection of catecholamines using
glyoxylic acid. Bratisl Lek Listy, 80, 1983 ,4, 390-396.
6. Carlei F, Polak JM: Antibodies to neuron-specific enolase for the delineation of the
entire diffuse neuroendocrine system in health and disease. Semin Diagn Pathol. 1984
Feb;1(1):59-70.
7. Maunoury R, Delpech A, Delpech B, Vidard MN, Vedrenne C, Constans JP, Hillereau
J: Immunocytochemical localization of gliofibrillary proteins (GFAP) in human
cerebral tumors. Histological and in vitro studies. Neurochirurgie. 1977 MayJun;23(3):173-85.
8. Haan EA, Boss BD, Cowan WM: Production and characterization of monoclonal
antibodies against the "brain-specific" proteins 14-3-2 and S-100. Proc Natl Acad Sci
USA. 79, 1982, 23, 7585-7589.
9. Gu J, Polak JM, Tapia FJ, Marangos PJ, Pearse AG: Neuron-specific enolase in the
Merkel cells of mammalian skin. The use of specific antibody as a simple and reliable
histologic marker. Am J Pathol. 104, 1981, 1, 63-68.
10. Terenghi G, Polak JM, Ballesta J, Cocchia D, Michetti F, Dahl D, Marangos PJ,
Garner A: Immunocytochemistry of neuronal and glial markers in retinoblastoma.
Virchows Arch A Pathol Anat Histopathol. 404, 1984, 1, 61-73.
99
100
Klinická sekcia
V. konferencia doktorandov LF UK
1.miesto
Porovnanie efektu mydriázy dvoma rôznymi spôsobmi pred operáciou sivého
zákalu
MUDr. Branislav Trnavec
2.miesto
Diagnostika patológie endometria u žien v postmenopauze
MUDr. Ing. Horst Urban
3.miesto
Závraty po kochleárnej implantácii
MUDr. Zuzana Pospíšilová
101
22. Závraty po kochleárnej implantácii
MUDr. Zuzana Pospíšilová
Spoluautori: Milan Jäger, Daniela Nechojdomová, Zuzana Kabátová, Milan Profant 1
Školiteľ: doc. MUDr. Zuzana Kabátová, CSc.1
1
I.ORL klinika LFUK, FNsP Antolská 11, Bratislava
Úvod
Kochleárna implantácia (KI) je efektívnou metódou rehabilitácie ťažkých porúch sluchu,
nesie ale isté riziko ovplyvnenia vestibulárneho systému. Príčinou závratov po KI môže byť
trauma spôsobená inzerciou elektródy, perioperačná strata perilymfy, labyrintitída ako reakcia
na cudzie teleso, pooperačná perilymfatická fistula, či endolymfatický hydrops. Medzi
zriedkavejšie príčiny patria elektrická vestibulárna stimulácia implantátom alebo benígne
paroxyzmálne polohové vertigo (BPPV) (1).
Cieľom práce bolo zistenie prevalencie, charakteristiky symptómov a potenciálnych
rizikových faktorov vestibulárnych porúch po jednostrannej kochleárnej implantácii.
Materiál a metódy
Populáciu v našej retrospektívnej štúdii tvorilo 52 dospelých pacientov po KI na našom
pracovisku v rokoch 1994-2008, ktorí vyplnili dotazník zameraný na prítomnosť závratov
v pooperačnom období. Všetci pacienti mali obojstrannú ťažkú poruchu sluchu bez
kompenzácie naslúchacím prístrojom. Priemerný vek pacientov bol 46 rokov (15-68). Pomer
žien a mužov v skupine bol 1:1.
Otázky v dotazníku boli zamerané na čas vzniku príznakov, charakter, intenzitu a
vyvolávajúce faktory závratov po KI. Závraty boli hodnotené ako včasné v prípade, že začali
do 24 hodín po operácii. Za neskoré boli považované závraty so vznikom po viac ako 24
hodinách od operácie. Na základe charakteru závratov sme pacientov rozdelili do troch
skupín, podľa toho, či udávali vertigo, poruchu rovnováhy alebo omámenosť. Podľa intenzity
sme za mierne považovali závraty bez nauzey. Ako stredné boli hodnotené závraty s nauzeou,
ako silné závraty s nauzeou a vomitom, Za veľmi silné boli považované závraty s nauzeou a
vomitom vyžadujúce pokoj na lôžku. Podľa frekvencie sme závraty delili na ojedinelý
závratový stav, opakujúce sa epizódy, alebo pretrvávajúci závrat. Zaznamenávali sme tiež
výskyt závratov predoperačne, vek v čase KI a dĺžku trvania poruchy sluchu.
Pacienti boli rozdelení do dvoch skupín, ktoré sme porovnávali s ohľadom na uvedené
parametre, pričom pacienti bez vestibulárnych príznakov po implantácii boli považovaní za
kontrolnú skupinu.
Výsledky
Štrnásť z 52 pacientov (27%) udávalo závraty v pooperačnom období. Skoré závraty udávalo
12 (86%) pacientov so závratmi. Iba dvaja pacienti (14%) udávali neskorý vznik závratov.
102
Závraty mali charakter poruchy rovnováhy u 11 (79%) pacientov zo 14, vertigo udával 1
pacient (7%), kombináciu vertiga a poruchy rovnováhy 2 pacienti (14%).
Miernu intenzitu závratov udávalo 5 pacientov (36%), stredný stupeň 3 pacienti (21%), silné
závraty mal 1 pacient (7%), veľmi silné závraty opisovalo 5 pacientov (36%).
Ojedinelý závratový stav udávalo 6 zo 14 pacientov (43%). U 4 pacientov vznikol ihneď po
operácii. Štyria pacienti (28,5%) udávali opakujúce sa epizódy závratov. Pretrvávajúci pocit
poruchy rovnováhy udávali 4 pacienti (28,5%). Dvaja pacienti (3,9%) opisovali krátke
záchvaty provokované zmenou polohy. Jeden pacient (2%) pozoroval vznik závratov
v súvislosti s aktiváciou implantátu. Jedenásť pacientov (21%) udávalo istý typ závratu
v predoperačnom období.
Porovnaním skupín pacientov s a bez závratov po KI sme zistili výrazný rozdiel vo výskyte
závratov predoperačne. Pred KI udávalo závraty 6 pacientov (43%) zo skupiny so závratmi po
KI a 4 pacienti (11%) to skupiny bez závratov po KI (viď. Graf 1). Fisherovým testom sme
dokázali signifikantnosť tohto rozdielu (p = 0.016).
Graf 1: Porovnanie výskytu závratov po KI u pacientov s a bez závratov pred operáciou
Diskusia
Frekvencia výskytu závratov po KI podľa literárnych údajov kolíše medzi 13% -74% (2, 3, 4,
5). Príznaky môžu byť rôznorodé, od pocitu miernej poruchy rovnováhy alebo omámenosti po
náhle vznikajúce opakujúce sa záchvaty vertiga (5). Závraty môžu vzniknúť v priamej
nadväznosti na KI, s časovým odstupom ako epizodické vertigo, alebo v súvislosti so
zapojením implantátu na podklade elektrickej stimulácie. Príznaky môžu súvisieť
s prechádzajúcimi vestibulárnymi zmenami, alebo vzniknúť nezávisle od predoperačného
stavu vestibulárneho systému. Závraty po KI v našej štúdii popisovalo 14 z 52 (27%)
pacientov, pričom 6 z nich (43%) udávalo závraty aj v predoperačnom období. Podľa
literárnych údajov pacienti so závratmi pred KI, starší pacienti a pacienti s neskorším
103
nástupom poruchy sluchu majú vyššiu pravdepodobnosť pooperačných závratov (6). Rovnako
v našej štúdii udávalo predoperačne závraty 6 pacientov (43%) zo skupiny pacientov
s pooperačnými závratmi a len 4 pacienti (11%) zo skupiny bez závratov pooperačne.
Uvažuje sa o niekoľkých možných mechanizmoch vysvetľujúcich závraty vznikajúce
v súvislosti s KI. Väčšina z nich predpokladá vznik ipsilaterálnej vestibulárnej hypofunkcie
na podklade chirurgickej traumy, porušenia normálnej kochleárnej fyziológie, alebo
skundárneho endolymfatického hydropsu (7). V našej skupine so závratmi po KI opísalo
ojedinelý závratový stav 43% pacientov. Na základe zistení zo štúdii zahrňujúcich vyšetrenia
spánkových kostí možno predpokladať, že včasné vestibulárne príznaky vznikajú na základe
chirurgickej deaferentácie. Inzercia elektródy implantátu môže narušiť normálnu homeostázu
vnútroušných tekutín, vyvolať priame poškodenie vestibulárnych zmyslových štruktúr alebo
spôsobiť zápal s následnou fibrózou alebo poškodením vláskových buniek. Preto sa odporúča
šetrné zavádzanie elektródy za účelom minimalizácie vestibulárneho poškodenia (6).
Incidencia BPPV v našej štúdii bola 3,9 % (2 z 52 pacientov), čo je v súlade s údajmi
z literatúry uvádzajúcimi 2,2 -13,8 % (8, 9, 5). Pri vzniku BPPV pravdepodobne zohrávajú
úlohu tri rôzne mechanizmy. Prvým môže byť napadanie kostných úlomkov do oblasti
kochley pri vytváraní kochleostómie. V druhom prípade môžu byť samotné vibrácie pri vŕtaní
kochleostomie podnetom na uvoľnenie otokónii do labyrintu. V prípade tretej hypotézy sa
predpokladá uvoľnenie otolitov na základe elektrickej stimulácie (9, 8, 2).
Elektrická vestibulárna stimulácia môže spôsobiť narušenie vstupných informácii a porušeniu
symetrie aktivity vestibulárnych jadier, čo vedie ovplyvneniu vestibulookulárnych a
vestibulospinálnych reflexných odpovedí, čo je následne vnímané ako posturálna instabilita
alebo vertigo (10). V našej štúdii sme zaznamenali závraty v súvislosti s aktiváciou
implantátu iba u jedného pacienta (2%).
Nakoľko u kandidátov na KI možno vo vyššom percente predpokladať poškodenie funkcie
vestibulárneho aparátu v súvislosti so základným ochorením už pred implantáciou, pre
chýbajúce predoperačné hodnotenie vestibulárnej funkcie nie je ľahké posúdiť presný rozsah
jej ovplyvnenia samotnou implantáciou.
Záver
Jednostranná KI býva príčinou závažných vestibulárnych porúch len zriedka. Pacienti
s vestibulárnou symptomatológiou pred KI majú vyššie riziko závratov po implantácii, ktoré
však môžu byť aj výsledkom chronických zmien vo vnútornom uchu súvisiacich so
základnýcm ochorením. Prechodná vestibulárna symptomatológia v pooperačnom období
zvyčajne ustupuje bez reziduálnych príznakov. U malého počtu pacientov sa po KI môže
vyvinúť na strane operovaného ucha BPPV. Vestibulárna stimulácia z kochleárneho
implantátu sa zdá byť na základe našich pozorovaní zriedkavým javom.
Zoznam použitej literatúry
1. Krause E, Wechtenbruch J, Rader T, Gurkov R. Influence of cochlear implantationon
sacculus function. Otolaryngol Head Neck Surg 2009;140:108-113.
2. Di Girolamo S, Fetoni AR, Di Nardo W, Paludetti G. An unusual complication of
cochlear implant: benign paroxysmal positional vertigo. J Laryngol Otol
1999;113:922-3.
104
3. Ito J. Influence of the multichannel cochlear implant on vestibular function.
Otolaryngol Head Neck Surg 1998;118:900–902.
4. Steenerson RL, Cronin GW, Gary LB. Vertigo after cochlear implantation. Otol
Neurotol 2001;22:842–843.
5. Fina M, Skinner M, Goebel JA, et al. Vestibular dysfunction after cochlear
implantation. Otol Neurot 2003;24:234-42.
6. Tien HC, Linthicum FH Jr. Histopathologic changes in the vestibule after cochlear
implantation. Otolaryngol Head Neck Surg. 2002 Oct;127(4):260-4.
7. Kubo T, Yamamoto K, Iwaki T, et al. Different forms of dizziness occurring after
cochlear implant. Eur Arch Otorhinolaryngol 2001;258:9-12.
8. Viccaro M, Mancini P, La Gamma R, De Seta E, Covelli E, Filipo R. Positional
Vertigo and Cochlear Implantation. Otol Neurotol 2007;28, 764-767.
9. Limb CJ, Francis HF, Lusting LR, Niparko JK, Jammal H. Benign positional vertigo
after cochlear implantation. Otolaryngol Head Neck Surg 2005;132:741-5.
10. Buchman CA, Joy J, et al. Vestibular effects of cochlear implantation. Laryngoscope
2004; 114(10 Pt 2 Suppl 103): 1-22.
105
23. Výskyt diabetes mellitus v gravidite na Slovensku v r. 1997 - 2008
MUDr. Lucia Féderová
Školiteľ: doc. MUDr. Miroslav Korbeľ, CSc.
I. Gynekologicko - pôrodnícka klinika LF UK a FNsP Bratislava
Úvod
Tehotnosť u žien s diabetom mellitom (DM) je vysoko riziková, ale vo väčšine prípadov pri
kvalifikovanom menežmente možná a reálna. V Európe diabetes mellitus 1. a 2. typu (DM1 a
2) komplikuje približne 0,3 – 0,5 % a gestačný diabetes mellitus (GDM) 3 - 5 % všetkých
gravidít (1).
Materiál a metódy
Retrospektívna analýza frekvencie pôrodov žien s DM l a 2 a GDM na Slovensku v rokoch
1997 – 2008. Údaje boli získané z hlásení hlavnému odborníkovi pre gynekológiu a
pôrodníctvo MZ SR. Analyzovaný bol výskyt diabetu v jednotlivých rokoch a podľa krajov.
Výsledky
V sledovanom období bolo v SR 636 348 pôrodov (tab. 1), z toho 1 834 (0,29 %) pôrodov
žien s DM 1 a 2 a 7 339 (1,15 %) pôrodov s GDM. Najnižšia frekvencia pôrodov žien s DM 1
a 2 bola v roku 2007
(0,18 %), najvyššia v roku 1998 (0,37 %). Najnižšia frekvencia
pôrodov žien s GDM bola v roku 1997 (0,71 %), najvyššia v roku 2002 (1,46 %).
Rok
Počet
DM 1 a 2
GDM
pôrodov
N
%
výskyt
N
%
výskyt
1997
58780
159 0,27 1 : 370
419 0,71 1 : 140
1998
56833
209 0,37 1 : 272
502 0,88 1 : 113
1999
55657
189 0,34 1 : 294
634 1,14 1 : 88
2000
54383
186 0,34 1 : 294
658 1,21 1 : 83
2001
50716
178 0,35 1 : 285
716 1,41 1 : 71
2002
49687
164 0,33 1 : 305
723 1,46 1 : 56
2003
50474
134 0,27 1: 379
690 1,37 1 : 74
2004
51980
137 0,26 1 : 379
712 1,37 1 : 73
2005
52233
132 0,25 1 : 396
503 0,96 1 : 104
2006
51 077
129 0,25 1 : 396
554 1,06 1 : 92
2007
51 146
93
0,18 1 : 550
522 1,02 1 : 98
2008
53 382
126
0,24 1: 424
606 1,14 1 : 88
Spolu
636 348
1834
0,29 1 : 347
7339 1,15 1 : 87
Tabuľka 1. Diabetes mellitus - frekvencia pôrodov v SR (1997 - 2008)
106
Najnižšia frekvencia pôrodov žien s DM 1 a 2 (tab. 2) bola v Trnavskom (0,19 %), najvyššia
v Bratislavskom kraji (0,54 %). Najnižšia frekvencia pôrodov žien s GDM bola v Košickom
(0,63 %), najvyššia v Trnavskom kraji (2,19 %). Najnižšia frekvencia pôrodov žien s DM 1
a 2 bola v Trnavskom kraji v roku 2004 (0 %), najvyššia v Bratislavskom kraji v roku 1999
(0,87 %). Najnižšia frekvencia pôrodov žien s GDM bola v Košickom kraji v roku 1998 (0,36
%), najvyššia v Trnavskom kraji v roku 2002 (3,47 %).
Kraj
Počet
DM 1 a 2
GDM
pôrodov
N
%
výskyt
N
%
výskyt
Bratislava
70 122
376
0,54
1 : 186
995
1,42
1 : 70
Trnava
51 521
99
0,19
1 : 520
1130
2,19
1 : 46
Nitra
73 474
145
0,20
1 : 507
909
1,24
1 : 81
Trenčín
60 139
171
0,28
1 : 352
1011
1,68
1 : 59
B. Bystrica
74 737
164
0,22
1 : 456
782
1,05
1 : 96
Žilina
85 271
193
0,23
1 : 442
742
0,87
1 : 15
Prešov
115 270
442
0,38
1 : 261
995
0,86
1 :116
Košice
105 814
256
0,24
1 : 413
670
0,63
1 :158
Slovensko
636
1834
0,29
1 : 347
7339
1,15
1 : 87
348
Tabuľka 2. Diabetes mellitus - frekvencia pôrodov v SR podľa krajov (1997 - 2008)
Priemerná frekvencia pôrodov s DM 1 a 2 na Slovensku v rokoch 1997 – 2008 bola 0,29 %
a s GDM 1,14 %. Frekvencia pôrodov s DM 1 a 2 varírovala v rozmedzí 0,18 % – 0,37 %
a GDM 0,71 – 1,46 %. Frekvencia pôrodov s DM 1 a 2 v jednotlivých krajoch sa pohybovala
od 0,19 % do 0,54 % a GDM od 0,63 % do 2,19 %. Výraznejšie rozdiely boli medzi krajmi
v jednotlivých rokoch – od 0 % do 0,87 % pri DM 1 a 2 a pri GDM
od 0,36 % do 3,47 %
(tab. 3).
DM 1 – 2 (%)
GDM (%)
Priemerný výskyt
0,29
1,14
Medziročné rozdiely
0,18 – 0,37
0,71 – 1,46
Medzikrajské rozdiely
0,19 – 0,54
0,63 – 2,19
Medzikrajské +
0,00 – 0,87
0,36 – 3,47
medziročné rozdiely
Tabuľka 3. Kumulatívne údaje pôrodov s DM na Slovensku (1997- 2008)
Diskusia
Priemerná frekvencia pôrodov žien s DM 1 a 2 sa do r. 2002 pohybovala nad 0,33 %, od r.
2003 klesla v priemere na 0,24 %. Z dostupných údajov sa nedá povedať, či je pokles
spôsobený iba posunom pôrodnosti do vyšších vekových kategórii, alebo sa za tým skrývajú
iné faktory (2). Takmer dvojnásobná frekvencia pôrodov rodičiek s DM 1 - 2 v Bratislavskom
kraji súvisí s odosielaním časti týchto rodičiek z Trnavského a Nitrianskeho kraja do
perinatologického centra v Petržalke.
107
GDM je spojený nielen s nepriaznivými ukazovateľmi materskej a fetálnej morbidity, ale aj s
dlhodobými dôsledkami (3,4,5). Rekurencia GDM v nasledujúcej tehotnosti je udávaná 20 –
50 %. GDM po 10 rokoch prechádza do DM 2 až v 50 %. Prevalencia GDM v rôznych
populačných štúdiách sa pohybuje od 1 do 14 %
a je podmienená geografickou, etnickou
a rasovou variabilitou (1,6,7). V našich podmienkach výraznou mierou závisí aj od kvality
skríningu a zrejme aj od skladby obyvateľstva (8). Pôrody žien s GDM mali do roku 2002
stúpajúcu frekvenciu (do 1,46 %). Od roku 2005 ich frekvencia poklesla a pohybuje sa okolo
1 %. To by mohlo signalizovať zhoršenie kvality skríningu GDM. Jeho nižší záchyt vo
východoslovenskom regióne môže byť podmienený aj etnickými špecifikami.
Závery: Frekvencia pôrodov komplikovaných DM na Slovensku sa pohybovala okolo 1,44 %
s regionálnymi rozdielmi od 0,87 % do 2,38 % a medziročnými rozdielmi od 0,98 % do 1,79
%. Medziročné rozdiely
v jednotlivých krajoch boli od 0,64 % do 3,04 %.
Objasnenie príčin širokej variability frekvencie pôrodov komplikovaných DM si bude
vyžadovať ďalšiu podrobnejšiu analýzu.
Použitá literatúra
1. Diabetes and pregnancy. Evidence based. Update and guidelines. Prague, Working
group on Diabetes and Pregnancy. Praha, EAPM. 2006, 1-87.
2. Korbeľ M., Borovský M, Danko J, Nižňanská Z, Féderová L.: Regionálna analýza
perinatálnych výsledkov v SR zarok 2007. Gynekol prax 2009; 7(1): 9-14.
3. Report of the Expert Committee on the Diagnosis and Classification of Diabetes
Mellitus. Diabetes Care 2002; 25(Suppl. 1): 5-20.
4. Korecová, M.: Gestačný diabetes mellitus. In: Mokáň, M., Martinka, E., Galajda, P.,
eds. Diabetes mellitus a vybrané metabolické ochorenia. Martin, P+M. 2008, 471-479.
5. Hyperglycemia and Adverse Pregnancy Outcome (HAPO) Study. Diabetes 2009;
58(2): 453-459.
6. ADA: Standards of medical care in diabetes – 2009. Diabetes Care 2009; 32(Suppl.
1): 13-61.
7. Hanna, F.W.F., Peters, J.R.: Screening for gestational diabetes; past, present and
future. Diabet Med 2002; 19(5): 351-358.
8. Korbeľ, M.: Úvod k téme čísla: Diabetes mellitus a tehotnosť. Gynekol prax 2005;
3(2): 79-80.
108
24. Koagulačné a fibrinolytické zmeny v gravidite
MUDr. Ľubica Hammerová
Školiteľ: doc. MUDr. Ján Chabada, CSc.1
1
I. gynekologicko – pôrodnícka klinika LF UK a FNsP Bratislava
Úvod
Hemostáza v organizme je zabezpečená dôkladnými mechanizmami, ktoré za fyziologických
okolností udržiavajú krv v tekutej forme a bránia formovaniu krvnej zrazeniny v cievnom
riečisku. Gravidita je spojená so zvýšeným rizikom tromboembolizmu a signifikantnými
zmenami vo všetkých aspektoch klasickej Virchowovej triády. Koncentrácia väčšiny
koagulačných faktorov rastie, niektorých prirodzených antikoagulansov klesá a zmenšuje sa
fibrinolytická aktivita. Jemná rovnováha sa posúva na stranu zvýšenej koagulácie. Zmeny
koagulačného systému vznikajú na podklade hormonálnych zmien a ich cieľom je chrániť
ženu pred nadmerným krvácaním a fatálnou krvnou stratou počas pôrodu a v šestonedelí.
Metodika
Sledovali sme 148 zdravých žien od 10.-15. týždňa gravidity do pôrodu. Každá žena mala
v minulosti jeden nevysvetlený potrat v prvom trimestri. Zo štúdie boli vyradené ženy
s obezitou (BMI >40), ochoreniami pečene a obličiek a ďalšími ochoreniami, ktoré môžu
ovplyvniť koagulačné parametre. Venózna krv sa odoberala medzi 10.-15., 20.-24. a 32.-36.
týždňom gravidity. Krvné odbery boli realizované nalačno do 3,5 ml koagulačnej skúmavky s
3,8% citrátom sodným v pomere 9:1 (krv:citrát sodný) a odstredené 3500 g po dobu 15 minút
pri izbovej teplote (25°C) pri vyšetrovaní parametrov koagulácie a v prípade kvantitatívneho
stanovenia trombocytov sa odoberala venózna krv do 3ml
koagulačnej skúmavky
odberového systému s obsahom K2EDTA (didraselná soľ kyseliny etyléndiamíntetraoctovej).
Scentrifugovaná plazma bola vyšetrená plne automatizovaným koagulomerom BCS XP Dade
Behring. Na kvantitatívne stanovenie funkčne aktívneho proteínu C pomocou chromogénneho
substrátu sa používal diagnostický set Berichrom *Protein C a funkčná aktivita proteínu
S ľudskej plazmy bola vyšetrovaná pomocou testu Protein S Ac. Kontrola bola vykonaná na
N plazmách.
Vyšetrovali sme nasledujúce parametre:
•
všeobecné testy: protrombínový čas (PT, referenčná hodnota 30-130%) vyjadrený aj
pomocou INR (International Normalized Ratio, referenčná hodnota 0,8-1,25), aktivovaný
parciálny tromboplastínový čas (aPTT, referenčná hodnota 26-36 sekúnd), trombocyty (Tr,
referenčná hodnota 150-440 x109.l-1)
•
koagulačné faktory: faktor I (plazmový fibrinogén, Fbg, referenčná hodnota 1,8-3,6
g.l-1), faktor II (referenčná hodnota 70-120%), faktor V (referenčná hodnota 70-140%), faktor
VII (referenčná hodnota 70-120%), faktor VIII (referenčná hodnota 70-150%), faktor IX
(referenčná hodnota 70-120%), faktor X (referenčná hodnota 70-120%), faktor XI (referenčná
hodnota 70-120%), faktor XII (referenčná hodnota 70-150%)
109
•
fibrinolytický marker: d-diméry (referenčná hodnota 0-470 µg.l-1)
•
prirodzené inhibítory koagulácie: proteín C (PC, referenčná hodnota 70-140%),
proteín S (PS, referenčná hodnota 59-118%), antitrombín III (AT III, referenčná hodnota 75125%)
Štatistické spracovanie bolo vykonané pomocou párového t-testu.
Výsledky
PT
aPTT
INR
Tr
Fbg
F II
FV
F VII
F VIII
F IX
FX
F XI
F XII
ddiméry
PC
PS
AT III
I.trimester
AP
103,600
31,270
1,002
253,400
2,969
93,800
103,600
98,180
105,800
97,430
95,700
93,160
109,100
II.trimester
AP
t-test
102,90 2,970
30,87 5,396
0,89
15,100
239,00 6,704
3,89
10,390
93,83 0,629
103,50 1,509
122,60 36,410
106,20 8,378
97,18 19,930
97,99 18,090
92,95 6,138
109,70 9,874
165,100
104,000
89,580
101,300
496,20
104,00
85,48
101,30
25,760
0,756
15,750
0,151
sign.
p<0,001
p<0,001
p<0,001
p<0,001
p<0,001
p>0,050
p>0,050
p<0,001
p<0,001
p<0,001
p<0,001
p<0,001
p<0,001
III.trimester
AP
t-test
101,600 4,618
30,430 5,161
0,821
19,990
228,000 4,542
4,967
11,200
93,730 1,693
103,700 1,897
151,600 31,660
106,700 8,201
97,920 27,730
126,600 50,300
92,720 6,530
110,100 7,640
sign.
p<0,001
p<0,001
p<0,001
p<0,001
p<0,001
p>0,050
p>0,050
p<0,001
p<0,001
p<0,001
p<0,001
p<0,001
p<0,001
p<0,001
p>0,050
p<0,001
p>0,050
979,000
104,000
87,700
101,400
p<0,001
p>0,050
p<0,001
p>0,050
10,290
0,304
11,090
1,022
Tab.1: Hemostatické zmeny v gravidite. AP – aritmetický priemer, g.t. – gestačný týždeň
Diskusia
Všetky zložky hemostatického systému musia byť v organizme v rovnováhe s cieľom
zabrániť vzniku trombózy alebo nadmernému krvácaniu.
V našej štúdii sme skúmali rozsah zmien koagulačných parametrov počas normálnej gravidity
u zdravých žien. Viaceré štúdie popísali v gravidite signifikantný vzostup hladiny
fibrinogénu, d-dimérov, faktoru VII a X súčasne s poklesom hladiny trombocytov a proteínu
S. Ostatné sledované parametre svoje hladiny menili len mierne.
Trombocytopénia je najčastejšia koagulopatia v gravidite. V populácií postihuje 6-10%
všetkých gravidít. Sainio vo svojej štúdii zistil, že u zdravých gravidných žien je najmä
posledný trimester asociovaný s trombocytopéniou a v tejto štúdii 7,3% žien malo počet
trombocytov nižší ako 150x109 l-1 (1). Burrows ďalšou štúdiou potvrdil tieto výsledky. Počet
žien s trombocytopéniou v termíne pôrodu dosiahol 11,6% (2). Tieto štúdie zdôraznili
benígny charakter náhodných trombocytopénií v gravidite. Fyziologická gravidita je spojená
so zvýšenou deštrukciou trombocytov. Trombocytopénia bola v našej štúdii v prvom trimestri
110
potvrdená u 8,8% žien, v druhom trimestri incidencia stúpla na 11,48% a v treťom trimestri
dosiahla hodnotu 14,19%. Pokles hladiny trombocytov počas gravidity bol signifikantný
(p<0.001).
Hladina fibrinogénu v gravidite lineárne rástla a vzostup bol v priemere o 1 g.l-1 za jeden
trimester. Najvyššie hodnoty dosahovala v treťom trimestri. Rozdiel medzi jednotlivými
trimestrami bol signifikantne významný (p<0.001).
Výrazný vzostup bol zaznamenaný aj v hodnotách faktoru VII a X. Svoje maximá dosiahli
v treťom trimestri identicky so štúdiou Bremme (p<0.001) (3).
Nepodarilo sa dokázať signifikantný rozdiel v hodnotách faktorov II a V medzi jednotlivými
trimestrami. Hladina faktorov VIII, IX a XI v priebehu gravidity mierne rástla (p<0.001),
faktor XI mal klesajúcu tendenciu (p<0.001) podobne ako vo viacerých štúdiách (3, 4).
Naša práca tiež potvrdila zmeny v jednotlivých trimestroch v hladinách protrombínového
času, aktivovaného parciálneho tromboplastínového času a INR (p<0.001). Tieto parametre
vykazovali signifikantný pokles.
Viaceré štúdie popísali pokles hladiny prirodzených antikoagulansov, čo sa v našej štúdii
nepotvrdilo v prípade proteínu C a antitrombínu III, ktorých hladiny sa počas gravidity
signifikantne nemenili (4,5,6). Paradoxne hladina proteínu S štatisticky významne vzrástla
v druhom trimestri, no v treťom trimestri mierne klesla, ale nedosiahla hodnotu prvého
trimestra (p<0.001) (6).
Koncentrácia d-dimérov je významným meradlom formovania intravaskulárnej
a extravaskulárnej tvorby fibrínových zhlukov a v menšej miere fibrinolytickej aktivity (7,9).
Už v prvom trimestri bola hladina d-dimérov signifikantne zvýšená oproti referenčným
hodnotám a lineárne rástla počas celej gravidity. Priemerná hodnota v treťom trimestri
dosahovala 10násobok hodnoty prvého trimestra (p<0.001).
Počas normálnej gravidity hladiny faktoru II, VII, X a d-dimérov stúpli, k očakávanej zmene
hladiny proteínu S nedošlo. Všetky gravidity boli úspešne ukončené pôrodom živonarodeného
plodu a u žiadnej ženy sa nevyskytli komplikácie v zmysle hlbokej žilovej trombózy počas
gravidity. Zmeny koagulačného a fibrinolytického systému v gravidite a šestonedelí sú zmeny
fyziologické a stimulácia koagulačného systému nie je nevyhnutne spojená so zvýšenou
trombotickou tendenciou.
Zoznam použitej literatúry
1. Sainio S, Kekomäki R, Riikonen S et al. Maternal thrombocytopenia at term – a
population-based study. Acta Obstet Gynecol Scand 2000; 79: 744-749.
2. Burrows RF. Platelet disorders in pregnancy. Curr Opin Obstet Gynecol 2001; 13:
115-119.
3. Bremme K. Haemostatic changes in pregnancy. Best Pract Res Clin Haematol 2003;
16(2): 153-168.
4. O'Riordan MN, Higgins JR. Haemostasis in normal and abnormal pregnancy. Best
Pract Res Clin Obstet Gynaecol 2003; 17: 385-396.
5. Asakura H, Ohshita T, Suzukis S et al. Correlation between grade III placenta and
plasma antithrombin III activity in full term pregnancy. Gynecol Obstet Invest 2001;
52: 47-50.
111
6. Clark P, Brennand J, Conkie JA et al. Activated protein C sensitivity. Protein C,
protein S and coagulation in normal pregnancy. Thromb Haemost 1998; 79: 11661170.
7. Dempfle CE. What role does the measurement of fibrinogen and its derivatives have
in the diagnosis of disseminated intravascular coagulation? Blood Rev 2002; 16(1):
S23-S28.
8. Dempfle CE, Wurst M, Smolinski M et al. Use of soluble fibrin antigen instead of Ddimer as fibrin-related marker may enhance the prognostic power of the ISTH overt
DIC score. Thromb Haemost 2004; 91: 815-818.
9. Dempfle CE. Validation, calibration and specificity of quantitative D-dimer assay.
Sem Vasc Med 2005; 5: 315-320.
112
25. Vplyv liečby rastovým hormónom na kostnú denzitu a kostné markery u pacientov
s deficitom rastového hormónu
MUDr. Martin Kužma
Školiteľ: prof. MUDr. Juraj Payer, CSc.
V.Interná klinika LF UK a FNsP Bratislava, Ružinov
Úvod
Medzi stavy spojené s deficitom RH zaraďujeme ochorenia hypofýzy (tumory v 90%,
následkom chirurg. zákrokov, postradiačné zmeny), iné príčiny ako je trauma, TBC,
histiocytóza X, zápaly a idiopatické (1). RH, či už priamo, alebo nepriamo cez generáciu IGF
a IGF viažúcich proteínov, má takisto účinok na rastúci skelet, ako aj vplyv na kostnú
modeláciu účinkom na chondrocyty rastovej platničky a kostné bunky. Aj napriek uzáveru
rastovej epifyzeálnej štrbiny, pretrvávajú účinky RH/IGF na kostný obrat a kostnú masu,
denzitu a silu reguláciou kostnej remodelácie (2). Viacero autorov pozorovalo u pacientov s
hypopituarizmom a deficitom RH nízku kostnú minerálnu denzitu (BMD) (3). Vo viacerých
štúdiach bola opísaná iniciálna redukcia BMD po 6-12 mesiacoch terapie, ale pokiaľ sa
pokračovalo v terapii, BMD sa normalizovala alebo bola vyššia v porovnaní so začiatkom. V
niektorých štúdiach po 12 mesiacoch terapie deficitu RH bol pozorovaný pokles markerov
kostného obratu až pokles na bazálne hodnoty. Iné štúdie potvrdili zvýšenie kostných
markerov (osteokalcínu) v závislosti od dávky rastového hormónu (4).
Charakteristika súboru a metódy
V našom súbore máme okolo 200 pacientov, z ktorých sme vybrali vzorku 20 pacientov (10
mužov a 10 žien) vo veku 24-62 (priemerne 47,5 r.) s deficitom RH bez ohľadu na etiológiu
deficitu. Pacienti boli liečení dávkami RH na základe odporúčaní.
Sledovali sme efekt liečby na kostnú denzitu (krčka femuru a L-chrbtice), ktorú sme u týchto
pacientov merali na začiatku a po 2 rokoch terapie RH na tom istom denzitometrickom
prístroji (HOLOGIC Discovery W .S/N81513). Zároveň sme sledovali aj markery kostného
obratu osteokacín a CTx počas 1 roka ( na začiatku,v 6. mesiaci a po roku terapie).
Výsledky
Vplyv na kostnú denzitu
V rámci sledovania kostnej denzity počas 2 ročnej terapie rekombin. RH sme zistili
signifikantne zvýšenie kostnej denzity (p=0,0001) krčka femuru(viď graf 1.) a tiež
signifikantné (p=0,0001) zvýšenie kostnej denzity L-chrbtice (graf 2)
113
Graf 1. P= 0,0001
1,5
1,0
0,5
0,0
-0,5
-1,0
-1,5
-2,0
-2,5
-3,0
-3,5
krč rok 0
krč rok 2
Graf 2. P=0,0001
1,0
0,5
0,0
-0,5
-1,0
-1,5
-2,0
-2,5
-3,0
-3,5
-4,0
L rok 0
L rok 2
114
Vplyv terapie RH na markery kostného obratu
Počas 1 roka terapie bol zaznamenaný signifikantný vzostup hladín sérového osteokalcínu
(p=0,001) a CTX (p=0,015), t.z. aj kostnej formácie (viď graf 4,5)
Graf 4.
p=0,001
Graf 5.
p=0,0150
115
Diskusia
Pozorovali sme signifikantný vzostup kostnej denzity po administrácii RH v súlade s
teoretickými predpokladmi. V súvislosti s tým sa objavujú rôzne názory na dlhodobú liečbu
(absentujú štúdie s vyšším počtom pacientov), preto by sme chceli pokračovať v sledovaní
efektu terapie RH počas dlhšej časovej periódy.
U kostných markerov sme takisto zaznamenali signifikantný vzostup po 1 roku terapie RH.
Podobne ako u kostnej denzity je žiadúca dlhšia observačná perióda s dostatočným
množstvom pacientov.
Zoznam použitej literatúry
1. Kužma M, Payer J. Deficit rastového hormónu a jeho vplyv na kostnú minerálnu
denzitu a riziko osteoporotických fraktúr.Casopis Lek Cesk, Apr 2010, v tlači.
2. Ohlsson C, Bengtsson BA, Isaksson OG, Andreassen TT, Slootweg MC. Growth
hormone and bone. Endocr Rev. 1998 Feb;19(1):55-79.
3. Johansson AG, Burman P, Westermark K, Ljunghall S. The bone mineral density in
acquired growth hormone deficiency correlates with circulating levels of insulin-like
growth factor I. J Intern Med. 1992 Nov;232(5):447-52.
4. Nielsen HK, Jørgensen JO, Brixen K, Christiansen JS. Serum osteocalcin and bone
isoenzyme alkaline phosphatase in growth hormone-deficient patients: dose-response
studies with biosynthetic human GH. Calcif Tissue Int. 1991 Feb;48(2):82-7.
116
26. Kultivované alogénne keratinocyty v terapii rán vzniknutých po odbere
dermoepidermálnych autotransplantátov II. časť
MUDr. Dominika Kevická
Spoluautor: MUDr. Darina Potocká
Školiteľ: Doc. MUDr. Ján Koller, PhD.
Klinika popálenín a Rekonštrukčnej Chirurgie FNsP Bratislava
Úvod
Popáleniny predstavujú závažný problém z hľadiska terapie. Konečnou metódou liečby
popálenín tretieho stupňa, je excízia popálenej plochy a jej prekrytie dermoepidermálnym
autotransplantátom čiastočnej hrúbky kože (1). Takéto riešenie je však často problematické v
prípadoch rozsiahlych popálenín, kde je nedostatok zdravej nepopálenej kože vhodnej na
odber autotransplantátov (2). V prípade nedostatku odberových miest, skrátenie času
potrebného pre zhojenie rán po odbere autotransplantátov, umožňuje ich skoršie využitie pre
opätovný odber (1).
Pomocou tkanivového bankingu sa v súčasnosti darí vytvárať mnohé druhy kožných náhrad
využívaných v terapii rôznych druhov rán (3, 4, 5). Objavenie spôsobu kultivácie
epidermálnych keratinocytov umožnilo ich využitie v terapii samotných popálenín alebo
donorských miest po odbere autotransplantátov (6). Prekrytie týchto plôch kultivovanými
alogénnymi keratinocytmi stimulujú hojenie rany z jej okrajov ako aj z reziduálnych kožných
príveskov (7). Ukázalo sa, že alogénne transplantáty prispievajú k tvorbe zdravo vyzerajúceho
granulačného tkaniva, indukujú koncový efekt a akcelerujú posun epidermy od zápalového do
regeneratívneho stavu (8).
Na začatie kultivácie je potrebné získať vzorky kože od zdravých darcov. Po odsúhlasení
etickou komisou FNsP Bratislava Ružinov sa vzorky kože potrebné pre prípravu
alotransplantátov získavajú od zdravých darcov podstupujúcich zákroky plastickej chirurgie
po ich informovanom súhlase, kultivované metódou Rheinwalda a Greena (9) a aplikované
pacientom po odbere dermoepidermálnych autotransplantátov.
Metodika
Alogénne keratinocyty boli izolované zo vzoriek kože odobratých pacientom liečeným na
Klinike popálenín a Rekonštrukčnej chirurgie FNsP Bratislava po získaní ich informovanom
súhlase.
Spracovanie a následná kultivácia keratinocytov prebieha podľa modifikovanej metódy
Rheinwalda Greena používanej v Centrálnej tkanivovej banke (CTB) pri Klinike Popálenín
a Rekonštrukčnej chirurgie FNsP Bratislava.
Súbor predstavuje 20 pacientov liečených na Klinike popálenín a RCh FNsP Ba, vybraných
náhodným výberom po získaní ich informovaného súhlasu a schválení aplikácie etickou
komisiou zdravotníckeho zariadenia. Každému pacientovi je vedená fotodokumentácia.
117
Alogénne kultivované keratinocyty (AKC) sa prichytía na sterilný tyl pomocou klipov
a následne sú aplikované priamo pacientovi prípadne sa zamrazia.
Epitélium sa spolu s tylom čerstvé alebo, po predchádzajúcom rozmrazení, epiteliálnou
stranou prikladá pacientom na plochy po odbere dermoepidermálnych autotransplantátov
hrúbky 250µm a zvyšok rany sa prekryje štandardným liečebným postupom (ŠLP)
používaným na klinike: Dermazin ung.+ 1% roztok Acidum aceticum (D+AA), ktoré slúžilo
ako kontrola.
Primárny výstup projektu: Inšpekciou rany a jej okolia v intervaloch 2,7,14 dní a následnou
fotodokumentáciou plôch sa porovnáva:
1. sekrécia rany (žiadna, stredná, silná)
2. farba granulácií (červená, bledá, cyanotická)
3. rýchlosťepitelizácie (hodnotená v %)
4. okolie rany (zapálené, podráždené, kľudné)
5. bolestivosť (žiadna, slabá, stredná, silná)
6. zhodnotenie plochy slovne
7. bakteriologický nález (pri podozrení na infekciu)
Sekundárny výstup projektu o 3-6 mesiacov:
1. porovnanie kozmetických výsledkov
2. tvorba jaziev
po použití alogénnych kultivovaných keratinocytov (AKC) a D+AA predstavujúcich
štandardný liečebný postup (ŠLP) na plochy po odbere dermoepidermálnych
autotransplantátov.
Výsledky
Zo získaných vzoriek sa nám úspešne podarilo vykultivovať súvislé epitéliá vhodné na
aplikáciu na ranu.
Do uzávierky konferencie sa nám podarilo do štúdie zaradiť 10 pacientov, preto výsledky nie
sú ešte celkom reprezentatívne. V najbližšom čase však súbor skompletizujeme na 20
pacientov, čo bude predstavovať reprezentatívnejší súbor.
Primárny výstup:
Pri hodnotení sekrécie rany sa preukázal rozdiel medzi použitým druhom krytia do druhého
dňa, kedy po použití AKC bola u polovice pacientov žiadna sekrécia a u druhej polovice
slabá, kým pri použití ŠLP bola slabá u všetkých. Neskôr sa rozdiel v sekrécii rany
nepreukázal.
118
Rozdiel farby granulácií bol tiež najvýraznejší do druhého dňa. Pri použití AKC boli
granulácie u 8 pacientov bledé, u 2 červené a pri použití ŠLP boli červené u všetkých
pacientov.
Bolestivosť hodnotili pacienti. 70% pacientov hodnotilo bolestivosť po použití AKC ako
slabú, žiaden ako slinú a pri použití ŠLP 50% pacientov hodnotilo bolestivosť ako strednú,
pričom dvaja ako silnú.
Okolie rany bolo u všetkých pacientov kľudné, z tohoto dôvovdu sme ster na kultiváciu
neodoberali.
Najvýraznejší rozdiel v epitelizácii odberovej plochy sa prejavil do 7 dňa, kedy bola
priemerná epitelizácia plochy po použití AKC 77,4% a pri použití ŠLP 55,2%. Do 2 a 14 dňa
sa žiaden rozdiel nepozoroval.
Sekundárny výstup:
Hodnotenie kozmetických výsledkov a tvorby jaziev sme z dôvodu poterby väčšieho
časového odstupu nevykonávali.
Diskusia
Z výsledkov klinickej štúdie vyplýva, že alogénne kultivované keratinocyty majú významný
vplyv na počiatočnú rýchlosť epitelizácie, kedy svojim priaznivým vplyvom na vlastné
keratinocyty z kožných adnexov, urýchľujú uzatvorenie otvorenej rany spôsobenej odberom
dermoepidermálnych autotransplantátov. Zhojenie tejto rany umožňuje jej skoršie opätové
použitie na odber autotransplantátov potrebných na definitívne prekrytie hlbokých popálenín.
Zníženie bolestivosti po použití AKC prispieva ku zvýšeniu komfortu pacienta. V ostatných
sledovaných parametroch mali AKC podobný až rovnaký účinok ako štandardné krytie.
Kultivácia keratinocytov je nesmierne náročná metóda. Kladie vysoké požiadavky na
vybavenie laboratória a manuálne zručnosti pracovníkov zabezpečujúcich kultiváciu, z čoho
vyplýva aj pomerne vysoká cena takéhoto epitélia. Neoceniteľným prínosom je však ich
schopnosť enormnej expanzie, kedy možno z malej kožnej biopsie vykultivovať pri
optimálnych podmienkach niekľkotisíc cm2 epitélia.
Aj keď sa rozdiel v rýchlosti epitelizácie z dlhodobého hľadiska nepreukázal, použitie AKC
sa zdá byť výhodné z hľadiska zabránenia prenikaniu infekcie, zníženia bolestivosti a tým
zvýšenia komfortu pacienta a vytvárania vhodného prostredia pre zhojenie rany.
Zoznam literatúry
1. Kamolz, LP, Kitzinger HP, Andel H, Frey M: The surgical treatment of acute burns.
European Surgery. 2006; 38(6): 417-423
2. Magliacani G. a spol.: The surgical treatment of burns: Skin substitues. Annals of the
MBC. 1990; 3 (9):145-160
3. Hanafy A, Hemieda M, Badran HA, Frey M: Cultured allogenic keratinocyte grafts in
treatment of burns: Preliminary Report. Egypt. J. Plast. Surg. 2002; 26 (2): 161-165
4. Dvoránková B, Broz L, Pafcuga L, Kapounková Z, Konigová R: The role of skin
bank in the treatment of severely burnt patients. Acta Chirugie Plasticae. 2004; 46 (2):
51-5
119
5. Dhennin C. : Skin substitues and skin culture. La revue du praticien. 2002; 15(12):
2249-52.
6. Nagase T., Kumagai N: Treatment of burns by grafting of cultured epithelium. Nippon
Geka Gakkai Zasshi. 2005; 106(12): 750-4
7. Nanchahal J, Dover R, Otto WR: Allogeneic skin substitues applied to burns patients.
Burns. 2002; 28(5): 254-7
8. Smirnov SV, Vasiliev AV, Paramonov BA, Loginov L, Kiseliov LV, Danilova TI,
Tereskikh VV: Seven-year experience in the treatment of burn patients with allogenic
cultured keratinocytes. Annals of Burns and Fire Disaster, 1999;12(4): 212-217
9. Rheinwald J.G., Green H: Serial cultivation of strains of human epidermal
keratinocytes. The formation of keratinizing colonies from singel cells. Cell. 1975;
6(3): 331-43
120
27. Prognostické faktory zápalových komplikácií v šestonedelí
MUDr. Maľová Andrea
Spoluautor: MUDr. Parrák Vojtech, CSc.2
Školiteľ: Doc. MUDr. Martin Redecha, PhD.1
1
I. gynekologicko-pôrodnícka klinika LFUK a FNsP, Antolská 11, Bratislava, 2KHaT LF UK
a FNsP, Antolská 11, Bratislava
Úvod
Tehotenstvo, pôrod a šestonedelie sú často sprevádzané rôznymi patologickými stavmi.
Medzi najčastejšie komplikácie gravidity, pôrodu aj šestonedelia patria, okrem iných, aj
infekčné resp. zápalové komplikácie. Puerperálne infekcie patrili v minulosti k
najzávažnejším popôrodným komplikáciám a spolu s preeklampsiou a krvácaním boli
najčastejšou príčinou materskej umŕtnosti. Objav antibiotík a ich zavedenie do praxe
v dvadsiatom storočí, bol prelomom v boji s infekčnými chorobami. Aj napriek úspechom
antibiotickej liečby však zostávajú puerperálne infekcie častou príčinou materskej morbidity.
S rozšíreným používaním antibiotík vznikli úplne nové problémy, nozokomiálne infekcie,
ktoré sú vyvolané rezistentnými baktériami.
Napriek súčasnému, intenzívnemu záujmu o tehotnú ženu, pôrod a šestonedelie, nie sú
jednoznačne definované zápalové markery, ktorých stanovenie v krvi tehotnej ženy, rodičky
alebo šestonedieľky, by jednoznačne potvrdilo prítomnosť infekcie. Pre klinickú prax nie sú
dostupné štandardné postupy, ktoré by uľahčovali prácu gynekológov a pôrodníkov. Za
fyziologických okolností prebiehajú počas gravidity, pôrodu aj v šestonedelí zmeny
v organizme matky, ktoré sa odrážajú i v laboratórnych parametroch. V doterajšej klinickej
praxi sa na väčšine gynekologicko–pôrodníckych oddelení Slovenska využíva pri diagnostike
zápalových ochorení stanovenie hladiny C–reaktívneho proteínu (CRP). CRP je základný
zápalový marker v chirurgických aj nechirurgických odboroch. Iné zápalové markery dosiaľ
nenašli celoplošné uplatnenie.
Prokalcitonín (PCT) je prohormón kalcitonínu. Prvýkrát bol izolovaný v roku 1984 v bunkách
medulárneho karcinómu štítnej žľazy. U pacientov bez systémovej infekcie sa PCT správa
ako hormón. Systémová mikrobiálna infekcia, najmä bakteriálna, ale aj mykotická
a parazitárna, indukuje tvorbu PCT v mnohých orgánoch a tkanivách a rôznych bunkách
celého organizmu. Induktormi tvorby „zápalového PCT“ sú zložky mikroorganizmov
a prozápalové cytokíny. Hladina PCT počas systémovej infekcie stúpa 100-10 000 násobne
(1)
. Vplyv kontrakčnej činnosti uteru a reparačných zmien v šestonedelí na hladiny PCT do t.č.
nebol publikovaný rovnako ako hladiny PCT u pacientok s puerperálnou infekciou.
Materiál a metódy
Klinický súbor tvorí 95 pacientok, ktoré rodili na I. gynekologicko-pôrodníckej klinike FNsP
a LF UK v Bratislave od apríla 2009 do marca 2010. Klinické sledovanie bolo schválené
etickou komisiou FNsP Bratislava 22. 01. 2009. Všetky pacientky zaradené do súboru
podpísali informovaný súhlas, ktorý je súčaťou dokumentácie. Pacientky, ktoré rodili
121
predčasne, pred 37. týždňom gravidity neboli do súboru zaradené. Zo súboru boli vyradené
pacientky s kortikoidnou terapiou. Súbor je rozdelený do 5 skupín.
1.
skupina: pacientky po vaginálnom pôrode bez puerperálnej infekcie
2.
skupina: pacientky po elektívnom cisárskom reze bez puerperálnej infekcie
3.
skupina: pacientky po cisárskom reze, ktorým predchádzala kontrakčná činnosť
4.
skupina: pacientky po operačnom vaginálnom pôrode
5.
skupina: pacientky s puerperálnou infekciou
V jednotlivých skupinách sme porovnávali vývoj hladín zápalových parametrov 1., 2. a 4. deň
po pôrode. Každej pacientke zaradenej do súboru, boli stanovené sledované zápalové
parametre aj pred pôrodom, t.j. po 37. týždni gravidity, v kľudovej fáze uteru, bez kontrakčnej
činnosti.
Sledované zápalové parametre: CRP a PCT.
Výsledky
V skupinách 1, 2 , 3 a 4 poukazujeme na fyziologický vývoj hodnôt vyššie spomenutých
zápalových markerov po vaginálnom pôrode, po cisárskom reze a operačnom vaginálnom
pôrode. Štatisticky významne vyššie hodnoty markerov zápalu sme zistili v prvý, druhý aj
štvrtý popôrodný deň v skupinách 1, 2 , 3 a 4. Nevýznamné rozdiely sú vo všetkých
sledovaných obdobiach v skupinách 2 a 3. Skupinu 5 tvoria pacientky s purperálnou
infekciou, s eleváciou zápalových parametrov s porovnaním s predchádzajúcimi
skupinami.Vo všetkých realizovaných meraniach PCT ( u pacientok bez puerperálnej infekcie
aj s puerperálnou infekciou) bola hladiny PCT pod 0.5 ng/ml. Vzhľadom na nízky počet
pacientok v súbore 5–pacientky s puerperálnou infekciou, nie je možné spoľahlivé štatistické
vyhodnotenie súboru 5.
Diskusia
Počas pôrodu (vaginálneho alebo cisárskeho rezu) dochádza k elevácii CRP. Zatiaľ však
neboli stanovené fyziologické hodnoty CRP v prvých dňoch šestonedelia (2) . Úloha PCT ako
zápalového markeru infekčného zápalu už bola dokázaná. Vzostup PCT koreluje so
závažnosťou infekcie a mortalitou. Elevácia hladiny PCT je rýchlejšia ako u CRP (3, 4).
Využitie PCT v diagnostike intrauterinnej infekcie pri predčasnom pôrode je kontroverzná (5,
6).
Hladiny PCT ako zápalového markeru v šestonedelí boli doposiaľ málo sledovaným
parametrom, v literatúre sú dostupné len ojedinelé a nejasné informácie. Sledovanie PCT
v skupinách 1-5 poukazuje na jeho kontroverzné využitie aj pri puerperálnych infekciách.
Zoznam použitej literatúry
1. Bucová M, Prokalcitonín-prohormón, hormokín, mediátor zápalu, doagnostický
a prognostický marker systémového zápalu Českoslov Fyziol 2005, 54, 97-107
2. Redecha M, a kol., Hladiny C–reaktívneho proteínu po cisárskych rezoch Prakt
Gynek 2006,13, 50–53
3. Resch B, et al., Procalcitonin and interleukin 6 in the diagnosis of early onset
sepsis neonates Acta Pediatr 2003, 92, 243-245
122
4. Al Nawas B, et al., Procalcitonin in the diagnosis of severe infections Eur J Med
Res, 1996, 331-333
5. Monneret G, et al., Procalcitonin, C-reactice protein level in neonatal infections
Acta Pediatr 1997, 86, 209-212
6. Bloomendahl J, et al., Comparison of procalcitonin with C-reactive protein and
differential white blood cell count for diagnosis culture proven neonatal sepsis
Scand J Infect Dis 2002, 34, 620-622
123
28. Význam jednotlivých parametrov rizikového profilu pacienta s nízkou kostnou
denzitou (FRAX) z hľadiska predikcie fraktúr a vývoja kostnej denzity
MUDr. Eva Lalciková
Školiteľ: Doc. MUDr. Zdenko Killinger, Csc.1
1
V. Interná klinika FNsP a LFUK, Nemocnica Ružinov, Bratislava
Úvod
Osteoporóza je ochorenie charakterizované nízkym objemom kostnej hmoty a poruchou
mikroarchitektúry kostného tkaniva vedúce k zvýšenej lámavosti kostí a k následnému
zvýšeniu rizika fraktúry. Prebieha nenápadne, klinické príznaky ako bolesti v oblasti
postihnutej kosti, zníženie telesnej výšky, deformity chrbtice sú často neskoré, nešpecifické a
prvým príznakom upozorňujúcim na toto ochorenie je často až komplikácia - fraktúra(1),
ktorá okrem zníženia kvality života predstavuje enormnú medicínsku aj ekonomickú záťaž.
V diagnostike sa využíva denzitometrické stanovenie kostnej denzity femuru a lumbálnej
chrbtice, pričom vyšetrenie sa má hodnotiť na základe oblasti s najnižšou kostnou denzitou
(2). Výsledkom denzitometrického merania je hodnota hustoty kosti vyjadrená v g/cm2,
alebo častejšie ako T skóre (počet štandardných odchýlok od priemernej hodnoty kostnej
denzity u mladých dospelých vo veku ich maximálnej kostnej denzity). WHO definuje
osteoporózu a osteopéniu na základe hodnôt týchto ukazovateľov (Tabuľka. č.1).
Tabuľka č.1: Definícia osteoporózy na základe hodnôt
denzitometrického vyšetrenia:
Zdravá kosť: T skóre nad -1
Osteopénia: T skóre medzi -1 a -2,5
Osteoporóza: T-skóre menej ako -2,5
Ťažká osteoporóza: osteoporóza s netraumatickou fraktúrou
V súčasnosti je antiresorbčná liečba indikovaná na základe hodnoty kostnej denzity, (T skóre
v pásme osteoporózy pod – 2,5), teda jedného kvantitatívneho ukazovateľa. Vzhľadom na
fakt, že viac ako polovica fraktúr vzniká u pacientov, ktorých hodnota T skóre sa pohybuje v
oblasti osteopénie (3), je potrebné vyselektovať z tejto skupiny tých pacientov, u ktorých je
vysoké riziko vzniku fraktúr. WHO preto vyvinulo FRAX ( z anglického fracture risk
assesment tool), dotazníkový elektronicky dostupný nástroj, vďaka ktorému je možné
stanoviť 10 ročné absolútne riziko fraktúry proximálneho femuru a veľkej osteoporotickej
fraktúry (definovanej ako klinicky vyznačená fraktúra predlaktia, chrbtice, humeru alebo
proximálneho femuru) pacienta doteraz neliečeného na osteroporózu. Pozostáva z 12 otázok
(4) (Tabuľka č.2).
124
Tabuľka č. 2 - 12 otázok dotazníka FRAX
Vek
Hmotnosť
Výška
Pohlavie
Predošlá fraktúra
Fraktúra krčka femuru u rodiča
Fajčenie
Reumatoidná artritída
Sekundárna osteoporóza
Alkohol
Kortikoidy
T skóre krčka femuru
Je možné vypočítať hodnoty z FRAX-u aj bez hodnoty kostnej denzity, čo by bolo
perspektívne využiteľné u lekárov prvého kontaktu. Hranica terapeutickej intervencie však
musí byť stanovená pre každú krajinu nakoľko je podmienená aj ekonomickými možnosťami.
Podľa odporúčaní IOF (International Osteoporosis Foundation) pre USA, každý pacient s
rizikom veľkej osteoporotickej zlomeniny vyšším ako 20 % a s rizikom zlomeniny krčka
femuru vyšším ako 3% je indikovaným na antiporotickú liečbu (5).
Metódy
Využívame dotazníkovú metódu s 12 otázkami predstavujúcimi položky rizikového profilu
(rizikové faktory z FRAX-u) na ktoré sú odpovede typu áno - nie. Tiež využívame hodnotu T
skóre z denzitometrického vyšetrenia. Tieto údaje dopĺňame do elektronickej formy FRAXu a
stanovujeme hodnotu 10-ročného rizika veľkej osteoporotickej fraktúry a fraktúry krčka
femuru. Tiež stanovujeme riziko len na základe BMI a rizikových faktorov, teda bez udania
hodnoty T skóre. Našim cieľom je stanoviť hodnotu 10 ročného rizika fraktúr, pri ktorej dnes
nasadzujeme antiresorpčnú liečbu a zistiť aký podiel pacientov z jednotlivých skupín by sme
liečili ak by sme nasadzovali liečbu na základe nami zistenej hodnoty rizika fraktúry resp.
hodnoty navrhovanej IOF.
Výsledky
V našom súbore sme spracovali 147 pacientov vyšetrených denzitometricky v oblasti krčka
femuru v Osteocentre FNsP Ružinov. Z tohto počtu 66 pacientov zapadalo do pásma
osteopénie, 32 pacientov do pásma osteoporózy, ostatní ( t.z. 49 pacientov) mali T skóre v
oblasti normy.
V skupine osteoporotických pacientov priemerná hodnota rizika veľkej osteoporotickej
fraktúry bola 34,19% a priemerná hodnota rizika fraktúry krčka femuru 18,58%. Pri stanovení
rizika fraktúr na základe BMI ale bez hodnoty T skóre, dospeli sme k hodnotám 29,2 % resp.
15,39%.
125
V skupine osteopenických pacientov priemerná hodnota rizika veľkej osteoporotickej fraktúry
bola 14,2% a priemerná hodnota rizika fraktúry krčka femuru 4,7%. Pri stanovení rizika
fraktúr na základe BMI a rizikových faktorov, ale bez hodnoty T skóre, sme dospeli k
hodnotám 18,8%, resp. 8,99%.
V skupine pacientov s T skóre v oblasti normy bola priemerná hodnota rizika veľkej
osteoporotickej fraktúry 6,55 % a priemerná hodnota rizika fraktúry krčka femuru 0,6 %. Pri
stanovení rizika fraktúr na základe BMI a rizikových faktorov, ale bez hodnoty T skóre, sme
dospeli k hodnotám 11,16%, resp. 3,75%.
Diskusia
Po spracovaní dát pomocou FRAX-u sme dospeli k záveru, že v našej skupine pacientov
všetci s hodnotou T skóre v oblasti osteoporózy mali hodnotu rizika FRAX-u v oblasti
indikovanej na liečbu podľa kritérii IOF v skupine pacientov s hodnotu T skóre v oblasti
osteopénie sme vyselektovali spolu 34 pacientov zo 66, teda 51,5% , u ktorých by sme na
základe hodnoty T skóre k liečbe nepristúpili, ale na základe hodnoty rizika fraktúry áno (u
14 pacientov na základe hodnoty rizika fraktúry krčka femuru, u 20 na základe hodnoty rizika
fraktúry krčka femuru aj veľkej osteoporotickej fraktúry). V skupine pacientov s hodnotou T
skóre v oblasti normy 1 pacient mal hodnotu rizika fraktúry krčka femuru v indikačnom
rozmedzí na liečbu (4,6%). Ak sme brali do ohľadu nami stanovenú hranicu – teda 34% a 18
%, indikovaných na liečbu z osteoporotickej skupiny by bolo 20 pacientov, z osteopenickej
skupiny 7 pacientov, teda menej pacientov ako pri použití údajov IOF.
Súčasné metódy diagnostiky a indikácie pacientov s osteoporózou na antiresorbčnú liečbu
hodnotia kvantitatívny parameter - kostnú denzitu v čase vyšetrenia. Nízka kostná denzita je
základným, nie však jediným predpokladom pre vznik fraktúry asociovanej s osteoporózou,
signifikantný vplyv majú aj ostatné faktory rizikového profilu pacienta, ktoré sú z veľkej časti
zahrnuté práve vo FRAX-e. Počítanie rizika fraktúry pomocou FRAXu na základe BMI bez
hodnoty BMD by mohlo slúžiť praktickým lekárom pri rozhodovaní indikácie
denzitometrického vyšetrenia, nami stanovená hranica, pri ktorej by sa denzitometrické
vyšetrenie mohlo zvažovať je 29% pre veľkú osteoporotickú fraktúru a 15% pre fraktúru
krčka femuru.
Literatúra
1. Marcus,R, Bouxsein, M: The Nature of osteoporosis.In Marcus R, eds. Osteoporosis.
Third edition. Volume I. USA,UK, Elsevier Academic Press, 2008, 27-36.
2. Killinger Z, Payer J, Baqi L, Hrúziková P: Diagnostika osteoporózy. Via practica
2005; 2 {11): 442-445
3. Schuit, SCE, et al: Fracture incidence and association with bone mineral density in
elderly men and wome: the Rotterdam Study. Bone 2004; 34: 195-202.
4. Francis RM: Fracture risk assesment. Current Orthopaedics 2008, 22: 322-327
5. National Osteoporosis Foundation: Clinician´s Guide to Prevention and Treatment of
Osteoporosis. Washington, NOF. 2008, 1-37.
126
29. Porovnanie efektu mydriázy dvoma rôznymi spôsobmi pred operáciou sivého zákal
MUDr. Branislav Trnavec
Školiteľ: prof. MUDr. Andrej Černák, DrSc.
Očná klinika SZU, Bratislava
Úvod
Operácia katarakty sa za posledné desaťročia mimoriadne zdokonalila , pokrok nastal aj v
prípravnej fáze pri príprave pacienta.
Pre extrakapsulárnu extrakciu katarakty, pre hladký operačný priebeh je dôležitá dobrá
mydriáza. Rozšírenie zrenice docielime podaním mydriatík do spojovkového vaku, alebo
intrakamerálne. Obyčajne sa používa kombinácia parasympatolytík a sympatomimetík.
My sme sledovali rozšírenie zrenice pred operáciou katarakty po topickom podaní mydriatík
do spojovkového vaku a porovnali sme s mydriázou, ktorú sme dosiahli pomocou
mydratického roztoku podaného do dolného fornixu na nasiaknutom merocele. Použili sme tie
isté mydriatiká.
Materiál a metódy
V prospektívnej štúdii sme sledovali 100 po sebe idúcich pacientov s kataraktou (60 žien, 40
mužov). Priemerný vek pacientov bol 70,17 rokov (42- 91). U 14 pacientov bol okrem
katarakty aj glaukóm s otvoreným uhlom, diabetes mellitus II. typu mali 7 pacienti súboru a 1
pacientka prekonala negranulomatóznu prednú uveitídu v minulosti.
Pacientov sme rozdelili po 50 do A a B skupiny. V skupine A sme 2x topicky podali v
priebehu 10-15 minút do spojovkového vaku 0,5% tropikamid, 10% fenylefrín, 4%
homatropín.
Pacientom v B skupine sme aplikovali do dolného fornixu asi 30-40 minút pred operáciou
merocel (sugi) napustené v mydriatickom roztoku. Mydriatický roztok sme „namiešali“ z
0,5% tropikamidu, 10% fenyefrínu a 4% homatropínu v rovnakom pomere. Iná medikácia na
dilatáciu zrenice použitá nebola v A ani B skupine pacientov.
Cieľom práce bolo porovnať dosiahnutú predoperačnú šírku zrenice u A a B skupiny
pacientov.
Po navodení mydriázy sme mierkou pod mikroskopom zmerali horizontálny priemer zrenice
na povrchu rohovky. Merania sme robili pri rovnakej intenzite svetla v mikroskpoe aj v
miestnosti.
Tiež sme zaznamenávali subjektívne, objektívne obtiaže v oboch skupinách pacientov.
Po mydriáze a zmeraní diametra zrenice nasledovala rutinná operácia katarakty malým
rohovkovým rezom, implantovala sa akrylátová šošovka do púzdra.
127
Výsledky
Sledovali sme arteficiálnu maximálnu mydriázu u 100 pacientov na 100 očiach pred
operáciou katarakty, ktorých sme rozdelili do dvoch skupín A a B po 50 pacientov.
Priemerná mydriáza v A skupine pacientov bola 7,84 ± 0,99 (mm), v tejto skupine sme
nakvapkali do spojovkového vaku 0,5% tropikamid, 10% fenyefrín, 4% homatropín.
V B skupine pacientov bola priemerná mydriáza 7,94 ± 1,03 mm, tu sme použili merocel
nasiaknutý v mydriatickom roztoku z tých istých mydriatík ako v skupine A (tabuľka 1).
Nezaznamenali sme významný rozdiel v diametri zreníc medzi A a B skupinou pacientov.
Subjektívne aj objektívne obtiaže pacientov sú zaznamenané v tabuľke 2. Až 18 % pacientov
v B skupine malo eróziu rovkového epitelu.
V oboch skupinách pacientov sme dosiahli dobré rozšírenie zreníc, systémové (obehové)
nežiadúce účinky sme nepozorovali u žiadneho pacienta.
A skupina
B skupina
7,84 ± 0,99
7,94 ± 1,03
Tab.1: Priemerná mydriáza (mm) v A a B skupine pacientov
A skupina
B skupina
Pálenie
1
3
Rezanie
0
2
Bolesť
0
1
Erózia epitelu
0
9
Tab. 2: Subjektívne, objektívne obtiaže (počet pacientov) v A vs B skupine
Diskusia
V našej práci sme u oboch skupín pacientov docielili veľmi dobrú priemernú maximálnu
mydriázu.
V B skupine pacientov (merocel nasiaknutý v mydriatickom roztoku) sa vyskytli subjektívne
aj objektívne obtiaže, pálenie, rezanie, bolesť očí. Až 18 % pacientov v tejto skupine malo
eróziu rohovkového epitelu. Tieto obtiaže zapríčinil trojuholníkový tvar a veľkosť merocelu,
ktorý sme vložili pacientom do dolného fornixu spojovkového vaku. Ak by sme použili iný
tvar a menší nasiaknutý merocel, oči po vložení merocelu prelepili, pravdepodobne by neboli
obtiaže ani v tejto skupine pacientov.
Topické podanie mydriatík pred operáciou katarakty má určité nevýhody ako pomalý nástup
mydriázy, vyššie riziko lokálnych i celkových vedľajších účinkov (kardiovaskulárnych) u
predisponovaných pacientov (1). Mydriatiká sa zo spojovkového vaku do určitej miery
128
systémovo absorbujú a preto treba zohľadniť aj možné interakcie s ostatnými užívanými
liečivami.
Alternatívou k instilačne navodenej mydriáze predoperačne je peroperačné rozšírenie zrenice
mydriatikami intrakamerálne (2, 3, 4). Pri apikácii intrakamerálnych mydriatík stačí použiť
malé množstvo (menšie než pri topikálnej mydriáze) a tým sa riziko vedľajších účinkov
významne redukuje (5).
Na peroperačnú intrakamerálnu mydriázu sa často používa 1% lidokain (3, 4, 2). Lidokain je
antiarytmikum a účinné lokálne anestetikum po podaní do prednej očnej komory vyvolá
okamžité rozšírenie zrenice (3). Avšak mydriáza je slabšia než pri topicky podaných
mydriatikách-naša práca tento poznatok potvrdila (4, 5, 2). Podanie 1% lidokainu
intrakamerálne sa osvedčilo na opätovné rozšírenie zrenice u pacientov s floppy-iris
syndrómom (1).
Za nevýhodu 1% lidokainu považujeme možnosť kontaminácie pri príprave, keďže 1%
originálny prípravok na trhu nie je a musí sa riediť 2% lidokain (2).
Štandardne navodená predoperčná mydriáza u pacientov v oboch našich súboroch bola veľmi
dobrá, podobný diameter zreníc dosiahli Lundberg a Behndig u svojich pacientov v topickej
skupine (5). Systémové nežiadúce účinky sme v našom súbore u žiadneho pacienta
nepozorovali.
Topická klasicky navodené predoperačná mydriáza má svoje pevné miesto aj v dnešnej
modernej chirurgii katarakty.
Zoznam použitej literatúry
1. Intracameral mydriatic delivery: simplifying the proces. Ophthalmology Times
Europe, October 2007, 21.
2. Marešová, K., Procházková, J.: Operace katarakty bez předoperační mydriázy. Cesk
Slov Oftalmol, 2009, 65(1): 16-18.
3. Lee, JJ., Moster, MR, Henderer, JD., Membreno, JH: Pupil dilation with intracameral
1% lidocaine during glaucoma filtering surgery. Am J Ophthalmol. 2003, 136(1): 201203.
4. Lundberg, B., Behndig, A.: Separate and additive mydriatic effects of lidocaine
hydrochloride, phenylephrine, and cyclopentolate after intracameral injection. J
Cataract Refract Surg, 34, 2008, 2: 280-283.
5. Lundberg, B., Behndig, A.: Intracameral mydriatics in phacoemulsification cataract
surgery. J Cataract Refract Surg, 29, 2003, 12: 2366-2371.
129
30. Diagnostika patológie endometria u žien v postmenopauze.
MUDr. Ing. Horst Urban
Školiteľ: prof. MUDr. Miroslav Borovský, CSc.1
1
I. Gynekologicko-pôrodnícka klinika LFUK a FNsP Bratislava
Úvod
Podozrením na patológiu endometria v postmenopauzálnom období života ženy sú klinicky sa
manifestujúce abnormálne krvácanie a suspektný ultrasonografický nález endometria
diagnostikovaný pri preventívnej gynekologickej prehliadke. Tieto nálezy sú vždy dôvodom
ku ďalšej diagnostike, ktorou je histologizácia endometria. Táto sa môže realizovať
probatórnou kyretážou, alebo za pomoci hysteroskopického vyšetrenia cielenou kyretážou
alebo cielenou biopsiou endometria priamo zo suspektného patologického ložiska.
Najčastejšími histopatologickými nálezmi na endometriu sú atrofia endometria, polyp
endometria, endometriálna hyperplázia bez atypii, alebo s atypiami a endometriálny resp.
endometroidný adenokarcinóm. Cieľom práce bolo porovnanie ultrasonografie endometria a
diagnostickej hysteroskopie s výsledkom histologického vyšetrenia materiálu získaného
frakcionovanou kyretážou.
Materiál a metódy
Do štúdie bolo zaradených 55 postmenopauzálnych žien s podozrením na patológiu
endometria vo veku od 51r. do 82r. (stredný vek 63,6 rokov). Podozrením na patológiu
endometria bolo u 32 pacientok (58,2%) abnormálne postmenopauzálne krvácanie a u 23
pacientok (41,8%) suspektný ultrasonografický nález. U 18 pacientok (32,7%) bola v
anamnéze kyretáž v období peri a postmenopazy. Všetky pacientky boli vyšetrené
hysteroskopicky a bola u nich vykonaná frakcionovaná kyretáž. Získaný materiál bol
odoslaný na histologické vyšetrenie. Výsledky hysteroskopického a ultrasonografického
vyšetrenia boli porovnané s histologickým vyšetrením materiálu získaného pri frakcionovanej
kyretáži.
Výsledky
Nereprezentatívne množstvo materiálu bolo odoslané na histologické vyšetrenie u 8 pacientok
(14,5%). Atrofia endometria bola pozorovaná v 8 prípadoch (14,5%) a v rovnakom počte
prípadov bolo kyretážou získané endometrium bez atrofie resp. bez známok dysplázie.
Takmer u jednej tretiny pacientok (29,1%) bol diagnostikovaný endometriálny polyp. U 4
vyšetrených pacientok (7,3%) bola diagnostikovaná hyperplázia endometria bez atypii a u 3
pacientok (5,4%) bola diagnostikovaná hyperplázia endometria s atypiami. Histologickým
vyšetrením bola u 8 pacientok (14,5%) potvrdená malignita. Najčastejšou histopatologicky
potvrdenou malignitou z materiálu získaného kyretážou dutiny maternice boli endometriálny
karcinóm 87,5% s podtypmi endometroidného adenokarcinómu (62,5%), adenoskvamózneho
karcinómu (12,5%) a adenoserózneho karcinómu (12,5%). Menej častým typom malignity bol
sarkóm (12,5%). V skupine pacientok s histologicky potvrdeným nálezom malignity
endometria bolo abnormálne krvácanie prítomné u 27% pacientok a u 87,5% pacientok bola
130
ultrasonografickým vyšetrením nameraná šírka endometria viacej ako 5mm. Malignita bola
u 25% pacientok spojená s anamnézou abnormálneho krvácania a súčastne s ultrazvukovo
nameranou šírkou endometria viacej ako 5mm. Výsledky porovnania hysteroskopického
vyšetrenia a histologického vyšetrenia sú zobrazené v tab. č.1, porovnanie ultrazvukovej šírky
endometria s histologickým vyšetrením sú zobrazené v tab. č. 2.
Histológia
Nereprezentatívne
množstvo
materiálu
Atrofia
Endometrium
bez
atrofie
resp.
dysplázie
Endometriálny
polyp
bez
dysplázie
Hyperplázia
bez atypii
Hyperplázia
s atypiami
Malignita
Nízka
sliznica, n=14
6
5
2
-
1
-
-
Stredne
vysoká
sliznica, n=3
1
-
1
1
-
-
-
Vysoká
sliznica, n=3
-
-
-
-
-
1
2
Nepravidelná
sliznica, n=3
-
-
1
-
1
1
-
Polypoidná
sliznica, n=6
-
2
1
-
1
-
2
Polyp, n=26
1
1
3
15
1
1
4
Hysteroskopia
Tab. č. 1: Porovnanie výsledku hysteroskopie s histologickým nálezom.
Histológia
Nereprezentatívne
množstvo
materiálu
Atrofia
Endometrium
bez
atrofie
resp.
dysplázie
Endometriálny
polyp
bez
dysplázie
Hyperplázia
bez atypii
Hyperplázia
s atypiami
Malignita
≤ 5mm,
n=16
2
4
4
2
2
1
1
> 5mm,
n=39
6
4
4
14
2
2
7
TVUSG
Tab. č. 2: Porovnanie ultrazvukovej šírky endometria s histologickým nálezom.
Diskusia
Z výsledkov vyplýva relatívne veľká diskrepancia medzi hysteroskopickým nálezom polypu
endometria a histopatologickým nálezom polypu endometria v odoslanom materiály.
Korelácia nálezov bola len na úrovni 57,7% prípadov, pričom v literatúre sa popisuje
131
špecificita vyšetrenia až u 100% (1). Limity ultrasonografického vyšetrenia odzrkadľuje nález
hyperplázie endometria u 18.8% pacientok, v skupine pacientok s ultrazvukovým nálezom
hrúbky endometria do 5mm. Kyretážou dutiny maternice sa správna diagnóza nemusí určiť až
u každej desiatej pacientky. Táto skutočnosť sa pripisuje tomu, že kyretážou sa nepodarí
odobrať reprezentatívny materiál z celej dutiny maternice, pričom problematickým je odber
vzorky endometria hlavne pri fokálnych léziách.
Vzhľadom na frekvenciu výskytu endometriálneho karcinómu a jeho dobré terapeutické
možnosti v ranných štádiách ochorenia, je v popredí snaha o jeho skorý záchyt (2, 3). Medzi
základné skríningové vyšetrenia patológie endometria patrí transvaginálna ultrasonografia.
Viaceré práce dokazujú pri hrúbke endometria nad 5mm relevantnosť ďalších diagnostických
opatrení (4). Hysteroskopia má v diagnostickom algoritme chorôb endometria u žien
v postmenopauze svoju nezastupiteľnú úlohu a v dnešnej dobe by pri podozrení na patológiu
endometria mala patriť k zaužívanému štandardu klinickej praxe (5). Pri histologizácii
endometria pred zavedením hysteroskopie, bolo veľa vzoriek hodnotených patológom ako
atrofia endometria resp. málo reprezentatívny materiál. Bolo zistené, že u žien s negatívnou
histologizáciou endometria a pretrvávajúcim abnormálnym krvácaním, malo až 20%
pacientok diagnózu atypickej hyperplázie, resp. rakoviny endometria (6).
Záverom sa dá konštatovať, že hysteroskopia s frakcionovanou kyretážou je spoľahlivou
metódou pri diagnostike endometriálnej patológie a v dnešnej dobe by mala byť aj
v slovenských podmienkach zlatým štandardom.
Zoznam použitej literatúry
1. Schmidt T, Breidenbach M, Nawroth F, Mallmann P, Beyer IM, Fleisch MC, Rein
DT: Hysteroscopy for asymptomatic postmenopausal women with sonographically
thickened endometrium. Maturitas 2009; 62: 176–178.
2. Münstedt K, Grant P, Woenckhaus J, Roth G, Tinneberg HR: Cancer of the
endometrium: current aspects of diagnostics and treatment. World J Surg Oncol. 2004;
2: 24.
3. Wingo PA, Ries LA, Rosenberg HM, Miller DS, Edwards BK: Cancer incidence and
mortality, 1973–1995: a report card for the US. Cancer 1998; 82: 1197–1207.
4. Gupta JK, Chien PF, Voit D, Clark TJ, Khan KS:Ultrasonographic endometrial
thickness for diagnosing endometrial pathology in women with postmenopausal
bleeding: a meta-analysis. Acta Obstet Gynecol Scand. 2002; 81(9): 799-816.
5. Ribeiro CT, Rosa-E-Silva JC, Silva-de-Sá MF, Rosa-E-Silva AC, Poli Neto OB,
Candido Dos Reis FJ, Nogueira AA: Hysteroscopy as a standard procedure for
assessing endometrial lesions among postmenopausal women. Sao Paulo Med J. 2007;
125(6): 338-342.
6. Rose PG: Endometrial carcinoma. N Engl J Med 1996; 335: 640-649.
132
31. Stanovenie kalcifikácií abdominálnej aorty využitím denzitometrického vyšetrenia
MUDr. Kristína Brázdilová
Spoluautori: MUDr. Daniel Čierny, doc. MUDr. Zdenko Killinger, PhD.
Školiteľ: prof. MUDr. Juraj Payer, CSc.
V. interná klinika LFUK a FNsP, Bratislava
Úvod
Prítomnosť kalcifikácií abdominálnej aorty sa stala ukazovateľom včasných
aterosklerotických zmien (1), zvýšeného kardiovaskulárneho rizika, a zároveň aj vyššej
morbidity a mortality nielen na ochorenia kardiovaskulárneho systému (2). Na základe
posledných pozorovaní možno ich prítomnosť hodnotiť ako signifikantný prediktor rizika
infarktu myokardu alebo náhlej cievnej mozgovej príhody, a to nezávisle od ďalších
kardiovaskulárnych rizikových faktorov (3, 4). Existujú aj údaje o asociácii kalcifikácií
abdominálnej aorty s prevalentnými vertebrálnymi fraktúrami a zároveň progresiou úbytku
kostnej hmoty (5). V súčasnosti možno stanoviť tieto zmeny na aorte aj pomocou
denzitometrického vyšetrenia, ktoré nám zároveň umožňuje zhodnotiť ich vzťah s kostnou
denzitou. Cieľom našej práce bolo zhodnotiť prítomnosť kalcifikácií abdominálnej aorty u
neselektovaného súboru pacientiek – postmenopauzálnych žien – odoslaných na
denzitometrické vyšetrenie do nášho osteocentra.
Metodika
V našej štúdii sme použili na stanovenie prítomnosti kalcifikácií abdominálnej aorty
denzitometrické vyšetrenie, ktoré je rýchle, neinvazívne, finančne a časovo nenáročné a pre
pacienta znamená vystavenie zanedbateľnej dávke ožiarenia (6). Okrem skenov lumbálnej
chrbtice a proximálneho femuru, projekcií používaných v bežnej praxi osteologickej
ambulancie, sme realizovali aj bočné skeny, ktoré umožňujú zhodnotenie spomínaných zmien
na stene aorty a súčasne aj prípadných vetebrálnych deformít alebo patologických fraktúr (7).
Na semikvantitatívne hodnotenie identifikovaných kalcifikácií abdominálnej aorty sme
použili skórovacie systémy AAC8 a AAC24 (7).
Semikvantitatívne AAC8 skóre stanovuje celkovú dĺžku kalcifikačného plátu na oboch
stenách aorty v dĺžke L1-L4 (3):
0 – neprítomnosť kalcifikácií
1 – do rozsahu tela jedného stavca
2 – viac než jeden, ale menej než dva stavce
3 – viac než dva, ale menej než tri stavce
4 – viac než tri stavce
133
Semikvantitatívne AAC24 skóre hodnotí kalcifikácie prednej a zadnej steny aorty v rozsahu
L1-L4 separátne pre jednotlivé stavce, pričom hodnotenia prednej a zadnej steny aorty sa
nakoniec zrátajú (3):
0 – neprítomnosť kalcifikácií
1 – menej ako 1/3 dĺžky tela stavca
2 – 1/3 až 2/3 dĺžky tela stavca
3 – viac ako 2/3 dĺžky tela stavca
Skóre 3 a viac (AAC8) resp. 6 a viac (AAC24) má u starších žien nad 75 rokov prediktívnu
hodnotu pre rozvoj infarktu myokardu alebo náhlej cievnej mozgovej príhod (3).
Výsledky
Hodnotili sme prítomnosť kalcifikácií abdominálnej aorty u postmenopauzálnych žien
dispenzarizovaných v našom osteocentre. Zároveň sme stanovili AAC24 skóre u pacientiek s
identifikovanými kalcifikáciami a korelovali získané výsledky so základnými
antropometrickými ukazovateľmi (vek, výška, hmotnosť, BMI) a zistenými kompresívnymi
fraktúrami.
Celkový počet pacientiek
70
Priemerný vek
77,6 roka
Priemerná telesná výška
154 cm
Priemerná telesná hmotnosť
60 kg
Priemerný BMI
25,3 kg/m2
Charakteristika súboru
Kalcifikácie abdominálnej aorty boli zistené u 24% vyšetrených pacientiek a 58% pacientiek s
identifikovanými kalcifikáciami malo aspoň jednu kompresívnu fraktúru.
Pacientky s kalcifikáciami
Pacientky bez kalcifikácií
Priemerný vek (roky)
75
78
Telesná výška (cm)
156
153,5
Telesná hmotnosť (kg)
65,5
59,6
BMI (kg/m2)
26
26
Pacientky s fraktúrou
58,00%
43,30%
134
AAC24 viac ako 6
35,00%
AAC24 menej ako 6
65,00%
Fraktúry AAC24 viac ako 6
20,00%
Fraktúry AAC24 menej ako 6
80,00%
Semikvantitatívne hodnotenie AAC24 a výskyt fraktúr
Naším pozorovaním bol zistený percentuálne vyšší výskyt fraktúr v skupine pacientiek s
kalcifikáciami, pričom viac fraktúr bolo v podskupine pacientiek s nižším skóre AAC24.
Paradoxne bol spozorovaný nižší vek v skupine pacientiek s kalcifikáciami.
Diskusia
V súčasnosti poznáme viacero možností detekcie aterosklerotických plátov. Patrí sem
klasická rtg snímka, CT sken, MRI, duplexná dopplerovská usg a ako nová metodika v
súčasnosti denzitometrické vyšetrenie (DXA - dual energy x-ray absorptiometry) (8). DXA je
využívaná v bežnej praxi na hodnotenie kostnej denzity, jej zmien v priebehu rôznych
ochorení a v rámci liečby osteoporózy a ostatných ochorení skeletu. Skeny získané použitím
denzitometrického prístroja nám poskytujú mimoriadne presné informácie ohľadom telesnej
kompozície, ktoré zahŕňajú BMC (bone mineral content), BMD (bone mineral density),
netukové telesné tkanivá a množstvo telesného tuku (6) a bočné skeny umožňujú zhodnotiť aj
prítomnosť kalcifikácií abdominálnej aorty. Chyba merania sa pri tejto metodike popisuje 12% (6). Veľkou výhodou denzitometrie je teda možnosť súčasného zhodnotenia kostnej
denzity, prítomnosti patologických fraktúr, ale taktiež možnej prítomnosti kalcifikácií
abdominálnej aorty. Vzhľadom k tomu, že prítomnosť kalcifikácií aorty sa ukazuje ako
nezávislý rizikový faktor kardiovaskulárnej morbidity a mortality, ich stanovenie pri
denzitometrickom vyšetrení by mohlo perspektívne prispieť k identifikácii asymptomatických
pacientiek ohrozených kardiovaskulárnymi príhodami (infarkt myokardu, náhla cievna
mozgová príhoda).V budúcnosti by sme chceli rozšíriť súbor pacientov, začať skúmať danú
problematiku aj v mužskej populácii, taktiež v iných vekových kategóriách a zároveň
korelovať ďalšie rizikové faktory s kalcifikáciami aorty, kostnou denzitou a kompresívnymi
fraktúrami.
Zoznam literatúry
1. Toussaint ND, Lau KK, Strauss BJ, Polkinghorne KR, Kerr PG: Determination and
validation of aortic calcification measurement from lateral bone densitometry in
dialysis patients. Clin J Am Soc Nephrol 2009;4(1):119-27.
2. Rodondi N, Taylor BC, Bauer DC a spol.: Association between aortic calcification
and total and cardiovascular mortality in older women. J Intern Med 2007;261(3):23844.
3. Schousboe JT, Taylor BC, Kiel DP, Ensrud KE, Wilson KE, McCloskey EV:
Abdominal aortic calcification detected on lateral spine images from a bone
densitometer predicts incident myocardial infarction or stroke in older women. J Bone
Miner Res 2008;23(3):409-16.
135
4. van der Meer IM, Bots ML, Hofman A, del Sol Al, van der Kuip DA, Witteman JC:
Predictive value of noninvasive measures of atherosclerosis for incident myocardial
infarction: the Rotterdam Study. Circulation 2004;109:1089-1094.
5. Naves M, Rodríguez-García M, Díaz-López JB, Gómez-Alonso C, Cannata-Andía JB:
Progression of vascular calcifications is associated with greater bone loss and
increased bone fractures. Osteoporos Int 2008;19(8):1161-6.
6. Brázdilová K, Killinger Z, Payer J: Využitie denzitometrie na meranie telesného tuku
u pacientov s metabolickým syndrómom. Rheumatol 2008;22(3):117-120.
7. Schousboe JT, Wilson KE, Hangartner TN: Detection of aortic calcification during
vertebral fracture assessment (VFA) compared to digital radiography. PloS One
2007;2(1):e715.
8. Schulz E, Arfai K, Liu X, Sayre J, Gilsanz V: Aortic calcification and the risk of
osteoporosis and fractures. J Clin Endocrinol Metab 2004;89(9):4246-53.
136
32. Gynekomastie z pohľadu plastickej chirurgie a onkológie
MUDr. Darina Potocká
Prednosta: Doc. MUDr. Ján Koller, PhD.
Klinika popálenín a rekonštrukčnej chirurgie FNsP Bratislava, nemocnica Ružinov
Úvod
Gynekomastia je slovo odvodené od dvoch gréckych výrazov, gyne - žena a mastos – prsník.
Týmto pojmom sa označuje zväčšenie mužského prsníka. (1) Predstavuje symptóm
sprevádzajúci rôzne etiopatogenetické stavy. Jej incidencia predstavuje 40 až 60 %. (2) Má
svoj charakteristický histologický obraz. Rast mliečnej žľazy je riadený hormonálne u oboch
pohlaví, pričom hlavnými hormónmi kontrolujúcimi tento proces sú estrogény. V živote
mužov sú tri obdobia, kedy je fyziologicky zvýšená hladina estrogénov, čo môže spôsobiť
zväčšenie mliečnej žľazy: obdobie neonatálne, puberta a staroba. Ako príčiny nárastu
mužských prsníkov sú uvádzané aj nasledujúce patologické stavy:
Hypogonadizmus
- pituitárno-hypotalamický
- primárne testikulárne zlyhanie: kongenitálny anorchizmus alebo kryptorchizmus, trauma,
kastrácia, orchitída, Klinefelterov syndróm
Endokrinné poruchy
- hypertyreóza
- hyperprolaktinémia
- hyperparatyreóza
- adrenokortikálna hyperplázia
Metabolické poruchy
- cirhóza pečene
- realimentácia po vyhladovaní
- ulcerózna kolitída
- renálne zlyhanie
Tumory
- testikulárne
- feminizujúce adrenálne
- ektopické zdroje
Farmakologická gynekomastia: testosterón, anabolické steroidy, HCG, digitalis, marihuana,
rezerpín, chemoterapeutiká a iné
Nárast mužských prsníkov môže byť rôzneho stupňa. Simon, Hoffman a Kahn vypracovali
chirurgickú klasifikáciu gynekomastie:
1. stupeň: málo viditeľné zväčšenie prsníka
2. stupeň: mierne zväčšenie prsníka
3. stupeň: značné zväčšenie prsníka – pendulujúci prsník ženského typu
137
Gynekomastia môže byť aj asymetrická.
Pokiaľ sa vyvinie mliečna žľaza u mužov, pravdepodobnosť jej malignizácie je rovnaká ako
u ženských prsníkov. (3)
Materiál a metódy
Do súboru bolo zahrnutých 44 pacientov operovaných na Klinike plastickej, rekonštrukčnej
a estetickej chirurgie LF FNLP v Košiciach pre gynekomastiu a 10 pacientov liečených na
Klinike rádioterapie a onkológie LF FNLP v Košiciach pre malígny karcinóm mužskej
mliečnej žľazy. Oba súbory boli spracované v rokoch 1993-2002, teda za 10 rokov. Údaje
boli spracované podľa dokumentácie oboch pracovísk. Pacienti boli roztriedení podľa veku,
bol sledovaný typ, choroby súvisiace so vznikom gynekomastie, trvanie rastu prsníkov a
lateralizácia. V súbore onkologických pacientov bol hodnotený vek, typ nádoru, lateralizácia
a spôsob terapie.
Výsledky
Najvyšší výskyt gynekomastie bol zaznamenaný v roku 1998.
V súbore pacientov z plastickej chirurgie dominuje II. a III. decénium. Nárast prsnej žľazy bol
prevažne v pubertálnom veku.
Kým pacient prišiel na operáciu, gynekomastia bola pozorovaná 1 až 9 rokov. Mnoho z týchto
pacientov bolo pred operáciou endokrinne neúspešne liečených.
Najčastejší bol obojstranný výskyt gynekomastie.
Histologicky bola potvrdená gynekomastia v 26 prípadoch, v 5 išlo o pseudogynekomastiu, čo
je len zmnoženie tukového tkaniva. U 13 pacientov nebol odoslaný materiál na histologické
vyšetrenie.
U 11 pacientov boli známe ochorenia v priamej súvislosti so vznikom gynekomastie [Tab. 1].
Vek v rokoch
57
43
23
21
20
20
19
19
18
18
18
Choroby
Tumor prostaty, hydronefróza
Hypogonadizmus
Hyperprolaktinémia
Zvýšená hladina testosterónu
Hyperprolaktinémia
Hyperlipidémia, toxická hepatopatia
Hypogonadizmus na podklade bronchiálnej astmy liečenej
kortikoidmi
Hyperprolaktinémia
Liečba bronchiálnej astmy
Hyperprolaktinémia, hyperestrogenizmus
Posilňovanie, anaboliká
Tab. 1: Ochorenia súvisiace so vznikom gynekomastie
Zastúpenie onkologických pacientov bolo vo vyšších decéniách (V. - VIII.)
138
Tabuľka 2 znázorňuje výskyt jednotivých typov karcinómov prsníka u mužov podľa decénií.
Decénium
Typy nádorov
V
VI
Duktálny
invazívny
karcinóm
sekretorický
Duktálny
invazívny
karcinóm
nesekretorický
Papilárny
infiltratívny
duktálny
karcinóm
Duktálny invazívny karcinóm,
mikropapilárny invazívny karcinóm,
tubulárny karcinóm
Papilárny invazívny karcinóm,
1
kribriformný karcinóm
Ca in situ multifokálny + kribriformný,
1
papilárny karcinóm
Papilárny invazívny karcinóm
Spolu
2
VII
VIII
1
1
Spol
u
1
1
2
1
4
1
1
1
1
1
1
3
2
3
1
10
Tab. 2: Výskyt jednotlivých typov karcinómov prsníka u mužov podľa decénií
Výskyt karcinómu bol rovnakým počtom pacientov zastúpený v pravom aj v ľavom prsníku.
Obojstranný výskyt sme v našom súbore onkologických pacientov nezaznamenali.
V jednotlivých prípadoch išlo o rôznu kombináciu troch typov onkologickej liečby:
rádioterapia (RAT), chemoterapia (CHT) a hormonálna terapia (HT). Všetci pacienti z nášho
súboru okrem jedného podstúpili aj chirurgický zákrok.
Diskusia
Výskyt gynekomastií mal v našom súbore prevalenciu v II. a III. decéniu, čo je v zhode
s literatúrou. (3) V 25 % sme zistili priamu súvislosť nárastu prsníkov na podklade známej
príčiny. V 75 % išlo o idiopatickú gynekomastiu. V období možného fyziologického
zväčšenia žľazy, najmä v puberte, nie je nutná okamžitá chirurgická intervencia vzhľadom
k možnej spontánnej involúcii. V tejto vekovej skupine je výskyt karcinómu prsnej žľazy
výnimočný, ale v literatúre bol popísaný výskyt obojstranného duktálneho karcinómu in situ
u 15 ročného muža operovaného pre gynekomastiu. (4) Rovnaký typ karcinómu pri
jednostrannej gynekomastii popísali autori z USA. (5) Podobne v UK bol duktálny karcinóm
in situ popísaný u obojstranne pretrvávajúcej gynekomastie u 26 ročného muža. (6) Ďalší
autori z USA popisujú výskyt karcinómov prsníka u mužov vo vekovom rozmedzí 19 – 80
rokov. (7) K operačnému zákroku sa pristupuje, pokiaľ gynekomastia pretrváva, existuje
podozrenie na malígne zvrhnutie, respektíve pokiaľ nereaguje na konzervatívnu liečbu. (1)
Operácia spočíva v odstránení žľazy prístupom čo najmenej mutilujúcim hrudník. K operácii
treba pristúpiť nielen z estetických dôvodov na zlepšenie psychického stavu pacientov, ale aj
z dôvodu možného malígneho zvrhnutia vo vyššom veku. Pokiaľ sa gynekomastia vyskytne,
je riziko vzniku karcinómu prsníka rovnaké ako u žien. (3) K týmto zmenám dochádza
prevažne vo vyšších vekových kategóriách. V našom súbore boli onkologickí pacienti
139
v porovnaní s pacientami operovanými pre gynekomastiou približne o dve decéniá starší.
V literatúre boli ojedinele zachytení pacienti s karcinómom prsníka aj v nižších vekových
kategóriách. (4, 5)
Záver
Termín gynekomastia označuje zväčšenie prsníka u mužov, ku ktorému dochádza v dôsledku
zväčšenia prsníkovej žľazy. Tieto zmeny môžu vznikať idiopaticky alebo na podklade iných
chorobných stavov. Podľa toho rozoznávame primárne a sekundárne gynekomastie.
Z hľadiska psychologického, gynekomastia signalizuje vážny problém, najmä v období
dospievania. V adolescencii môže znamenať pre postihnutých chlapcov príčinu sociálnej
maladaptácie, vzniká porucha sebahodnotenia, deformuje sa prístup ku kolektívnemu
spolužitiu, napr. v internátoch, pri športe, na kúpalisku, atď. Riziko malignizácie mužského
prsníka je rovnaké ako u žien. (3) Príčiny sú multifaktoriálne. Endogénna či exogénna
zvýšená produkcia estrogénu má signifikantný vplyv na výskyt karcinómu prsníka u mužov.
(8) U každej gynekomastie je vhodné urobiť USG prsníkov, mammografiu a hormonálny
status. U mužov liečených na testikulárny karcinóm alebo squamocelulárny karcinóm kože, je
potrebné myslieť aj na zvýšené riziko vzniku gynekomastie s následnou malignizáciou. (8)
Nakoľko existuje potenciálne nebezpečenstvo vzniku malígneho ochorenia, odstránenie
prsníka u mužov nemožno považovať iba za estetický operačný výkon.
Literatúra
1. Guzanin Š, Szitášová A, Potocká E a spol.: Gynekomastia z pohľadu plastickej
chirurgie. Slovenský lekár 1997; 7: 27–30.
2. gynecomastia.org [online]. <www.gynecomastia.org>; [cit. 2009-01-28].
3. McGrath MH: Gynecomastia. In Jurkiewicz M.J., Krizek T.J., Mathes S.J. eds. Plastic
surgery. Principles and Practice. Vol. II. St. Louis, C.V. Mosby Co, 1990, 1119 –
1136. ISBN 0801626021.
4. Corroppolo M, Erculiani E, Zampieri N a spol. Ductal Carcinoma in Situ in a 15 –
Year - Old Boy with Gynaecomastia: a Case Report. Pediatric Surgery International
2008; 24 {8): 943 – 945.
5. Chang HL, Kish JB, Smith BL a spol.: A 16 – Year - Old Male with Gynecomastia
and Ductal Carcinoma in Situ. Pediatric Surgery International 2008; 24 {11): 1251 –
1253.
6. Qureshi K, Athwal R, Cropp G a spol.: Bilateral Synchronous Ductal Carcinoma in
Situ in a Young Man: Case Report and Review of the Literature. Clinical Breast
Cancer 2007; 7 {9): 710 – 712.
7. Mathew J, Perkins GH, Stehens T a spol.: Primary Breast Cancer in Men: Clinical,
Imaging, and Pathologic Findings in 57 Patients. American Journal of Roentgenology
2008; 191 {6): 1631 – 1639.
8. Olsson H, Bladstrom A, Alm P: Male Gynecomastia and Risk for Malignant Tumours
- a Cohort Study. BMC Cancer 2002; 16 {2): 26.
140
33. Úspech 3-ročnej kampane “MOST” ako silného nástroja na implementáciu
Európskej charty zdravia srdca
MUDr. Anton Dlesk1
Spoluautori: doc. MUDr. Gabriel Kamenský, CSc, FESC1, prof. MUDr. Ján Murín, CSc2
Školiteľ: doc. MUDr. Gabriel Kamenský, CSc., FESC
1
V. interná klinika LFUK a FNsP Bratislava, 2 I.interná klinika LFUK a FNsP Bratislava
Úvod
Na Slovensku predstavuje mortalita na kardiovaskulárne ochorenia v súčasnosti až 54%
všetkých úmrtí. Neklesá incidencia nových akútnych koronárnych príhod, cievnych
mozgových príhod, neuspokojivá je kontrola artériovej hypertenzie, dyslipidémie a iných
významných rizikových faktorov. Veľkým problémom je nízka úroveň vedomostí širokej
verejnosti o najzávažnejších rizikových faktoroch kardiovaskulárnych ochorení, základných
príznakoch infarktu myokardu a prítomnosť viacerých rizikových faktorov najmä u mladej
populácie, akými sú fajčenie, obezita a nedostatočná fyzická aktivita, ktoré významnou
mierou prispievajú k rozvoju kardiovaskulárnych ochorení.
Cieľ
Prostredníctvom MOSTu (mesiac o srdcových témach), celonárodnej edukačnej kampane
prebiehajúcej od septembra 2007 do septembra 2009, zvýšiť informovanosť verejnosti o
najzávažnejších rizikových faktoroch kardiovaskulárnych ochorení a ich prevencii.
Metódy
Slovenská nadácia srdca a Slovenská kardiologická spoločnosť, za podpory Európskej
kardiologickej spoločnosti a Európskej Únie, pripravili národnú edukačnú kampaň, ktorá
trvala od septembra 2007 do septembra 2009. Nezávislý prieskum informovanosti verejnosti
o hlavných rizikových faktoroch kardiovaskulárnych ochorení a ich uvedomovaní si bol
vykonaný nezávislou agentúrou pred a po kampani v roku 2007, 2008 a 2009. Všetkých šesť
prieskumov pozostávalo z deviatich rovnakých kľúčových otázok. Prieskum sa uskutočnil
pred a po kampani MOST v septembri 2007, 2008 a 2009 u celkovo 6200 respondentov,
pričom vždy boli použité rovnaké metódy. Štatistické spracovanie dát sa realizovalo
prostredníctvom programu SPSS, zber dát sa uskutočnil v súlade s kódexom ESOMAR.
Interval spoľahlivosti pre celú vzorku sa vypočítal ako max. ± 3,1% na 95% hladine
významnosti pre frekvenciu javu 50%.
Výsledky
Pri porovnaní výsledkov v roku 2007 a 2009 z obidvoch prieskumov pred aj po kampani
MOST, stúpla informovanosť vo väčšine kategórií. Najdôležitejšími rizikovými faktormi bola
podľa všetkých hypertenzia (45%, 62%, 78% a 78%), fajčenie (30%, 46%, 40% a 43%),
vysoká hladina cholesterolu (22%, 32%, 41% a 42%), obezita (20%, 32%, 40% a 37%)
141
a fyzická inaktivita (7%, 14%, 18% a 15%). Mierne sa zlepšili vedomosti o správnych
hodnotách optimálneho krvného tlaku (45 versus 52%), správnu hodnotu cholesterolu
uviedlo však len 27 verzus 33% respondentov. Informovanosť o rizikových faktoroch u tých,
ktorí zaregistrovali kampaň MOST v médiách, najmä u cieľových skupín (žien a občanov vo
veku 45-54 rokov), bola signifikantne vyššia než u ostatnej populácie. Vedomosť o správnych
hodnotách optimálneho krvného tlaku sa v roku 2009 zvýšila u žien o 6.4%, a u respondentov
vo veku 45-54 rokov o 9.4%. Rovnaké výsledky sme zaznamenali pre normálne hodnoty
celkového cholesterolu (6.9% u žien a 8.5% u respondentov vo veku 45-54 rokov). Pokiaľ v
roku 2007 informačnú kampaň MOST zaregistrovalo iba 23% respondentov, v roku 2008
kampaň zanamenalo 25% respondentov a v roku 2009 až 30%. Informovanosť verejnosti
o najvýznamnejších rizikových faktoroch kardiovaskulárnych ochorení a ich prevencii sa
zvýšila o 9% v roku 2007 a dokonca o 16% na konci roku 2008.
Diskusia
Za tri roky kampane MOST sme zaznamenali priaznivý vývoj v oblasti najzávažnejších
rizikových faktorov kardiovaskulárnych ochorení. Zaznamenali sme pokles fajčiarov medzi
vyšetrenými, vrátane poklesu fajčiarov u mladistvých (nie však medzi ženami), pokles počtu
osôb so zvýšeným tlakom krvi, nižší počet osôb bez fyzickej aktivity a mierny pokles počtu
vyšetrených so zvýšenou hladinou celkového cholesterolu. Intenzívna trojročná informačná
kampaň MOST výrazným spôsobom zahájila implementáciu Európskej charty zdravia srdca
na Slovensku. Zvýšila informovanosť verejnosti o najvýznamnejších rizikových faktoroch
kardiovaskulárnych ochorení a nutnosť ich celoživotnej prevencie. Stala sa integrálnou
súčasťou Národného preventívneho kardiovaskulárneho programu.
Zoznam použitej literatúry
1. Kamenský G., Murín J. Mesiac o srdcových témach 2009.
2. Kamenský G., Murín J. Mesiac o srdcových témach 2008.
3. Kamenský G., Murín J. Mesiac o srdcových témach 2007.
142
Klinická sekcia
49. fakultná konferencia ŠVOČ
1.miesto
Malé denzné LDL-lipoproteíny u novodiagnostikovaných pacientov s artériovou
hypertenziou.
Jozef Mikovčák, Martin Stančík, Peter Sabaka, Matej Kaško
2.miesto
Interaktívny anatomický atlas topografických régií
Kollárik Boris , Michal Lapides
3.miesto
Kontaminácia zubných kefiek bakteriálnou flórou
Zuzana Borecká, Roman Andil, Miroslav Novotný
143
34. Malé denzné LDL–lipoproteíny u novodiagnostikovaných pacientov s artériovou
hypertenziou
J. Mikovčák, M. Stančík, P. Sabaka, M. Kaško
(všeobecné lekárstvo, 6.ročník)
Spoluautori: doc. MUDr. S. Oravec, CSc., MUDr. M. Čaprnda, PhD
Školiteľ: prof. MUDr. A. Dukát, CSc
II.interná klinika LFUK v Bratislave
Úvod:
Kardiovaskulárne ochorenia svojím výskytom, závažnosťou orgánových postihnutí a
dôsledkov pre zdravotný stav obyvateľstva tvoria jeden z najvyznamnejších problémov našej
populácie. Na Slovensku sa KVS ochorenia podieľajú na celkovej mortalite cca 53%. Jedným
z najvzýnamnejších rizikovým faktorom KVS ochorení je hyperlipidémia a prítomnosť
zvýšenej hladiny LDL cholesterolu. Pri prítomnosti siedmich frakcií LDL cholesterolu, je
dôležité rozdelenie na neaterogénne frakcie LDL 1-2 a aterogénne frakcie LDL 3-7 malé
denzné lipoproteíny. Prítomnosť malých denzných lipoproteínov aj pri normálnych
hodnotách celkového a LDL cholesterolu trojnásobne zvyšuje kardiovaskulárne riziko. Na
základe systému Lipoprint môžeme sledovať kvantitatívne zastúpenie jednotlivých frakcií
LDL. Taktiež môžeme týmto systémom sledovať zloženie frakcií pri ich ovplyvnení
hypolipidemickou liečbou. Táto liečba je podľa viacerých štúdií jedným z preventívnych
opatrení, ktoré môžu znížiť úmrtnosť na KVS ochorenia. (1,2)
Cieľ práce:
Primárnym cieľom nášho sledovania bolo určiť distribúciu lipoproteínových partikúl, zvlášť
malých denzných lipoproteínov (MDLP) u skupiny novodiagnostikovaných pacientov
s esenciálnou hypertenziou.
Pacienti a metódy:
Sledovali sme skupinu 107 následných pacientov s esenciálnou hypertenziou, ktorí boli
odoslaní obvodnými lekármi do tunajšieho centra pre diagnostiku a liečbu pacientov
s hypertenziou, ktorí ešte nedostávali hypolipidemickú liečbu. Títo boli porovnaní so 150
kontrolnými subjektami (študentami medicíny) bez dokázateľného ochorenia
kardiovaskulárneho systému, nefajčiarmi, ktorí nebrali žiadne lieky. Na stanovenie veľkostí
lipoproteínových partikúl a koncentrácie MDLP sme použili systém Lipoprint Quantimetrix,
čo je metóda schválená Federal and Drug Administration v USA pre humánnu medicínu
(r.2008). Každému pacientovi bolo vypočítané skóre vyjadrujúce aterogénne riziko.
Štatistická analýza bola realizovaná štatistickým programom SPSS for Windows. Na overenie
rozdielov dát medzi skupinami bol použitý dvojcestný nepárový Studentov t-test a chíkvadrátový test.
144
Výsledky:
U zdravých kontrol neaterogénny (NA) lipoproteínový profil malo 140 (93,3%) probandov
(hladina MDLP 0,06 mmol/l; skóre 37,8), aterogénny (A) profil lipoproteínov bol prítomný u
10 (6,7%) probandov (hladina MDLP 0,37 mmol/l; skóre 6,0). Priemerné hodnoty celkového
cholesterolu v sére oboch skupín sa štatisticky neodlišovali (A: 4,25 mmol/l vs NA: 4,28
mmol/l; NS). V skupine pacientov s esenciálnou hypertenziou malo iba 23 (21,5%) pacientov
neaterogénny lipoproteínový profil (hladina MDLP 0,08 mmol/l; skóre 24,2) a 84 (78,5%)
pacientov malo aterogénny liproteínový profil (hladina MDLP 0,42 mmol/l; skóre 5,6).
Priemerné hodnoty celkového cholesterolu boli u pacientov s hypertenziou mierne vyššie ako
u zdravých kontrol, avšak taktiež nebol prítomný signifikantný rozdiel medzi aterogénnou
a neaterogénnou skupinou (A: 5,15 mmol/l vs. NA: 5,32 mmol/l; NS).
Esenciálna hypertenzia
TC [mmol/l]
MDLP
[mmol/l]
Lipoproteín
ové skóre
Kontrola
A profil
NA profil
Sign.
A
profil
NA profil
Sign.
5,15
5,32
NS
4,25
4,28
NS
0,42
0,08
p < 0,05
0,22
0,03
p < 0,05
5,6
24,2
p < 0,05
6
37,8
p < 0,05
Tab.1: Lipoproteinový profil. TC – celkový cholesterol, MDLP – malé denzné lipoproteiny,
A – aterogénny, NA - neaterogénny.
Diskusia a záver:
Systém Lipoprint na polyakrylovom géli poskytuje možnosti presného stanovenia veľkostí
i distribúcie lipoproteínov (LDL 1-7, HDL 1-10). Kvantitatívne stanovenia neaterogénneho
(LDL 1-2) a aterogénneho spektra lipoproteínov (LDL 3-7) môže presnejšie identifikovať
rizikových pacientov, ktorí budú vyžadovať cielenú hypolipidemickú liečbu. V našom súbore
mali tri štvrtiny novodiagnostikovaných pacientov (78,5%) s esenciálnou hypertenziou
prítomné MDLP. Títo pacienti sú okrem antihypertenzívnej liečby súčasne indikovaní aj na
hypolipidemickú liečbu. Podľa záverov štúdie ASCOT – Lipid Lowering Arm, ktorá
sledovala rizikových hypertonikov v primárnej prevencii KV ochorení, podávanie
hypolipidemickej liečby u týchto pacientov viedlo k výraznému poklesu KV morbidity
a mortality (3). Systém Lipoprint by mohol napomôcť v identifikácii rizikových pacientov
vhodných pre hypolipidemickú liečbu.
Zoznam použitej literatúry
1. Jackson R, Lawes M, Bennett D, et al. Treatment with drugs to lower blood pressure
and blood cholesterol bassed on an individual to absolute cardivascular risk. Lancet
2006; 366: 434- 441.
145
2. D. Duncan, J. Morais, N. Muniz, G. Neyer. Lipoprotein Subfraction Testing with the
Lipoprint® System - Easy, Accurate and Comprehensive. Presented at CLAS,
Northbrook, IL (May 2004).
3. Sever PS, Dahlöf B, Poulter NR, et al. Prevention of coronary and stroke events with
atorvastatin in hypertensive patients who have average or lower-than-average
cholesterol concentrations, in the Anglo-Scandinavian Cardiac Outcomes Trial--Lipid
Lowering Arm (ASCOT-LLA): a multicentre randomised controlled trial. Lancet.
2003 Apr 5;361(9364):1149-58.
146
35. Selected parameters of insulin sensitivity in hypertensive patients after the change in
therapy from angiotensin converting enzyme inhibitors to angiotensin II type I receptor
blockers
Branislav Zagrapan
(General Medicine, Year 2)
Supervisors: MUDr. Richard Imrich, PhD., Ing. Štefan Zórad, PhD.
Institute of Experimental Endocrinology, Slovak Academy of Sciences, Bratislava
Introduction
Candesartan, angiotensin II receptor (AT1) antagonist, has been used as an effective
antihypertensive drug for several years. In addition to the antihypertensive actions, data from
animal models showed fat tissue mass lowering effects, adipose tissue hypotrophy and
reduction in adipocyte size of the drug (1). Furthermore, AT1 antagonists have been shown to
improve insulin sensitivity and reduce inflammation, the mechanisms implicated in
prevention or retardation of coronary heart disease (2, 3). In the present pilot study, we
investigated effects of candesartan cilexetil therapy on changes in adiposity and glucose
metabolism in subjects with primary hypertension.
Methods
Fourteen (N=14) men aged 33-64 years with primary hypertension (European Society of
Hypertension/European Society of Cardiology Grade 1 and 2) treated with angiotensinconverting enzyme inhibitors (ACEI) participated in the study. The patients were studied
before and six months after ACEI were replaced with candesartan cilexetil in treatment of
hypertension, while any other additional antihypertensive medication remained unchanged.
The following procedures were performed before and after the change in hypertension
treatment:
•
anthropometric measurements including height, weight, body fat % (Omron BF306,
Omron Healthcare Europe B.V., The Netherlands), waist/hip ratio),
•
blood pressure and heart rate measurements,
•
adipocyte size measurements from subcutaneous adipose tissue biopsy as previously
described (1, 4),
•
the oral glucose tolerance test (OGTT), in which 75g of glucose dissolved in 200ml of
liquid were given after an overnight fast; venous blood samples were withdrawn from
antecubital vein before and every 15min after the start of OGTT up to 120min; blood samples
withdrawn at the start of the examination before any other procedures were conducted were
used for determination of fasting levels of glucose, insulin and C-peptide
147
Plasma glucose was measured by glucose oxidase method. Insulin and C-peptide was
measured by immunoradiometric assay (Immunotech, France). Plasma samples of one patient
were excluded from the study due to poor compliance with overnight fast requirements.
The study was approved by the local ethics committee and informed consent was obtained
from all participants prior to examination.
Statistical analysis
Changes in glucose, insulin and C-peptide were analyzed by two-way ANOVA for repeated
measurements. Paired Student’s t-test was used to compare mean baseline values for other
variables.
Results
Six months after change from ACEI to candesartan, the systolic and diastolic blood pressures
was lower (p<0.05) compared to pre-change values; systolic blood pressure decreased by 6.95
± 4.07 mmHg, diastolic blood pressure decreased by 5.68 ± 2.35 mmHg. Fasting glycemia
was lower (p<0.01) after change from ACEI to candesartan; the mean fasting plasma glucose
decreased by 0.84 ± 0.06 mM. Changes in all other analysed characteristics were not found to
be statistically significant.
250.00
200.00
10.00
insulin [µIU/ml]
glucose concentration [mmol/l]
12.00
8.00
6.00
150.00
100.00
4.00
50.00
2.00
0.00
0.00
0
0
15
30
45
60 75
t [min]
90
105 120
15
30
45
60 75
t [min]
90
105 120
Figure 1: Plasma glucose (left) and insulin (right) during the oral glucose tolerance test
in primary hypertension patients before (white circles) and after (black squares)
treatment switch from ACEI to candesartan. Error bars shown as ± SD.
148
Table 1: Measured characteristics before and after the change in prescription to
candesartan cilexetil.
characteristic
SBP [mmHg]
DBP [mmHg]
m [kg]
BMI [kg/m2]
waist/hip ratio [cm]
BF%
ISI(QUICKI) (5)
ISI(MATSUDA)
[mg-1 x dl x mIU-1 x l] (5)
IR(HOMA)
[mmol x l-1 x µIU x ml-1]
(5)
ISI(AVIGNON) (5)
ISI(CEDERHOLM) (5)
[mg.l2 x mmol-1 x mIU-1 x
min-1]
fasting plasma glucose
[mM]
fasting insulin [mIU/ml]
insulin OGTT AUC per
120min
[µU x ml-1 x min]
before
prescription
change
136.38 ± 6.93
82.74 ± 2.95
94.14 ± 15.01
30.16 ± 4.66
0.979 ± 0.039
27.44 ± 9.63
0.628 ± 0.095
after
prescription
change to candesartan
cilexetil
129.43 ± 4.88
77.06 ± 2.61
96.03 ± 16.32
30.77 ± 5.13
0.978 ± 0.053
29.79 ± 5.89
0.695 ± 0.183
P
0.047
0.032
NS
NS
NS
NS
NS
4.494 ± 2.302
5.843 ± 4.444
NS
2.062 ± 0.910
27.136 ± 26.600
1.795 ± 1.028
43.336 ± 76.955
NS
NS
45.15 ± 11.552
43.58 ± 13.853
NS
4.91 ± 0.59
10.22 ± 4.68
4.07 ± 0.53
10.08 ± 5.33
0.003
NS
9350.8 ± 4552.3
9665.4 ± 7610.0
NS
Data are expressed as mean ± SD. Quantitative Insulin Sensitivity Check (QUICKI) =
1/log(fasting glucose) + log(fasting insulin), Insulin Resistance Homeostasis Model
Assessment (IRHOMA= (fasting insulin x fasting glucose)/22.5), ISI – insulin sensitivity index.
SBP – systolic blood pressure, DBP – diastolic blood pressure, m – weight, BMI – body mass
index = m/h2, BF – body fat, insulin OGTT AUC – area under curve for insulin 0 to 120min,
NS – non-significant.
Quantitative statistical assessment of OGTT glucose, insulin and C-peptide curves by
ANOVA yielded that any variation among the patients before and after the change of
prescription was not statistically significant.
Discussion
Primary hypertension (HT) as the risk factor for stroke, cardiovascular diseases and renal
insufficiency is among the most frequently medically treated conditions (6). It appears that
lowering of blood pressure per se irrespective of pharmacotherapy, has a direct positive effect
in decreasing the risk of HT-related problems (7). A meta-analysis comparing effects of
different antihypertensive regimens found a possible decrease in the risk of stroke, coronary
heart disease, heart failure and cardiovascular death by 28-38%, 20%, 16% and 22%,
respectively (8). Nevertheless, the risk lowering potential varies among first-line
149
antihypertensives. These effects seem to be largely due to variation among antihypertensives
in clinical efficacy of blood pressure control. However, blood pressure-independent factors
such as different modes of action, pharmacokinetics and the degree of end organ protection
(kidney, heart, vascular system and brain) probably also play a role (8). Furthermore,
tolerability and potential side-effects are considered when it comes to the choice of treatment
for the individual patient.
As expected, our results showed that candesartan had blood pressure lowering effects, which
were comparable to those of ACEI. This result is in line with other larger studies comparing
ACEI or ARB efficacy in primary hypertension treatment (9, 10). Although the change from
ACEI to candesartan resulted in lowering of fasting plasma glucose, there were no other signs
of improvement in insulin sensitivity observed in our study. Six months of candesartan
treatment had only modest effect on adipocyte size with no change in the anthropometric
markers of body fat quantity used in our study.
Acknowledgments
The study was supported by grant of Slovak Ministry of Health MZ2007/27-SAV-02.
Abbreviations
AT1 - Angiotensin II receptor type I
ACEI – angiotensin converting enzyme inhibitor
ARB – angiotensin receptor blockers
HT – hypertension
OGTT – oral glucose tolerance test
References
1. Zorad S, Dou JT, Benicky J, Hutanu D, Tybitanclova K, Zhou J, Saavedra JM:
Long-term angiotensin II AT1 receptor inhibition produces adipose tissue hypotrophy
accompanied by increased expression of adiponectin and PPARgamma. Eur J
Pharmacol. 2006 Dec 15; 552(1-3): 112-22.
2. Higashiura K, Ura N, Miyazaki Y, Shimamoto K: Effect of an angiotensin II receptor
antagonist, candesartan, on insulin resistance and pressor mechanisms in essential
hypertension. J Hum Hypertens. 1999 Jan; 13 Suppl 1: S71-4
3. Koh KK, Quon MJ, Han SH, Chung WJ, Lee Y, Shin EK: Anti-inflammatory and
metabolic effects of candesartan in hypertensive patients. Int J Cardiol. 2006 Mar 22;
108(1): 96-100
4. Skopkova M, Penesova A, Sell H, Radikova Z, Vlcek M, Imrich R, Koska J,
Ukropec J, Eckel J, Klimes I, Gasperikova D: Protein array reveals differentially
expressed proteins in subcutaneous adipose tissue in obesity. Obesity (Silver Spring).
2007 Oct ; 15(10): 2396-406
5. Radikova Z: Assessment of insulin sensitivity/resistance in epidemiological studies.
Endocr Regul. 2003 Sep; 37(3): 189-94
150
6. Mancia G, Grassi G: Management of essential hypertension. Br Med Bull. 2010 Feb
8; 1-11
7. Mancia G: Blood pressure reduction and cardiovascular outcomes: past, present, and
future. Am J Cardiol. 2007 Aug 6; 100(3A): 3J-9J
8. Turnbull F, Blood Pressure Lowering Treatment Trialists' Collaboration: Effects of
different blood-pressure-lowering regimens on major cardiovascular events: results of
prospectively-designed overviews of randomised trials. Lancet. 2003 Nov 8;
362(9395): 1527-35
9. Ong HT: Are angiotensin-converting enzyme inhibitors and angiotensin receptor
blockers especially useful for cardiovascular protection? J Am Board Fam Med. 2009
Nov-Dec ; 22(6): 686-97
10. Uchiyama-Tanaka Y, Mori Y, Kishimoto N, Fukui M, Nose A, Kijima Y,
Yamahara H, Hasegawa T, Kosaki A, Matsubara H, Iwasaka T: Comparison of the
effects of quinapril and losartan on carotid artery intima-media thickness in patients
with mild-to-moderate arterial hypertension. Kidney Blood Press Res. 2005; 28(2):
111-6
151
36. Kontaminácia zubných kefiek bakteriálnou flórou
Zuzana Borecká, Roman Andil, Miroslav Novotný
(zubné lekárstvo, 5.ročník; zubné lekárstvo, 5.ročník; zubné lekárstvo, 5.ročník)
Školiteľ: MUDr. Bohuslav Novák, PhD.1, prof. MUDr. Daniela Kotulová, PhD.2
1
Klinika stomatológie a maxilofaciálnej chirurgie LFUK a OÚSA, 2Mikrobiologický ústav
LFUK a FN
Úvod
Je potvrdené viacerými štúdiami, že pravidelne používané zubné kefky sú kontaminované
rôznymi druhmi mikroorganizmov(1, 2). Ide hlavne o bežnú orálnu flóru, no takisto aj
o oportúnne patogény ako sú koliformné baktérie, S. aureus a Pseudomonas sp. Tieto
mikroorganizmy môžu spôsobovať reinfekcie alebo lokálne a systémové infekcie hlavne
u oslabených jedincov a môžu sa prenášať medzi členmi rodiny pri nedodržiavaní
hygienických zásad. Predpokladá sa, že kontaminácia súvisí s miestom a spôsobom
skladovania kefky, úrovňou hygieny jedinca, jeho zdravotným stavom a frekvenciou výmeny
kefiek. Tento výskum poukazuje na to, ako doba používania kefky, jej tvrdosť a skladovanie
ovplyvňujú jej bakteriálnu kontamináciu.
Materiál a metódy
Výskum sa robil na Gymnáziu Ul. L. Sáru v novembri 2009 – februári 2010 na súbore 54
žiakov vo veku 12 – 13 rokov. Z toho bolo 23 chlapcov a 31 dievčat.
Žiakom sa rozdal dotazník a nové zubné kefky rôznej tvrdosti a boli poučení o umývaní
zubov Bassovou metódou po dobu 3 mesiacov. Každému sa odobral ster z kefky, ktorú
používal rôzne dlhú dobu. Odber bol vykonaný sterilným tampónom, ktorý sa následne
kultivoval 24 hodín v živnom bujóne.
Potom bol obsah steru z kefky vyočkovaný na nasledujúce média: krvný agar, McConkey
pôda a Sabouraudova pôda, ktoré boli inkubované pri teplote 37˚ C ďalších 24 - 48 hodín.
Následne boli identifikované jednotlivé kolónie mikroorganizmov za pomoci ďalších metód:
farbenie podľa Grama, Staphytect Plus, identifikácia na základe biochemických vlastností
(krátky rad cukrov, oxidácia, fermentácia a pigmenty, Enterotest, oxidázový test,
koagulázový test).
V rámci identifikácie možných súčiniteľov, ktoré mohli ovplyvniť mikrobiálny nález, sa
urobili kontrolné stery zo šiestich nových kefiek a vyočkovanie troch vzoriek pitnej vody
z rôznych vodovodných kohútikov.
O tri mesiace boli zopakované stery a kultivácie z rozdaných kefiek.
Výsledky boli štatisticky spracované. Podľa mikrobiálneho zastúpenia bol každej kefke
pridelený stupeň kontaminácie:
čistá kefka – bežná flóra (viridujúce streptokoky, koaguláza negatívne stafylokoky,
nepatogénne neisserie, spirochéty, candidy a iné)
152
mierne znečistená kefka – bežná flóra ojedinele, mikroorganizmy, ktoré sa bežne
nenachádzajú v dutine ústnej
znečistená kefka - mikroorganizmy, ktoré sa bežne nenachádzajú v dutine ústnej (E.coli a iné
enterobaktérie, Pseudomonas sp., S. aureus).
Výsledky
Zastúpenie mikroorganizmov na zubných kefkách pri prvom a druhom stere je uvedené na
Obr.1. Na všetkých platniach sa objavil rast, na viac ako polovici bola vykultivovaná bežná
flóra, enterobaktérie, E. coli, Staphylococcus aureus a Pseudomonas sp. boli izolované
z 33%, 25%, 11%, 1,8% kefiek pri prvom stere a 18%, 29%, 11%, 11% kefiek pri druhom
stere.
Stupeň znečistenia pri oboch steroch v závislosti od dĺžky používania a tvrdosti kefiek je
uvedený v Tab.1. Pri prvom odbere boli čisté, mierne znečistené a znečistené kefky
v zastúpení 40,7%, 14,8%, 44,4%, z toho u chlapcov 21,7%, 30,4%, 47,8% a u dievčat 54,8%,
3,2%, 41,9%. Pri druhom odbere 35,2%, 17,6%, 47%, z toho chlapcov 38,5%, 15,4%, 46,1%
a dievčat 33,3%, 19%, 47,6%. Z toho vyplýva, že kontaminácia je u oboch pohlaví približne
rovnaká a nezávisí od dĺžky používania zubnej kefky.
Starostlivosť o kefku po použití, jej skladovanie, prítomnosť toalety v kúpeľni, používanie
iných pomôcok ústnej hygieny a tvrdosť kefky nemali na stupeň kontaminácie žiadny
signifikantný vplyv.
Dĺžka používania vlastnej Vyhodnotenie
Pohlavie kefky
1
mierne
♂
6 mesiacov
znečistená
♀
mesiac
čistá
♂
2 týždne
čistá
supersoft
supersoft
supersoft
♀
týždeň
čistá
soft
♀
♀
♀
♀
♂
mesiac
mesiac
včera
4 mesiace
2 mesiace
supersoft
supersoft
supersoft
ultrasoft
soft
znečistená
čistá
♂
♀
♂
♀
2 mesiace
3 mesiace
3-4 mesiace
4 mesiace
soft
soft
ultrasoft
soft
znečistená
♂
♂
♂
2-3 mesiace
2 mesiace
♂
4 mesiace
znečistená
čistá
čistá
znečistená
znečistená
mierne
znečistená
znečistená
znečistená
znečistená
mierne
znečistená
znečistená
znečistená
mierne
znečistená
153
Tvrdosť
kefky
novej Vyhodnotenie
2
čistá
čistá
mierne
znečistená
mierne
znečistená
čistá
ultrasoft
soft
ultrasoft
znečistená
♀
♀
3 týždne
mesiac
♂
3 týždne
čistá
čistá
mierne
znečistená
♂
♀
♂
♂
♂
♂
♀
♂
♀
♀
♂
♀
♂
mesiac
3 mesiace
3 mesiace
2 mesiace
mesiac
cca mesiac
2 mesiace
2-3 mesiace
6 mesiacov
2 mesiace
mesiac
čistá
znečistená
čistá
čistá
znečistená
znečistená
znečistená
znečistená
čistá
znečistená
znečistená
čistá
čistá
♀
2 dni
♂
♀
♀
♀
♀
♀
2 mesiace
nevie
týždeň
týždeň
týždeň
3 mesiace
♀
♀
♀
♂
2 týžde
3 mesiace
mesiac
2,5 mesiaca
♀
♀
♂
3 mesiace
pár dní
týždeň
♂
♀
2 dni
mesiac
♂
♀
♀
♀
♀
mesiac
mesiac
3 mesiace
2 týždne
dva týždne
čistá
mierne
znečistená
čistá
znečistená
znečistená
čistá
znečistená
ultrasoft
soft
znečistená
čistá
ultrasoft
znečistená
mierne
znečistená
supersoft
ultrasoft
supersoft
ultrasoft
ultrasoft
soft
ultrasoft
soft
soft
soft
soft
soft
soft
soft
soft
ultrasoft
soft
supersoft
supersoft
znečistená
čistá
znečistená
znečistená
mierne
znečistená
čistá
znečistená
ultrasoft
supersoft
supersoft
ultrasoft
znečistená
čistá
mierne
znečistená
čistá
čistá
čistá
znečistená
supersoft
ultrasoft
Tab.1 Výsledky odberu mikrobiologického materiálu
154
supersoft
ultrasoft
soft
ultrasoft
soft
soft
supersoft
ultrasoft
čistá
znečistená
čistá
znečistená
znečistená
čistá
mierne
znečistená
znečistená
znečistená
znečistená
znečistená
znečistená
čistá
mierne
znečistená
znečistená
znečistená
čistá
mierne
znečistená
čistá
znečistená
čistá
% 60%
50%
40%
30%
20%
10%
A c in e to b a c te r s p .
Pseudom onas sp.
Stery z dňa 16.11.2009
K le b s ie lla
C .a lb ic a n s
S .a u re u s
Stery z dňa 23.2.2010
E .c o li
E n te ro b a c te r s p .
B e ž n á fló ra
0%
Najčastejší zástupcovia
mikrobiálnej flóry
Obr.1 Zastúpenie jednotlivých mikroorganizmov po odberoch materiálu
Diskusia
Z výsledkov vyplýva, že zubné kefky sú kontaminované rôznorodou mikrobiálnou flórou, čo
je porovnateľné so závermi iných autorov (1, 2). Je možné predpokladať, že kontaminácia
vlákien zubnej kefky priamo súvisí so zastúpením mikrobiálnej flóry v dutine ústnej daného
jednotlivca.
Z hľadiska kontaminácie nenachádza na základe našich pozorovaní všeobecne odporúčané
vymieňanie kefky po troch mesiacoch používania žiadne opodstatnenie, keďže bola
u niektorých jedincov zaznamenaná silná kontaminácia už po dvoch dňoch používania kefky
(Tab.1). Výmena po deväťdesiatich dňoch je potrebná kvôli mechanickému opotrebovaniu.
Podľa niektorých autorov (3) je nutné meniť kefku po dvoch týždňoch. Inou možnosťou je
dekontaminácia za použitia chlórhexidínu, natriumhypochloridu (4), ústnej vody (5).
Fluoridovaná zubná pasta má takisto tendenciu znižovať počet mikroorganizmov na kefke (6).
Používanú zubnú kefku môžeme považovať za dobré kultivačné médium. Zamedzenie rastu
baktérií na nej je prakticky nemožné. Pre obmedzenie ich premnoženia je nutné dodržiavať
nasledujúce zásady: nevymieňať kefku s inými osobami, po chorobe okamžite vymeniť,
skladovať v otvorenom prostredí hlavičkou hore. Do budúcnosti by sme chceli náš výskum
155
rozšíriť o preskúmanie možností dekontaminácie a zníženia počtu baktérií na čo najnižšiu
možnú mieru.
Za poskytnuie zubných kefiek rôznej tvrdosti ďakujeme spoločnosti CURADEN Slovakia s.r.o.
Zoznam použitej literatúry
1. Taji S. S., Rogers A. H.: The microbial contamination of toothbrushes. A pilot study.
Australian Dental Journal 1998, 43(2), s. 128 – 130
2. Verran J., Leahy – Gilmartin A. A.: Investigations into the microbial contamination of
toothbrushes. Microbios 1996, vol. 85, s.231 – 238
3. Glass R. T., et al.: Oral Inflammatory Disease and the Toothbrush. Journal. Alabama
Dental Association 77(4), 1993, s. 12-16
4. Nelson Filho P., Macari S., Faria G., Assed S., Ito IY.: Microbial contamination of
toothbrushes and their decontamination. Pediatr Dent 2000, Sep-Oct, 22(5) , s. 381 –
384
5. Murray, J.J.: The Prevention of Oral Disease. 3. vydanie, New York, Oxford
University Press, 1995, s. 1 - 280
6. Efstratiou M., Papaioannou W., Nakou M., Ktenas E., Vrotsos I. A., Panis V.:
Contamination of a toothbrush with antibacterial properties by oral microorganisms.
Journal of Dentistry 2007, 35(4), s. 331 - 337
156
37. Epidemiologické aspekty reprodukčných strát v Slovenskej republike II (veková
analýza)
Zuzana Kosibová,
(všeobecné lekárstvo, 6. ročník)
Školiteľ: doc. MUDr. Miroslav Korbeľ, CSc.1
1
I. Gynekologicko - pôrodnícka klinika LF UK a FNsP Bratislava
Úvod
Najčastejším abortívnym faktorom včasných spontánnych potratov sú chromozómové
aberácie (50 - 70 %). Riziko chromozómových aberácií progresívne narastá so stúpajúcim
vekom ženy. Väčšina z nich sú numerické aberácie chromozómov (86 %). Štruktúrové
aberácie sú prítomné u 2 - 4 % potratených plodov (1,2).
Cieľom predkladanej práce bola analýza tehotenských strát v SR v rokoch 1997 – 2007
v reprodukčnom období podľa veku žien. Detailná analýza príčin reprodukčných strát by
mohla prispieť k zlepšeniu demografického vývoja v SR.
Materiál a metódy
Retrospektívne sme analyzovali epidemiologické údaje o absolútnych počtoch potratov a
mieru potratovosti z údajov Národného centra zdravotníckych informácií (3 - 13) v
reprodukčnom období žien (v 5 ročných intervaloch). Reprodukčný vek je definovaný ako
vek, počas ktorého je žena schopná rodiť deti (15 - 49 rokov). Miera potratovosti vyjadruje
počet všetkých potratov u žien v danej vekovej skupine na 1000 žien v tej istej vekovej
skupine. Údaje sme zobrazili v tabuľkách a grafoch programu Microsoft Office Excel 2003.
Výsledky
Analyzovali sme dynamiku miery potratovosti pre spontánne potraty (MP-Sp.Ab)
a interrupcie (MP-UPT) na území SR v rokoch 1997 - 2007 v reprodukčnom období žien (tab.
1, graf 1).
Najväčší pokles MP-Sp.Ab za posledných 11 rokov bol vo vekovej skupine 20 - 24 ročných
žien - o 3,8 a v skupine 25 - 29 ročných - o 1,58 (tab. 1, obr. 1). Vo vekovej skupine 15 – 19
ročných MP-Sp.Ab poklesla o 0,8. U žien 30 - 34 ročných stúpla MP-Sp.Ab o 1,2 a u 35 - 39
ročných o 0,85. Vo vekovej skupine 40 - 44 ročných žien bol vzostup MP-Sp.Ab menší - o
0,43. V roku 2007 sú mierne medziročné nárasty MP-Sp.Ab vo všetkých vekových skupinách
okrem 25 - 29 ročných žien. Celkovo MP-Sp.Ab. v reprodukčnom období žien poklesla len
veľmi mierne - o 0,39 (10 %). MP - Sp.Ab. v skupine 20 - 39 ročných žien sa nachádza nad
reprodukčným priemerom, u 15 - 19 a 40 - 49 ročných žien je pod priemerom.
157
MPSp.Ab
1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007
15-19r.
2,59
2,67
2,46
2,21
2,15
1,96
1,96
1,82
1,83
1,77
1,81
20-24r.
7,71
7,57
7,18
6,35
5,26
5,10
5,10
4,68
4,27
3,78
3,92
25-29r.
7,53
7,24
7,71
7,13
6,77
6,66
6,71
6,12
6,16
6,12
5,95
30-34r.
4,72
4,86
5,25
4,65
4,73
4,86
5,05
5,14
5,77
5,79
5,92
35-39r.
2,92
3,11
3,07
2,91
2,80
2,89
3,26
3,52
3,66
3,76
3,77
40-44r.
1,15
1,13
1,05
1,06
1,10
1,13
1,25
1,26
1,46
1,39
1,54
45-49r.
0,16
0,12
0,13
0,15
0,09
0,15
0,14
0,15
0,15
0,17
0,22
15-49r.
3,82
3,84
3,87
3,53
3,30
3,30
3,42
3,31
3,41
3,36
3,43
15-19r.
8,64
8,30
7,79
7,80
7,23
7,06
6,49
5,98
5,61
5,39
5,23
20-24r.
23,26 19,35 17,17 15,35 15,22 14,28 12,74 11,86 11,00 10,99 10,38
25-29r.
27,16 23,20 21,57 19,40 18,14 17,07 15,14 13,43 12,46 11,79 10,40
30-34r.
23,69 21,93 20,77 18,60 17,96 17,33 16,35 15,30 13,53 13,48 12,51
35-39r.
17,08 14,94 14,53 13,54 12,81 12,91 12,18 11,50 11,12 10,96 10,08
40-44r.
7,27
6,68
6,12
5,47
5,61
5,38
5,25
4,97
4,88
4,54
4,55
45-49r.
0,58
0,51
0,42
0,40
0,44
0,35
0,40
0,38
0,38
0,23
0,37
15-49r.
15,23 13,43 12,51 11,43 11,00 10,61 9,82
9,13
8,54
8,37
7,85
MP-UPT
Tab. 1. Prehľad miery potratovosti pre spontánne potraty a interrupcie. MP-Sp.Ab. - miera
potratovosti pre spontánne potraty, MP-UPT - miera potratovosti pre interrupcie, UPT –
interrupcie, r. - vek v rokoch
MP-UPT vo všetkých vekových skupinách žien poklesla (tab. 1, obr. 2). Najvýraznejší pokles
bol v skupinách, ktoré sa v súčasnosti najviac podieľajú na pôrodnosti v SR. Vo vekovej
skupine 25 - 29 ročných bol pokles
o 16,66 (72 %), v skupine 20 - 24 ročných o 12,88
(55 %) a v skupine 30 - 34 ročných o 11,18 (47 %). Nižší pokles - o 7 (41 %) bol
zaznamenaný v skupine 35 - 39 ročných, v skupine 15 - 19 ročných o 3,41 (40 %) a v skupine
40 - 44 ročných o 2,72 (37 %). Najnižší pokles bol v skupine 45 - 49 ročných - o 0,21 (36 %).
Celkovo MP-UPT v SR v reprodukčom veku poklesla o 7,38 (49 %). Nad jej priemerom sa
nachádzajú vekové skupiny 20 - 39 ročných, pod jej priemerom skupiny 15 - 19 a 40 - 49
ročných žien.
158
9
MP-Sp.Ab.
8
7
6
5
4
3
2
1
0
1997
1998
15-19r.
45-49r.
1999
2000
20-24r.
15-49r.
2001
2002
25-29r.
2003
2004
30-34r.
2005
2006
35-39r.
2007
40-44r.
Obr. 1. Miera potratovosti pre spontánne potraty. MP-Sp.Ab. - miera potratovosti pre
spontánne potraty, r. - vek v rokoch
30
MP-UPT
25
20
15
10
5
0
1997
1998
1999
2000
15-19r.
20-24r.
45-49r.
15-49r.
2001
2002
25-29r.
2003
30-34r.
2004
2005
35-39r.
2006
2007
40-44r.
Obr. 2. Miera potratovosti pre interrupcie. MP-UPT - miera potratovosti pre interrupcie, r. vek v rokoch
159
Diskusia
Najpriaznivejší vývojový trend v MP-Sp.Ab a MP-UPT v rokoch 1997 – 2007 možno
pozorovať vo vekovej skupine 20 - 29 ročných žien. Ženy danej vekovej skupiny predstavujú
reprodukčné optimum, najvýznamnejšie sa podieľajú na reprodukcii.
Vo vekových skupinách 15 - 19 a 40 - 49 ročných žien dosahuje MP-Sp.Ab a MP-UPT
najnižšie čísla. Ženy z daných vekových skupín sa v najmenšej miere podieľajú na
reprodukčných stratách, ale aj na celkovej reprodukcii.
Demograficky zaujímavá je skupina 30 – 39 ročných žien. Hodnoty MP-Sp.Ab majú
vzostupný charakter, hodnoty MP-UPT klesajú len mierne. Vysvetlením je, že v posledných
dvoch desaťročiach nastal posun reprodukcie do vyšších vekových skupín (nad reprodukčné
optimum), v ktorých ale narastá riziko reprodukčného neúspechu (2). Objasňovanie príčin
tehotenských strát v tejto skupine žien by mohlo priaznivo ovplyvniť vývoj reprodukcie v SR.
Použitá literatúra
1. Vojtaššák, J., Korbeľ, M., Vojtaššák, B.: Význam vyšetrenia spontánneho potratu pre
klinickú prax. časť - Chromozómové aberácie. Gynekol prax, 5, 2007, č. 2, s. 82 - 87.
2. Korbeľ, M.: Spontánny potrat. Úvod k téme čísla. Gynekol prax, 5, 2007, č. 2, s. 70 –
71.
3. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 1997.Bratislava 1999, ISBN 80-967476-4-9.
4. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 1998. Bratislava 2000, ISBN 80-967-476-6-5.
5. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 1999. Bratislava 2000, ISBN 80-967476-7-3.
6. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 2000. Bratislava 2001, ISBN 80-967476-8-1.
7. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 2001. Bratislava 2002, ISBN 80-967476-9-X.
8. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 2002. Bratislava 2003, ISBN 80-968936-4-5.
9. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 2003. Bratislava 2004, ISBN 80-968936-5-3.
10. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 2004.Bratislava 2005, ISBN 80-968936-7-X.
11. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 2005. Bratislava 2006, ISBN 978-80-89292-01-1.
12. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 2006. Bratislava 2007, ISBN 978-80-89292-07-3.
13. Ústav zdravotníckej informatiky a štatistiky: Zdravotnícka ročenka Slovenskej
republiky 2007. Bratislava 2008, ISBN 978-80-89292-13-4.
160
38. Využitie konfokálnej endomikroskopie pri in vivo diagnostike dysplastických zmien
u pacientov s ulceróznou kolitídou a Crohnovou chorobou
Peter Zita
(všeobecné lekárstvo, 4.ročník)
Školiteľ: MUDr. Tibor Hlavatý PhD. 1
1
V.interná klinika Lekárskej fakulty Univerzity Komenského a Fakultnej Nemocnice
s Poliklinikou Ružinov ,Bratislava
Úvod
Ulcerózna kolitída a Crohnova choroba sú chronické črevné zápalové ochorenia. Patogenéza
týchto ochorení nie je presne známa, ale predpokladá sa patologická aktivácia imunitného
systému.
Jednou z vážnych komplikácií týchto ochorení, ktoré zvyšujú ich mortalitu je kolorektálny
karcinóm. Výsledky Eadena et al. (1) ukázali, že u pacientov s ulceróznou kolitídou
predstavuje kumulatívne riziko kolorektálneho karcinómu 2% pri 10 rokov trvajúcom
ochorení , 8% pri 20 rokov trvajúcom ochorení, 18% pri 30 rokov trvajúcom ochorení. Riziko
je značne vyššie u pacientov s pankolitídou, primárnou sklerotizujúcou cholangitídou, alebo
rodinnou anamnézou kolorektálneho karcinómu. U pacientov s Crohnovou chorobou
postihujúcou hrubé črevo je toto riziko analogické s rizikom obdobného postihnutia a trvania
ulceróznej kolitídy. V porovnaní so sporadickým výskytom kolorektálneho karcinómu je
karcinóm asociovaný s chronickými črevnými zápalmi diagnostikovaný v mladšom veku. Je
častejšie multifokálny, dediferencovaný, agresívnejší.
Prevencia kolorektálneho karcinómu spočíva v pravidelných kolonoskopických vyšetreniach
a v chemoprevencii pomocou 5-aminosalicylátov (2) a ursodeoxycholovej kyseliny
u pacientov s primárnou sklerotizujúcou cholangidídou (3).
U pacientov s nešpecifickými črevnými zápalovými ochoreniami je prítomnosť dysplázie
markerom kolorektálneho karcinómu. Dysplázia predstavuje abnormálny rast a vývoj buniek.
Problematické je, že mnoho dysplázii uniká klasickým zobrazovacím metódam. Skríningové
protokoly odporúčajú odobrať necielené bioptické vzorky (2-4) každých 10 centimetrov
hrubého čreva. Takýto protokol je prácny, časovo náročný ako pre gastroenterológa tak i
pre patológa. Dysplastické zmeny sa klasifikujú podľa Viedenskej klasifikácie(4) na nondyspláziu, dyspláziu neurčitého stupňa, dyspláziu nízkeho stupňa, dyspláziu vysokého stupňa
a karcinóm.
Konfokálna laserová endomikroskopia predstavuje novú metódu, ktorá umožňuje diagnostiku
dysplastických zmien už počas prebiehajúcej kolonoskopie. Princíp metódy je založený na
schopnosti fluoreskujúcich látok obsiahnutých v sliznici (po príslušnej medikácii
fluoresceínom, alebo akriflavínom) vysielať žlto-zelené svetlo s vlnovou dĺžkou 510 – 580
nm po dopade modrého svetla s vlnovou dĺžkou 488nm. Výsledný obraz je sivý a v tak
vysokom rozlíšení, že nám umožní sledovať dané miesto na celulárnej až subcelulárnej úrovni
(5).
161
Materiál a metódy
Cieľom tejto štúdie je posúdiť senzitivitu a špecificitu konfokálnej laserovej endomikroskopie
ako novej metódy na detekciu dysplázií pri dlhotrvajúcej ulceróznej kolitíde a Crohnovej
chorobe.
Inklúzne kritéria štúdie predstavovali : ulcerózna kolitída s trvaním ochorenia minimálne 8
rokov vo forme pankolitídy, ulcerózna kolitída s trvaním ochorenia 15 rokov vo forme
ľavostranného postihnutia, primárna sklerotizujúca cholangitída a Crohnova kolitída
s rozsahom postihnutia minimálne 40 centimetrov a dĺžkou trvania ochorenia minimálne 8
rokov. Ochorenie muselo byť v čase vyšetrenia v remisii. Exklúzne kritéria predstavovali :
stredná a vysoká aktivita ochorenia, stav po totálnej kolektómii a závažné komorbidity.
Každý segment čreva (coecum, colon ascendens, colon transversum, colon descendens, colon
sigmoideum, rectum) bol vyšetrený dvakrát – najskôr bol vyšetrený konvenčnou
kolonoskopiou a boli identifikované suspektné lézie. Následne bol vyšetrený
chromoendoskopicky po aplikácii 0,4% indigokarmínom a lézie boli vyhodnotené podľa
Kuda et al. (6)
a endomikroskopicky systémom PENTAX EC-3870 CIFK a boli
klasifikované podľa Mainzskej klasifikácie (7). V poslednom kroku bola zobratá vzorka
a bola vyhodnotená patológom podľa Viedenskej klasifikácie (4). Na záver boli u každého
pacienta odobrané necielené etážové biopsie podľa doporučení Itzkowitz et. al. (8)
Výsledky
Na V. internej klinike je sledovaných 248 pacientov s nešpecifickými črevnými zápalovými
ochoreniami.
Inklúzne kritéria z hľadiska trvania ochorenia splnilo 71 pacientov. Exklúzné kritéria splnilo
45 pacientov. Z nich 15 pacientov podstúpilo klasickú kolonoskopiu. Chromoendoskopiu
spolu s konfokálnou laserovou endomikroskopiou podstúpilo 30 pacientov.
V súbore pacientov bolo diagnostikovaných 100 lézií (z toho 64 bolo diagnostikovaných
voľným okom a 36 za pomoci farbenia indigokarmínom).
Všetky z nich boli analyzovateľné chromoendoskopiou, avšak 32 z nich nebolo možné
vyšetriť pomocou konfokálnej laserovej endomikroskopie. Pomocou endomikroskopie sa
nám podarilo vyšetriť 28 z 30 (93%) plochých lézií (jazvy, ploché lézie, sesilné polypy) , ale
len 40 z 70 ( 57%) elevovaných lézii (polypov). Najmä vyčnievajúce polypy väčších
rozmerov nad 10 mm boli náročné na vyšetrenie. Treba zdôrazniť, že 6 z 10 dysplázií nebolo
možné endomikroskopicky vyšetriť.
Pokračovali sme analýzou zhody definitívnej histologickej diagnózy a usporiadania krýpt vo
všetkých léziách vyšetrených chromoendoskopicky a endomikroskopicky.
162
Endoskopická
charakteristika
Všetky lézie
Bolo možné
Nebolo možné
vyšetriť
vyšetriť
endomikroskopicky
endomikroskopicky
Typ lézie
Jazva
7
6 (86%)
Plochá lézia
14
13 (93%)
Sesilný polyp
9
9 (100%)
Elevovaný polyp
70
40 (57%)
Malý (6mm)
38
22 (58%)
Stredný (6-10mm)
13
8 (61%)
Veľký (10+mm)
19
10 (53%)
Histológia lézie
Non-dysplastická lézia
90
64 (71%)
Dysplázia neurčitého
5
2 (40%)
stupňa
Dysplázia nízkeho
4
1 (25%)
stupňa
Dysplázia vysokého
1
1 (100%)
stupňa
Tab.1 : Charakteristika identifikovaných lézií
1 (14%)
1 (7%)
0 (0%)
30 (43%)
16 (42%)
5 (39%)
9 (47%)
26 (29%)
3 (60%)
3 (75%)
0 (0%)
Senzitivita konfokálnej laserovej endomikroskopie pre neoplastické dysplázie (nízkeho
a vysokého stupňa) bola 100% , špecificita 98,4 % , pozitívna prediktívna hodnota 66,7 %
a negatívna prediktívna hodnota 100%.
Diskusia
Endoskopická identifikácia dysplastických a neoplastických zmien predstavuje dôležité ciele
v terapii pacientov s chronickými nešpecifickými zápalovými procesmi, najmä u tých, ktorí
majú zvýšené riziko vzniku malígneho procesu .
Podľa Kiesslicha et al. (7) je senzitivita konfokálnej laserovej endomikroskopie 94,7%,
špecificita 98,3% a negatívna prediktívna hodnota 99,1%, čo je porovnateľné s našimi
výsledkami – senzitivita 100%, špecificita 98,4% a negatívne prediktívna hodnota 100%.
V tejto práci však väčšinu lézií predstavovali ploché lézie. Z niektorých štúdii (9) vyplýva, že
dysplázia pri chronických črevných zápalových ochoreniach sa vyskytuje v 60 – 87 % na
elevovaných léziách, ktorých podiel v spomínanej práci bol veľmi nízky. Podľa našich
výsledkov bolo 70 lézii elevovaných (70%) a 30 (43%) z nich sa nedalo endomikroskopicky
vyšetriť. Treba však zdôrazniť, že až 6 dysplastických zmien bolo prítomných na léziách,
ktoré nebolo možné vyšetriť .
Medzi limitácie konfokálnej laserovej endomikroskopie patrí nedostatočná možnosť
vizualizovať jadrá buniek a tým diferencovať dyspláziu nízkeho, vysokého stupňa
alebo karcinóm. Limitáciou je i hĺbka prieniku, ktorá predstavuje 250µm.
163
Konfokálna laserová endomikroskopia je pri diagnostike dysplastických zmien pomerne
limitovaná. V našej štúdii nebolo možné zhodnotiť značnú časť elevovaných lézií a až 60%
dysplastických lézií tak uniklo diagnostike. K rozšíreniu použitia tejto metódy v klinickej
praxi by mohlo dôjsť najmä rozvojom nových generácií tejto metodiky.
Poďakovanie
Školiteľovi ďakujem za ústretovosť, obetavosť a odborné vedenie v danej problematike.
V.internej klinike ďakujem za umožnenie ŠVOČ na ich pracovisku.
Zoznam použitej literatúry
1. Eaden JA, Abrams KR, Mayberry JF, et al.: The risk of colorectal cancer in ulcerative
colitis: a metaanalysis. Gut 2001; 48: 526-535.
2. Farraye FA, Odze RD, Eaden JA, et al.: AGA technical review on the diagnosis and
management of colorectal neoplasia in inflammatory bowel disease. Gastroenterology
2010; 138{2): 746-774.
3. Tung BY, Emond MJ, Haggitt RC, et al.: Ursodiol Use Is Associated With Lower
Prevalence of Colonic Neoplasia in Patients With Ulcerative Colitis and Primary
Sclerosing Cholangitis. Ann Intern Med 2001; 134: 89–95.
4. Schlemper RJ, Riddell RH, Kato Y, et. al.: The Vienna classification of
gastrointestinal epithelial neoplasia. Gut 2000; 47: 251-255.
5. Huorka M.: Konfokálna laserová endoskopia – nová endoskopická metóda
v diagnostike včasných neoplázií hrubého čreva. Gastroenterol. Prax 2008; 7{3): 123125.
6. Kudo S, Hirota S, Nakajima T, et al.: Colorectal tumours and pit patern. J Clin Pathol
1994; 47{10): 880-885.
7. Kiesslich R, Goetz M, et al.: Chromoscopy-guided endomicroscopy increases the
diagnostic yeald of intraepithelial neoplasia in ulcerative colitis. Gastroenterology
2007; 132 {3): 874- 882.
8. Itzkowitz SH, Harpaz N,: Diagnosis and management of dysplasia in patients with
imflamatory bowel diseases. Gastroenterology 2004; 126{6): 1634-1648.
9. Rutter MD, Saunders BP, Wilkinson KH, et. al.: Most dysplasia in ulcerative colitis is
visible at colonoscopy. Gastrointest Endosc. 2004; 60: 334-339.
164
39. Defekty prednej brušnej steny
Marián Janík
(všeobecné lekárstvo, 3.ročník)
Školiteľ: Doc.MUDr.Eliška Kubíková,PhD., MUDr. Monika Čiešková
Anatomický ústav LFUK; Klinika detskej chirurgie DFNsP
Úvod
Pokroky vo všetkých oblastiach medicíny umožňujú udržať pri živote aj deti, ktoré sa narodili
s veľkými a nenapraviteľnými malformáciami.
Medzi závažné malformácie patria aj vrodené chyby brušnej steny. Ak sa včas (počas
tehotenstva) odhalia a po pôrode okamžite liečia, dieťa prakticky nemá žiadne komplikácie
a vyrastá ako plnohodnotný jedinec.
Predná brušná stena sa u embrya vytvára a formuje v rovnakom čase a súbežne s oddelením
hrudníkovej a brušnej dutiny a s vývojom brušných orgánov.
Vrodené chyby brušnej steny môžu mať veľký počet príčin, vývojových porúch a ich
následkov, a tým aj veľa podôb. Všetky však vznikajú ako následok porušeného vývoja
v embryonálnom živote.
Prednú brušnú stenu tvoria m. rectus abdominis, m. obliquus externus abdominis, m. obliquus
internus abdominis, m. transversus abdominis, m. quadratus lumborum. V rámci defektov
však nesmieme zabúdať ani na regio inguinalis, ktoré býva miestom vzniku hernií. Tu však
nejde o defekty, ale o oslabené miesto v brušnej stene, ako predilekčné miesto vzniku hernií.
Ak dochádza k poruche celistvosti a pevnosti brušnej steny tak, že pri nich zostáva v stene
otvor, môže sa stať, že časť brušných orgánov zostáva v pupočníku. V takomto prípade
hovoríme o omfalokéle. Ak je prítomný iba otvor v stene, jedná sa o gastroschízu. Ak je
spoločná kloaka medzi močovou a tráviacou trubicou ústiaca na povrch brušnej steny, ide
o vezikointestinálnu fissúru.
Materiál a metódy
Náš súbor tvorili pacienti operovaní na Klinike detskej chirurgie DFNsP. Súbor bol zistený
z Operačnej knihy Kliniky detskej chirurgie DFNsP.
Výsledky
V roku 2009 bolo na Klinike detskej chirurgie DFNsP operovaných 20 pacientov s vrodeným
defektom prednej brušnej steny, z ktorých 11 pacientov malo diagnostikovanú omfalokélu a
9 pacientov malo diagnostikovanú gastroschízu, pričom pomer chlapcov a dievčat bol 1:1.
Pacienti s diagnózou vezikointestinálnej fissúry v roku 2009 operovaní neboli.
Omfalokéla – prietrž pupočného povrazca je pomerne častá vrodená chyba, ktorá zodpovedá
stavu a pomerom prednej brušnej steny 6.-10. embryonálneho týždňa. V tomto období sa ešte
165
časť stredného čreva nachádza v pupočníkovom povrazci a pri súčasnej rotácii sa vťahuje do
zväčšujúcej sa brušnej dutiny. Ak sa tento vývojový dej preruší, črevo sa nevtiahne a nemôže
sa dotvoriť predná brušná stena v celej oblasti jej spojenia s pupočníkovým povrazcom.
Omfalokéla bola diagnostikovaná a chirurgicky riešená u 11 pacientov (55 %), z ktorých 6
bolo dievčat (30 %) a 5 chlapcov (25 %).
Ak vznikne defekt prednej brušnej steny mimo pupočného povrazca, cez ktorý vystúpili
črevné kľučky do amniovej dutiny, hovoríme o gastroschíze. V posledných rokoch je jej
výskyt častejší ako omfalokély. V našom súbore bolo s touto diagnózou v roku 2009
chirurgicky liečených 9 pacientov (45 %), z ktorých 4 boli dievčatá (20 %) a 5 bolo chlapcov
(25 %).
Najťažšou vrodenou chybou prednej brušnej steny, ktorá je spojená i s postihnutím čriev
a močových ústrojov je vezikointestinálna fissura. Na Klinike detskej chirurgie DFNsP nebol
v roku 2009 operovaný žiadny pacient s touto diagnózou.
Počet
pacientov
Z
toho Z
toho
dievčat
chlapcov
Omfalokéla
11 (55 %)
6 (30 %)
5 (25 %)
Gastroschíza
9 (55 %)
4 (20 %)
5 (25 %)
Vezikointestinálna
fissura
0
0
0
Spolu
20 (100 %)
10 (50 %)
10 (50 %)
Tab. 1: Pacienti s vrodeným defektom prednej brušnej steny operovaní v r. 2009
Vo všetkých prípadoch je jedinou metódou voľby chirurgická liečba. Vyžaduje sa niekoľko
chirurgických zákrokov po sebe a tak isto aj kvalitná pooperačná starostlivosť. Operačná
rekonštrukcia gastroschízy je mnohokrát spojená s pooperačnými komplikáciami. Preto musí
byť pooperačná starostlivosť na najvyššej úrovni. V súčasnej dobe je úspešnosť liečby takmer
80 %.
Diskusia
Úspešnosť liečby je závislá od prenatálnej starostlivosti (opakované USG – predpoklad
vzniku defektu brušnej steny). Vďaka prenatálnej diagnostike sú pacienti s defektmi prednej
brušnej steny včas zachytení a tým ihneď po pôrode odoslaní na špecializované pracovisko v
rámci Slovenska t.j. na Kliniku detskej chirurgie do Bratislavy, kde sú ihneď podrobení
operačnému riešeniu. Vďaka moderným chirurgickým postupom i kvalitnej pooperačnej
starostlivosti sú pacienti prakticky bez následkov.
Záver
Úlohou lekára je, aby predišiel ťažkostiam v diagnostike i komplikáciách. To je však možné
vtedy, ak bude dokonale poznať všetky anatomické štruktúry, ale zároveň bude rátať s ich
možnými defektmi či variabilitami.
166
Práca chcela upozorniť v rámci anatómie na možnosť výskytu defektov prednej brušnej steny
v rámci vrodených vývojových chýb, s ktorými je potrebné v rámci prenatálnej diagnostiky
rátať.
Zoznam použitej literatúry
1. Balaš V, a kol: Špeciálna chirurgia. Vydavateľstvo Osveta. 1987. 352-353.
2. Janec M: Starostliovsť o deti s vrodenými chybami. Vydavateľstvo Osveta. 1991.
ISBN 80-217-0279-6. 142-155
3. Mráz P: Anatómia ľudského tela 1. Slovak Academic Press, spol. s r.o., Bratislava.
2004. ISBN
80-89104-57-6. 220-227.
167
40. Normálny apendix a apendix v zápale – morfologická štúdia
Ján Dzuracký, Katarína Galliková
(všeobecné lekárstvo, 3.ročník)
Školiteľ: Prof. MUDr. Ján Jakubovský, DrSc.1, Doc. MUDr. Eliška Kubíková, PhD. 2
1
Ústav patologickej anatómie LF UK, 2Anatomický ústav LF UK
Úvod:
Zápaly apendix vermiformis trápia ľudstvo od nepamäti. Hoci ide o zápal s veľmi malou
mortalitou, jeho frekvencia v celosvetovej populácii ročne dosahuje obrovské čísla. Aj malé
% mŕtvych predstavuje nepríjemne veľa ľudí. Okrem sociálnych následkov prináša tiež veľké
ekonomické straty. Medzinárodné štatistiky udávajú napr. incidenciu akútnej apendicitídy 25
postihnutých na 10.000 zdravých ľudí vo veku 10 – 17 rokov, a 1 – 2 na 10.000 mladších ako
4 roky. Incidencia apendicitídy v USA je asi 1 na 400, t. j. 0.25% (internet 1).
CIEĽ PRÁCE: Porovnať stavbu ľudského a králičieho appendix vermiformis. Opísať obraz
akútnej apendicitídy v králikoch a u ľudí.
Materiál a metódy:
Vzorky z 23 apendixov ľudí pochádzajú z retrospektívnej analýzy bioptického materiálu ÚPA
LFUK. Vzorky z apendixu králikov pochádzajú od 15 králikov zo spätnej analýzy
kontrolných vzoriek, odobratých počas rozličných pokusov v minulosti a od 15 králikov
po vykonaní pokusnej apendicitídy.
Peyerove plaky v králičom apendixe tvorí kupola, pokrytá enterocytmi, bez pohárikových
buniek. Typickou zložkou sú M bunky. Pri subjektívnom hodnotení tu pri apendicitíde
pribúdajú epitelové (T) lymfocyty. Lamina basalis epitelu je fenestrovaného typu. Otvormi
v nej, aj štrbinami medzi enterocytmi dochádza ku komunikácii obsahu čreva s makrofágmi.
V zápale pribúdajú makrofágy osobitne pod lamina basalis. Neskôr sa napučané makrofágy
nachádzajú aj v hlbších častiach lymfatického tkaniva Peyerovho plaku.
Výsledky, získané opisom makroskopických a mikroskopických nálezov uvádzame v tab. 1
a 2.
168
Výsledky:
Štruktúra
Dĺžka
Obvod
Seróza
Svalovina
- cirkulárna
- longitudinálna
1. Lymfatické tkanivo
Peyerove plaky (PP)
Epitelový kryt kopuly PP
Pohárikové bunky
Makrofágy
Dendritové bunky
Lymfocyty B
Lymfocyty T
Epitelové lymfocyty
Venuly s vysokým endotelom
Epitelový kryt Leberkühnových
krýpt
Pohárikové bunky
M bunky
Membrana basalis
Epitelové lymfocyty
Medzikryptová sliznica
Epitelový kryt
M bunky
Membrana basalis
Makrofágy (MF)
Dendritové bunky
Lymfocyty B
Lymfocyty T
Epitelové lymfocyty
Venuly s vysokým endotelom
Apendix králika
max 4-5 cm
max 1 cm
jemná, lesklá,
hladká
tenká
súvislá
nesúvislá
+
Enterocyty,
bunky
+
+
+
+
-
Ľudský apendix
Ľudské črevo
2-20 cm
cca 1cm
jemná,
lesklá,
hladká
hrubá
súvislá
súvislá
?
M ?
+
+
?
?
?
?
?
?
?
+
+
+
+
+
+
-
+
+
fenestrovaná
zriedka
+
?
?
?
+
+
+
+
Enterocyty
+
súvislá
+
+
+
+
+
+
?
?
?
+
+
+
+
+
+
Enterocyty
+
súvislá
+
+
+
+
+
+
Tab. 1. Porovnanie apendixu králika, človeka a hrubého čreva človeka
169
Sliznica
Apendix králika
1h
6h
Neporušená
Poškodená
24 h
Zničená
Epitel
Nepoškod.
Zničený
– enterocyty
Nezmenené
– pohárikové bunky
Viac
Lamina basalis
Neporušená
Lamina propria mucosae
Hyperémia
– lymfocyty B
– lymfocyty T
– epitelové lymfocyty
– makrofágy
Nezmenené
Nezmenené
+
Aktivované
– retikulové bunky
– granulocyty (PMN)
–
venuly
s vysokým
endotelom
– krvná mikrocirkulácia
Nenápadné
Leukostáza
Nezmenené
++
+
+++
Veľké,
často
Nenápadné
Početné
Napučané
Hyperémia
Hyperémia
– lymfové cievy
Svalovina
– krvná mikrocirkulácia
Nenápadné
Neporušená
Hyperémia
Široké
Opuch
Hyperémia
– lymfové cievy
– bunkový infiltrát
Nenápadné
Občas PMN
Rozšírené
Časté PMN
Seróza
Hyperémia
Hyperémia
– krvná mikrocirkulácia
Rozšírená
Rozšírená
– lymfové cievy
Nenápadné
Široké
– bunkový infiltrát
Nenápadný
PMN, MF
Dystrofia,
nekróza
Dystrofie
Veľmi
početné
Neporušen
á
Hyperémia
Rozpadnuté
Rozpadnuté
Ľudský apendix (čas odhadom)
1h
6h
24 h
Nepoškod. Ložiskovo Zničená
poškodená
Nepoškod. Ložiskovo Zničený
zničený
Nezmenen Dystrofia
Zničené
é
až nekróza
Aktivované Početnejšie Zničené
Ložiskovo
zničená
Krvácania
Neporušen Občas
Zničená
á
defekty
Hyperémia Prevaha
Ložisková
PMN
nekróza
Občas
?
?
?
Občas
?
?
?
Nehodnotiteľné +
++
Žiadne
Rozpadávajúce ?
Aktivované Zanikajúce
sa
Zreteľné
?
?
?
Veľmi početné +
++
+++++
Uzvreté alebo ?
?
?
neprítomné
Krvácanie
Hyperémia Hyperémia Krvácanie
+
Obsahujú PMN Rozšírené Široké
Zničené
Rozpadnutá
Opuch
Opuch
Zničená
Krvácania
Mierna
Výrazná
Zničená
hyperémia hyperémia
Obsahujú PMN Nenápadné Rozšírené Zničené
Prevažne PMN Žiaden
Hlavne
Všade
PMN
PMN
Ložiskovo
?
Hyperémia Krvácania
poškodená
Hyperémia
Hyperémia s pribúdajúcou stázou
PMN
Široké s PMN
Nerozšír Široké, s prímesou Er,
ené
PMN
PMN, MF
Žiaden
PMN a krvácanie
Tab. 2. Porovnanie apendixu králika, človeka - histologické nálezy
Diskusia:
170
Pribúdanie makrofágov, najmä v kupole Peyerových plakov, opísali aj iní, napr. Michalka et
al. (2007), ktorí ukázali v prvých štádiách apendicitídy mohutné vychytávanie Gram
pozitívnych paličiek makrofágmi práve pod lamina basalis. Po glykokalyxe na povrchu
enterocytov (Blažeková et. al), ktorý je identifikačnou vrstvou zložiek črevného obsahu, ide
o 1. obrannú líniu nešpecifickej rezistencie organizmu. Cudzí antigén, ktorý preniká do ich
blízkosti, tieto bunky pohlcujú a spracujú. Výslednú informáciu podávajú lymfocytom
v kupole Peyerovho plaku. (Azzali 1998, 2003). Tie realizujú imunitné obranné reakcie.
Porovnanie normálneho ľudského a králičieho apendixu ukazuje, že obe štruktúry nie sú
morfologicky úplne podobné. Rozdiely sa týkajú osobitne Peyerových plakov. Tieto je vidno
v králičom, ale nie v ľudskom apendixe. Podobné štruktúry sa nachádzajú v hrubom čreve
a v distálnom ileu ľudí. Vo vzniku apendicitídy majú významnú rolu epitelové lymfocyty. Na
rozdiel od T lymfocytov, ktoré vznikajú mimo tráviaceho traktu a vyzrievajúcich v týmuse,
lymfocyty diferencujúce sa v tráviacom trakte vyzrievajú v Peyerových plakoch (Fujimora et
al 1991, 1992) a osídľujú tráviaci trakt. Aj keď sme nemali priamo možnosť diferencovať T
a B lymfocyty inak ako podľa vzťahu k okolitým štruktúram, môžeme tvrdiť, že počet
epitelových (T) lymfocytov sa počas apendicitídy mení.
Zoznam použitej literatúry:
1. Internet http://www.symptomsofappendicitis.org/Appendicitis-Statistics.html
2. P. Michalka, R. Šolcová, J. Holzerová, O. El-Hassoun, V. Jakubovská, Š. Polák, J.
Jakubovský, J. Novotný: Experimental appendicitis in the rabbits analysis of gram
stained histological sections. J. Health Sci. Management Publ. Health. 8, 2007, 2, 165176.
3. Azzali G. Structure, lymphatic vascularization and lymphocyte migration in mucosaassociated lymphoid tissue. Immunol Rev. 195, 2003, 178-189.
4. Azzali G. Three-dimensional and ultrastructural aspects of the lymphatic
vascularization of the vermiform appendix. J Submicrosc Cytol Pathol. 30, 1998, 4,
545-553.
5. Blažeková J, Brozman M, Jakubovský J, Benová J, Blahutová V: Fixácia za
prítomnosti ruténiovej červenej vo fixačnom roztoku. Bratisl Lek Listy 74, 1980, 2,
145-154.
6. Fujimura Y, Hosobe M, Kihara T: Ultrastructural study of M cells from colonic
lymphoid nodules obtained by colonoscopic biopsy. Digest. Dis. Sci. 37, 1992, 7,
s.1089-1098.
7. Fujihashi K, McGhee JR, Lue C, Beagley KW, Taga T, Hirano T, Kishimoto T,
Mestecky J, Kiyono H: Human appendix B cells naturally express receptors for and
respond to interleukin 6 with selective IgA1 and IgA2 synthesis. J Clin Invest. 88,
1991, 1, 248-252.
171
41. Diagnostika intrauterinného ohrozenia plodu
Mária Vojtaššáková
(všeobecné lekárstvo, 4. ročník)
Školiteľ: MUDr. Lenka Linhartová, PhD.
II. gynekologicko - pôrodnícka klinika LFUK a FNsP Bratislava
Úvod
Jednou z najčastejších príčin ohrozenia plodu je rozvoj intrauterinnej hypoxie až asfyxie. Tie
tvoria hlavný problém perinatologickej patológie (1). Fetálna asfyxia je intrauterinný stav
plodu, kedy dochádza k takému narušeniu výmeny plynov, že je nedostatočná a vedie
k progresívnej hypoxémii a hyperkapnii so signifikantnou metabolickou acidózou (2).
Cieľom intrauterinného monitorovania stavu plodu počas pôrodu je včasná detekcia
rozvíjajúcej sa hypoxie plodu, čím sa znižuje nielen celková perinatálna mortalita, ale aj
intrapartálna a postnatálna morbidita novorodenca. Rozvíjajúca sa hypoxia plodu je
najčastejšou indikáciou na operačné ukončenie pôrodu (1, 3). Existuje viacero vyšetrovacích
metód, ktoré umožňujú detekciu hypoxie plodu počas pôrodu. V našej práci sa zaoberáme
dvoma metódami intrapartálneho monitorovania stavu plodu - kardiotokografiou (CTG) a
intrapartálnou fetálnou pulznou oxymetriou (IFPO).
CTG je monitorovacia metóda, ktorá súčasným grafickým záznamom na dvojkrivkovom
zapisovači vyhodnocuje kontrakčnú činnosť maternice a zmeny akcie srdca plodu (1, 3).
V praxi využívame externú, nepriamu a kontinuálnu kardiotokografiu, keď snímače
pripevníme na brucho tehotnej v punctum maximum srdcových oziev plodu (1).
IFPO patrí k novým metódam, ktoré sa využívajú ako doplnkové monitorovacie metódy
počas pôrodu (1, 3, 4). Ide o priame, kontinuálne a neinvazívne monitorovanie fetálnej
oxygenácie (SpO2), teda meranie saturácie hemoglobínu kyslíkom v krvi. Princíp spočíva
v spektrofotometrickom meraní rozdielnej absorpcie svetla oxyhemoglobínom alebo
deoxyhemoglobínom. Indikáciou použitia je suspektný alebo patologický kardiotokografický
záznam (1). Podľa klinických štúdií bola stanovená dolná hranica normálnej saturácie na 30%
(5, 6). Pri pomalom poklese SpO2 pod 30% počas desiatich minút dochádza k zmenám
acidobázickej rovnováhy (pH < 7,2) (5, 6, 7).
Cieľom našej práce bola analýza pôrodov, u ktorých bol intrauterinný stav plodu
monitorovaný pomocou CTG a IFPO v období od januára 2008 do decembra 2009.
Materiál a metódy
Súbor tvorilo 38 rodičiek so suspektným alebo patologickým kardiotokografickým
záznamom. Priemerná dĺžka gestácie v sledovanom súbore bola 39,6 týždňa. Intrauterinný
stav plodu bol kontinuálne monitorovaný kardiotokografickým prístrojom a
intrapartálnym fetálnym pulzným oxymetrom.
172
Kardiotokografický záznam sme hodnotili podľa FIGO-klasifikácie (FIGO - Medzinárodná
federácia gynekológov a pôrodníkov), pričom záznam hodnotený 7 – 5 bodmi sme pokladali
za suspektný, záznam hodnotený 4 bodmi a menej za patologický. Pri hodnotení SpO2 sme
vychádzali z algoritmu, že ak je SpO2>30%, plod nie je ohrozený hypoxiou. Ak je hodnota
SpO2 < 30% v dĺžke trvania 10 minút a viac, zásobenie plodu kyslíkom je nedostatočné.
V sledovanom súbore sme vyhodnocovali okrem CTG a SpO2 aj spôsob ukončenia pôrodu,
Apgar-skóre a pH pupočníkovej krvi novorodenca. Pričom pH ≥ 7,2 sme pokladali za
fyziologické, pH < 7,2 za patologické.
Súbor rodičiek sme rozdelili do 2 základných skupín podľa hodnotenia kardiotokogramu –
skupina so suspektným a skupina s patologickým kardiotokografickým záznamom.
Výsledky
Prvú skupinu tvorili rodičky s patologickým kardiotokografickým záznamom (7 rodičiek)
(schéma č.1). U všetkých rodičiek bola SpO2 < 30% v dĺžke trvania 10 minút a viac, zároveň
tehotenstvo bolo ukončené cisárskym rezom z indikácie hroziacej hypoxie plodu. Hodnota
pH pupočníkovej krvi novorodenca bola u všetkých < 7,2, čiže patologická. Avšak žiaden
novorodenec nemal znížené Apgar-skóre.
Patologický CTG záznam
7 (100%)
SpO2<30%
SpO2>30%
7 (100%)
0 (0%)
pH<7,2
pH≥7,2
7 (100%)
0 (0%)
Normálne Apgar-skóre
7 (100%)
Abnormálne Apgar-skóre
0 (0%)
Schéma č.1: Výsledky IFPO, pH a.umbilicalis a Apgar-skóre rodičiek s patologickým CTG
záznamom
173
Suspektný
CTG záznam
31 (100%)
SpO2<30%
SpO2>30%
8 (26%)
23 (74%)
pH<7,2
pH≥7,2
pH<7,2
pH≥7,2
4 (50%)
4 (50%)
4 (17%)
19 (83%)
Normálne
Apgar-skóre
4 (100%)
Normálne
Apgar-skóre
4 (100%)
Normálne
Apgar-skóre
4 (100%)
Normálne
Apgar-skóre
19 (100%)
Abnormálne
Apgar-skóre
0 (0%)
Abnormálne
Apgar-skóre
0 (0%)
Abnormálne
Apgar-skóre
0 (0%)
Abnormálne
Apgar-skóre
0 (0%)
Schéma č.2: Výsledky IFPO, pH a.umbilicalis a Apgar skóre rodičiek so suspektným CTG
záznamom
Druhú skupinu tvorili rodičky so suspektným kardiotokografickým záznamom (31 rodičiek)
(schéma č.2). U 26% rodičiek bola SpO2 < 30%. V tejto skupine bol jeden pôrod (13%)
ukončený vaginálne – operačne per forcipem sec. Simpson z indikácie hroziacej hypoxie
plodu. Ostatné pôrody boli ukončené cisárskym rezom pre hroziacu hypoxiu plodu (87%). Pri
SpO2 > 30% až 17 rodičiek (74%) porodilo vaginálne. V 26% bol pôrod ukončený cisárskym
rezom, avšak z indikácie nepokračujúci pôrod v I. alebo v II. dobe pôrodnej.
Všetci novorodenci v tejto skupine mali normálne Apgar-skóre. Pri SpO2 < 30% bolo pH <
7,2 u 4 novorodencov (50%). Taktiež 4 novorodenci mali pH ≥ 7,2 (50%). Pri SpO2 > 30%
bolo pH < 7,2 u 4 novorodencov (17%), 23 novorodencov (83%) malo fyziologické pH.
Špecificita patologického kardiotokografického záznamu a riziko výskytu acidózy pri
nedostatočnej SpO2 plodu sa nedala štatisticky zhodnotiť pre nedostatočný počet rodičiek.
IFPO pri patologickom kardiotokografickom zázname preukázala 100% špecificitu.
Špecificita suspektného kardiotokografického záznamu bola 25,81%. IFPO pri suspektnom
kardiotokografickom zázname mala 50% špecificitu aj senzitivitu.
174
Diskusia
Cieľom práce bolo potvrdenie špecificity jednotlivých metód (CTG, IFPO) a efektivity
kontinuálneho monitorovania plodu (CTG + IFPO). Zhodnotili sme adekvátnosť použitia
vyšetrovacích metód pri hroziacej hypoxii plodu a celkový prínos kontinuálneho
intrapartálneho monitorovania plodu z dôvodu sledovania jeho stavu.
Podľa klinických štúdii by mal patologický kardiotokografický záznam vykazovať väčšiu
špecificitu ako suspektný kardiotokografický záznam (3). Pri patologickom
kardiotokografickom zázname bol u všetkých rodičiek zrealizovaný cisársky rez pre hroziacu
hypoxiu plodu, čo poukazuje na vyššiu špecificitu (napriek tomu, že sme špecificitu číselne
nezhodnotili) ako pri suspektnom zázname.
Monitorovanie pôrodu pomocou IFPO pri suspektnom alebo patologickom
kardiotokografickom zázname výrazne znižuje počet pôrodov ukončených cisárskym rezom
z indikácie hroziacej hypoxie plodu (8, 9, 10). Súčasným monitorovaním intrauterinného
stavu plodu pomocou kontinuálneho CTG a IFPO sa znížil počet pôrodov ukončených
cisárskym rezom na 52,63% v oboch skupinách. Z toho 30% cisárskych pôrodov bolo
realizovaných z indikácie nepokračujúci pôrod v I. alebo II. dobe pôrodnej a 70% z dôvodu
hroziacej hypoxie. Tieto hodnoty poukazujú na zníženie incidencie cisárskych pôrodov pri
simultánnom monitorovaní CTG aj IFPO o takmer 63,16% pre hroziacu hypoxiu plodu
a spoločnú vyššiu špecificitu vyšetrení (špecificita CTG + IFPO bola 93,3%).
Záver
Naše výsledky poukazujú na pomerne vysokú špecificitu IFPO oproti CTG, a preto
odporúčame pri suspektnom, respektíve patologickom kardiotokografickom zázname
monitorovanie stavu plodu pomocou CTG aj IFPO, čím výrazne prispejeme k zníženiu počtu
pôrodov ukončených cisárskym rezom z falošnej indikácie hroziacej hypoxie plodu.
Zoznam použitej literatúry
1. Holomáň, Karol et al.: Vybrané kapitoly z pôrodníctva. 1. vydanie. Bratislava, 2004,
209 s.
2. Low, J.A.: Intrapartum fetal asphyxia: definition, diagnosis, and classification. Amer.
J. Obstet. Gynecol., 176, 1997, s. 957–959.
3. Breckwoldt, Meinert et al.: Gynekologie a porodnictví. 1. vydanie. Martin, 1996, 648
s.
4. Roztočil, Aleš et al.: Moderní porodnictví, 1. vydanie. Bratislava, 2008, 408 s.
5. Carbonne, B., et al.: Multicenter study on the clinical value of fetal pulse oxymetry. II.
. Obstet.Gynecol., 177, 1977, s. 593-598.
6. Carbonne, B., et al.: Use of fetal pulse oximetry during labor. J. Gynecol. Obstet. Biol.
Reprod., 29, 2000, s. 309-311.
7. Bloom, S., et al.: Duration of desaturation and intrapartum outcome. Obstet.
Gynecol., 93, s. 1036-1040.
175
8. Csitári, I.K., Pasztuhov, A., Lászlo, A.: The reliability of fetal pulse oximetry: The
effect of fetal oxygen saturation below 30% on perinatal outcome. Eur. J. Obstet.
Gynecol. Reprod. Biol., 136, 2008, s. 160-164.
9. Fernandéz, A.I., Martinéz, M.I.,: Fetal pulse oximetry. Intrapartum foetal hypoxia
evaluation. Comparative
study with invasive techniques concerning foetal welfare.
An. Sist. Sanit. Navar., 27, 2004, s. 179-189.
10. East, Ch. E., Brennecke, S.P., King, F.J., Chan, Y.F., Colditz, P.B.: The effect of
intrapartum fetal pulse oximetry, in the presence of a nonreassuring fetal heart rate
pattern, on operative delivery rates: A multicenter, randomized controlled trial. Am. J.
Obstet. Gynecol, 194, 2006, s. 606.e1–606.e16.
176
42. Interaktívny anatomický atlas topografických régií
Boris Kolárik, Michal Lapides
(všeobecné lekárstvo, 3. ročník)
Školiteľ: Doc. MUDr. Eliška Kubíková, PhD.
Anatomický ústav, LF UK, Bratislava
Úvod
V 21. storočí je neodmysliteľnou súčasťou vzdelávania internet a počítačové interaktívne
programy, tzv. e-learning. Našim cieľom bolo poukázať, že tieto informačné systémy majú
svoje miesto aj vo výučbe Anatómie. Našim zámerom bolo vytvoriť interaktívny anatomický
atlas jednotlivých topografických oblastí ľudského tela. Tento atlas by v budúcnosti slúžil ako
učebná pomôcka študentom všeobecného ale aj zubného lekárstva na osvojenie si základných
topograficko-anatomických vzťahov a topografických oblastí dôležitých najmä pre budúcu
klinickú prax.
Materiál a metódy
Kadáver 75 ročného muža. Pomôcky: skalpel, anatomická pinzeta, chirurgická pinzeta,
fotoaparát značky Cannon, model PowerShot A720.
Preparačný postup podľa literatúry a rád zamestnancov (asistentov) Anatomického ústavu.
Preparovali sme anatomické štruktúry postupnou preparáciou z povrchu do hĺbky. Jednotlivé
vypreparované štruktúry sme zdokumentovali fotoaparátom.
Výsledky
Výsledky našej práce sú zjavné na postupne sa rozvíjajúcom anatomickom atlase.
S výslednou prácou bude môcť študent samostatne pracovať, odhaľovať názvy jednotlivých
štruktúr ako aj overovať si svoje vedomosti.
Program má aktívne zapájať študenta na overovanie si anatomických vedomostí zábavnejšou
formou a prispieť k uľahčeniu štúdia anatómie.
Diskusia
Na svete existuje množstvo anatomických atlasov rôznej formy spracovania. Poznáme ako
najbežnejšie anatomické atlasy spracované v textovej podobe s podrobnými nákresmi,
obrázkami alebo aj fotografiami. Taktiež existujú aj atlasy zostavené s minimálnou textovou
časťou založené hlavne na obrazovej podobe rôznej formy. Tento atlas volí druhý spôsob
podávania informácií študentovi. Naša práca mala podklady z . Pitevných cvičení . (Mráz
a kolektív, 1995). Hlavná inovácia tohto diela spočíva v jeho priblížení modernej dobe. To čo
bolo doteraz poskytnuté študentom len vo forme obrázkov v knihách, je im priblížené
v interaktívnej podobe na sérii fotografií v interaktívnym štýlom. Našou snahou bolo uľahčiť
výučbový proces študentom počas pitevných týždňov, tak, aby boli schopní sa lepšie
orientovať a popisovať anatomické útvary na kadáveroch. Je nesporne veľký rozdiel, ak si
177
môže študent pozrieť anatomické útvary v rovnakej forme ako ich uvidí v pitevni, spoločne aj
s popisom a získa tak reálnejšiu a presnejšiu predstavu o anatómii ľudského tela.
Zoznam použitej literatúry
1. Mráz, P. a kolektív: Pitevné cvičenia, 1995, 208 strán
178
Download

ZBORNÍK KONFERENCIE 49. fakultná konferencia