Ročník 2, 2014/2
Dlouhá evoluční cesta rostlin
Rozsivky a jejich vizitky
Aerobiologie aneb o životě ve vzduchu
Tajemství kořenového systému smrku
Pampelišky, jak je neznáte
Mokřadní rostlina polním plevelem?
Seriál o houbách
Léčivé houby
Herbářové poklady
Krása jarních květů
Nová naučná stezka
OBSAH
Úvodní slovo
2
Dlouhá evoluční cesta rostlin (L. Záveská Drábková)
3
Rozsivky a jejich vizitky (M. Kozáková)
6
Aerobiologie aneb o životě ve vzduchu (B. Obstová)
7
Tajemství kořenového systému smrku (J. Machač a T. Lukešová)
9
Pampelišky, jak je neznáte – alternativní zdroj přírodního kaučuku (J. Kirschner)
10
Přírodě blízká obnova – stále ještě netradiční přístup k obnově těžebních prostor (L. Šebelíková)
13
Mokřadní rostlina polním plevelem? (P. Zákravský a Z. Hroudová)
14
Invaze ambrózie peřenolisté? (H. Skálová)
15
Seznamte se – rozhovory s našimi vědci – D. Jančula
16
Průhonický park z pohledu mykologa (F. Kotlaba, Z. Pouzar)
18
Léčivé houby (Z. Navrátilová)
20
Herbářové sbírky rostlin – poklady v našich rukou (J. Štěpánek)
21
Hledání rodinného stříbra v herbářích (J. Liška)
23
Jaká rostlinná společenstva jsou v Průhonickém parku druhově nejbohatší? (P. Petřík)
24
Virtuální naučná stezka Průhonickým parkem (P. Sekerka, P. Petřík, Z. Caspers)
25
Pozvánka do Průhonického parku: Zimní květy pod lupou – vilíny (L. Záveská Drábková)
27
Jarní fotografická soutěž
28
Svět rostlin v umělecké makrofotografii: Krása jarních květů (B. Obstová)
29
O znovu objevených podzemních prostorách průhonického zámku (J. Skála)
31
Akce pro veřejnost
33
2
Úvodní slovo
Vážení a milí čtenáři,
rok je za námi a Vy dostáváte do rukou opět prosincové číslo časopisu Botanika. První rok v životě nového časopisu
je vždy nejtěžší. Vše je nové, tvoří se koncept, struktura, přesvědčují se lidé, přicházejí první příspěvky, oslovují se
první čtenáři, hledají se finanční příspěvky na provoz. To vše již máme za sebou a doufáme, že jste v letošním roce
v našem novém časopise Botanika načerpali nové informace a zajímavosti ze světa rostlin.
První číslo našeho časopisu vyšlo 5. prosince 2013. Hned v dubnu letošního roku jsme pro Vás připravili první číslo
z plánované řady Speciálů, „Zaostřeno na rododendrony“, kterým jsme Vás pozvali na vycházku záplavou květů rododendronů v Průhonickém parku. Druhé řádné číslo vyšlo za pár týdnů, začátkem června 2014. Nyní držíte v rukou
již třetí číslo časopisu. Za uplynulý rok jsme pro Vás připravili 56 článků v různých rubrikách.
V tomto čísle naleznete tři nové rubriky. První z nich je seriál o houbách v Průhonickém parku. Tentokrát bude
o makromycetech, tedy o oblíbené skupině mezi amatérskými houbaři, neboť jsou to houby, které lze určit „pouhým okem" nebo jen za použití lupy. Druhou novinkou je seriál volně navazujících příspěvků věnovaných důležitým
aspektům vědy o rostlinách – „Téma“. V tomto čísle se budeme věnovat tématu velmi rozsáhlému – evoluci rostlin.
Třetí novinkou je rubrika věnovaná „Světu rostlin v umělecké makrofotografii“, kde bychom Vám chtěli představovat
křehkou krásu našich botanických objektů. V tomto čísle začneme jarními květy.
V uplynulém roce jsme pro Vás připravili „Jarní fotografickou soutěž“. Soutěžit jste mohli ve dvou soutěžích, soutěži
o „Hlavní cenu časopisu Botanika“ a o „Cenu příznivců časopisu Botanika na Facebooku“. V první soutěži proběhlo
hodnocení zaslaných fotografií odbornou porotou, v soutěži druhé jste porotci byli vy sami a hodnotili jste soutěžní
fotografie přímo na našich FB stránkách. Vítězné snímky naleznete v tomto čísle.
I v dalších číslech časopisu bychom chtěli udržet nastavený trend a informovat Vás nejen o novinkách a vědeckém
bádání na poli botaniky a o širším dění v Botanickém ústavu, tedy na všech třech našich pracovištích, v Průhonicích,
v Třeboni a v Brně, ale i o krásách a zajímavostech Průhonického parku a akcích pro veřejnost u nás pořádaných.
Přejeme Vám příjemné a poučné chvíle při čtení časopisu Botanika
Vaše redakce
CAAATGGCTGT TCAT T TACCT T TATCT T TGGAAGCTCAAGCGGAGGCGCGT
CAAATGGCTGT TCAT T TACCT T TATCT T TGGAAGCTCAAGCGGAGGCGCGT
3
CAAATGGCTGT
TCAT T TACCT T TATCT T TGGAAGCTCAAGCGGAGGCGCGT
CAAATGGCTGT TCAT T TACCT T TATCT T TGGAAGCTCAAGCGGAGGCGCGT
CAAATGGCTGT TCAT T TACCT T TATCT T TCGAAGCTCAAGCGGAGGCGCGT
CAAATGGCGGT TCAT T TACCCCTATCT T TCGAAGCTCAAGCGGAGGCTCGT
C AAATGGCTGT TC AT T TACCT T TATCT T TGGAAGCTC AAGTAGAGGCTCGT
CAAATGGCTGT TCAT T TACCT T TATCT T TCGAAGCTCAAGCGGAGGCGCGT
C AAATGGCTGT TC AT T TACCT T TATCT T TCGAAGCTC AAGCGGAGGCTCGT
C AAATGGCTGT TC AT T TACCT T TATCT T TCGAAGCTC AAGCGGAGGCTCGT
CAAATGGCTGT TCAT T TACCT T TATCT T TCGAAGCTCAAGCGGAGGCGCGT
C A AATG G C TG T TC AT T TACC T T TATC T T TCG AAG C TC A AG TG TAG G C TCG T
C A AATG G C TG T TC AT T TACC T T TATC T T TCG AAG C TC A AG TG TAG G C TCG T
CAAATGGCTGT TCAT T TACCT T TATCT T TCGAAGCTCAAGCGGAGGCGCGT
C A AATG G C TG T TC AT T TACC T T TATC T T TCG AAG C TC A AG TG TAG G C TCG T
CAAATGGCTGT TCAT T TACCT T TATCT T TCGAAGCTCAAGCGGAGGCGCGT
CAAATGGCTGT TCAT T TACCT T TATCT T TCGAAGCTCAAGCGGAGGCGCGT
C AAATGGCTGT TC AT T TACCT T TATCT T TCG AAGCTC AAGCGTAGGCTCGT
C AAATGGCTGT TC AT T TACCT T TATCT T TCG AAGCTC AAGCGTAGGCTCGT
DLOUHÁ EVOLUČNÍ CESTA ROSTLIN
Vznik života je téma, které stále přitahuje pozornost
nejen vědců, ale i široké veřejnosti. Ponechme však
nyní teorie o vzniku života stranou a podívejme
se, jak vznikly rostliny, tedy předmět zájmu
našeho časopisu.
Z vědeckého hlediska je základní jednotkou
života buňka. Zde tedy hledejme počátky jak
rostlin, tak všech živých tvorů. Rostlinná buňka
se vyznačuje řadou společných charakteristik,
které dělají rostliny rostlinami. První z nich, která
každého napadne, je to, že jsou zelené. Mnozí jistě
znají pojem chlorofyl a chloroplast, tedy názvy
sloučeniny a organely, které za zeleným zbarvením
rostlin stojí. Ano, především zde je skryta základní
vlastnost rostlin, tedy schopnost fotosyntézy, tj.
přeměny anorganických látek, oxidu uhličitého
a vody v látky organické, uhlovodíky, za pomoci
energie slunečního záření. Rostlinná buňka má
i další typické znaky – buněčnou stěnu, vakuoly,
zásobní látky tvořené oleji a škrobem, obsah
barviv a neukončený růst, abychom jmenovali
alespoň nejdůležitější z nich.
vchlípení
plasmatické
membrány
Předpokládá se, že chloroplasty jsou pozůstatkem
fúze předků dnešních cyanobakterií a mitochondrie pozůstatkem fúze předků dnešních proteobakterií s ancestrálním prokaryotem (obr.). Teorie,
která je podpořena mnohými důkazy včetně nejnovějších molekulárních studií, se nazývá teorie
endosymbiózy. Poprvé hypotézu endosymbiózy
formuloval roku 1905 ruský lichenolog Konstantin Merežkovský. Při pozorování symbiotického
endoplasmatické
retikulum
jádro
soužití řasy a houby u lišejníků ho napadlo, že
chloroplasty mohly vzniknout endosymbiózou
sinic. Známější je však americká badatelka Lynn
Margulisová, která se v šedesátých letech 20. století
zabývala strukturou a původem eukaryotických
buněk. Zjistila, že chloroplasty se vyvinuly právě
z cyanobakterií. Také předpokládala, že v evoluční
historii živých organismů nešlo jen o tuto jedinou
endosymbiózu, ale že tímto způsobem vznikly
dvě či více linií.
Výsledkem endosymbiózy byl zisk dvou typů
organel, které zásadním způsobem změnily
metabolismus rostlinných buněk. Díky chloroplastům rostliny získaly schopnost fotosyntézy,
díky mitochondriím se zase výrazně zvýšila
efektivita buněčného dýchání a tvorby zdroje
energie, tedy ATP (adenosin trifosfátu). Buňky
se postupně spojovaly do mnohobuněčných
celků, které v průběhu času získaly funkční
i morfologickou specializaci. Jednoduché buněčné
dělení bylo nahrazeno tvorbou specializovaných
reprodukčních buněk samičího a samčího typu
s polovičním počtem chromozomů v porovnání
se somatickými buňkami rostlin. Variabilita
generovaná sexuálním rozmnožováním díky
rekombinacím genů a velkému množství nově
vznikajících kombinací dala vzniknout ohromnému
množství forem. Z nich jen ty nejschopnější přežít,
tj. ty, které se byly schopny vyrovnat se změnami
prostředí, osídlit daný biotop a přežít v konkurenci
s ostatními, předaly své geny do dalších generací.
V průběhu milionů let se díky změnám v atmosféře,
především díky produkci kyslíku jednobuněčnými
zelenými mořskými některé organismy, vytvořily
podmínky pro osídlení souše. Pouze organismy
ancestrální
fototrofní
eukaryot
(předek rostlin)
mitochondrie
s
začlenění
ancestrálního
fototrofního
prokaryota
(cyanobakterie)
ča
DNA
Již před zhruba 3,5 miliardami lety existoval jednobuněčný předek všech organismů, tedy i rostlin,
který neměl schopnost fotosyntézy. V průběhu
evoluce se vyvinul další jednobuněčný předek,
který již schopnost fotosyntézy měl. Jeho buňky
byly velmi podobné (tedy blízce příbuzné) dnešním
sinicím, tzv. cyanobakteriím. Chloroplasty, zelené
organely dnešních rostlin plné chlorofylu a mající
schopnost dělení, se v buňkách rostlin neocitly
náhodou. Kde se chloroplasty a také další organely,
jako jsou mitochondrie u eukaryotických buněk,
vzaly? To je otázka, kterou se zabývali vědci již
před sto lety. A zabývají se jí dodnes.
Téma: Evoluce rostlin
cytoplasma
ancestrální
prokaryot
plasmatická
membrána
začlenění
aerobního
heterotrofního
prokaryota
(proteobakterie)
Upraveno podle UK Essays. Endosymbiotic theory and eukaryotic cell evolution
biology essay (internet). November 2013
ancestrální heterotrofní eukaryot
(předek živočichů a hub)
chloroplast
Téma: Evoluce rostlin
4
Po celou dobu vývoje rostlin i dalších organismů zanechaly události
v evoluční historii „nesmazatelnou“ stopu v podobě změn
v sekvenci DNA.
dobře geneticky vybavené pro tuto kolonizaci
mohly uspět. Působení UV záření ze slunečních
paprsků akcelerovalo mutace genů a vznik dalších
nových genových kombinací, to vše za spolupůsobení řady faktorů. Jednotlivé kombinace genů
se začaly od sebe odlišovat tak, že se organismy
nebyly schopny vzájemně rozmnožovat – došlo k vyčlenění nových rodů a druhů v rámci
různě blízce či dalece příbuzných skupin. Faktory prostředí a kompetice příslušníků vlastního
i cizích druhů o zdroje a možnost reprodukce
způsobily, že přežily jen nejsilnější organismy.
Úspěch závisel na schopnosti přizpůsobit se
měnícím se podmínkám prostředí. Kolonizace
souše rostlinami šla ruku v ruce se schopností
obstát v konkurenčním boji nejen s rostlinami,
ale záhy také se živočichy, pro které se rostliny
staly vítaným zdrojem potravy. Vytvořily se
specializované vztahy s abiotickým prostředím
a především síť vzájemně komplikovaných vztahů rostlin a živočichů. Jejich spolupráce např.
v oblasti opylování vytvořila jeden z nejúžasnějších
příkladů koevoluce, dobře patrný např. ve tvaru
květů orchidejí, připomínajících své opylovače
(viz obr.). Možnost opylování hmyzem, ale i jinými
živočichy, přinesla zvýšenou efektivitu reprodukce,
přinášející opět nové genetické kombinace. Rostliny
postupně osídlily všechny kouty planety. Tam, kde
pravděpodobnost opylení živočichy byla výrazně
menší, vyvinuly rostliny způsoby asexuálního
rozmnožování, od klonálního rozmnožování
výběžky či oddenky, odnožemi až po sofistikované
způsoby částečného nebo úplného opuštění
sexuálního rozmnožování, známého pod názvem
apomixie (např. u pampelišek, o nichž si můžete
přečíst na str. 12).
Po celou dobu vývoje rostlin i dalších organismů
zanechaly události v evoluční historii „nesmazatelnou“ stopu v podobě změn v sekvenci DNA.
Všechny změny tak byly zaznamenány. Ale stejně
jako informace na harddisku vašeho počítače může
být smazána, i v evoluci docházelo k takovým
událostem. Nepohodlné úseky DNA mohly být
vymazány a nenávratně ztraceny, jiné se naopak
zmnožily do velkého množství kopií. Vzájemné
křížení rostlin mohlo sice přinést řadu nových
kombinací, ale také problém nekompatibility
genomů. Jednou z cest, jak tento problém vyřešit,
byla polyploidizace (znásobení počtu chromozomových sad), aby nedocházelo k poruchám
při párování chromozomů. Případně docházelo
k reorganizaci chromozomů, jejich spojování
či štěpení, událostem doprovázeným změnami
ve velikosti genomu.
Celosvětový počet dnes se vyskytujících druhů
rostlin je odhadován na více než 250 tisíc. Jejich
výskyt je výsledkem výše uvedených a mnoha
dalších složitých procesů, které probíhaly po miliony let a stále probíhají. Evoluce je nikdy nekončící
proces a cesta lemovaná množstvím vyhynulých
organismů. Zjištění vzájemných evolučních
vztahů je tak velmi komplikované, neboť mnozí
předkové již dávno vyhynuli a nemáme k nim
Příklad koevoluce ve tvaru květů orchidejí,
např. tořičů (rod Ophrys)
Víte, že i živočichové mají chloroplasty? Je
tomu opravdu tak, někteří mořští plži (např.
rody Elysia nebo Elysiella) začlenili ze své
potravy, zelených řas, do svého těla chloroplasty, které zůstaly fotosynteticky funkční
v buňkách žaludku živočicha. Tyto živočišné
chloroplasty se nazývají kleptoplasty. Nejsou
součástí zárodečného vývoje živočicha, ten
je tedy musí v každé generaci získat znovu
z potravy. Jádro řasy v těle plže zaniká. Plži
tak mohou podobně jako rostliny získávat
živiny fotosyntetickým procesem.
žádné, ani fosilní doklady. I tam, kde se snažíme
najít příbuzenské vztahy u současných druhů,
čeká řada úskalí. Mezi jinými je to nalezení
„správných“ genů pro relevantní fylogenetické
hypotézy. A zde se nachází klíč ke správnému
příbuzenskému zařazení rostlin, které je základem
pro jejich identifikaci. Kde všude by mohla rychlá
identifikace rostlin pomocí tzv. barcodingu být
užitečná, je již jiný příběh, o kterém si můžete
přečíst jinde. Nezapomeňme však, že živé organismy lze nejlépe poznávat v přírodě a bez pomoci
přístrojů. Stačí se jen pozorně dívat a případně
nahlédnout do některé z mnoha určovacích
příruček a publikací.
Čmelák zemní (Bombus terrestris) na květu aksamitníku (Tagetes patula)
Kontakt:
RNDr. Lenka Záveská Drábková, Ph.D. ([email protected]; Taxonomické oddělení)
Rostliny známé neznámé
5
ROZSIVKY A JEJICH VIZITKY
Rozsivky tvoří až čtvrtinu veškeré biomasy, kterou na Zemi
rostliny produkují, a velkou měrou se tedy podílejí na fotosyntéze.
proto rafe postrádají. Naopak penátní rozsivky
žijí ve vodách převážně na substrátu (kamenech,
písku, větvích, mechorostech, vodních rostlinách),
po němž se pohybují nebo jsou k němu pevně
přichyceny. Rozsivky často vylučují sliz, který
může mít podobu malých polštářků spojujících
jednotlivé buňky v koloniích, stopek, kterými jsou
buňky přichyceny k podkladu, či trubic, v nichž
buňky žijí (obr. na str. 6 vpravo dole).
20 µm
Schránka rozsivky rodu Diploneis ve skenovacím elektronového mikroskopu (SEM)
Milí čtenáři, dovolte mi seznámit vás s nejrozšířenější skupinou řas, jejíž zástupci tvoří až čtvrtinu
veškeré biomasy, kterou na Zemi rostliny produkují,
a velkou měrou se tedy podílejí na fotosyntéze.
Jedná se o rozsivky, na které si jistě pamatujete
ze školních let díky jejich specifickému způsobu
nepohlavního rozmnožování, spojenému se
zmenšováním schránek.
Rozsivky jsou jednobuněčné eukaryotické organismy řazené do skupiny hnědých řas. Vyvinuly
se asi před 200 miliony let z předka třídy Chrysophyceae pokrytého křemičitými šupinami, jež
se přetvořily ve dvojdílnou schránku – frustulu,
která je pro rozsivky typická. Frustula je v podstatě buněčná stěna, jejíž pektinová vrstva je
inkrustovaná částečně hydratovaným amorfním
oxidem křemičitým. Pod schránkou se nachází živý
obsah buňky – protoplast, nicméně klasifikace
rozsivek je založená především na morfologii
frustuly (na její velikosti, tvaru a strukturách
jejího povrchu).
Podle tvaru frustuly dělíme rozsivky na kulaté
(centrické), připomínající nízký válec, a podlouhlé,
protáhlé (penátní), připomínající svým kopinatým
tvarem např. lodičku, jak se latinsky nazývá
druhově nejpočetnější rod člunovka – Navicula.
Kromě tvaru se tyto dvě skupiny od sebe liší
i přítomností struktury na povrchu misky, které
říkáme rafe. Jedná se o podélnou štěrbinu či rýhu,
táhnoucí se středovou osou (obr. nahoře). Přes
rafe je vylučován lepivý proteoglukanový sekret,
který společně se svazky aktinových vláken, ležícími podél vnitřní strany štěrbiny, napomáhá pohybu
(„lezení“) rozsivky a jejímu udržení na podkladu.
Právě schopnost aktivního pohybu je většině
zástupců rostlinné říše zapovězena. Centrické
rozsivky žijí většinou jako součást planktonu
ve vodním sloupci. Jsou pasivně unášeny vodou,
Za účelem detailního určení, především do druhů a nižších taxonomických kategorií, je nutné
za použití peroxidu a kyselin získat čisté frustuly,
na nichž jsou pak ve světelném či elektronovém
mikroskopu dobře patrné všechny důležité
struktury jako např. perforace – komůrky (areoly) či póry. Tyto „dírky“ slouží k transportu
vody a v ní rozpuštěných látek přes frustulu.
Areoly uspořádané v symetrických řadách jsou
ve světelném mikroskopu patrné jako čárky (strie),
jejichž přítomnost, orientace a hustota je dalším
determinačním znakem. Dále jsou přítomné
např. různé ztluštěniny, žebra a výrůstky sloužící
ke spojení buněk.
Pozorovat rozsivky v mikroskopu je úchvatná
podívaná. Můžeme jen žasnout nad obrovskou
pestrostí tvarů. Odhaduje se, že na Zemi žije až
milion druhů těchto organismů. Je to jako sledovat nádherné umělecké dílo, které ale nevytvořil
člověk. Trochu horší je začít rozsivky určovat
do rodů a druhů. Dnešní taxonomie rozsivek je
jako džungle, v níž se musíte prosekat mačetou.
Taxonomové neustále popisují nové rody a druhy.
Ne, že by tak rychle vznikaly, ale díky dokonalejším nástrojům (jako např. kvalitní mikroskopy)
je k dispozici mnohem více informací. Někdy
je nový druh popsán pouze na základě studia
materiálu z jedné jediné lokality či dokonce
jedné jediné buňky nebo na základě drobné
morfologické odchylky, a proto je třeba ocenit
kolegy, kteří jsou v tomto ohledu kritičtí a při
zkoumání potenciálního nového taxonu řasy
kultivují, sledují jejich rozmnožování (sexuální
kompatibilitu), morfologickou variabilitu a využívají molekulárně-biologické metody.
Kde rozsivky najdeme?
Kromě nejrůznějších typů sladkých i slaných vod,
v nichž je najdeme nejčastěji, osidlují rozsivky
rovněž svrchní vrstvy půdy a někdy poletují
i vzduchem jako součást tzv. aeroplanktonu. Nejvíce druhů rozsivek nalezneme v čistých vodách,
jako jsou prameniště v přírodních rezervacích
(až 50 druhů ve vzorku), naopak ve znečištěných
vodách nalezneme pouze několik málo druhů
masově pomnožených.
20 µm
Schránka rozsivky Epithemia argus (SEM)
Rostliny známé neznámé
6
Něco málo z historie a současnosti české
diatomologie
Studium mikroskopických řas je úzce spjato
s vynálezem mikroskopu v první polovině
17. století. Ještě před dvěma sty lety byl
mikroskop velmi vzácným přístrojem a používala jej výhradně lékařská věda. První druh
rozsivky popsal roku 1773 O. F. Müller jako
Vibrio paxillifer. Použil rodového jména z mikrobiologické terminologie. Jednalo se o rozsivku dnes známou pod jménem Bacillaria
paxillifera. Zájem o rozsivky a jejich studium
se rozvinul mimo Českou republiku, ale někteří
zahraniční badatelé uváděli i nálezy z našeho
území. Roku 1827 popsal švédský botanik
C. A. Agardh několik druhů termálních rozsivek
z Karlových Varů. První souvislejší článek zdejšího autora zabývající se rozsivkami z našeho
území pochází od Mendelova současníka
algologa J. Naveho. Další zdejší badatelé
(ovšem hovořící a píšící německy) začali
rozsivkám věnovat pozornost až počátkem
minulého století. Jmenujme např. O. Richtera,
který sbíral rozsivky na Hané a jižní Moravě
(slaniska v okolí Hustopečí), nebo R. Dvořáka, který působil v Třebíči. S Dvořákem byl
v kontaktu R. Fischer, který sbíral řasy na jižní
Moravě (v Podyjí a Lednických rybnících).
Velmi významnou postavou je F. Nováček,
který kromě sběru a determinace řasy jako
první na světě i kultivoval. Nestorem české
diatomologie je J. Bílý, učitel na dívčí škole
ve Šlapanicích u Brna. Původně se věnoval
vyšším rostlinám, ze zdravotních důvodů
však přešel k rozsivkám. Publikoval mnoho
floristických prací o rozsivkách Čech, Moravy
i Slovenska.
Mezi naše současné nejvýznamnější diatomology patří žák J. Bílého doktor Petr Marvan,
uznávaný především díky zpracování metodiky
k hodnocení kvality vod na základě řasových
indikátorů, profesorka Aloisie Poulíčková
působící na PřF UP v Olomouci a doktor
Václav Houk z Centra pro algologii AV ČR,
jenž se zabývá centrickými rozsivkami.
5 µm
Pohled na vnitřní stranu misky rozsivky Eunotia arcus (SEM); různé druhy tohoto rodu jsou hojné
v kyselých vodách, Eunotia arcus je výjimkou ze zásaditých vod.
Přestože jednu rozsivku bychom pro její malou velikost pouhým okem nespatřili (měří od 3 do 300 μm), při jarních a podzimních procházkách v přírodě můžeme v potocích pozorovat
hnědé, zelené či zelenohnědé povlaky na kamenech,
větvích a jiných ve vodě ponořených substrátech.
Jsou to kolonie rozsivek čítající miliony jedinců.
Jak se dívat na rozsivku aneb na úhlu pohledu
záleží.
Schránka rozsivek se skládá ze dvou částí. Odtud
pochází i název skupiny rozsivky – Diatomae,
anglicky Diatoms. Horní části říkáme epitéka,
spodní části hypotéka. Pro názornost si představte krabici od bot s víkem nebo Petriho misku.
Když buňku pozorujeme shora (ve valvárním
pohledu), vidíme plochu misky (valvy), pokud
ji pozorujeme z boku (v pleurálním pohledu),
vidíme překrývající se části horní a dolní misky,
kterým říkáme pásky (pleury).
se měnilo prostředí v třetihorách. Mohutným
vrstvám rozsivek, které se usadily v příznivých
obdobích geologické historie, říkáme diatomit
neboli křemelina. Podle stupně čistoty se používá
např. při filtracích v pivovarnictví či vinařství,
nejkvalitnější pak ve farmaceutickém průmyslu.
Méně kvalitní diatomit se používá jako lehký
izolační materiál. Dokonce jej použil Alfréd Nobel
k výrobě dynamitu. Indikační vlastnosti rozsivek
se využívají také v archeologii či kriminalistice.
Ale kdo by chtěl zbohatnout, ať se ve službách
naftařské společnosti pídí po fosilních rozsivkách,
z jejichž zásobních látek vznikla ložiska ropy.
Využití rozsivek
Schránky rozsivek druhu Fragilaria ulna mají
dlouhou buňku a vypadají trochu jako teploměr
(SEM).
Pro své vynikající bioindikační vlastnosti (řada
druhů má specifické nároky na prostředí, jako
je např. pH a obsah živin) se rozsivky využívají
k hodnocení kvality vod. Schránky rozsivek jsou
navíc velmi trvanlivé. Když uhyne živý obsah
buňky, v sedimentech se zachová schránka,
která zde přetrvá miliony let a pro nás nese
cennou informaci, například jak vypadalo a jak
Rozsivky rodu Gomphonema (na obr. je schránka druhu Gomphonema olivaceum z Bílých
Karpat) vylučují svým užším koncem slizové
stopky, jimiž jsou přichyceny k substrátu.
Kontakt:
Mgr. Markéta Fránková, Ph.D. ([email protected]; Oddělení vegetační ekologie)
Co všechno nám může říci…
aerobiologie
7
založena meteorologická stanice (l´Observatoire
de Montsouris). Pro její účely byl P. Miquelem,
prvním profesionálním aerobiologem, sestaven
nejstarší známý volumetrický lapač spor, jenž
pomocí vodního čerpadla aktivně nasával vzduch
na sklíčko potřené glycerinem.
Ke konci 19. století se britský fyzik Ch. H. Blackley
zabýval další aerobiologickou metodou sběru
pylu – gravimetrickou. Pylová zrna jsou zachycována na adhezivní médium pasivně pomocí
jejich samovolné sedimentace. Svými pokusy
mimo jiné dokázal, že příčinou „senné“ rýmy
jsou jednoznačně pylová zrna.
Modifikovaná pylová past Tauberova typu, do které otvorem ve víčku samovolně sedimentuje pyl.
Krkonoše, říjen 2013
AEROBIOLOGIE
ANEB O ŽIVOTĚ VE VZDUCHU
Už se vám také stalo, že jste na jaře hledali pod
nánosem žlutého prachu své modré auto? Nebo
jste najednou všichni v práci dostali rýmu?
Vaše nažloutlé auto má na svědomí pyl dovátý
z právě kvetoucích jehličnanů (u nás především
borovice a smrku) a rýmu ve většině případů
vzdušný přenos virů. Ačkoliv se to tedy někdy
na první pohled nezdá, protože pylové zrno ani
virion nejsme schopni pouhým okem vidět, všude
kolem nás je vzduch plný života. Mikroskopicky
malého života.
S pyly a viry se vzduchem pasivně pohybují další
malé biologicky aktivní objekty, jako jsou řasy,
bakterie, úlomky rostlinných a živočišných těl či
spory hub. Těmito objekty, jejich zdroji, způsobem
šíření a vlivy se zabývá věda zvaná aerobiologie.
Pohled do historie
Pro bližší seznámení s aerobiologií se podíváme
na zásadní milníky jejího historického vývoje.
Cestou do minulosti se nejdříve dostaneme
do starověkého Řecka, kde byl zřejmě v polovině
8. století př. n. l. složen (pravděpodobně Homérem)
epos Ilias. V tomto díle se nacházejí nejstarší dochované zmínky popisující problémy s lapáním
po dechu či „hladem po vzduchu“, objevující se
například po silné námaze. V 5. století př. n. l.
se pak Hippokratés snažil nalézt původ těchto
problémů. Oba dva se pokoušeli o totéž, vysvětlit
příčiny astmatu, které však v té době ještě nebylo
možné objasnit. O několik století později, konkrétně v polovině 1. století př. n. l., pozoroval řím-
ský filosof Lucretius prachové částice ve slunečním
paprsku v tmavé místnosti. Pohyb si vysvětloval
bombardováním částeček neviditelnými atomy,
tj. teorií, která tehdy převládala jako vysvětlení
nákazy nemocemi.
Po Lucretiovi pak trvalo mnoho staletí, než badatelé opět začali studovat různorodé částice
ve vzduchu. Italský botanik P. A. Micheli v první
třetině 18. století popsal rod Aspergillus a ze svých
mykologických experimentů vyvodil závěr, že se
plísně z jednoho plátku ovoce na druhý, několik
cm vzdálený, rozšiřují pomocí vzduchu. V průběhu
18. století se vědci s rozvojem mikroskopie a botaniky začali více zabývat stavbou květu, pylem
a jeho šířením, jako například anglický botanik
T. A. Knight, který v té době popsal přenos pylu
větrem na dlouhé vzdálenosti.
Jedním z prvních průkopníků spojovaných přímo
s aerobiologií je německý mikrobiolog Ch. G.
Ehrenberg. V polovině 19. století mikroskopicky
zkoumal dešťové kapky, prach či sněhové vločky,
ve kterých hledal mikroorganismy. Nedlouho
po něm popsal francouzský biolog L. Pasteur teorii
o zárodkovém vzniku nemocí, německý mikrobiolog R. Koch zjistil příčinu antraxu a tuberkulózy
a anglický lékař a fotograf R. L. Maddox v roce
1870 sestavil aerokoniskop, přístroj, ve kterém
částečky ze vzduchu, pasivně proudící kónickým
tunelem (obr. vpravo A), ulpívaly na lepivém povrchu sklíčka (obr. vpravo B). Maddoxův kolega
D. D. Cunningham přístroj používal v Kalkatě
pro výzkum cholery (obr. dole). Na sklíčko se
mu však zachytával především pyl a spory hub.
V roce 1871 byla v Paříži v parku Montsouris
Termín aerobiologie byl poprvé použit ve 30.
letech minulého století v abstraktu amerického
vědce F. C. Meiera jako název pro projekt o mikrobiálním životě ve vzduchu. Meier však ,,svou“
vědu neměl nikdy možnost rozvíjet, neboť cestou
na představení svých předběžných výsledků zemřel
při letecké havárii. Moderní aerobiologie 20. století je tedy spojena především s P. H. Gregorym,
britským vědcem, který se spolu s meteorology
zabýval výzkumem větrného transportu částic,
jejich depozicí, disperzí či rychlostí jejich přenosu.
Spolu se svým britským kolegou J. M. Hirstem
založil a standardizoval volumetrickou metodu
měření vzdušných částic vztaženou k m3 vzduchu. Právě Hirstem je pak v roce 1952 sestaven
první standardizovaný volumetrický lapač spor,
tzv. ,,Hirst Spore Trap“, který funguje na principu
nasávání vzduchu na lepkavé medium rychlostí
10 l/min, což se rovná průměrnému objemu
vzduchu nadýchaného za minutu průměrným
Cunninghamův aerokoniskop: A – boční
pohled, B – řez prostorem lepivého sběrného
média (upraveno dle Gregory 1973 in Lacey &
West 2006: The air spora: A manual for catching
and identifying airborne biological particles.
Springer, Dordrecht.).
Co všechno nám může říci…aerobiologie
8
dospělým člověkem. Hirstův lapač našel ihned
po svém uvedení do praxe uplatnění ve zdravotnictví a zemědělství, ve kterých je používán dodnes.
Další typ pylového lapače používaného v současnosti je Tauberova past – otevřená nádoba
zapuštěná do země, do které samovolně sedimentuje pyl (tj. gravimetrická metoda). Tyto
pasti (obr. vlevo nahoře) se využívají při studiu akumulace pylu za určitou jednotku času na určitém
místě v krajině a pro sledování lokálního, regionálního a dálkově transportovaného pylu. Získané
výsledky a informace o vztazích mezi vyskytující
se vegetací a pylem jsou využívány paleoekology
při rekonstrukcích vzhledu krajiny v dobách, ze
kterých je k dispozici informace pouze pylová.
Jiné lapače, založené například na postupném
oddělování různě velkých částic ve vzduchu,
jsou pak využívány v alergologii, imunologii či
ekotoxikologii ke zhodnocení aktuální korelace
mezi obsahem pylových zrn či hub a alergenicitou ovzduší.
Aerobiologie
a alergologie
Z předchozích řádků je zřejmé, že aerobiologie
je multidisciplinární obor, který se rozvíjí a vzájemně ovlivňuje spolu s botanikou, palynologií,
paleoekologií, medicínou či meteorologií. Některé
obory využívají poznatků aerobiologie téměř
denně, jako například lékařský obor zaměřený
na alergie – alergologie.
Nejčastějším projevem alergie je alergická
(„senná“) rýma, kterou nejčastěji způsobují
pylová zrna (obr. vpravo nahoře), popřípadě
spory hub (obr. vpravo dole). Pro zpřesnění
lékařské péče a uzpůsobení aktivit alergiků
(větrání domu, sport, dovolená) je nutné znát
aktuální pylový stav ovzduší. Z tohoto důvodu
zahájila v roce 1988 provoz Centrální evropská
pylová databanka ve Vídni (European Aeroallergen Network Server – EANS), využívající
pro vyhodnocování ovzduší sedmidenní volumetrické lapače spor dle Hirsta. Od té doby se
v Evropě a dalších částech světa postupně rozvíjí
síť pylových monitorovacích stanic, ke které se
v roce 1992 připojilo i tehdejší Československo.
Česká pylová informační služba poskytuje jednou
týdně aktuální údaje o pylovém stavu ovzduší
na svých webových stránkách či prostřednictvím
médií. Vylepšení v podobě pylové předpovědi
na další dny přináší právě na základě údajů z pylových monitorovacích stanic a dále předpovědi
Vzduch kolem nás je plný překvapení
počasí model SILAM Finského meteorologického institutu.
borného využití, jako je například základní výzkum v paleoekologii, proniká více a více do sféry
aplikovaných věd a zdravotní péče.
Je tedy patrné, že aerobiologie zažívá v poslední
době silný rozvoj a kromě stále převážně od-
50 µm
Tři pylová zrna naší alergologicky nejvýznamnější dřeviny břízy (Betula) a jedno pylové zrno alergologicky středně významné dřeviny jasanu (Fraxinus), barveno safraninem.
50 µm
Spora rodu Alternaria. Spolu s rodem Cladosporium jsou nejčastějšími venkovními mykologickými
původci alergických dýchacích problémů (v našich podmínkách).
Kontakt:
Mgr. Barbora Obstová ([email protected]; Oddělení vegetační ekologie)
Tajemný mikrokosmos
9
FASCINUJÍCÍ POHLEDY DO MIKROSVĚTA HUB – 3. DÍL
Tajemství ukryté v kořenech smrků a borovic
Ve třetím díle našeho seriálu zaměříme svou
pozornost do hloubi kořenového systému smrku
ztepilého, který skrývá "temné" tajemství v podobě endofytických hub s charakteristickými
tmavými přehrádkovanými hyfami (houbovými
vlákny). Těm tyto houby také vděčí za své odborné
pojmenování: Dark Septate Endophytes (DSE),
česky: tmaví přehrádkovaní endofyté.
Označení "endof yt" dává tušit, že se jedná
o organismus žijící uvnitř těla rostlinného hostitele.
DSE jsou typické endofytické houby, které v těle
hostitelských rostlin tráví celý svůj život a většinou
rostlině nepřináší žádný na první pohled viditelný
užitek, ani jí nepůsobí žádnou škodu. Svými hyfami prorůstají mezibuněčnými prostorami rostliny,
někteří mohou vstupovat i dovnitř buněk a byly
nalezeny i druhy schopné přispívat k látkové
výměně a tím k růstu hostitele. DSE se vyskytují
v kořenech většiny rostlin, přesto jejich význam
není ještě zcela objasněný. Někdy se mohou
projevovat jako rostlině prospěšní mutualisté,
někdy naopak jako parazité, ale také jako komensymbióza – úzké soužití dvou i více různých
organismů (sym = „spolu“ a bios = „život“); tyto
se pak označují jako symbiotické organismy
či symbionti
mutualismus – forma symbiózy, ze které
mají všechny zúčastněné organismy prospěch
parazitismus – forma symbiózy, při které
jeden organismus (parazit) získává dočasně
nebo trvale výhody na úkor druhého organismu
(hostitel), kterému tím škodí
komenzálismus – forma symbiózy, při které
jeden organismus (komenzál) využívá druhého
organismu (hostitel), aniž by mu škodil
mykorhiza (mykorhizní symbióza) – mutualistické soužití specializované skupiny
půdních hub s kořeny vyšších cévnatých rostlin
(lze ji nalézt u většiny suchozemských rostlin)
ektomykorhiza – typ mykorhizy častý u dřevin,
typický pronikáním houbových vláken do mezibuněčných prostor, ale nikoliv do buněk kořenů
rostliny, s vlivem na stavbu kořenů, přičemž
kořenové vlášení je nahrazeno rozsáhlým
mimokořenovým myceliem (podhoubím)
zálové bez významného vlivu na hostitele; stává
se dokonce, že houba svůj přístup k hostitelské
rostlině v průběhu života mění.
Pozoruhodným příkladem DSE je náš současný
objekt zájmu, druh Acephala macrosclerotiorum.
Dřívější práce popsaly specifické mykorhizní
struktury, tvořené touto houbou v kořenech borovice lesní (Pinus sylvestris), ačkoli u příbuzných
druhů hub se podobné struktury neobjevují. Jejich
přítomnost zde svědčí o mutualistickém vztahu,
kdy rostlina a houba spolupracují na výměně
látek, které k životu potřebují.
Našemu týmu se nově podařilo pozorovat stejný
typ symbiózy mezi DSE druhem A. macrosclerotiorum a smrkem ztepilým (Picea abies). Mikroskopické snímky ukazují struktury charakteristické
pro ektomykorhizu (typ mykorhizní symbiózy
častý u dřevin), které tato DSE houba v kořenech
smrku vytvořila. Jsou jimi jednak Hartigova síť,
tj. spleť vzájemně propojených hyf vyplňující
mezibuněčné prostory v kořeni hostitele, a jednak
i hyfový plášť obalující jeho jemné kořeny. Právě
na povrchu Hartigovy sítě dochází k výměně látek
(jako jsou uhlíkaté látky, minerální látky a voda)
mezi houbou a rostlinou. Skutečnost, že smrk
s druhem A. macrosclerotiorum tyto struktury
tvoří, ukazuje, že i v tomto případě jde s velkou
pravděpodobností o oboustranně prospěšný
mutualistický vztah.
Na prvním obrázku je z pravé strany ke kořeni
připojen další typ houbové struktury – výrazné
sklerocium, které houbě A. macrosclerotiorum
dalo jméno. Jedná se o útvar tvořený ztvrdlými,
pevně spletenými hyfami, schopný přežít i velmi
nepříznivé podmínky. Plně vyvinutá sklerocia
jsou na povrchu chráněna vrstvou silně melanizovaných hyf a po odlomení od kořene slouží
k šíření houby. Struktura tohoto sklerocia je
dobře zobrazitelná pomocí skenovací elektronové
mikroskopie - oproti světelné mikroskopii, při
které ji právě kvůli přítomnosti hnědočerného
pigmentu - melaninu - nelze dostatečně prosvítit.
Kontakty:
Mgr. Jiří Machač ([email protected]; Optická laboratoř)
a Mgr. Tereza Lukešová ([email protected]; Oddělení mykorhizních symbióz)
Příčný řez kořenem smrku ztepilého a ke kořeni
přisedlým sklerociem (vpravo) houby Acephala
macrosclerotiorum kolonizující kořen; povrch
kořene je opředen hyfovým pláštěm houby;
hyfy tvořící tzv. Hartigovu síť, prostupující mezi
buňkami kořene, jsou méně patrné. (ESEM
– environmentální skenovací elektronová
mikroskopie)
Příčný řez kořenem smrku ztepilého kolonizovaný houbou A. macrosclerotiorum,
na kterém můžeme pozorovat struktury
charakteristické pro ektomykorhizu - Hartigovu
síť mezi buňkami a hyfový plášť na povrchu
kořene; zleva přisedají také menší sklerocia.
(ESEM)
Povrch sklerocia tvořeného hyfami se silně
melanizovanou buněčnou stěnou (ESEM)
Významné projekty
10
PROGRAM SMĚŘUJÍCÍ K PRŮMYSLOVÉMU VYUŽITÍ
NÁHRADNÍCH ZDROJŮ PŘÍRODNÍHO KAUČUKU
Přírodní kaučuk (PK) patří k nejvýznamnějším
surovinám současnosti, je například třetí nejvýznamnější surovinou dováženou do USA.
Spolu se syntetickým kaučukem (vyráběným
z ropy) světová spotřeba kaučuku přesahuje
22 mil. tun, z toho asi 50 % je přírodní kaučuk.
Je třeba poznamenat, že PK nelze syntetickým
plně nahradit, a to vzhledem k mnohem kratším
řetězcům polyisoprenoidů u syntetického kaučuku. Ceny PK značně kolísají, dlouhodobě však
v průměru rostou.
Naprostá většina (více než 99 %) světového
přírodního kaučuku je získávána z kaučukovníku, Hevea brasiliensis. Vývoj ukázal, že světový
systém zásobování PK je značně fragilní, snadno
ohrozitelný různými faktory. Již během obou
světových válek se ukázalo, že blokování obchodu
s kaučukem (ponorkovými blokádami) může
vývozců do kategorie dovozců). S globalizací
ovšem stouplo i riziko zavlečení SALB do Asie.
Při nedostatku PK z kaučukovníku bylo přirozenou
myšlenkou nalézt alternativní zdroje. V řadě zemí
existovaly programy vyhledávání náhradních
zdrojů, přičemž určitého průmyslového využití
(pouze během 2 světové války) bylo dosaženo
u pampelišky koksaghyz (Taraxacum koksaghyz
z Kazachstánu) a u guajule (Parthenium argentatum z jihu Spojených států) - u guajule existuje
dodnes několik zpracovatelských podniků v USA,
protože latex a PK z této hvězdnicovité rostliny
může být využit i tam, kde kaučukovníkový PK
způsobuje alergie.
Obě tyto rostliny byly v letech 2008-2012 podrobeny novému zkoumání během projektu
EU-PEARLS (http://www.wageningenur.nl/en/
Zasolené vypásané trávníky s pampeliškou
koksaghyz. Tuzkol, JV Kazachstán
Od přírodního kaučuku
z koksaghyzu k využití
dalších látek tohoto
druhu – DRIVE4EU
Na technologiích pro využívání koksaghyzu
v novém projektu spolupracuje řada firem, které
si v životě byznysu navzájem tvrdě konkurují. Je
to proto, že případná krize kaučukovníkových
plantáží by shodně ohrozila všechny hráče v oblasti
zpracování kaučuku.
Program DRIVE4EU má tedy následující cíle:
a Převést znalosti o technikách a technologiích
získávání kaučuku z koksaghyzu z laboratoře
a poloprovozu do provozních rozměrů.
b Do systému využívání koksaghyzu zapojit
technologicky i ekonomicky inulin.
c Nalézt dlouhodobě udržitelné podmínky,
za nichž bude možno koksaghyz využívat, aniž
by byla ohrožena jeho existence v přírodě.
Taraxacum koksaghyz Rodin. Tuzkol, JV Kazachstán
válčícím stranám způsobit velké potíže. Brazilský
kaučukový boom skončil ve 20. století katastrofou
– zničením plantáží následkem napadení houbou
Microcyclus ulei (SALB); brazilské zemědělství se
dosud z této rány nezotavilo. Prakticky veškerá
produkce PK tak přešla do jihovýchodní Asie,
kde jsou největší současní producenti i vývozci
(tradičně Thajsko jako největší vývozce, Vietnam
s největšími nárůsty produkce i vývozu, Indonésie,
Malajsie a také Indie a Čína, které přešly z kategorie
Research-Results/Projects-and-programmes/
eu-pearls). Výsledkem byla řada objevů týkajících
se biosyntézy kaučuku, vlastností různých forem
PK, extrakcí a izolací PK, křižitelnosti koksaghyzu
s blízkými druhy atd. Výsledkem bylo i poloprovozní agrotechnické vybavení a experimentální
výrobní kapacity. Nakonec si každý účastník mohl
sáhnout na pneumatiky z dílen firmy Vredestein:
jedna byla z koksaghyzu, druhá z guajule. Solidní
začátek, ale stále pouze začátek.
Kvetoucí guajule (Parthenium argentatum)
Významné projekty
11
Přirozené meandry řeky Kegen u stejnojmenné obce (JV Kazachstán). V pozadí západní výběžky
pohoří Ketmentau
Druhou nejvýznamnější látkou obsaženou
v kořenech koksaghyzu a jeho hybridů je inulin.
Zatímco u většiny rostlin jsou hlavními zásobními
látkami škrob nebo sacharóza, u 15 % je to právě
inulin, lineární nebo větvený polymer fruktózy,
obvykle zakončený molekulou glukózy. Na regulovaném evropském trhu tvoří inulin jen 3 %
komerčních sacharidů, zatímco v USA je to až
30 %, což dokazuje, jaký má inulin potenciál. Je
používán hojně v potravinářství – pozoruhodnou
vlastností inulinu je fakt, že člověk nemá enzymy,
jimiž by fruktózové polymery štěpil, takže inulin
hraje v potravě roli rozpustné vlákniny. Mikroorganismy tlustého střeva si ovšem s inulinem
poradí, což vede k častému nadýmání, pokud to
člověk s konzumací inulinu přežene.
Největší potenciál koksagyzového inulinu ovšem
spočívá v možnosti štěpit polymer na fruktózu,
kterou je možno transformovat např. na FDCA,
furan-2,5-dikarboxylovou kyselinu. Ta je již známá
jako náhrada za ropné produkty, ať již pro výrobu
plastů, tak i pro využití jako biopaliva (po další
transformaci).
Protože hektarový výtěžek kaučuku je u koksaghyzu
výrazně nižší než u kaučukovníku (>100 kg versus >1000 kg na hektar), je třeba do ekonomiky
využití koksaghyzu zapojit i další komponenty. Je
to zejména právě inulin a také nadzemní biomasa
jako prvotřídní krmivo.
Další asp ek t studia
koksaghyzu
Květenství Taraxacum haemanthum Kirschner
et Štěpánek (podsekce Haemantha).
Severní Gruzie v blízkosti obce Kazbegi
Stupeň a původ ohrožení a prognóza pro
udržitelné využívání
Jak jinak než prostřednictvím další expedice
do jihovýchodního Kazachstánu bylo možné
získat údaje o současném stavu známých lokalit
koksaghyzu, přesněji stanovit hranice rozšíření
tohoto pozoruhodného druhu, identifikovat vlivy,
které jej mohou negativně ovlivňovat, a stanovit
podmínky, které naopak jeho výskyt umožňují
a podporují. Některé z navštívených lokalit hostí
statisíce rostlin koksaghyzu, jiné desetitisíce, ale
většina jen desítky a stovky.
Není ještě vše zhodnoceno, ale vodní režim
a mezoklimatické výkyvy se nyní zdají být určující
pro přežívání koksaghyzu. V posledních několika
letech zasáhlo oblast výskytu koksaghyzu, vysoko
položená plochá údolí mezi Ťan-Šanem a pohořím
Ketmen-Tau, značné sucho a první známky desertifikace je již možno sledovat: vysychající tůně,
rozsáhlé plochy s výkvěty solí, ústup některých
druhů, snižování pokryvnosti vegetace.
Prozatím je možno se spolehnout na účinek nepravidelné pastvy, hlavního typu obhospodařování
lokalit s koksaghyzem. Kazašské místní komunity
Živinami bohatým loukám ve střední
Evropě dominují apomiktické formy souhrnně
nazývané Taraxacum officinale
(T. sect. Taraxacum)
žijí tradičním způsobem. Pokud zde ovšem dojde
k velkým změnám (vlastnictví, rozvojové programy,
industrializace), bude s koksaghyzem konec.
Účast pracovníků Botanického ústavu na projektu
DRIVE4EU ukazuje, že klasická botanika může
podstatným způsobem přispět k industriálnímu
využití technických plodin.
Významné projekty
12
PAMPELIŠKY JAKO
TA X O N O M I C K Á
ZAPEKLITOST
A SOUČASNĚ JAKO
VELKÝ POTENCIÁL
Jedna ze sekcí rodu Taraxacum (sekce Leucantha) se vyznačuje častými bílými nebo běložlutými
květenstvími. Taraxacum virgineum Kirschner, Štěpánek et Klimeš (Ladák, SZ Indie)
Nažky pampelišek jsou tvarově různorodé. Zleva: T. aristum (Austrálie), T. sp. (sekce Atrata, Uzbekistán), T. coronatum (sekce Coronata, Pákistán), T. glaciale (sekce Glacialia, Itálie) a T. glabrum (sekce
Glabra, Sibiř)
Rod Taraxacum, pampeliška, někdy také
smetánka, zahrnuje na 3000 druhů rozšířených
hojně v mírném pásu severní polokoule,
na jižní polokouli pouze ojediněle, pokud
nebereme v úvahu zavlečenou pampelišku
lékařskou. Podle toho, jaký mají jednotlivé
druhy způsob rozmnožování, „normální”
cizosprašnost nebo samosprašnost, a na druhé
straně rozmnožování nažkami bez pohlavního
procesu (tzv. agamospermie), mají také různý
typ proměnlivosti. Agamospermické druhy mají malý počet genotypů, ale vysokou
heterozygotnost, samosprašné mají téměř
výhradně homozygotní genotypy o středním
počtu, zatímco cizosprašné vykazují vysoký
počet genotypů a heterozygotnost odpovídající zpravidla Hardy-Weinbergovu zákonu.
Takto rozličné vlastnosti jednotlivých druhů
způsobují, že badatelé musejí zkoumat řadu
biologických a populačních vlastností studovaných rostlin, aby mohli odpovědně přikročit
k taxonomickému hodnocení a případně
dalšímu využití.
Jakkoli si středoevropan obvykle představí
pampelišku jako standardní rostlinu se žlutými
úbory („květy” ‒ ve skutečnosti jsou květy
pampelišky velice drobné, četné a skládají bohatá květenství) a bílými „padáčky”
s nažkami, můžeme nalézt řadu odchylek
od tohoto základního tvaru. Květy mohou
být bílé nebo červené, chmýr růžový, stvol
větvený, nažky bez zobánku atd. Abychom tuto biologickou ‒ reprodukční a morfologickou
‒ rozmanitost mohli systematicky uspořádat,
řadíme druhy pampelišek do sekcí, tj. skupin
blízce příbuzných nebo podobných druhů.
Například všechny naše pampelišky z okruhu
pampelišky lékařské, Taraxacum officinale,
řadíme do sekce Taraxacum (dříve sekce
Ruderalia). Podobně je to skupina pampelišky
bahenní (sekce Palustria) nebo pampelišky
červenoplodé (sekce Erythrosperma). Pokud
neumíme určit pampelišku do druhu, můžeme
použít jméno sekce.
Kontakty:
Doc. RNDr. Jan Kirschner, CSc. ([email protected]; Taxonomické oddělení)
Zajímavé výsledky výzkumu
13
PŘÍRODĚ BLÍZKÁ OBNOVA – STÁLE JEŠTĚ NETRADIČNÍ
PŘÍSTUP K OBNOVĚ TĚŽEBNÍCH PROSTOR
Spontánní sukcese ve vápencovém lomu
na Svatém kopečku (J. Morava)
Při představě rozsáhlých uhelných dolů na Mostecku či velkých kamenolomů v Českém krasu se
mnoha lidem vybaví slovní spojení „měsíční krajina“ či „jizvy v krajině“. Těžba nerostných surovin
skutečně značně ovlivňuje vzhled krajiny. Nicméně
přírodní procesy si v dostatečně dlouhém časovém
horizontu s těmito místy často dokáží poradit samy
a začlenit je do okolní krajiny. Těchto přirozených
procesů využívá při rekultivaci těžebních prostor
přírodě blízká obnova. Tento způsob obnovy
se snaží těžbou narušená území nejen začlenit
do okolní krajiny, ale navíc z bývalých těžebních
prostor dolů vytvořit i přírodně hodnotná území.
Přírodě blízká obnova je tedy jedna z metod
obnovy území po těžbě nerostných surovin,
která v sobě zahrnuje několik přístupů. Můžeme
se spolehnout čistě na spontánní sukcesi a nechat prostor samovolně zarůstat. Často je však
potřeba tento přirozený proces nějak ovlivňovat,
usměrňovat. Tomuto přístupu se říká řízená, nebo také asistovaná sukcese. Zde se může jednat
například o přenos biomasy, vysévání semen
cílových druhů (tj. druhů, které bychom chtěli
podpořit a jejichž výskyt je z hlediska úspěšnosti
obnovy daného místa žádoucí), narušování
povrchu apod. Můžeme sem zařadit i různá
opatření ve prospěch vybraných druhů rostlin
či živočichů, například omezování invazních
druhů. Všechny tyto činnosti přirozený proces
obnovy buď urychlují nebo naopak zpomalují,
což je velmi důležité pro vytvoření různorodých
plošek i na značně malém území – vedle sebe se
tak mohou nacházet mokřady, travnaté porosty,
otevřené plochy s holým substrátem, křoviny i lesní
porosty. Různorodost prostředí pak podporuje
výskyt rostlinných i živočišných druhů z mnoha
různých skupin. Z přírodovědného hlediska jsou
v těžebních prostorách nejcennější mokřady
a mělké tůňky a další otevřené nezarostlé plochy.
V povrchových dolech se tak mohou vyskytovat
rostlinné druhy, které upřednostňují živinami
chudá stanoviště a které je tudíž obtížné nalézt
v dnešní celkově přehnojené krajině. V místech
dříve narušených těžbou a ponechaných „svému
osudu“ se tak často vyskytují různé ohrožené
druhy orchidejí, např. okrotice bílá (Cephalanthera
damasonium), kruštík bahenní (Epipactis palustris), kruštík tmavočervený (Epipactis atrorubens),
střevíčník pantoflíček (Cypripedium calceolus)
a jiné. Z dalších zajímavých druhů můžeme
například v pískovnách najít nahoprutku písečnou
(Teesdalia nudicaulis), plavuňku zaplavovanou
(Lycopodiella inundata), bělolist nejmenší (Filago
minima) či třezalku rozprostřenou (Hypericum
humifusum), v lomech pak například koniklec
velkokvětý (Pulsatilla grandis), oman mečolistý
(Inula ensifolia), vratičku měsíční (Botrychium
lunaria) či kavyly (Stipa spp.).
Přírodě blízká obnova těžbou (i jinak)
narušených míst je jedním z hlavních výzkumných témat Pracovní skupiny ekologie
obnovy při Katedře botaniky PřF JU v Českých
Budějovicích. Sdružuje vědecké pracovníky
nejen z PřF JU a ústavů Akademie věd, ale
i členy neziskových organizací. Někteří členové
skupiny se přírodě blízké obnově věnovali
poslední čtyři roky v rámci grantu GA ČR
na Botanickém ústavu AV ČR. Skupina se
intenzivně věnuje studiu sukcese na různých
člověkem narušených místech (lomy, pískovny,
rašeliniště, výsypky, odkaliště apod.), obnově
luk na bývalé orné půdě či obnově přirozenějšího složení kulturních lesů. Skupina se snaží
obor popularizovat, prosazovat do podvědomí
odborné veřejnosti i praktiků a také pozitivně
ovlivňovat tvorbu resortních zákonů a směrnic.
Více: www.ekologieobnovy.cz
V současné době je přírodě blízká obnova v praxi
využívána pouze okrajově. Dává se přednost
spíše tradičním způsobům rekultivace – lesnické
a zemědělské, které slouží zejména k produkčním
účelům, avšak splývají s dnešní stejnorodou
krajinou. Je však potřeba podotknout, že např.
pískovny na Třeboňsku jsou dobrým příkladem
spolupráce těžební firmy, Správy CHKO Třeboňsko
a přírodovědců převážně z Akademie věd ČR
a Jihočeské univerzity. Ukázkovou lokalitou je
pískovna Cep II, která se nachází severně od obce
Suchdol nad Lužnicí. Zde vznikl unikátní prostor,
kde probíhají vědecké experimenty a kde byly
současně vytvořeny plochy sloužící k ochraně
vzácných rostlin i živočichů. Takovýto unikátní
prostor mohl vzniknout díky rozsáhlému biologickému průzkumu zaměřenému na vyšší rostliny
a vybrané skupiny bezobratlých živočichů. Při
tomto průzkumu byly mezi sebou porovnávány
plochy, které byly lesnicky rekultivované borovicí lesní, plochy ponechané samovolnému
vývoji, které však byly soustavně narušovány
návštěvníky pískovny či erozí, a plochy samovolně
se vyvíjející bez dalšího narušování. Výsledky
ukázaly, že cílové druhy (v tomto případě druhy
typické pro písčiny a otevřená stanoviště) a druhy
ohrožené upřednostňovaly spontánně se vyvíjející,
narušovaná stanoviště. Na lesnicky rekultivovaných
plochách se naopak vyskytovaly spíše druhy
běžné. Je tedy zřejmé, že přírodě blízká obnova
má velký potenciál pro ochranu přírody a je velmi
potěšující, že poznatky získané při vědeckých
výzkumech začínají být uváděny i do praxe, právě
jako v pískovně Cep II. Doufejme, že v budoucnu
bude takových míst v České republice přibývat.
Kromě přírodovědného hlediska je zde velmi
významné i hledisko finanční: spontánní sukcese
je zdarma, asistovaná s poměrně malými náklady,
zato rekultivace jsou velmi drahé a často nejsou
vůbec nezbytné.
Experimentální plochy pro výzkum přírodě
blízké obnovy na pískovně Cep II. (Třeboňsko)
Těžbou narušená místa bývají často domovem
mnoha různých druhů orchidejí.
Kontakt:
Mgr. Lenka Šebelíková ([email protected]; Oddělení funkční ekologie a PřF JU)
Více v: http://www.calla.cz/piskovny/wordpress/wp-content/uploads/sbornik_internet.pdf
http://www.quarrylifeaward.cz/system/files/winners_files/1._place_cep_ii_sandpit_for_biodiversity.pdf
Zajímavé výsledky výzkumu
14
MOKŘADNÍ ROSTLINA POLNÍM PLEVELEM?
Mapa výskytu kamyšníků na orné půdě v ČR;
černě – kamyšník polní, bíle – kamyšník širokoplodý
Porost kamyšníku v kukuřici v místech, kde
na jaře stála voda.
V posledních desetiletích se objevily problémy
se zaplevelením orné půdy trávovitou rostlinou,
často zaměňovanou za pýr. Ovšem na rozdíl
od pýru na ni neplatil osvědčený postup hubení
– postřik herbicidem na listy a po zorání půdy
postřik na obnažené oddenky. Tato rostlina
nemá totiž pod zemí jen oddenky, ale ty spojují
kulovité, postupem času dřevnatějící hlízky, které
odolávají i herbicidům. Onen obtížný plevel je
kamyšník (Bolboschoenus), o němž jsme psali
již v minulém čísle tohoto časopisu.
Podzemní oddenkový systém kamyšníku
s hlízkami
Plevelné jsou dva druhy: kamyšník polní (Bolboschoenus planiculmis) a kamyšník širokoplodý
(B. laticarpus). Přitom oba plevelné kamyšníky
nejsou cizí zavlečené druhy; vyskytují se přirozeně na mělčinách při březích vodních toků
a nádrží, v příkopech a zamokřených terénních
prohlubních. Zvýšená frekvence výskytu v polích
se objevila po druhé světové válce a vzestupný
trend dále pokračuje. Analýzou jejich populací
v polních kulturách v Čechách i na Moravě bylo
zjištěno, že dokáží vytvořit husté zapojené porosty
i s více než 500 nadzemními odnožemi na m2 (pro
srovnání – pšenice mívá 500 stébel a kukuřice
10 jedinců na m 2). Pokud chceme vědět, proč
k tomu dochází, musíme si uvědomit způsoby
jejich rozmnožování a změny stanovištních
podmínek v souvislosti s hospodařením na polích.
Jak se kamyšníky množí a šíří?
Hlavním způsobem šíření i zachování a obnovy
populací je u kamyšníků vegetativní rozmnožování
podzemními hlízkami. Specifickou schopností
hlízek je přežívat dlouhodobě v dormantním stavu.
V přírodě běžně dochází k tomu, že v suchých
letech se nadzemní výhonky neobjeví – populace
nemusí být vůbec nalezena. Jakmile však přijde
mokré jaro, po kterém třeba v prohlubních na okraji
polí dlouhodobě stojí voda, hlízky se probudí
k životu a celý porost velmi rychle regeneruje. Podle
údajů z literatury i našich zjištění mohou hlízky
přežívat v dormantním stavu i 5-7 let. Produkce
hlízek bývá značná: jedna hlízka vytvoří během
vegetační sezóny okolo 24 (ale až 80) nových
hlízek, celkový počet hlízek na jednotku plochy
může být až 2 500/m 2. Díky hlízkám odolávají
kamyšníky všem dosud užívaným herbicidům.
Nadzemní orgány jsou při aplikaci sice zničeny,
ale porost je schopný z hlízek opět regenerovat.
Oba druhy kamyšníků produkují v přírodě běžně
množství semen. Pokud stihnou dozrát (tj. nejsou
„sklizena“ s hlavní plodinou nebo zničena herbicidy), semena z květenství vypadávají a ukládají se
do půdní semenné banky. U obou druhů kamyšníků
byla v orné půdě zjištěna značná zásoba semen,
kolísající mezi lokalitami od 5 000 do 70 000
semen na m2, z toho cca 50 % semen bylo životaschopných. Přesto ale nebylo v polních kulturách
pozorováno klíčení a úspěšný vývoj semenáčků. To
je zřejmě dáno rychlým vysycháním nebo naopak
zaplavením povrchové vrstvy půdy (semenáčky
přežívají nejlépe na bahnitém povrchu dlouhodobě
syceném vodou), nebo jsou semenáčky zničeny
při orbě nebo aplikaci herbicidu.
Co přispívá k expanzi kamyšníků na polích?
Přirozené stanovištní podmínky – tam, kde jsou
pole na místech dřívějších mokřadů a slepých
říčních ramen, kde je těžká půda a nerovný terén
a kde se udržuje vysoká spodní voda.
Způsob obhospodařování – hlubokou orbu
nahrazuje tzv. minimalizační technika zpracování půdy, při které se půda kypří rotavátorem
a zároveň se uvláčí. Půda je ovšem zpracována
jen do hloubky 8–10 cm. Právě v této hloubce
je nejhustší síť oddenků s hlízkami kamyšníků,
které se při obdělávání oddělují od sebe a rozšiřují
po poli. Půda v hloubce pod 10 cm se naopak
stlačuje a vytváří druhotný vodonosný horizont,
který brání průsaku vody, takže po deštích stojí
v poli dlouho voda. To všechno, často spolu
s neudržovanými melioracemi, podporuje šíření
kamyšníků.
Druh plodiny – kamyšníku nejlépe svědčí širokořádkové plodiny, zejména kukuřice, a zavlažovaná pole se zeleninou. Naopak bývá potlačen
pícninami.
Zavlažované pole se zeleninou zaplevelené
kamyšníkem. V rané fázi vývoje je možné ho
mylně považovat za pýr.
Pokud se už kamyšník někde rozmnoží, jeho
potlačení je velmi obtížné a nákladné. Proto je
lepší prevence – volba vhodné plodiny, způsob
obdělávání na polích s těžkou půdou a fungující
meliorace.
Kontakty: RNDr. Zdenka Hroudová, CSc. ([email protected]; Oddělení genetické
ekologie), Ing. Petr Zákravský ([email protected]; Pokusná zahrada)
Více v: Belgian Journal of Botany, 140, 121–129 (2007), Farmář 11: 27–28 (1999), Metodika, VÚRV (2007),
Úroda 2: 46–49 (2004).
Zajímavé výsledky výzkumu
15
INVAZE AMBRÓZIE PEŘENOLISTÉ?
nejsilněji jsou zasaženy teplejší oblasti s dostatkem
jarní vláhy: Maďarsko, Srbsko, Rakousko, Ukrajina, jižní Slovensko, jižní Francie a severní Itálie.
Vzhledem k dálkovému transportu pylu větrem
působí negativně i v místech, kde se tyto rostliny
vyskytují pouze sporadicky. Právě k takovým
oblastem patří i Česká republika.
Mladá rostlina ambrózie peřenolisté
Ambrózie peřenolistá (Ambrosia artemisiifolia L.)
je jednoletá šedozelená bylina z čeledi hvězdnicovitých s 10-150 cm vysokou větvenou lodyhou,
s 1-3x peřenosečně dělenými vstřícnými nebo
střídavými listy a nenápadnými zelenkavými
květy. Kvete ve druhé polovině léta. Méně četné
samičí květy přisedají v úžlabích horních listů
a posléze se z nich vyvíjejí 2,5-3,5 mm dlouhé
ostnité nažky ukrývající semena. I když jsou samičí
květy méně četné, je jedna rostlina schopná vyprodukovat až 3 000 semen. Výrazně početnější
samčí květy vytvářejí úbory o průměru 4-5 mm
uspořádané do hroznů na koncích jednotlivých
lodyžních větví. Nenápadnost květů souvisí se
způsobem opylení, které zprostředkovává vítr.
Stejně jako jiné větrosprašné rostliny vytváří
ambrózie obrovské množství pylu, díky kterému
je známá i širší veřejnosti, zejména alergikům.
Pyl je vysoce alergenní a v nejpostiženějších
zemích je příčinou až 60 % všech alergií. Vedle
snížení kvality života postižených s sebou alergie
přinášejí nemalé náklady na léčbu, které jsou např.
v Maďarsku podle údajů zástupců maďarského
zdravotnictví odhadovány na 110 milionů euro
ročně. K dalším srovnatelným finančním ztrátám
dochází v důsledku snížení zemědělské produkce,
protože v postižených oblastech je ambrózie
jedním z nejčastějších polních plevelů.
Ambrózie peřenolistá pochází ze Severní Ameriky,
kde se s rozvojem zemědělství masivně rozšířila
z poměrně malých oblastí na východě a na západě
kontinentu. Kontaktem dříve izolovaných populací vznikl vysoce invazní typ, který byl následně
zavlečen prakticky do celého mírného pásma
severní i jižní polokoule. V Evropě je evidována
jako invazní druh ve více než 30 zemích, přičemž
Poprvé byla u nás ambrózie peřenolistá zaznamenána koncem 19. století u Třeboně, kam se
dostala s jetelovým osivem. Později byla zavlékána
se sójovými boby, tzv. labskou dopravní cestou.
Nepřekvapí proto, že hodně nálezů pochází
z míst, kde byly boby zpracovávány nebo kde
se používaly sójové odpady, např. z blízkosti
výkrmen hospodářských zvířat. Dalším zdrojem
semen je ovčí vlna a krmné směsi pro ptáky se
slunečnicí, díky kterým se ambrózie rozšířila
v západní Evropě. V České republice je však hlavním
vektorem šíření železniční doprava. Železnice
zřejmě nepředstavuje pouze prostředek šíření, ale
poskytuje i příhodná stanoviště pro rozvoj po-
Pyl ambrózie je častým alergenem. Gram pylu
obsahuje okolo 30-35 milionů pylových zrn.
Jedna plodná rostlina vyprodukuje více než 45
gramů pylu za rok. Deset pylových zrn na metr
krychlový vzduchu přitom může u citlivých
jedinců vyvolat alergickou reakci ve srovnání
s 50 pylovými zrny trav na metr krychlový.
v teplejších oblastech, v Polabí a na jižní a severní
Moravě. Na místech, kde rostlina úspěšně plodí,
vzniká zásoba semen, která mohou přetrvávat
v půdě i několik desítek let a představují tak
hrozbu obnovení populace.
Vzhledem k negativním vlivům se na ambrózii
peřenolistou zaměřuje soustředěný výzkum.
Dosud největším mezinárodním projektem je
COST SMARTER, do kterého je prostřednictvím
Botanického ústavu zapojena i Česká republika.
Cílem projektu je najít dlouhodobě aplikovatelné
metody potlačování ambrózie, protože tradiční
způsoby hubení plevelů, jakými jsou chemické
postřiky a mechanická likvidace, jsou velmi
drahé a dlouhodobě nejsou dostatečně účinné.
Příspěvkem České republiky do projektu by měl
být souhrn dosavadních znalostí o druhu z našeho
území. Vzhledem k tomu, že tyto znalosti jsou
dosud poměrně omezené, by byl velmi žádoucí
další výzkum. Ten však MŠMT nepodpořilo.
V současné době se alespoň snažíme sestavit
co nejpodrobnější seznam lokalit a analyzovat
faktory, které na našem území výskyt ambrózie
podmiňují. V budoucnu bychom rádi vliv faktorů
prostředí na růst a vývoj druhu experimentálně
otestovali a navrhli způsob boje proti tomuto
expanzivnímu druhu nejvhodnější pro naše
území.
Květenství ambrózie peřenolisté
pulací. Ambrózie je konkurenčně slabou rostlinou,
a proto se jí daří na narušovaných místech, kde
je okolní vegetace alespoň částečně potlačena.
Pokud není narušování pravidelné, okolní rostliny
ambrózii často vytlačí. Příhodnost železnice
spočívá v pravidelném postřiku kolejišť herbicidy
a vytvářením prostoru pro ambrózii. Dalšími
vhodnými místy pro uchycení a růst ambrózie
jsou ruderální stanoviště, skládky zeminy a okraje
silnic, cest a polí. Vzhledem k tomu, že se jedná
o teplomilný druh, vyskytuje se zatím většinou jen
Kontakt:
RNDr. Hana Skálová, Ph.D. ([email protected]; Oddělení ekologie invazí)
Ambrózie peřenolistá v narušené krajině
Seznamte se
16
SEZNAMTE SE – ROZHOVORY S NAŠIMI VĚDCI
DANIEL JANČULA
které se věnuje vlivu směsi chemických látek na živé
organismy – v tomto případě na zelenou řasu
Chlamydomonas reinhardtii (obr. na straně 17).
Můžete nám tento výzkum trochu přiblížit?
Daniel Jančula při plnění separační kolony pro HPLC
Ekotoxikologie je věda, která zkoumá negativní
vlivy především chemických látek na živé organismy a jejich populace. Pro jednoduchost
se testují většinou jednotlivé látky na daném
organismu, abychom pochopili rizika, která
mohou nastat, pokud se tato daná chemikálie
dostane do životního prostředí. Problémem
však je, že reálně se dnes v přírodě (například
ve vodách) nacházejí desítky a stovky cizorodých
chemikálií (pesticidy, farmaka, ftaláty, těžké kovy a další), i když ve velmi nízkých koncentracích.
Velice nízká koncentrace jedné konkrétní látky
by tedy zřejmě nepředstavovala žádné zásadní
riziko, ale pokud se takových látek vyskytne
na jedné lokalitě více, mohou se účinky sčítat
(někdy dokonce násobit) a přesně to bylo téma,
na kterém jsme pracovali.
Jaké toxické látky jste tedy vybrali a proč?
Jak se bádá ve Švýcarsku, za hranicemi Botanického ústavu. Dr. Daniel Jančula je již
téměř deset let zaměstancem Botanického
ústavu AV ČR, v. v. i. Pracuje na Oddělení
experimentální fykologie a ekotoxikologie
v Brně, kde se věnuje především negativním
vlivům chemických látek na živé organismy
a jejich osudem v životním prostředí. Ve svých
32 letech se rozhodl vycestovat za novými
zkušenostmi do zahraničí. Cílovou destinací
se mu stalo Švýcarsko, konkrétně prestižní
výzkumný institut Eawag v městečku Dubendorf poblíž Curychu. O zkušenostech ze
své půlroční stáže se s námi Daniel podělil
v následujícím rozhovoru.
Co Vás vedlo k rozhodnutí navštívit právě
výzkumný institut Eawag?
O zahraniční stáži jsem uvažoval poslední cca
3 roky. Uvědomil jsem si, že po dlouhých letech
strávených na jenom pracovišti nastal čas zjistit
i to, jak se dělá věda za našimi hranicemi. Další
motivací bylo samozřejmě naučit se další dovednosti, které bych mohl využít pro svou další
vědeckou práci v ČR, seznámit se s novými kolegy a podívat se na obor ekotoxikologie trošku
z jiného úhlu. Konkrétně pro tuto stáž jsem využil
stipendijního programu SCIEX-NMSch, který
podporuje spolupráci mezi Švýcarskem a osmi
konkrétními státy EU (Českou republikou, Eston-
skem, Litvou, Lotyšskem, Maďarskem, Polskem,
Slovenskem a Slovinskem).
Jak probíhalo výběrové řízení na pozici stážisty
přes program SCIEX?
Musím říct, že program SCIEX na mě udělal
obrovský dojem. Především pak z pohledu minimalizace byrokracie. Vše, co bylo potřeba udělat,
bylo najít si švýcarského partnera, napsat návrh
vědeckého projektu zhruba na tři stránky a připojit
životopisy zúčastněných lidí. Pak už zbylo jenom
počkat na vyjádření hodnotící komise.
Která očividně vyhodnotila Váš projekt jako
úspěšný...
Ano, celkem bylo vybráno 66 projektů, z toho
14 z České republiky. Všem mladým vědcům
(doktorandům i postdokům) bych tento program
určitě doporučil. Bohužel to však vypadá, že další
výzva již pro Českou republiku nebude vypsána.
Proběhlo celkem 10 výzev a všechny stáže musí
být dokončeny nejpozději v roce 2016.
Jakému tématu jste se tedy věnoval na švýcarském pracovišti?
Jako ekotoxikolog jsem toužil po tématu, které
by se co nejvíce blížilo mému zaměření. S mým
vedoucím ve Švýcarsku jsme se dohodli na tématu,
Pro naši studii jsme vybrali směs 14 chemických
látek (tzv. prioritních polutantů, které je nutno
v našich vodách sledovat) o velice nízkých koncentracích, které by podle evropské legislativy
neměly mít akutní či chronické efekty na vodní
řasy, rostliny či živočichy. Jinými slovy, měly by
být bezpečné.
Proč jste si jako testovací organismus vybrali
právě zelené řasy?
Zelené řasy, i když se to nezdá, jsou zásadním
článkem potravního řetězce ve vodách. Řasy
jsou pro vodní živočichy zásadním zdrojem živin
a energie a samozřejmě také produkují kyslík.
Jejich funkce je tak jen stěží nahraditelná. Bez
autotrofních organismů (řas a rostlin) by život
v našich vodách, tak jak ho dnes známe, vůbec
neexistoval.
Měl jste možnost využít nějaké nové metodiky
pro svůj výzkum?
Pro výzkum jsem využíval jak klasické, tak velice
moderní metody. Zjišťovali jsme tedy především
růst populace řas v čase a její fotosyntetickou
aktivitu. Z moderních metod jsme pak využili
dvou-dimenzionální kapalinovou chromatografii v kombinaci s tandemovou hmotnostní spektrometrií (2D nano-LC + MS/MS). Toto uspořádání
Seznamte se
17
nám umožnilo sledovat v jednom okamžiku cca
dva tisíce různých proteinů a jejich množství
v buňkách Chlamydomonas reinhardtii, což není
zdaleka samozřejmostí.
K jakým závěrům jste dospěli?
Vzhledem k tomu, že v současné době jsou výsledky
v oponentním řízení pro publikaci v mezinárodním
časopise, mohu snad jen naznačit. Velice pozitivní
zprávou je, že směs těchto 14 látek nepůsobila
negativně na růst zkoumané řasy. Pokud jsme se
však zaměřili na zmíněných dvou tisíc proteinů
uvnitř řasy, zjistili jsme, že až 10 % z nich bylo
nějakým způsobem ovlivněno. Většina těchto
proteinů byla spjata s fotosyntetickým aparátem
řasy. Z pohledu běžného člověka se to může zdát
jako zanedbatelné číslo, ale pokud si představíte,
že by vám u lékaře diagnostikovali významné
odchylky v produkci 10 % všech vašich proteinů,
do smíchu by vám zřejmě nebylo. Pokud vím,
tak se jedná o první studii, která popisuje vliv
zmíněné směsi 14 prioritních polutantů právě
na proteinovou výbavu řas.
Děkujeme za náhled do Vašeho výzkumu.
Na závěr, jak na Vás působila úroveň vědy
na Eawagu a jak obecně ve Švýcarsku?
Eawag je špičkové pracoviště světové úrovně.
Má navíc obrovskou výhodu, že je federálním
institutem, což v praxi znamená, že drtivou
Zelená řasa Chlamydomonas reinhardtii (Databáze Eawag, Švýcarsko)
většinu svých nákladů na vědu (včetně platů,
vybavení, provozních nákladů) každoročně získává
od státu. Odpadají tak stresové situace, spojené
s nejistotou výhledu bádání do dalších let, které
často zažíváme u nás. To se logicky odráží jak
v nasazení, tak na výsledcích vědeckých týmů.
Zkušenost s vědeckou prací ve Švýcarsku tak
rozhodně doporučuji zažít. Co se týče samotného
Švýcarska, budu na něj vzpomínat v tom nejlepším. Krásná příroda, přátelští lidé, čisté ulice.
Existuje vůbec něco, co se Vám ve Švýcarsku
nelíbilo?
Především to bylo odloučení od rodiny, protože
jsme se dohodli s manželkou, že zůstane po dobu
stáže s dcerou v Brně. Tímto bych jí chtěl vyjádřit
od srdce veliké díky, protože si toho opravdu vážím.
Máte nějaké doporučení pro mladé vědce, kteří
váhají s vycestováním?
Nebojte se jít za svými vědeckými sny, i když to
nemusí být na začátku příjemné. Sbírejte zkušenosti
i za hranicemi naší republiky. V další vědecké
kariéře vás to posune mílovými kroky dopředu.
Oddělení Environmentální toxikologie (Eawag)
Kontakt:
Mgr. Daniel Jančula Ph.D. ([email protected]; Oddělení experimentální fykologie
a ekotoxikologie)
Seriál: Houby
18
PRŮHONICKÝ PARK Z POHLEDU MYKOLOGA
poloparazitické) vyrůstající na živých rostlinách
nebo i živočiších, jimž v menší nebo větší míře
škodí a v posledku často vedou až k jejich záhubě.
Zvláštní a v přírodě neobyčejně důležitou skupinu
představují houby mykorhizní, které většinou
tvoří oboustranně užitečnou symbiózu s kořeny
určitých dřevin, k jejichž zdárnému růstu přispívají
(více o mykorhize viz str. 9).
Mnohá místa v Průhonickém parku poskytují vhodná stanoviště pro růst hub,
jako např. „Podalpinská louka“ pro travní houby – špičky, šťavnatky, voskovky, kukmáky a jiné.
Řekne-li se houby, většině lidí se v mysli vynoří
představa statných hřibů, štíhlých elegantních
bedel, pestrobarevných holubinek, různých
čirůvek, ryzců atd., tj. velkých hub, které nazýváme
makromycety; patří k nim ale i druhy s velmi
malými plodničkami od velikosti 1 mm. Leckteré
druhy makromycetů lze určit pouhým okem
nebo za použití lupy, ovšem k přesnému určení
mnoha hub je ve většině případů zapotřebí
dobrý mikroskop. Kromě toho ovšem existuje
ohromné množství hub, kterých si běžně člověk
ani nevšimne. Nazývají se mikromycety a jejich
studium se už bez mikroskopu vůbec neobejde.
Dále se budeme zabývat pouze makromycety.
Je si třeba uvědomit, že to, co vidíme a označujeme jako houby, jsou jen plodnice hub – vlastní
houba je v podobě tzv. podhoubí (mycelia) skryta
Hřib dubový (Boletus reticulatus) lze najít téměř
po celou sezonu pod duby. Hráz rybníka „Polný“
u Vlastiboře v jižních Čechách
v půdě, dřevě nebo v rostlině. Při studiu většiny
hub je nevýhodné, že pro své určování nezbytné
plodnice tvoří často velmi nepravidelně, některé
dokonce i v několikaletých přestávkách. To je také
jeden z hlavních důvodů, proč je studium hub
značně obtížné. Dalším problémem je skutečnost,
že pro správné určení druhů je ve velké většině
případů nutný dobrý mikroskop (ne každý jej má
ovšem k dispozici) a dosti pracné zhotovování
preparátů – to není v případě určování cévnatých
rostlin většinou nezbytné.
Z praktického hlediska rozeznáváme houby jedlé,
nejedlé a jedovaté. Jedlé houby (zejména hřibovité) byly prověřeny požíváním lidmi po dlouhá
staletí, ovšem bylo tomu pouze v některých
oblastech světa – např. muchomůrka císařka
byla vyzkoušena a oblíbena již v antickém Římě,
hřibovité a lupenaté houby požívali hlavně staří
Slované atd. Jedovaté houby dělíme na slabě,
silně (prudce) a smrtelně jedovaté. K prudce
jedovatým patří třeba muchomůrka tygrovaná
(Amanita pantherina), zatímco muchomůrka
zelená (A. phalloides) je smrtelně jedovatá. Existují
však houby, které jsou jedovaté jen tehdy, jsou-li
požity za syrova nebo příliš krátce povařené nebo
usmažené, zatímco po dostatečně dlouhé tepelné úpravě jsou nejen jedlé, ale i chutné – např.
hřib kovář (Boletus luridiformis), hřib koloděj
(B. luridus), dokonce i hřib satan (B. satanas).
K jedlým druhům hub rostoucím v Průhonickém
parku náleží přirozeně i běžný hřib dubový
(B. reticulatus, viz obr.). Valná většina hub však
patří mezi houby nejedlé, a to z různých důvodů:
jsou páchnoucí, nechutné, palčivé, tuhé, dřevnaté
apod.; v přírodě však hrají většinou významnou
roli. Některé houby mají také léčivé účinky.
Různé houby mají podle druhů pestré ekologické
nároky, takže se vyskytují za rozdílných podmínek.
Podle způsobu výživy se houby dělí na saprotrofní (hniložijné), které se vyživují rozloženou
nebo rozkládající se organickou hmotou (rostliny, listí, jehličí, dřevo), a na parazitické (popř.
V tomto seriálu se výběrově věnujeme jenom
některým v Průhonickém parku se vyskytujícím
houbám, neboť je jich skutečně velmi mnoho
– jde totiž o přírodní park s velkými partiemi
víceméně původní vegetace. Tento, i další články,
budou doprovázeny fotografiemi některých pojednávaných druhů, přičemž ne všechny budou
pořízeny v Průhonickém parku.
Hlívenka rumělková (Tubercularia vulgaris)
je nepohlavním stadiem rážovky rumělkové;
na odumřelém dřevě listnáčů tvoří žlutooranžové
„kupky“. „Komárovský chobot“ Soběslavských
blat v jižních Čechách
Rážovka rumělková (Nectria cinnabarina) vypadá jako karmínově červené nepravidelné
korálky na mrtvém dřevě listnatých stromů
a keřů. Okraj mokřadu „Chobot“ u Hostivice
západně od Prahy
Seriál: Houby
19
Nahloučené mladé plodnice klihatky černé
(Bulgaria inquinans) vyrostly v puklinách kůry
položivého kmene dubu červeného. Průhonický
park, „Jeřábkovy potoky“
Abychom mohli vidět celé plodničky drobné
jehnědky olšové (Ciboria amentacea) musíme
odhrnout staré spadané listí olší a najít pod
ním samčí olšové jehnědy. „Tiché údolí“, Praha
6-Suchdol
V Průhonickém parku, který je národní kulturní
památkou a památkou organizace UNESCO,
se musí návštěvníci chovat jinak než v obyčejných lesích. Podle návštěvnického řádu se
v něm nesmí cokoli trhat nebo sbírat – houby
nevyjímaje. Je třeba, aby se tam návštěvníci
drželi vymezených cest a chodníčků a mimo
ně nevstupovali. Pokud jde o houby, samotné
sbírání plodnic jim sice nevadí, avšak jejich
podhoubí škodí ušlapávání půdy omezující
její provzdušňování.
najít téměř po celý rok. Jsou to droboučké tvrdé
tmavočervené útvary, v nichž se tvoří pohlavně
vznikající výtrusy (askospory). Kromě toho ale
vytváří mnohem častěji světle oranžově zbarvené
malé „bochánky“, což je nepohlavní stadium houby
zvané hlívenka rumělková (Tubercularia vulgaris,
viz obr. str. 18); z ní se odškrcují nepohlavně vznikající výtrusy, konidie. Brzy na jaře můžeme místy
pod spadaným listím najít drobnou jehnědku
olšovou (Ciboria amantacea = C. casca, viz obr.),
jejíž plodničky v podobě většinou jen 3-5 mm
širokého okrového nebo hnědavého kalíšku
na tenkém dlouhém třeni („nožičce“) vyrůstají
ze starých ležících samčích jehněd olší. Naproti
tomu v parku nehojná klihatka černá (Bulgaria
inquinans, viz obr.) má větší plodnice, 1,5-4 cm
široké, ztuha rosolovité, zprvu téměř kulovité,
později „káčovité“, nakonec mělce miskovité až
skoro ploché, na vnitřní (svrchní) straně černé, hladké, lesklé, na vnější straně rezavohnědě štětinatě
šupinkaté; roste na odumřelých kmenech a větvích
listnáčů, zejména dubů a buků. V Průhonickém
parku vyrostla dokonce na položivém kmenu
původem severoamerického dubu červeného
(Quercus rubra). Lze ji i jíst naloženou v octě,
nálev však zbarvuje dočerna.
Nejprve se krátce věnujme houbám vřeckovýtrusným čili vřeckatým (Ascomycetes), u nichž se
výtrusy tvoří uvnitř zvláštních buněk zvaných
vřecka (asky), a později houbám stopkovýtrusným
(Basidiomycetes), které tvoří výtrusy na buňkách
zvaných bazidie, a to na výrůstcích čili stopečkách
(sterigmatech) zevně těchto buněk. Vřecka, bazidie a výtrusy můžeme ovšem pozorovat pouze
pod mikroskopem.
Z hojných vřeckovýtrusných hub, kterých je
ohromný počet, uvádíme v tomto článku jenom tři druhy, neboť množství jiných většině
lidí běžně uniká, a navíc o ně ani nejeví zájem.
Na odumřelých větvičkách, větvích a tenčích
kmenech to je tvrdohouba rážovka rumělková
(Nectria cinnabarina, viz obr. str. 18) – tu můžeme
Výborná jedlá houby pečárka císařská (Agaricus
augustus – Seč u Chrudimi,u silnice nad „Plynostavem“, pod douglaskou tisolistou
Krásná muchomůrka červená (Amanita muscaria)
je jen slabě jedovatá. Průhonický park – Obora
Některým dalším vřeckovýtrusným houbám
zjištěným v Průhonickém parku se budeme
věnovat v další části seriálu.
Kontakt:
RNDr. František Kotlaba, CSc. a prom. biol. Zdeněk Pouzar, CSc. ([email protected];
emeritní pracovníci Taxonomického oddělení)
Sledování postupného růstu plodnic šupinovky
slizké (Pholiota adiposa) na dřevěné konstrukci
na nádvoří zámku v Průhonicích jedním z autorů
článku Dr. Kotlabou.
Seriál: Léčivé rostliny
20
LÉČIVÉ HOUBY
První známky o léčebném využití hub lze nalézt
již ve spisech starověké Číny a Indie, starých tisíce
let. V Evropě se o léčivých účincích hub zmiňuje
Démokritos a Hippokrates. Theofrastos jako první
uvádí ve své knize Historia plantarum (350-287
př. n. l.) 4 druhy a jména hub. Další starověcí autoři (Dioskorides, Plinius Starší) zmiňují vesměs
poživatelnost či jedovatost hub. Mattioli ve svém
Herbáři neboli bylináři, který vyšel v českém
překladu Tadeáše Hájka z Hájku v roce 1562,
uvádí 6 druhů hub s léčivými účinky. Houby se
používaly např. k zástavě krvácení, hojení ran, při
bolestech hlavy a infekcích, empiricky byly zjištěny
i protinádorové a imunostimulační účinky. Řadu
těchto účinků potvrzuje i současná medicína.
Široké uplatnění měly (a mají) houby v tradiční
medicíně v Číně, Japonsku a Koreji.
K dobře prozkoumaným druhům, co se obsahových látek a léčivých účinků týče, patří zejména lesklokorka lesklá (Ganoderma lucidum),
housenice čínská (Cordyceps sinensis), hlíva
ústřičná (Pleurotus ostreatus), trsnatec lupenitý
(Grifola frondosa), žampion brazilský (Agaricus
blazei) a houževnatec jedlý (Lentinula edodes).
Mezi významné farmaceutické suroviny patří
námel, což je sklerocium (pevné útvary vytvořené
houbovými vlákny, z nichž mohou vyrůstat plodničky) paličkovice nachové (Claviceps purpurea),
která parazituje na obilninách. Námel slouží
k izolaci alkaloidů, které se používají v medicíně
(zejména v porodnictví k zástavě krvácení).
Víte, že podle nejnovějších molekulárních
studií houby, tedy zástupci říše Fungi (Eumycota) patří spolu s některými jednobuněčnými
i mnohobuněčnými živočichy do nadříše
Opisthokonta? Společným znakem těchto
organismů je tlačný bičík, který mají výtrusy
mikroskopických hub některých skupin, stejně
jako živočichové (např. spermie). U mnohých
zástupců hub však bičík druhotně vymizel.
Houby tedy nejsou přímými příbuznými
rostlin, ty patří do skupiny Archaeplastida.
Lesklokorka lesklá (Ganoderma lucidum) je chorošovitá houba s léčivými účinky proti řadě chorob
Další studium obsahových látek hub a jejich
semisyntetických derivátů je velmi perspektivní
a může vést k vývoji nových léčiv.
Ganoderma lucidum
Lesklokorka lesklá (Ganoderma lucidum) je dřevokazná houba, která je již po tisíce let využívána
v tradiční východní medicíně v Číně, Japonsku
a Koreji, kde je známá pod jménem ling-zhi či
reishi. Nazývána je rovněž „houba nesmrtelnosti“
a patří k vysoce ceněným léčivům. Používá se
zejména k udržování dobré fyzické i psychické
kondice, na zlepšení paměti a proti artritidě.
V současné době je tato houba populární po celém
světě. Vzhledem k vysoké poptávce se uměle
pěstuje, a to zejména v Číně, Koreji a Vietnamu.
V České republice roste roztroušeně v listnatých
či smíšených lesích. Houba je nápadná lesklou
červenohnědě zbarvenou plodnicí (latinské
jméno Ganoderma pochází z řeckých slov ganos
= lesklý a derma = kůže). Ganoderma lucidum
obsahuje více než 400 různých látek, hlavními
účinnými látkami jsou především polysacharidy
a triterpenoidy.
Ganoderma lucidum a její obsahové látky vykazují
celou řadu účinků na organismus, které byly potvrzeny v četných studiích. Zajímavé jsou zejména
účinky na imunitní systém, za který zodpovídají
polysacharidy, které mají také protinádorové
účinky. Triterpenoidy snižují krevní tlak a hladinu cholesterolu v krvi, působí protizánětlivě,
významný je také účinek proti patogenním
bakteriím, houbám a virům.
Lesklokorka jehličnanová (Ganoderma carnosum) obsahuje patrně podobné léčivé látky jako
l. lesklá, od které se liší tmavě červenohnědou
až hnědou barvou plodnic, většími výtrusy
a růstem hlavně na dřevě jehličnanů.
Znáte naše léčivé houby?
Lesklokorku je možné využít při léčbě řady potíží,
např. jaterních a kardiovaskulárních onemocnění,
artritidy, astmatu, vysokého krevního tlaku,
cukrovky a žaludečních vředů. Doporučována
je také při poruchách paměti a k léčbě demence;
tento účinek je vysvětlován protizánětlivým
působením v nervové soustavě. Lze ji také použít
jako doplněk při léčbě nádorových onemocnění
a u HIV-pozitivních osob, protože snižuje nežádoucí
účinky chemoterapie a ozařování.
Na trhu je řada potravních doplňků, které obsahují Ganoderma lucidum v tabletách či kapslích.
Někdy se používá i v kombinaci s dalšími rostlinami
či houbami, např. se shiitake ‒ houževnatcem
jedlým (Lentinula edodes). Koupit lze i přímo
sušenou krájenou houbu či prášek z ní připravený.
Většina obsahových látek Ganoderma lucidum
je extrahovatelná horkou vodou, proto je častou
aplikační formou i odvar. Na trhu jsou rovněž
čaje, káva, potraviny a kosmetické přípravky,
které ji obsahují.
Obsahové látky hub
Houby obsahují velké množství látek, z nichž
mnohé vykazují biologickou aktivitu. Zjištěny
byly polysacharidy, triterpeny, seskviterpeny,
alkaloidy, steroidní látky, proteiny, glykoproteiny, peptidy a aminokyseliny, nukleotidy
a nukleosidy, mastné kyseliny, vitaminy, stopové
prvky a aromatické látky.
Kontakt:
Mgr. Zdeňka Navrátilová ([email protected]; Přírodovědecká fakulta Univerzity Karlovy)
Více v: Curr. Pharm. Biotechnol.: 10: 717-742 (2009), Semerdžijeva M., Veselský J.: Léčivé houby dříve a nyní
(1986), Socha R., Jegorov A.: Encyklopedie léčivých hub (2014)
Naše herbářová sbírka
21
HERBÁŘOVÉ SBÍRKY ROSTLIN – POKLADY V NAŠICH RUKOU
pracovali se správně pojmenovanými rostlinami,
že jsme se nezmýlili a nezkoumali vlastně něco
úplně jiného? A zde nastupují herbáře. Dosud
totiž nebyl vymyšlen jiný spolehlivější způsob,
jak doložit identitu studovaného rostlinného
materiálu, než jeho klasické usušení, opatření
nějakou písemnou identifikací a uložení do herbářové sbírky. Samozřejmě není nutné do herbáře
uložit všechny jedince, které jsme prozkoumali,
ale měli bychom dbát na to, aby po nás v herbáři
zůstal alespoň jeden důkaz, že jsme si daný druh
nespletli třeba s nějakým druhem podobným.
V některých případech je dokonce uložení vzorku
rostliny ve formě herbářové položky do herbáře
nějaké instituce neodpustitelnou podmínkou
pro publikaci daného typu vědecké práce. To se
týká například prací, v nichž je popisován nový
druh. Takovou práci vám žádný botanický časopis
neuveřejní, pokud tam není uvedeno, ve kterém
herbáři je uložen originální, tzv. typový materiál
(podrobněji o významu nomenklatorických typů
viz článek na str. 23).
Sbírka lišejníků A. Vězdy – jedna z nejcennějších
kolekcí v herbáři BÚ (viz článek na str. 23)
Vědecká oddělení Botanického ústavu využívají
ve své badatelské činnosti různé laboratorní a jiné
podpůrné útvary, mimo jiné také Herbář BÚ. Jde
o tradiční součást každé badatelské instituce,
která se věnuje výzkumu rostlin, jejich rozšíření,
evoluci, systematice a v neposlední řadě i výzkumu
vegetace na nejrůznějších úrovních. V dřívějších
dobách byl v každé botanické instituci herbář
vedle knihovny tím nejdůležitějším zdrojem
poznatků, které botanici využívali při přípravě
svých odborných prací. Dnes tomu už zdaleka tak
není. Široké spektrum rozmanitých metodických
přístupů z arzenálu genetiky, molekulární biologie, biochemie, mikroskopie atd., provozované
v řadě specializovaných laboratoří, dnes vévodí
badatelské práci i v Botanickém ústavu.
Přesto má tradiční sběr rostlin pro herbář, jejich preparace a ukládání do herbářové sbírky
stále svou nezastupitelnou roli. Chceme-li totiž
začlenit botaniku mezi ostatní exaktní přírodní
vědy, potřebujeme nástroj, který umožní ověřit
pravdivost našich publikovaných výsledků. Fyzik,
chemik či matematik, když připravuje nějakou
svou odbornou práci ke zveřejnění, vždy popíše
experimentální podmínky tak podrobně, aby
kdokoli mohl jeho pokusy nejen pochopit, ale
třeba i přesně zopakovat. Botanik pracuje obdobně,
má však jednu velkou nevýhodu plynoucí z toho,
že jeho hlavním objektem bádání jsou konkrétní
druhy rostlin nebo jejich společenstva. Jak ale
můžeme přesvědčit ostatní, že jsme opravdu
V posledních letech se studenti občas pozastavují nad tím, proč ještě sbírat do herbáře, proč
k dokumentaci raději nevyužít současnou již
docela kvalitní digitální fotografii. Proč raději
jen nefotit místo trhání, lámání a vyrýpávání
rostlin, vždyť řada z nich v přírodě ubývá a stávají se stále vzácnějšími a ohroženějšími. Mají
pravdu v tom, že při nešetrném a nerozumném
sbírání by skutečně mohlo dojít i k závažnému
poškození malé populace nebo dokonce k jejímu
zničení. Mají pravdu i v tom, že z území s dlouhou
tradicí botanického výzkumu, k jakým střední
Evropa bezesporu patří, je v herbářích již dnes
uchováváno velké množství dokladů o výskytu většiny druhů. Na druhé straně povědomí
Ukázka uspořádání obálek se vzorky lišejníků
z kolekce A. Vězdy
Preparace starších sběrů nemá často daleko
k práci restaurátora.
o nutnosti chránit populace vzácnějších druhů
v jejich přirozeném prostředí je již poměrně silné
(svědčí o tom ostatně i právě takové diskuse se
studenty) a i mnohé výzkumné instituce vytvářejí
vlastní "etická" pravidla pro práci s přírodními
populacemi a pro sběr přírodnin.
Hlavní důvod ke sbírání ale spočívá v tom, že
žádným jiným způsobem nejsme zatím schopni
shromáždit a uchovat informace o rostlinách tak,
aby byly použitelné pro budoucí zkoumání. Je to
hlavně proto, že nikdy nevíme, co vlastně bude
ještě potřeba na rostlině prozkoumat. Proč je to
potřebné, si ukážeme na příkladu jedné z mála
našich endemických rostlin.
Když v r. 1821 pražský profesor botaniky
I. F. Tausch uveřejnil pojednání o novém druhu
pampelišky (Taraxacum alpestre), kterou nalezl
roku 1812 při výpravě do Krkonoš, byl jeho popis
tak stručný, že by mohl pasovat na několik desítek
druhů tohoto rodu. Dlouho se pak mělo za to,
že Tauschovy rostliny jsou totožné s rostlinami
Taraxacum nigricans, které o pár let dříve popsal
ze slovenských Karpat uherský botanik P. Kitaibel.
Teprve když se v herbářích dohledaly původní
Tauschovy a Kitaibelovy rostliny a podrobněji se
prozkoumaly, ukázalo se, že pravděpodobně nejsou
totožné. Údaje z herbářů pak umožnily i nalézt
jejich živé recentní populace v přírodě a porovnat
je. Nakonec se prokázalo, že Tauschův druh je
krkonošským endemitem, druhem rostoucím
jen na několika málo místech na české a polské
straně Krkonoš a nikde jinde. A mimochodem
tato studie umožnila i přehodnotit naše poznatky
o Kitaibelově pampelišce černající (Taraxacum
nigricans). Nejde o druh se širším středoevropským rozšířením, jak se dříve přepokládalo, ale
opět o endemit vázaný na velmi malé území (tzv.
stenoendemit), rostoucí pouze nad hranicí lesa
v Nízkých Tatrách. Jistě se nedá tvrdit, že bez
oněch prastarých herbářových sběrů Tausche
a Kitaibela bychom nebyli dnes s to takovou
Naše herbářová sbírka
22
hádanku vyřešit. Ale cesta k jejímu vyřešení by
byla delší, trnitější a kdoví, zda bychom se dobrali
správného výsledku.
Dokládat věrohodnost a pravdivost botanických
odborných prací je ale jen jednou z úloh herbářů
v dnešní době. Neméně významnou je poskytování herbářových fondů k dalšímu studiu.
Mnoho botanických vědeckých prací využívá
data získatelná v herbářích – data o rozšíření
rostlin, o jejich morfologii, anatomii, obsahových
látkách atd. Dokonce i fylogenetické studie využívající DNA se dnes z velké části uskutečňují
za pomoci rostlinného materiálu z herbářových
sbírek. A to ještě před 15-20 lety se mělo za to, že
k tomuto účelu jsou herbáře nepoužitelné. Stačilo
pak pár let bouřlivého vývoje metodik získávání
a zpracování DNA a situace je opačná: herbáře
běžně poskytují DNA od druhů vzácných nebo
pro badatele nedostupných.
Herbář Botanického ústavu přirozeně svou roli
plní hlavně vůči pracovníkům mateřské instituce,
ale obdobně jako jiné institucionální herbáře
umožňuje studium i zájemcům z jiných pracovišť.
Herbářové fondy, o které pečuje (jde o cca. 0,5 mil.
herbářových položek), ale pocházejí především
z činnosti botaniků, kteří působili nebo působí
v BÚ. K nejvýznamnějším sbírkám patří např.
světoznámá lichenologická kolekce A. Vězdy.
Pracovníkům Botanického ústavu (především
na průhonickém pracovišti) herbář slouží i jinak,
pomáhá radou i skutkem při preparaci a sušení
rostlin, zajišťuje výpůjční protokol, vytváří databázovou evidenci herbářových položek a jejich
digitalizaci. Právě do oblasti elektronického
shromažďování dat z herbářů včetně digitálních
snímků herbářových položek (často se dnes užívá
výrazu téměř z vojenské terminologie „mobilizace
dat“) a do jejich zpřístupňování na Internetu
se v současnosti soustřeďuje asi nejviditelnější
úsilí většiny herbářových institucí. A náš herbář
nezůstává pozadu.
Herbář Botanického ústavu je součástí celosvětové
sítě institucionálních herbářů (http://sweetgum.
nybg.org/ih/), která dnes pokrývá všechny kontinenty s výjimkou Antarktidy. Tato síť sestává z více
než 3000 herbářových sbírek velkých i menších
muzeí, univerzit i jiných vědeckých institucí, které
dohromady pečují o více než 350 milionů sbírkových předmětů (herbářových položek, vzorků
semen, vzorků dřev apod.). Jejich základní role je
všude stejná – uchovávat doklady o badatelské
práci v botanice a mykologii a pečovat o ně tak,
aby byly k dispozici badatelům.
Každý herbář je zcela samostatný a jeho zapojení
do sítě mezi ostatní institucionální herbáře má
hlavně informační úlohu. Například v tom, že
Originální materiál netýkavky tichomořské z typové sbírky herbáře BÚ
umožňuje jednoduché a jednoznačné určení
každého sbírkového předmětu, o kterém se
potřebuje badatel zmínit ve své vědecké práci.
Každý herbář si vede nějakou vnitřní evidenci (obvykle nějaký typ očíslování sbírkových předmětů)
a zároveň má přidělenou mezinárodní zkratku
(náš herbář má zkratku PRA). Kombinace zkratky
herbáře a evidenčního čísla pak vytváří unikátní
identifikátor odkazující k danému předmětu.
Například označení „PRA-7469“ jednoznačně
identifikuje herbářovou položku, jejíž snímek
jako ukázku zde uvádíme. Jde vlastně o evidenci
sbírkových předmětů, která usnadňuje třeba
i rozsáhlé mezinárodní projekty. Jako příklad lze
uvést nadnárodní databázi typových herbářových
položek Global Plants (http://plants.jstor.org/
page/global-plants), která již dnes obsahuje více
než 2 miliony digitálních snímků.
Kontakt:
RNDr. Jan Štěpánek, CSc. ([email protected]; Herbářová sbírka PRA)
Významné projekty
23
HLEDÁNÍ RODINNÉHO STŘÍBRA V HERBÁŘÍCH
I lišejníky se ukrývají v herbářových sbírkách.
holotyp – jediná položka označená autorem
v protologu
isotyp – duplikát holotypu
Herbářové sbírky, podobně jako jiné sbírky
(galerijní, muzejní, knihovnické apod.), představují
národní kulturní bohatství. V případě herbářů
jde o hodnoty různého charakteru: historického
(obraz floristického výzkumu našeho území),
kulturního (jako výsledek práce významných
osobností vědeckých i kulturních, doklady rukopisu apod.), největší význam je však především
vědecký. Jde jednak o aspekt dokumentační (doklad o výskytu určitého organismu na daném místě
v daném čase, který může být využit např. pro
zpracování rozšíření), taxonomický (dokladový
materiál, sloužící např. k podrobnému studiu
variability v rámci určité taxonomické jednotky)
a taxonomicko-nomenklatorický. Vedle toho lze
herbářové položky využít i v rámci dalších oborů
– např. studium chemismu, znečištění prostředí aj.
V herbářích lze najít i nejrůznější dokumenty – kromě dobového tisku i různé předměty
sběratelské hodnoty (např. obaly od čokolád,
sýrů, čajů – tedy evidentně pozůstatky terénní
konzumace, které zřejmě nahrazovaly momentální nedostatek papíru či sáčků). Prof. Velenovský používal pro psaní lokalit svých sběrů
zadní stranu přihlášek studentů na přednášky.
Tak byla nalezena i přihláška O. Matouška
(1899-1994), pozdějšího profesora Karlovy
Univerzity a dlouholetého redaktora časopisu
Vesmír (1923-1950).
Na tomto místě se podrobněji zmíníme o posledně zmíněném aspektu. Každé jméno organismu,
nejen rodu a druhu, ale na všech taxonomických
úrovních, tedy např. i čeleď, odrůda aj., je spojeno
s konkrétní položkou (vzácněji kresbou). Takové
herbářové položky se nazývají typový materiál;
na něj je vázáno konkrétní jméno taxonu zvolené
autorem popisu a navždy je s ním spojeno. Jde
o nejvýznamnější části herbářových sbírek, které
mají celosvětový význam a jsou předmětem stálého
zájmu vědecké obce. Typový materiál je proto
ve všech herbářích evidován, označován a někdy
je vyčleňován do typové sbírky; zároveň podléhá
speciálnímu režimu. V současné době probíhají
práce na projektu financovaného Ministerstvem
kultury ČR v rámci programu Národní a kulturní
identity (program NAKI), jehož cílem je aktivní
dokumentace typového materiálu lišejníků
pocházejícího z území naší republiky. Jde o ty
taxony, které byly popsány zhruba během posledních 200 let nejen našimi, ale i zahraničními
badateli. Někdy může jít i o taxon velmi omezeného
rozšíření, který se jinde nevyskytuje – pak jde
o tzv. endemit.
syntyp – několik sběrů se shodnými údaji
na etiketě nebo několik různých sběrů uvedených v popise, aniž autor ustanovil konkrétní
jedinou položku jako holotyp
paratyp – další položky zmíněné autorem
v protologu spolu s vlastním holotypem
lektotyp – z několika syntypů další badatel
dodatečně vybral jedinou položku
neotyp – stanovení zcela nového typu
Práce na tomto projektu se podobá příslovečnému
hledání jehly v kupce sena, v tomto případě hledání
v mnoha našich i zahraničních herbářových
sbírkách. Zahrnuje několik různých a nezbytných
fází. V první řadě je třeba mít představu, jakého
charakteru ona jehla je, tj. ujasnit si, co vlastně
hledáme. Počáteční fáze proto představuje vyhledávání popisů jmen lišejníků v nepřeberném
množství odborné literatury, které byly založeny
na materiálu sebraném během různých období
a pocházejícího ze současného území České
republiky. Vyhledané jméno je následně zapsáno
do databáze spolu s citací zdroje, tj. název časopisu
či knihy, stránkový rozsah a rok vydání. Zároveň
je naskenován popis taxonu (odborně se nazývá
protolog), který je uložen v elektronické podobě.
Poté je jméno podrobeno nomenklatorické revizi,
tj. ověření, zda publikace (validita neboli platné
uveřejnění) i publikované jméno (legitimita neboli
oprávněnost) odpovídají pravidlům Mezinárodního nomenklatorického kódu. V zásadě jde mj.
o ověření, zda jméno má všechny náležitosti (popis)
a zda stejné jméno nebylo již dříve použito někým
jiným. Na základě údajů v protologu se vytipuje,
v jakých herbářích se udávaná položka nebo
položky mohou nacházet. Někdy je přímo uveden
konkrétní herbář, častěji je však uvedena jen sbírka
sběratele nebo jen jeho jméno. Poté je třeba zjistit,
v jaké institucionální sbírce či sbírkách je herbář
konkrétního badatele uložen. Pak následuje osobní
návštěva dané instituce a snahou je najít konkrétní
položku. Ta může být uložena pod původním
jménem (často historickým) autora popisu, může
však být zařazena i pod současným jménem či
jiným jménem na základě přeurčení některého
z pozdějších badatelů. Nalezená položka je poté
podrobena ověření, zda jde skutečně o typový
materiál – tedy zda údaje o lokalitě, datu sběru
a jménu sběratele souhlasí s údaji uvedenými
v popise. Následuje stanovení hodnoty typového
materiálu – zda jde o tzv. holotyp, isotyp, syntyp
či paratyp nebo lektotyp (vysvětlení pojmů viz
rámeček). V případě, že žádný typový materiál
nebyl nalezen (např. v případě herbářů zničených
Kontakt:
RNDr. Jiří Liška, CSc. ([email protected]; Taxonomické oddělení)
během 2. světové války), je třeba stanovit typ
nový (neotyp). Lístek s uvedením konkrétní
hodnoty typu je vložen do obálky k vlastní
položce. Každá takto nalezená a ověřená položka
typového materiálu je pak zapsána do databáze
a poté fotograficky zdokumentována snímáním
s vysokým rozlišením. Snímky celkové položky
a detailu jsou uloženy v elektronické podobě,
a to jak v původním rozlišení (formát TIFF), tak
i ve zmenšeném (JPG). Vedle vlastního lišejníku je
naskenována také obálka s etiketou. Veškeré údaje
z databáze spolu s digitalizovanou dokumentací
budou přístupny online v rámci internetové
prezentace celé vědecké obci.
Grant NAKI je podobný jiným projektům zaměřeným na digitalizaci herbářů, jež probíhají ve světě. V některých ohledech však má svá důležitá
cenná specifika. Většina podobných projektů
a databází je totiž zaměřena na digitalizaci konkrétní sbírky. V našem případě je úkolem vyhledání pokud možno kompletního typového
materiálu vztaženého ke konkrétnímu jménu, tj.
materiál uložený v různých herbářích, a to nejen
v ČR, ale i v zahraničí. Dalším specifickým rysem
je, že databáze zahrnuje nejen digitalizovanou
dokumentaci vlastního typového materiálu, ale
i protolog daného jména taxonu.
Doprovodnou dokumentaci u některých
položek ocení i ti, kteří lišejníkům nepropadli.
Ukázka z herbáře V. Kuťáka (1876-1956), který
svůj život věnoval především výzkumu lišejníků
Krkonoš.
Představujeme Průhonický park
24
JAKÁ ROSTLINNÁ SPOLEČENSTVA JSOU V PRŮHONICKÉM
PARKU DRUHOVĚ NEJBOHATŠÍ?
Kdo hádal louky, hádal správně. Louky totiž patří
v parku k nejcennějším biotopům nejen proto,
že zde mohou na 25 m 2 hostit i přes 40 druhů
cévnatých rostlin, ale hlavně v nich přežily druhy, které již v širokém okolí vymizely. Příkladem
budiž orchidej prstnatec májový (Dactylorhiza
majalis). Rozmanitost lučních stanovišť se utváří
zejména na vlhkostním gradientu. Máme zde
mokřadní a vzácně prameništní společenstva
na bahnitých a vodou trvale zamokřených půdách,
na ně v mozaice navazují sezonně vysychavé
nebo přeplavované louky. V nejvýše položených
úsecích nebo na svazích rostou teplomilné ovsíkové louky, v lesních průhledech pak mechaté
a většinou druhově chudé porosty s psinečkem
obecným (Agrostis capillaris) nebo medyňkem
měkkým (Holcus mollis).
Jako každé druhotně vzniklé stanoviště se louky
musejí pravidelně udržovat, jinak by postupně
rychleji či pomaleji zarostly během tzv. sukcese
nejprve křovinami a později lesem. Sukcesi se
brání sečí i třikrát ročně. Louky se tak vyznačují
velkou proměnlivostí nejen v rámci jednoho roku,
ale v závislosti na výkyvech počasí se každý rok
střídají i dominanty travin a bylin.
Park nejsou jen louky
Floristická statistika Průhonického parku
Během roku 2014 jsme napočítali, že v parku
nachází svůj přirozený biotop 552 druhů
cévnatých rostlin (nepočítaje v to mikrodruhy pampelišek). V minulosti jich zde bylo
uváděno dalších 47, které se nám již bohužel
nepodařilo dohledat. Z celkového součtu
roste největší podíl na loukách, o něco méně
z nich upřednostňuje spíše antropogenní, tj.
člověkem ovlivněná stanoviště (narušovaná
a živinami obohacovaná místa jako okraje
cest, pole a rumiště), podobný počet najdeme převážně v lese, jednou méně jich roste
převážně podél vodotečí nebo v rybnících
(tam často přechodně) a nejméně druhů je
vázáno na skály nebo zdi (viz koláčový graf).
Asi desetina, tj. 63 druhů, je nepůvodních
pro oblast Průhonické plošiny, kterou řadíme
do oblasti tzv. Mezofytika s květenou minerálně
chudších podkladů postrádající vysloveně
teplomilné a vápnomilné druhy. Celkem 8 %
flóry parku je pak na Červeném seznamu ČR
v kategorii ohrožených rostlin.
Průhonickým parkem protékají Dobřejovický
a Zdiměřický potok, které se vlévají do Botiče,
který pak dál vytváří i meandry a pěkné náplavy.
Na toku byly v parku vybudovány čtyři rybníky,
přičemž nejlépe vyvinutou pobřežní (litorální)
vegetaci s orobincem úzkolistým a na hladině
s okřehky nalezneme na Labešce. Jednou za čas se
rybníky musejí vypustit, aby se odbahnily (tomu
říkáme letnění), a to pak zde rostou nevídané druhy,
které se obnovují buď ze semenné banky ukryté
v bahně, nebo sem semena nalétají i z velké dálky.
Najdeme zde také skály a sutě, které na jižně
ukloněných svazích hostí např. tolitu lékařskou
(Vincetoxicum hirundinaria) a na zastíněných
roste zase kapradina osladič obecný (Polypodium
vulgare). Na zámeckých zdech se pak uchytily
zvěšinec zední (Cymbalaria muralis) a dymnivka
žlutá (Pseudofumaria lutea).
Vazba rostlinných druhů
na biotopy
v Průhonickém
parku
lesy
louky
rybníky a vodoteče
antropogenní biotopy
skály a zdi
Největší plochu parku zabírají lesy. Ty patří
paradoxně k nejvíce přetvořeným stanovištím,
protože při krajinářské kompozici byly dosazovány různými exotickými druhy, které v nich
na mnoha místech zplaněly. Bez vlivu člověka
by zde přirozeně rostly (a leckde tomu tak i je)
potoční luhy s olšemi, jasany a vrbami. Na ně by
navazovaly dubohabřiny s více či méně bohatým
bylinným patrem, místy vzácně se suťovými lesy
s javory a lípami na svazích. Na jižně ukloněných
svazích s mělkou půdou by pak rostly kyselé
teplomilné doubravy s vtroušenou borovicí
a břízou, na rovinách by většinou převažovaly
druhově chudé doubravy.
Podrost acidofilní dubohabřiny
Interiér zbytku lužního lesa
Břehový porost Dobřejovického potoka s pomněnkou bahenní (Myosotis palustris)
Porost s osladičem obecným (Polypodium
vulgare)
Ovsíř pýřitý (Avenula pubescens) - kvetoucí
Kontakt:
RNDr. Petr Petřík, Ph.D. ([email protected]; Oddělení GIS a dálkového průzkumu Země).
Představujeme Ibotky.cz
25
VIRTUÁLNÍ NAUČNÁ STEZKA PRŮHONICKÝM PARKEM
Projekt ibotky.cz vznikl v Průhonické botanické zahradě na Chotobuzi s cílem vybudovat
fotogalerii s možností archivovat a zveřejňovat
fotografie rostlin pěstovaných ve sbírkách zahrady
a Průhonického parku. Důvodem bylo, že slovní
či číselný popis květů pomocí klasifikátorů je
u odrůd kosatců, růží, denivek a pivoněk, tedy
rostlin našeho zájmu, nedostatečný, protože
nemůže zachytit jemnější detaily kresby či tvaru.
Proto je vhodné doplnit popis fotografiemi. Protože databáze Národního programu genetických
Brzy po založení stránek projevili zájem o zveřejnění fotografií také pracovníci Alpina Průhonického parku. Protože stavebnicový systém umožňuje správu fotografií pro více uživatelů, nebylo
problémem jejich další rozšíření. V současnosti
obsahuje databáze více než 4 200 fotografií osmi
autorů. Jedná se především o dokumentaci sbírek
zahrady a Alpina, ale také o reportážní fotografie
z akcí botanické zahrady či dokumentace rozvoje
zahrady a jejích expozic.
do anglické verze a verze pro mobilní telefon,
což umožňuje stažení překladu informační tabule
pomocí QR kódu, umístěného na česky psané
infotabuli, do mobilního telefonu. Články doplňují zveřejněné historické dokumenty v pdf formátu, jako jsou Zprávy botanické zahrady s Indexem Plantarum botanické zahrady a Průhonického parku z šedesátých let, Průvodce po sbírkách
a sborníky z konferencí botanických zahrad ČR.
Článek může být doplněn o komentáře, bodem
na mapě parku a klíčovými slovy pro vyhledávání.
Podle jednotlivých položek je možné vyhledávat fotografie se stejnými klíčovými slovy či
stejnými systematickými kategoriemi.
Fotogalerie slouží především k archivaci a publikaci fotografií sbírek botanické zahrady.
zdrojů (EVIGEZ) a databáze pěstovaných rostlin
Unie botanických zahrad ČR (Florius) neumožňují přímé vkládání fotografií, rozhodli jsme
se fotografie publikovat ve vlastní fotogalerii.
Fotogalerie byla koncipována tak, aby každá
zveřejněná fotografie či výběr fotografií měly
svou vlastní nezaměnitelnou webovou adresu,
což u některých jednodušších aplikací nebývá
zvykem. Díky adrese obrázku je možné propojení
s databázemi pomocí polí s webovými odkazy.
Fotogalerie umožňuje archivaci fotografií
ve čtyřech posloupných úrovních v předem
definovaných kategoriích. Každá fotografie má
svůj popis pomocí druhového a kultivarového
jména, čeledi a klíčových slov, část popisu je
stahována ze souboru exif. Kromě vlastního
popisu je možné vkládání odkazů na webové
stránky (zpětné propojení s databází Florius)
a lokace v Google Maps.
Současně s tvorbou fotogalerie jsme připravili
možnost publikování aktualit z botanické zahrady v levém sloupci a stránky byly doplněny
i o možnost prohledávání databáze Florius (viz
článek v minulém čísle 2014/1) pomocí předem
nadefinovaných dotazů – vyhledávání podle
českých a latinských jmen rostlin a podle názvu
odrůdy.
Kromě vlastní fotogalerie byla naprogramována možnost uveřejňování článků v blogovém
schématu. Záměrem bylo především zveřejnění
popisů expozic botanické zahrady, článků o rostlinách a dalších historických dokumentů, které
jsou sice okrajové z celoústavního pohledu, ale
jsou důležité pro informační systém botanické
zahrady. Postupně tak byly uveřejněny texty
většiny informačních tabulí, články o členění
kosatců, historii sbírek i o jednotlivých druzích
rostlin. Informační tabule jsou též přeloženy
Velmi zajímavá je možnost pořádání soutěží. Jedná
se o hlasování kliknutím na fotografie, které se
Vám líbí. Z jedné IP adresy je však možné hlasovat pouze třikrát. Výsledky hlasování využijeme
především při hodnocení novinek kosatců ze
středoevropského šlechtění.
Samostatnou kapitolou pro stránky ibotky.cz
bylo jejich rozšíření o naučnou stezku Průhonickým parkem a botanickou zahradou. Cílem
bylo na stejných stránkách zveřejnit a propojit
údaje o pěstovaných rostlinách, planě rostoucích
druzích cévnatých rostlin a jejich společenstvech
v Průhonickém parku a botanické zahradě. Kromě
vlastních zastavení naučné stezky v parku je možné
otevřít podkapitoly alpinum (zatím nenaplněné),
botanická zahrada a evidenční oddělení parku.
Článek naučné stezky po botanické zahradě obsahuje schematickou mapu, stručný popis expozice,
rozcestník odkazů na další články a seznamy
pěstovaných rostlin a zeměpisné souřadnice
s odkazem na Google Maps a QR kódem souřadnic pro stažení do mobilního telefonu.
Evidenční oddělení parku jsou používaná
26
Představujeme Průhonický park
od šedesátých let pro soupis vysazovaných dřevin.
Při otevření článku se otevře mapa s umístěním
oddělení a odkaz na výběr v databázi Florius
s pěstovanými dřevinami.
Publikované mapy parku jsou mapa porostů,
oddělení, letecká mapa, mapa potencionální
přirozené vegetace a mapa luční vegetace. Mezi
mapami lze překlikávat, použité mapy je možné
zvětšovat a podle důležitosti se na nich v úvodním
menu objevují jednotlivé body naučné stezky.
Ve článcích pak bod aktuálně se vztahující k článku. Kliknutím na bod se otevře článek s popisem
zastavení. Článek je doplněn odkazy na jednotlivé
druhy ve fotogalerii, pérovkami dřevin a dalších
význačných druhů a QR kódem s pozicí zastavení
a odkazem na Google Maps.
S přípravou naučné stezky jsme připravili dvě nové
kategorie ve fotogalerii – rostlinná společenstva
a plané rostliny Průhonicka.
Projekt stránek ibotky.cz vznikl za podpory
Programu na podporu druhové diverzity neprodukčních rostlin a zachování jejich genových
zdrojů a grantu Botanická zahrada Chotobuz jako
významný ekoturistický bod Průhonic, který byl
získán díky Revolvingovému fondu MŽP na podporu udržitelného rozvoje – Podpoře rozvoje
ekoturistických a geoturistických destinací.
Článek zastavení naučné stezky.
Články jsou řazené podle termínu zveřejnění. Úvodní obrazovka obsahuje upoutávku na 10 článků,
uvedených fotografií a úvodním odstavcem. Články je možné vyhledávat podle kategorií nebo
klíčových slov.
Naučná stezka je řešená podobně jako články, na úvod je však mapa s jednotlivými zastaveními.
Mapa se dá zvětšovat a postupně se na ní objevují další méně důležité body naučné stezky. Při
největším zvětšení se objevují čísla evidenčních oddělení parku. Při kliknutí na bod se otevře článek.
Kontakty: RNDr. Pavel Sekerka ([email protected]; Oddělení genofondových sbírek),
RNDr. Petr Petřík, Ph.D. ([email protected]; Oddělení GIS a dálkového průzkumu Země),
Ing. Zuzana Caspers ([email protected]; Oddělení genofondových sbírek)
Pozvánka do Průhonického parku
27
ZIMNÍ KVĚTY POD LUPOU – VILÍNY
Vilín prostřední (Hamamelis × intermedia
'Carmin Red')
Vilín měkký (Hamamelis mollis)
Vilín jarní (Hamamelis vernalis)
V zimním období většina stromů a keřů prožívá
období klidu s květy a listy ukrytými v pevně
uzavřených pupenech, chránících je před mrazem.
Čekají na první teplé sluneční paprsky a prodlužující se den. Návštěvníci Průhonického
parku však vědí, že i v průběhu zimních měsíců
lze nalézti kvetoucí keře se sladce vonícími
květy. A to i ve sněhových závějích. Jde o vilín
neboli Hamamelis. Tato dřevina, která u nás není
původní (pochází ze severní Ameriky a východní
Asie), nás již uprostřed zimy, jako jeden z prvních
poslů přicházejícího jara, potěší záplavou svých
jednoduchých květů.
Naproti tomu vilín jarní (Hamamelis vernalis)
kvete od počátku nového roku až do března
na holých větvích. Jeho žluté květy jsou proto
velmi dobře patrné. Tento druh má svůj domov
na jihu USA.
Vilíny patří do řádu Saxifragales, stejně jako
skalničkářům dobře známé lomikameny (rod
Saxifraga), mají ale svou vlastní čeleď vilínovité
(Hamamelidaceae), kam patří 30 různých rodů
pro nás převážně exotických rostlin. Čeleď je to
ovšem velmi starobylá, nejstarší fosilní nálezy
vilínovitých pocházejí již z období křídy, tedy
konce druhohor. Přijměte naši pozvánku a přijďte
se na tyto zajímavé dřeviny podívat již v zimě
k nám do Průhonického parku.
V Průhonickém parku můžeme vidět vilín virginský
(Hamamelis virginiana), který má květy schované
v podzimním listí, neboť kvete již na podzim,
od října až do prosince. Tento druh nalezneme
v přírodě v lesích podél vodních toků či na vlhčích
stanovištích východu USA a jihovýchodu Kanady
ve výškách kolem 1200 m n. m.
Vilín viržinský (Hamamelis virginiana) - květy
V našem parku však můžete obdivovat i druhy
z euroasijského kontinentu, konkrétně z Číny. Vilín
měkký (H. mollis), který je typický také žlutými
květy s výrazným purpurovým kalichem, kvete
od ledna do března. Ve své domovině roste ve vyšších nadmořských výškách, až do 2 500 m n. m.
Kromě původních druhů najdeme hojně pěstované
i křížence. V parku naleznete vilín prostřední
(H. x intermedia), který na první pohled překvapí
červenou barvou květů, kterou zdědil po jednom
svém rodiči, vilínu japonském (H. japonica).
Druhým rodičem byl již zmíněný vilín měkký.
Vilín viržinský (Hamamelis virginiana) - tobolky
Kontakt:
RNDr. Lenka Záveská Drábková, Ph.D. ([email protected]; Taxonomické oddělení)
Víte, že české jméno „vilín“ poukazuje na charakteristické svinutí okvětních lístků květů?
Latinské jméno Hamamelis pochází z označení
pro mišpuli (snad již z dob Pliniových). Mišpule
má prohnuté kališní lístky, podobně vilín má
prohnuté zobánky, ovšem dobře viditelné
ve stádiu tobolek (viz obr. níže).
Jarní fotografická soutěž
28
JARNÍ
FOTOGRAFICKÁ
SOUTĚŽ
V jarních měsících jsme pro Vás, čtenáře časopisu
Botanika, připravili Jarní fotografickou soutěž.
Soutěže byly vlastně dvě. Soutěž o „Hlavní cenu
časopisu Botanika“ a o „Cenu příznivců časopisu
Botanika na Facebooku“. V první soutěži proběhlo hodnocení zaslaných fotografií odbornou
porotou, v soutěži druhé jste porotci byli vy
sami a hodnotili jste soutěžní fotografie přímo
na našich FB stránkách. Obě soutěže probíhaly
od 14. dubna do 17. června 2014. Výherci mohli
získat řadu zajímavých cen, jmenujme například
roční předplatné časopisu Botanika, speciál
časopisu Botanika „Zaostřeno na rododendrony“
či celoroční rodinné vstupné do Průhonického
parku. Vítězné fotografie obou soutěží jsme pro
Vás připravili na následující dvoustránce.
1
Hlavní cena
časopisu Botanika
1. místo –Eva Požárová
Záraza žlutá, Radobýl
2. místo –Cedrik Haškovec
Jaro v Durmitoru
3. místo –Štěpánka Parvová
Zlaté pole
4. místo – Josef Zimola - Vstavač
5. místo – Jana Halúzová - Klíčící buk
6. místo – Jana Halúzová - „Vojáček”
7. místo – Martina Nejezchlebová
Jarní velikán
3
2
Cedrik Haškovec – Jaro v Durmitoru
Cena příznivců časopisu
Botanika na Facebooku
1. místo –Josef Zimola - Prstnatec
2. místo –Eva Požárová
Běžník na vstavači nachovém
3. místo –Martina Nejezchlebová
Zde žijí!
Martina Nejezchlebová
Po souboji s mravenci (a)
Jan Kollross - Borůvka (b)
Josef Zimola - Pavouk
Josef Zimola - Bukvice (c)
4. mimořádné místo – Jana Halúzová
Pcháč a pavouk (a),
„Vprostřed” (b)
Eva Požárová – Záraza žlutá
Štěpánka Parvová – Zlaté pole
1
2
4b
3b
3a
3c
4a
29
KRÁSA JARNÍCH KVĚTŮ
Jaterník podléška (Hepatica nobilis)
Plicník měkký (Pulmonaria mollis)
Plicník lékařský (Pulmonaria officinalis)
Smil (Helichrysum trilineatum)
Ladoňka (Scilla sp.)
Sasanka hajní (Anemone nemorosa)
Svět rostlin v umělecké makrofotografii
30
Svět rostlin v umělecké makrofotografii
Šafrán zlatý (Crocus chrysanthus), šafrán (Crocus sp.), jaterník podléška (Hepatica nobilis), sasanka hajní (Anemone nemorosa),
ostřice horská (Carex montana)
Kontakt:
Mgr. Barbora Obstová ([email protected]; Oddělení vegetační ekologie)
Fotografie © Barbora Obstová
Představujeme průhonický zámek
31
O ZNOVU OBJEVENÝCH PODZEMNÍCH PROSTORECH
PRŮHONICKÉHO ZÁMKU
Zámek vydává své tajemství ...
Koncem roku 2013 započal průzkum a dokumentování podzemních systémů průhonického
zámku. Zámek je národní kulturní památkou,
proto všechny práce probíhaly pod památkovým
dozorem za účasti archeologa nedestruktivními
metodami za využití speleologických technik
byl již roku 1187 vysvěcen pražským biskupem
Jindřichem. Na kostel bylo jistě vázáno již v době
vysvěcení významnější sídlo s hospodářským
zázemím. Jeho pozice je však předpokládána
v blízkém okolí kostela mimo skalní ostrožnu,
kde se nachází zámek dnes.
Další zajímavou zmínkou je prodej z roku 1616,
kdy je v listinách mimo jiné uvedeno, že předmětem prodeje je také „zámek Průhonice se
vším příslušenstvím, s pivovarem ...“. Při dalším
prodeji roku 1636 je však zámek, pivovar i vesnice
popisovány jako zpustošené a zruinované.
Roku 1676 je uváděna stavba nového mlýna pod
zámkem, v následujícím desetiletí pak probíhá
mimo jiné i oprava zámku, který „na polovici
bořiti se počal, se nyní spravuje by v něm škody
nenásledovalo“. V roce 1685 se již zámek popisuje
„ze tří stran postavený z kamene, s mnohými sklepy,
má mnoho pokojů nahoře i dole a ty jsou klenuté.
Pivovar a sladovna, obojí postaveno z kamene“.
Další výrazné zásahy byly kolem roku 1802, kdy je
uvedeno, že hrabě Nostitz zámek Průhonice úplně
nově přestavěl. Ve vztahu k podzemním systémům
jsou zajímavé i další zápisy, kde se praví, že obytné
budovy (zřejmě zámku) byly od předhradí odděleny dvojitým, ve skále vyhloubeným příkopem,
nebo že zámecké sklepení slouží pivovaru. Tyto
informace pomáhají částečně poodhalit morfologii
původního terénu a podloží, na kterou jsou
vázány historické trasy odvodňovacích systémů.
Na scénu vstupuje
zakladatel parku hrabě
Silva–Tarouca
a speciálních průzkumných zařízení. Hlavním
vodítkem při studiu základních historických faktů
vývoje průhonického zámku ve vztahu k dosud
možným dochovaným fragmentům odvodňovacího a větracího podzemního systému je stavebně
historický průzkum (SHP) z roku 1977 autorského
kolektivu vedeného Dr. Líbalem a ing. arch. Kašičkou. Hned na prvních listech píše, že: „…archivní
fond Velkostatek Průhonice se dochoval pouze
ve zlomcích, neobsahuje žádný materiál stavební
povahy, který by mohl osvětlit jednotlivé etapy
vývoje objektu“. Také další archivní zdroje neobsahují z pohledu stavebního vývoje hodnotnější
materiály a autoři SHP vycházejí z aktuálních
stavebních konstrukcí a údajů v „topografické
a uměleckohistorické literatuře“.
Historické souvislosti
Vraťme se však v historickém čase trochu nazpátek
a připomeňme si několik zajímavých událostí.
Název Průhonice je uváděn již v Kronice Františka
Pražského v souvislosti s rokem 1270, ovšem
nápis na severní straně kostela sděluje, že tento
V následných letech jsou Průhonice děděny,
darovány nebo prodávány a zápisy z kronik se
vážou na změnu vlastníků. Prameny dále uvádí,
že roku 1542 došlo k rozdělení statku na dva díly
a je ve výčtu majetku uváděna také ves s mlýnem
pod zámkem.
Zásadní datem pro zámek a park je rok 1885, kdy
se držitelka Průhonic, Marie Antonie hraběnka
Nostic-Reinek provdala za Arnošta Emanuela
hraběte Silva-Taroucu. Hned následující rok
pověřil hrabě Silva-Tarouca architekta Jiřího Stibrala přestavbou průhonického zámku. Bohužel
plány z přestavby se s výjimkou několika zřejmě
nerealizovaných návrhů nedochovaly a autoři SHP
získávají kusé informace o provedených změnách
z knihy Antonína Mikulky o životě a díle Jiřího
Stibrala. Při úpravách došlo k přestavbě křídla
bývalého pivovaru v části dnešního „Malého
zámku“ a především k odbourání nejstarší jižní
části Velkého zámku a otevřením jeho vnitřního
nádvoří jižním směrem do upravovaného parku.
Také další křídla zámku doznávají výrazných změn.
Popisy se však zabývají zejména architektonickým
členěním a rozsah zásahů do podzemí a suterénních částí staveb zde zcela chybí. Roku 1927 celý
areál zámku i s parkem odkoupil od hraběte
Silva-Taroucy československý stát a správou je
pověřeno ministerstvo zemědělství.
Před rokem 1989 byla část sklepů využívána jako
kryt civilní obrany. Dešťové svody zámku byly
zaústěny do podzemní odvodňovací a větrací
32
štoly, která ale již svůj účel mnoho desetiletí
neplnila. Pravděpodobně byla průchodnost
štoly porušena založením opěrného sloupu již
při poslední přestavbě zámku a také několika
spontánními závaly.
„Nové” prostory vytesané přímo ve skále
Na počátku roku 2014 bylo na základě výsledků
průzkumů podzemních systémů vytipováno
a naprojektováno několik kopaných sond a získáno povolení k jejich realizaci formou závazného stanoviska. Se sondážními pracemi byly
současně plánované sanační práce na zajištění
a opravě pokračování podzemního systému
po vyústění z objektu zámku tak, aby se dosáhlo obnovení odtoku vod z podzemních štol a nedocházelo ke kumulacím vody v chodbách a enormnímu
zamokřování okolních konstrukcí zámku.
V první etapě došlo k vytěžení zvodnělých sedimentů ve štole, jimiž byla štola téměř úplně zanesena. Následně proběhla oprava přezděním stěn
a stropů, spárování rozvolněných kamenů včetně
mohutné kaverny ve stropě, zasahující do nosné
zdi, a také předlážděním vlastního dna štoly
do stavu schopného zajistit řádné větrání a odvodnění podzemního systému a tím potažmo i sklepů zámku. V místech poškození štoly kolem
opěrného sloupu byl vybudován zcela nový úsek
štoly v délce cca 5 m, který poškozenou část,
na které stojí sloup, obchází. V místě začátku
Představujeme průhonický zámek
odvodňovacího systému bylo možné prověřit
předpokládané pokračování systému západním směrem. Zde se podařilo po demontáži
novodobé cihelné příčky nalézt pokračování
ve formě podlouhlého sklepu tesaného ve skále
se dvěma bočními prostory. Tesaný sklep se již
nachází pod nádvořím zámku a je celý napojený
na odvodňování a větrání výše popisovanou
štolou. Tyto prostory dříve sloužily jako „vinotéka“. Vzhledem k úplnému závalu štoly ve stráni
nad Podzámeckým rybníkem byl proveden
horizontální vrt a tím funkčnost systému znovu
obnovena. Přebytečná voda může nyní odcházet
a zároveň do systému proudí vzduch, čímž je
podzemí zámku vysušováno.
Ve druhé etapě došlo k odstranění druhotně
dozděných příček, prostory se tak vrátily do původního půdorysu a očištěním stěn se objevily
skalní výběhy i gotická klenba. Z části podlah byl
odstraněn beton a tak je dnes možné obdivovat
původní pískovcovou a břidličnou dlažbu. Opět
byl obnoven přístup do sklepních prostor přímo
ze zámku, a to ze schodiště u Rytířského sálu.
Tím, že došlo k obnově historických sklepů a štoly,
získává zámek další atraktivní prostory, o které se
v budoucnu rozšíří návštěvnický okruh.
Část sklepů, která v minulosti sloužila pro
uskladnění a archivaci vín, si jistě zaslouží, aby
takové využití bylo obnoveno a mohla se zde
vína ochutnávat.
Kontakt:
Jan Skála ([email protected]; Technicko správní úsek)
Více v: Řehák – Speleo (Průzkum a dokumentace podzemních systémů průhonického zámku)
Akce pro veřejnost
34
33
ZA ODPOČINKEM I POUČENÍM
DO PRŮHONICKÉHO PARKU
A ZA KULTUROU NA ZÁMEK
Prosinec 2014
Vánoční koncerty
14. prosince v 18:00
Marika Singers – koncert vokální skupiny
19. prosince v 19:00
Jakub Jan Ryba – Česká mše vánoční
Galerie Natura
od 12. září do prosince 2014
– Pavel Baňka a hosté, Kmenové souvislosti
BOTANIKA, informační a popularizační časopis
Vydává: Botanický ústav Akademie věd České republiky, v. v. i.
Adresa redakce: BÚ AV ČR, v. v. i., Zámek 1, 252 43 Průhonice
ISSN 2336-2243 (Print), ISSN 2336-2251 (On-line)
Evidenční číslo Ministerstva kultury ČR E21830.
Autoři fotografií: J. Burda, J. Doležal, M. Fránková, D. Jančula,
Z. Hroudová, E. Hudcová, J. Kirschner, F. Kotlaba, J. Liška,
J. Machač, Z. Navrátilová, B. Obstová, I. Oliveira, P. Petřík,
J. Řehák, P. Sekerka, J. Skála, H. Skálová, H. Svobodová,
L. Šebelíková, J. Štěpánek, P. Zákravský, L. Záveská Drábková,
L. Záveský, J. Zázvorka, J. Zimola
Číslo 2014/2, ročník 2 vychází 5. prosince 2014.
Šéfredaktorka: RNDr. Lenka Záveská Drábková, Ph.D.
tel.: 271 015 258, e-mail: [email protected]
Časopis vychází s podporou institucionálního projektu
RVO 67985939.
Internet: www.ibot.cas.cz/botanika/
Facebook: https://www.facebook.com/pages/%C4%8CasopisBotanika/178504005689756?ref=stream
Redakční rada:
Mgr. et MgA. Radim Hédl, Ph.D.; Ing. Barbora Kačmáčková;
Doc. Mgr. Zuzana Münzbergová, Ph.D.; RNDr. Zdeněk Palice, Ph.D.; Veškeré podněty, náměty a připomínky
Ing. Ivana Plačková; RNDr. Pavel Sekerka; RNDr. Hana Skálová, CSc. posílejte na adresu [email protected]
Grafické zpracování: Markéta Tichá,
e-mail: [email protected]
Tisk: LABEL, spol. s r. o., Kutná Hora.
© Časopis Botanika, Botanický ústav AV ČR, v. v. i.
Všechna práva vyhrazena.
Akce pro veřejnost
34
Rok 2015
leden – únor
Kapradiny zblízka, makro a mikrofotografie
výstava ve spolupráci s Botanickou
zahradou hl. m. Prahy
11. dubna Jarní běh Průhonickým parkem
16. května Květinové slavnosti
6. – 7. června Trvalkový víkend a Japonský den
13. – 14. června Víkend otevřených zahrad
27. – 28. června Provázení po růžích
květen – září 2014
Výročí Akademie věd
výstavy, workshopy, vědecký trek
září 2015
Výročí založení PP – 130 let
cyklus odborných přednášek, workshopy
jaro a podzim 2015
Milongy
Změna programu vyhrazena, pro aktuální informace
sledujte webové stránky Botanického ústavu AV ČR, v. v. i.
Download

Ročník 2, 2014/2 - Botanický ústav AV ČR